Prerpints.org logo
Preprint
Article

Alternaria alternata and A.koreana, the Causal Agent of a New Leaf Spot in Celtis sinensis and Their Sensitivity to Fungicides

Altmetrics

Downloads

78

Views

39

Comments

0

A peer-reviewed article of this preprint also exists.

This version is not peer-reviewed

Submitted:

20 November 2023

Posted:

21 November 2023

You are already at the latest version

Alerts
Abstract
Celtis sinensis is an adaptable species that is widely grown in southern China. In June 2022, a leaf blotch disease of C. sinensis was observed in Nanjing, Jiangsu, China. Based on morphological characterization, three isolates were identified as Alternaria species. Phylogenetic analysis of combined ITS, GAPDH, TEF1-α, RPB2 and Alt a 1 sequences identified the three isolates we obtained as Alternaria alternata and Alternaria koreana. Koch’s postulates were fulfilled in the greenhouse, and the pathogenicity of A. alternata and A. koreana was determined by leaf inoculation tests on C. sinensis seedlings. The symptoms of indoor inoculation were consistent with those in the field. A. alternata and A. koreana can grow at 15-35 °C, with an optimal growth temperature of 25 °C. The results of fungicide sensitivity experiments indicated that A. alternata and A. koreana were the most sensitive to prochloraz, which may be a useful strategy for the future prevention and control management of A. alternata and A. koreana. This study provides the first step for further research on A. alternata and A. koreana as pathogens of C. sinensis and provides a theoretical basis for future control strategies.
Keywords: 
Subject: Environmental and Earth Sciences  -   Other

1. Introduction

Celtis sinensis is an important member of the Ulmaceae family [1] that is native to China, Japan, and Korea [2]. Mainly distributed in the central and eastern regions of China, with straight trunks and beautiful tree shapes, it is a common street and landscaping tree species and a valuable resistant tree species that can adsorb toxic gases such as sulfur dioxide and chlorine and has a certain degree of adsorption capacity for dust [3]. C. sinensis demonstrates remarkable resilience, as it is able to withstand both dry conditions and moist, infertile soils. These trees possess a strong adaptability to diverse environmental factors. Moreover, the branches, leaves, roots, and bark of C. sinensis hold important medicinal value and can be utilized in the treatment of burns and urticaria [4]. In addition, it has a wide range of industrial uses. The roots and branches can be used to make artificial cotton and furniture, and the fruits can also be used as raw materials for lubricant production [5]. However, in Xuanwu District, Nanjing, Jiangsu Province, a large number of leaf spot and leaf curling occurred in C. sinensis, which seriously affected the ornamental value of C. sinensis and damaged the ecological environment.
Alternaria is a widely distributed group of fungi in the natural environment and is also economically important as a dematiaceous fungus [6]. More than 95% of the species are plant parthenogenetic parasites. They can grow and multiply in low-temperature and humid environments, causing a variety of plant diseases, as well as fruit rot, which severely jeopardizes the growth of crops and plants and causes enormous economic losses while destroying natural ecosystems globally [7]. In addition, the spores of Alternaria can also release allergens [8], triggering diseases such as asthma [9] and posing a major threat to human health. The pathogenic fungi of Alternaria establish their population by colonizing the surface of seeds with mycelium or conidia [10] on diseased plant residues and in the soil. These serve as primary infection sources for the following year. The conidia of the fungi are spread and dispersed by air currents, leading to secondary infections, thus perpetuating the cycle of transmission and spread of disease.
At present, the most direct and effective method for the control of diseases caused by Alternaria is chemical control [11]. Fungicides such as dithiocarbamates, triazoles, strobilurins, iprodione, or copper fungicides are used in most areas for disease control [12]. Copper-based fungicides are widely used due to their long residual effectiveness and resistance to washing [13]. Methoxyacrylate, dimethomorph, and mancozeb fungicides have also been registered for the control of brown spot disease in countries such as the United States, Israel, and Spain [14]. Due to the difficulty of mixing copper-based formulations with other pesticides and the single-site action of methoxyacrylate and dimethomorph fungicides, resistant populations can quickly emerge in the field, leading to decreased or ineffective efficacy of these fungicides. Recently, nicotinamide fungicides such as cyazofamid have been registered in the United States for the control of this disease [15]. These fungicides can be used for preseed disinfection, as well as direct application to the soil, effectively providing preventive protection [16].
This study reveals the characteristics of the pathogen related to leaf spot in C. sinensis in Xuanwu District, Nanjing, Jiangsu Province, China. This disease has caused significant damage to the local ecosystem. This study was conducted through the following methodologies: to determine the causative agent of brown spot disease in C. sinensis using Koch's postulates; to identify the pathogen through molecular biological and morphological identification methods; and to screen fungicides with significant inhibitory effects on the mycelial growth of the pathogen through culture-based plate phenotype experiments.

2. Materials and Methods

2.1. Sampling and fungal isolations

In June 2022, the disease was observed on the leaves of C. sinensis on the campus of Nanjing Forestry University, Nanjing City, Jiangsu Province (119°46'43"E, 32°02'38"N), and 20 diseased leaves were collected as samples from across 0.75-1.5 meters of C. sinensis. The samples were collected and returned to the laboratory, and the diseased leaves were wiped with absorbent paper with sterile water to remove surface dust and impurities. One hundred small tissues (3×3 mm2) were cut from lesion margins and surface-sterilized in 75% ethanol for 30 s, followed by 5% NaClO for 90 s, rinsed in sterile water 3 times, dried on sterilized filter paper, plated onto potato dextrose agar (PDA) for 4 days at 25 °C [17]. On the third day, fungal hyphae emerging from leaf tissue were shifted to fresh PDA [18]. The isolated strains were preliminarily classified according to morphological characteristics and ITS sequence alignment for subsequent experiments.

2.2. Pathogenicity tests

Healthy C. sinensis and seedlings were obtained from the laboratory of Nanjing Forestry University, and the seedlings had heights of approximately 80 cm. Before the pathogenicity experiment, the leaf surface was wiped with 75% alcohol twice, and sprayed with sterile water three times. The water stains on the surface of the leaves were wiped dry with absorbent paper. The colony morphology of 100 fungal samples was assessed, and they were divided into different groups. Three isolates (11, 12 and 13) from the group with the highest frequency of occurrence were selected for pathogenicity testing and inoculation of leaf blades and seedlings, respectively [19]. Five isolated leaves were inoculated with each isolate, wounds were created on both sides of the leaf veins with a sterile needle, and a 6 mm mycelium block was placed face down on each puncture wound and removed after 24 hours [20]. In addition, five leaves were inoculated with sterilized PDA agar blocks as a control. The samples were cultured for four days under environmental conditions of 25 °C temperature, 70%-80% humidity, and 24 hours of light exposure per day. Nine healthy C. sinensis seedlings were selected on each plant, 3 leaves were inoculated with spores of one of the 3 isolates by puncturing the leaf with a sterile needle as a wound suspension (106 conidia/mL), and the other three plantlets were inoculated with sterile water as a control group. The plantlets were covered with plastic bags and sprayed with water to maintain a high level of humidity.

2.3. Morphological identification and biological characteristics

Three isolates (11, 12 and 13) were cultured on PDA medium at 25 °C for 7 days in a constant temperature incubator. Morphological identification relied on colony appearance and conidia characteristics. Morphology of conidia using Zeiss Axio Imager A2m microscope (Carl Zeiss, Germany) (n=30).
Three isolates (11, 12, and 13) were chosen for the purpose of conducting morphological observations and biological characterization. Isolates were cultured on potato dextrose agar medium (PDA), Czapek dox agar medium (CDA), Richard medium (Richard), corn meal agar medium (CMA), oatmeal agar medium (OA), and potato saccharose agar medium (PSA) for 7 days at 25 °C, and the appearance and coloration of the colonies were documented.
In order to ascertain the isolates' optimal growth temperature, mycelial plugs with a diameter of 6 mm were positioned on freshly prepared PDA medium, which had a diameter of 90 mm, and incubated at 5 °C, 15 °C, 20 °C, 25 °C, 30 °C, and 35 °C. The colony growth diameter was measured and recorded daily.

2.4. DNA extraction, PCR amplification, and sequencing

The isolated fungi were cultured on PDA medium for 7 days, and mature mycelium was scraped off using a sterilized surgical blade. DNA extraction was carried out utilizing the CTAB method [21]. All DNA extracts were preserved at a temperature of -20 °C for future utilization.
Polymerase chain reaction was performed on ITS [22], TEF1-α [23], GAPDH [24], RPB2 [25], and Alt a 1 [26] five genes, which were sequenced using primers ITS1/4, EF1-728F/EF1-986R, GPD1/GPD2, RPB2-5F2/RPB2-7C and Alt-for/Alt-rev, respectively. PCR was carried out in a 25 µL reaction mixture containing 21 μL of Tmix, 1 μL of DNA template, 1 μL of Taq DNA polymerase, 1 μL of forward primer and 1 μL of reverse primer (Table 1). The PCR products were sequenced at Sangon Biotech Co. Ltd. (Nanjing, China).

2.5. Phylogenetic analyses

The phylogenetic tree was constructed using sequences from the fungal cultures in this study and sequences related to Alternaria sp. in GenBank (Table 2); Alternaria alternantherae was used as the outgroup. Sequence alignment analysis using MAFFT version 7 (https://mafft.cbrc.jp/alignment/software/) [27], to trim sequences to ensure a high degree of sequence alignment [28]. Phylogenetic analysis through concatenation of five loci (ITS, TEF1-α, GAPDH, RPB2, and Alt a 1). Phylogenetic trees based on combined genes were constructed using two independent optimality search criteria: maximum likelihood (ML) and Bayesian inference (BI) criteria. The ML analysis used the GTR + F + I + G4 model, and branch stability was determined by 1,000 bootstrap replicates. BI analysis used the GTR + I + G + F model, including two parallel runs of 2,000,000 generations. The resulting trees were plotted using FigTree v.1.4.3 (http://tree.bio.ed.ac.uk/software/figtree/).

2.6. Evaluation of fungicides against A. alternata and A. koreana

Fungicides were kindly provided by Mrs. Tingting Dai of Nanjing Forestry University as 96% prochloraz [29], 97% myclobutanil [30], 97% tebuconazole [31], and 98% pyraclostrobin [32]. Each fungicide was prepared as a stock solution, which was then diluted to different concentrations. The solutions were added to sterilized PDA medium at a rate of 2% to create agar plates containing the respective concentrations of the fungicide. PDA plates without the use of any fungicide were used as a control. A fungal plug was extracted from the colony's edge using a 6mm punch and relocated to the center of the medium. After incubation at 25 °C for 7 days, the diameter of the fungal mycelium was measured. The EC50 value was calculated using GraphPad Prism 8.

3. Results

3.1. Field observations and fungal isolation

The survey results indicated that nearly 50% of the C. sinensis in Xuanwu District, Nanjing, have shown signs of disease. Most of the spots were produced on the apex part of the leaves (Figure 1A), and the spots were brown with darker margins and round to irregular in shape (Figure 1B), on which dark brown chains of conidia were visible. Over time, the spots gradually expand, and the leaves become dark brown, dry, curled, and necrotic and eventually fall off. In total, 90 fungal colonies developed from the tissue pieces and were grouped into three types according to their colony characteristics, with frequencies of 84.4% (76 of 90), 10% (9 of 90), and 5.5% (5 of 90). Three isolates from the highest frequency were selected for purification. According to ITS sequences, 3 fungi belonged to Alternaria and were used for further research.

3.2. Pathogenicity test

Three representative isolates (11, 12 and 13) were inoculated on healthy leaves, and black spots were observed on the leaves after 4 days (Figure 2). The induced symptoms matched those observed in the wild. Conversely, the control maintained healthy with no symptoms of disease. Observing the size of the lesions, those caused by isolates 11 and 13 had smaller affected areas. In contrast, the lesions caused by isolate 12 exhibited a larger affected area. The isolates obtained from the inoculated diseased leaves displayed similar morphological characteristics and shape to the originally isolated strains. DNA was extracted and subjected to PCR using the primer ITS1/4, and the obtained sequences were similar to the original ones. The symptoms observed on seedlings inoculated in a controlled environment closely resembled those seen in the natural field conditions, thus meeting the criteria of Koch’s postulates. Therefore, A. alternata and A. koreana are the pathogens of leaf spot disease of C. sinensis.

3.3. Morphological characteristics

Three representative isolates were grown on PDA medium and hatched for 7 days at 25 °C, and morphological characteristics were recorded based on visual observations (Figure 3). The colonies of isolates 11 and 13 on PDA were initially gray and became grayish brown over time. Conidiophores produced numerous conidia in long chains, mostly unbranched. Conidia were obclavate, dark brown, with two to five transverse and zero to two longitudinal or oblique septa, and measured 10.1 to 35.9 × 7.6 to 24.3 μm (n=30). The colony of isolate 12 on PDA was grayish-green. Hyaline (young) hyphae or brown (old) hyphae, with septa and smooth walls, were slightly constricted at the septa and branched. Conidiophores produced numerous conidia in long chains. These conidia were globose to ellipsoidal and 13.5 to 34.5 × 7.0 to 14.1 μm (n = 30). The morphological characteristics of the 3 isolates matched those of Alternaria spp. The three isolates showed different morphological characteristics on different media.

3.4. Multigene phylogenetic analysis

BLAST results showed that the ITS, GAPDH, TEF1-α, RPB2 and Alt a 1 sequences of isolate 12 were highly similar (≥98%) to those of A. koreana (culture ex-type SPL2-1), while sequences of isolates 11 and 13 were highly similar (≥99%) to those of A. alternata (culture representative CBS 918.96). The sequences of genes/region ITS, GAPDH, TEF1-α, RPB2 and Alt a 1 from the three isolates (11, 12 and 13) were deposited in GenBank, and the accession numbers are shown in Table 2. Phylogenetic analyses using concatenated sequences placed isolate 12 in the clade of A. koreana and isolates 11 and 13 in the clade of A. alternata. Based on the phylogeny and morphology, isolate 12 was identified as A. koreana, and isolates 11 and 13 were identified as A. alternata (Figure 4).

3.5. Biological characteristics

The colonies of isolates 11 and 13 on CDA appeared as yellowish colonies with flattened colonies (Figure 5B, N). On Richard's medium, the colony appeared grayish-white, with very few hyphae and weak growth (Figure 5C, O). The colony of isolate 11 was dark green with dense mycelium on CMA and OA media, and on PSA media, the colony was dark gray in the middle with a brown ring around it with abundant mycelium (Figure 5D, E). The colony of isolate 13 was light green and radial on CMA, OA and PSA media (Figure 5P, Q, R). The colony of isolate 12 on CDA was almost identical to the colony morphology on PDA and PSA, with grayish-white colonies with dense hyphae (Figure 5G, H, L), showing a brownish color on Richard, with reticulated colonies and fewer hyphae (Figure 4I), a whitish-green color on CMA, with loosely packed colonies (Figure 5J), and a dark green color on PSA medium, with fuzzy colonies (Figure 5K).
Isolates 11, 12, and 13 were cultured between 5°C-35°C for 7 days, and the colony diameter reached a maximum and grew most vigorously at 25°C, but at 5°C, the mycelium hardly grew, which shows that 25°C is the optimum culture temperature for isolates 11, 12, and 13 (Figure 6).

3.6. Susceptibility of Alternaria isolates to fungicides

The three isolates showed similar biological responses to the four fungicides (Figure 7). All four fungicides showed significant growth inhibition of the isolates on PDA media. Prochloraz had a lower EC50 on mycelial growth than the other three fungicides and showed the best inhibitory effect on isolates 11, 12, and 13 (Table 3). Pyraclostrobin had the highest EC50 on mycelial growth of 13 isolates and the weakest inhibitory effect but still had a strong inhibitory effect on 11 and 12 isolates. Based on the EC50 values, myclobutanil inhibited isolates 11 and 13 almost equally but more strongly against isolate 12. Isolate 12 was the most sensitive to tebuconazole compared to 11 and 13, and isolate 13 was the least sensitive. The results indicated that prochloraz was the most effective fungicide against Alternaria spp. in this study.

4. Discussion

Celtis sinensis is a common deciduous tree that not only has some value in food and medicine but also plays an important role in urban greening and the economy. However, leaf spot disease deteriorates the appearance of leaves and severely affects the ornamental value of C. sinensis. This disease also leads to leaf damage and interferes with photosynthesis, which prevents C. sinensis from fully utilizing sunlight for nutrient synthesis, resulting in slow growth of the plant and weakening of the leaves, which in turn affects the health and growth of the whole tree and reduces the quality of the timber [33], resulting in an economic loss to the timber industry, as well as affecting the ecological function of C. sinensis. Timely identification of the pathogen responsible for C. sinensis leaf spot is essential. By combining morphological identification, molecular analysis, and phylogenetic research [34], A. alternata and A. koreana were identified as the causal agents of C. sinensis leaf spot in China. To our knowledge, this is the first report of A. alternata and A. koreana causing leaf spot in C. sinensis.
The majority of pathogenic species within the Alternaria genus are the primary cause of the most detrimental plant diseases, commonly referred to as “leaf spot” or “leaf blight”. These diseases are characterized by the development of circular or irregular necrotic lesions on the surface of the leaf, accompanied by a distinct concentric ring-like pattern at the center of the lesions. It is difficult to classify species of Alternaria based on spore morphology characteristics. The challenge arises because a considerable number of small-spore Alternaria species, commonly referred to as A. alternata, exhibit closely similar morphological characteristics [35]. Currently, there is very little research available on A. koreana species. The spore size observed in this study closely resembles the findings reported by Romain et al. [36]. However, there is actually a large amount of research available on Alternaria spp., and there is considerable variation in spore sizes reported. The spore sizes observed in this study are notably different from those described by Ramirez et al. [37], but they are similar to the description by Sun et al. [38]. Due to its morphological characteristics being susceptible to environmental conditions and the presence of many uncontrollable factors, it is highly prone to variations [39].
Currently, the classification of Alternaria species primarily relies on the utilization of morphological characteristics and multigene phylogenetic analysis methods. Lawrence et al [40], Woudenberg et al [41], Grum-Grzhimaylo et al [42] and Ghafri et al [43] used multigene analyses to reconstruct phylogenetic relationships within the genus Alternaria, resulting in the division of the genus into 28 clades, each represented by a type specimen. Phylogenetic analysis of Alternaria using multiple nucleotide sequences, such as ITS, mtLSU, endoPG, TUB, mtSSU, ATP, EF-1α, gpd, Alt a 1, CAL, CHS, ACT, OPA2-1, IGS, HIS, TMA22, PGS1, and REV3, is often employed because these genes play a role in the identification of the genus Alternaria as well as similar interspecifics. Alternaria sect. Alternaria contains most of the small-spored Alternaria species with concatenated conidia, including important plant, human and postharvest pathogens [44]. Alternaria sect. Alternaria consists of only 11 phylogenetic species and one species complex [40].
Temperature is typically regarded as the primary environmental factor influencing the prevalence of plant diseases [45]. In this study, the optimal growth temperature for the representative isolates was 25 °C, mycelial growth was stagnant at 5 °C, and growth was weaker at 15 °C, 20 °C, 30 °C, and 35 °C than at 25 °C. This aligns with the findings of prior studies regarding the ideal temperature for the growth of A. alternata [46]. Therefore, it is advisable to implement timely pathogen control measures before the optimal growth temperature is reached. Leaf spot of C. sinensis tend to occur in March and April, with outbreaks peaking in May and June and continuing through October. During this period, the pathogen thrives in suitable environments and produces highly infectious conidia that infect the plant host.
Evaluating the biological characteristics of pathogens is of utmost significance in preventing and controlling plant disease outbreaks, as it can lay the groundwork for scientifically informed disease prevention and control measures. It is important to detect the presence of pathogens as early as possible to effectively prevent and control plant diseases [47]. Leaf spot of C. sinensis caused by Alternaria not only affect the health and appearance of plants but also have an impact on their economic value. Fungal leaf spot disease usually spreads under wet conditions and can spread to other healthy C. sinensis or plants by wind, raindrops, insects or artificial means, thus spreading the disease further and causing the occurrence of leaf spot disease on large areas of C. sinensis as well as the epidemic occurrence of other plant diseases, which disrupts the ecological balance. Therefore, the negative impacts of C. sinensis leaf spot on agriculture, forestry, urbanization, ecosystems and the economy are manifold, and measures need to be taken to prevent and manage this plant disease. It is necessary to inhibit the growth of fungal mycelium, thus further controlling the spread and transmission of the disease to prevent greater losses. The temperature experiment conducted in this study conclusively demonstrates the importance of determining the timing for fungicide application before the pathogen reaches its optimal growth temperature.
Different fungicides exert their fungicidal effects through various mechanisms based on their type, chemical structure, etc. [48]. Prochloraz inhibits sterol synthesis in fungal cell membranes, leading to cell wall rupture and cell death. It also interferes with fungal DNA synthesis and protein synthesis, resulting in fungicidal effects [49]. In 2009, researchers conducted in vitro susceptibility tests using six fungicides against the pathogen Alternaria solani. The results showed that prochloraz, with EC50 values ranging from 0.03 to 0.11 µg/ml, was effective in inhibiting the growth of the pathogen [50]. This result is consistent with the results of the present study that prochloraz has the best inhibitory effect on A. alternata and A. koreana, causing leaf spot in C. sinensis. However, by comparing the EC50 values, the sensitivity of prochloraz to A. alternata and A. koreana are much less than that to A. solani, and the inhibitory effect is still unsatisfactory. In 2023, the EC50 value of fludioxonil was only 0.089 ± 0.020 in Wang et al.'s study [51], whereas the EC50 value of prochloraz in this study was 2.92, which clearly shows that the inhibitory effect of fludioxonil on A. alternata was stronger. Fewer fungicides were selected in this study, and the selection of efficient, environmentally friendly, and economical fungicides needs to be further explored.

5. Conclusions

In this study, we performed the isolation of fungal pathogens and carried out pathogenicity tests. We identified three isolates (11-13) responsible for causing leaf spot in C. sinensis through multilocus phylogenetic analyses involving ITS, GAPDH, TEF1-α, RPB2, Alt a 1 locis, as well as physical attributes. Three isolates were ascertained that A. alternata and A. koreana. The pathogen's susceptibility to the four fungicides was ascertained through phenotypic experiments conducted on culture medium plates. These sensitivity data can serve as a point of reference for assessing potential changes in the sensitivity of Alternaria spp. to various fungicides in the future. To our knowledge, this is the inaugural report that A. alternata and A. koreana causing leaf spot in C. sinensis in China and worldwide. This finding will yield valuable insights for future investigations focused on the prevention and treatment strategies for this recently emerged disease.

Author Contributions

Q.-Q.W., X.-Y.Z., Y.W., and Y.-J.Z. designed the study and were involved in writing the paper; Q.-Q.W. and Y.-J.Z. were responsible for sample collections; Q.-Q.W. was responsible for pathogenicity tests; Q.-Q.W., X.-Y.Z., and Y.W. were involved in morphological identification; Q.-Q.W., X.-Y.Z. and Y.W. were involved in phylogenetic analyses; Q.-Q.W., X.-Y.Z., Y.W., and Y.-J.Z. contributed to planning and editing of the paper. All authors have read and agreed to the published version of the manuscript.

Data Availability Statement

All data generated or analyzed during this study are included in this article.

Acknowledgments

The authors would like to thank those who provided assistance and advice for this study.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Fan, J.; Chen, Y.; Luo, M.; Liang, Z.; Nong, X. The chloroplast genome characteristics, comparative genomics and gene resource mining of Celtis sinensis (Persoon, 1805). MITOCHONDRIAL DNA B 2022, 7, 698–704. [Google Scholar] [CrossRef] [PubMed]
  2. Lee, H.B.; Lee, K.H.; Nguyen, T.T.T. First Report of Powdery Mildew Caused by Erysiphe michikoae on Celtis sinensis in Korea. Plant Dis. 2020, 104, 984–985. [Google Scholar] [CrossRef]
  3. Guozheng, W.; Yunyan, Z.; Jiehan, Z.; Mengyuan, Z.; Yimin, H.; Yongjing, T.; Jingbo, Z.; Zhongsheng, W. Characterization of the first complete chloroplast genome sequence of Celtis sinensis (Cannabaceae) and its phylogenetic implications. MITOCHONDRIAL DNA B 2019, 4. [Google Scholar] [CrossRef]
  4. Huizheng, W.; Shilong, W.; Yubin, L. First Report of Botryosphaeria dothidea Causing Leaf Spot and Wilt on Celtis sinensis in China. Plant Dis. 2020. [Google Scholar] [CrossRef]
  5. Liang, L.; Li, H.; Zhou, L.F.; Chen, F.M. Lasiodiplodia pseudotheobromae causes stem canker of Chinese hackberry in China. J. For. Res. 2020, 31, 2571–2580. [Google Scholar] [CrossRef]
  6. Woudenberg, J.H.C.; Groenewald, J.Z.; Binder, M.; Crous, P.W. Alternaria redefined. STUDIES IN MYCOLOGY 2013, 171–212. [Google Scholar] [CrossRef]
  7. Qin, Q.M.; Fan, Y.Y.; Jia, Q.L.; Duan, S.S.; Liu, F.J.; Jia, B.X.; Wang, G.Q.; Guo, W.H.; Wang, C. The Potential of Alternaria Toxins Production by A. alternata in Processing Tomatoes. TOXINS. 2022, 14. [Google Scholar] [CrossRef]
  8. Mitakakis, T.Z.; Barnes, C.; Tovey, E.R. Spore germination increases allergen release from Alternaria. J. Allergy Clin. Immunol. 2001, 107, 388–390. [Google Scholar] [CrossRef]
  9. Bush, R.K.; Prochnau, J.J. Alternaria-induced asthma. J. Allergy Clin. Immunol. 2004, 113, 227–234. [Google Scholar] [CrossRef] [PubMed]
  10. Pochon, S.; Terrasson, E.; Guillemette, T.; Iacomi-Vasilescu, B.; Georgeault, S.; Juchaux, M.; Berruyer, R.; Debeaujon, I.; Simoneau, P.; Campion, C. The Arabidopsis thaliana-Alternaria brassicicola pathosystem: A model interaction for investigating seed transmission of necrotrophic fungi. Plant Methods 2012, 8. [Google Scholar] [CrossRef] [PubMed]
  11. Baez-Flores, M.E.; Troncoso-Rojas, R.; Osuna, M.A.I.; Dominguez, M.R.; Pryor, B.; Tiznado-Hernandez, M.E. Differentially expressed cDNAs in Alternaria alternata treated with 2-propenyl isothiocyanate. Microbiol. Res. 2011, 166, 566–577. [Google Scholar] [CrossRef] [PubMed]
  12. Timmer, L.W.; Peever, T.L.; Solel, Z.; Akimitsu, K. Alternaria diseases of citrus - Novel pathosystems. Phytopathol. Mediterr. 2003, 42, 1000–1014. [Google Scholar]
  13. Vicent, A.; Badal, J.; Asensi, M.J.; Sanz, N.; Armengol, J.; Garcia-Jimenez, J. Laboratory evaluation of citrus cultivars susceptibility and influence of fruit size on Fortune mandarin to infection by Alternaria alternata pv. citri. Eur. J. Plant Pathol. 2004, 110, 245–251. [Google Scholar] [CrossRef]
  14. Vega, B.; Dewdney, M.M. Distribution of Qol Resistance in Populations of Tangerine-Infecting Alternaria alternata in Florida. Plant Dis. 2014, 98, 67–76. [Google Scholar] [CrossRef]
  15. Vega, B.; Dewdney, M.M. Sensitivity of Alternaria alternata from Citrus to Boscalid and Polymorphism in Iron-Sulfur and in Anchored Membrane Subunits of Succinate Dehydrogenase. Plant Dis. 2015, 99, 231–239. [Google Scholar] [CrossRef]
  16. Song, J.H.; Wang, Y.F.; Yin, W.X.; Huang, J.B.; Luo, C.X. Effect of Chemical Seed Treatment on Rice False Smut Control in Field. Plant Dis. 2021, 105, 3218–3223. [Google Scholar] [CrossRef] [PubMed]
  17. Ju, Y.; Si, Y.Z.; Li, D.W.; Xu, W.; Sun, J.W.; Zhu, L.H. First Report of Leaf Blotch of Salix babylonica Caused by Botryosphaeria dothidea in China. Plant Dis. 2021, 105, 224–224. [Google Scholar] [CrossRef]
  18. Zhu, L.H.; Xu, W.; Huang, L.; Ye, J.R.; Li, D.W. Pathogenicity and Biological Characteristics of Septotinia populiperda Causing Leaf Blotch of Willow. Plant Dis. 2022, 106, 1262–1270. [Google Scholar] [CrossRef]
  19. Liao, Y.C.Z.; Wan, Y.; Si, Y.Z.; Geng, J.X.; Li, D.W.; Zhu, L.H. Leaf spot of Ligustrum japonicum caused by Diaporthe eres newly reported in China. Crop Prot. 2023, 164. [Google Scholar] [CrossRef]
  20. Si, Y.Z.; Sun, J.W.; Wan, Y.; Chen, Y.N.; He, J.; Li, W.Z.; Li, D.W.; Zhu, L.H. Neofusicoccum cryptomeriae sp. nov. and N. parvum Cause Stem Basal Canker of Cryptomeria japonica in China. J. Fungi 2023, 9. [Google Scholar] [CrossRef]
  21. Jiao, H.; MeiLing, S.; DeWei, L.; LiHua, Z.; JianRen, Y.; Lin, H. A real-time PCR for detection of pathogens of anthracnose on Chinese fir using TaqMan probe targeting ApMat gene. Pest Manage. Sci. 2022, 79. [Google Scholar] [CrossRef]
  22. White TJ, B.T., Lee SB, Taylor JW. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A guide to Methods and Applications 1990, 18, 315–322.
  23. Carbone I, K.L. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
  24. Berbee ML, P.M., Hubbard S Cochliobolus phylogenetics and the origin of known, highly virulent pathogens, inferred from ITS and glyceraldehydes-3-phosphate dehydrogenase gene sequences. Mycologia 1999, 91, 964–977. [CrossRef]
  25. Liu, Y.J.; Whelen, S.; Hall, B.D. Phylogenetic relationships among ascomycetes: evidence from an RNA polymerse II subunit. Mol. Biol. Evol. 1999, 16, 1799–1808. [Google Scholar] [CrossRef] [PubMed]
  26. Hong, S.G.; Cramer, R.A.; Lawrence, C.B.; Pryor, B.M. Alt a 1 allergen homologs from Alternaria and related taxa: analysis of phylogenetic content and secondary structure. Fungal Genet. Biol. 2005, 42, 119–129. [Google Scholar] [CrossRef]
  27. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
  28. Zhang, D.; Gao, F.; Jakovlic, I.; Zou, H.; Zhang, J.; Li, W.X.; Wang, G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2020, 20, 348–355. [Google Scholar] [CrossRef]
  29. Zhang, Y.; Zhang, B.; Luo, C.; Fu, Y.; Zhu, F. Fungicidal Actions and Resistance Mechanisms of Prochloraz to Penicillium digitatum. Plant Dis. 2021, 105, 408–415. [Google Scholar] [CrossRef] [PubMed]
  30. Ypema, H.L.; Ypema, M.; Gubler, W.D. Sensitivity of Uncinula necator to Benomyl, Triadimefon, Myclobutanil, and Fenarimol in California. Plant Dis. 1997, 81, 293–297. [Google Scholar] [CrossRef]
  31. Gama, A.B.; Baggio, J.S.; Rebello, C.S.; Lourenco, S.d.A.; Gasparoto, M.C.d.G.; da Silva Junior, G.J.; Peres, N.A.; Amoriml, L. Sensitivity of Colletotrichum acutatum Isolates from Citrus to Carbendazim, Difenoconazole, Tebuconazole, and Trifloxystrobin. Plant Dis. 2020, 104, 1621–1628. [Google Scholar] [CrossRef]
  32. Han, S.; Lu, J.; Gao, J.; Cheng, J.; Xu, W.; Tao, L.; Zhang, Y. Pyraclostrobin induced AMPK/mTOR pathways mediated autophagy in RAW264.7 macrophages. J. Environ. Sci. Health Part B. 2021, 56, 793–800. [Google Scholar] [CrossRef] [PubMed]
  33. Zhang, M.J.; Zheng, X.R.; Li, H.; Chen, F.M. Alternaria alternata, the Causal Agent of a New Needle Blight Disease on Pinus bungeana. J. Fungi 2023, 9. [Google Scholar] [CrossRef]
  34. Meng, J.X.; Zhang, X.Y.; Han, X.S.; Fan, B. Application and Development of Biocontrol Agents in China. PATHOGENS 2022, 11. [Google Scholar] [CrossRef]
  35. Zhu, X.Q.; Xiao, C.L. Phylogenetic, Morphological, and Pathogenic Characterization of Alternaria Species Associated with Fruit Rot of Blueberry in California. Phytopathology 2015, 105, 1555–1567. [Google Scholar] [CrossRef] [PubMed]
  36. Romain, B.B.N.D.; Hassan, O.; Kim, J.S.; Chang, T. Alternaria koreana sp. nov., a new pathogen isolated from leaf spot of ovate-leaf Atractylodes in South Korea. Mol. Biol. Rep. 2022, 49, 413–420. [Google Scholar] [CrossRef]
  37. Ramirez-Villacis, D.; Barriga-Medina, N.; Llerena-Llerena, S.; Pazmino-Guevara, C.; Leon-Reyes, A. First Report of Alternaria alternata Causing Leaf Spot on Broccoli in Ecuador. Plant Dis. 2023. [Google Scholar] [CrossRef] [PubMed]
  38. Sun, H.F.; Jiang, X.; Li, Z.; Wang, H.; Yan, Y.; Yang, H. First report of Alternaria alternata causing leaf blight on Trollius chinensis in China. Plant Dis. 2023. [Google Scholar] [CrossRef]
  39. Pryor, B.M.; Michailides, T.J. Morphological, pathogenic, and molecular characterization of Alternaria isolates associated with Alternaria late blight of pistachio. Phytopathology. 2002, 92, 406–416. [Google Scholar] [CrossRef]
  40. Lawrence, D.P.; Gannibal, P.B.; Peever, T.L.; Pryor, B.M. The sections of Alternaria: formalizing species-group concepts. Mycologia 2013, 105, 530–546. [Google Scholar] [CrossRef] [PubMed]
  41. Woudenberg, J.H.C.; Truter, M.; Groenewald, J.Z.; Crous, P.W. Large-spored Alternaria pathogens in section Porri disentangled. Stud. Mycol. 2014, 1–47. [Google Scholar] [CrossRef] [PubMed]
  42. Grum-Grzhimaylo, A.A.; Georgieva, M.L.; Bondarenko, S.A.; Debets, A.J.M.; Bilanenko, E.N. On the diversity of fungi from soda soils. Fungal Diversity. 2016, 76, 27–74. [Google Scholar] [CrossRef]
  43. Ghafri, A.; Maharachchikumbura, S.S.N.; Hyde, K.D.; Al-Saady, N.; Al-Sadi, A.M. A new section and a new species of Alternaria encountered from Oman. PHYTOTAXA 2019, 405, 279–289. [Google Scholar] [CrossRef]
  44. Woudenberg, J.H.C.; Seidl, M.F.; Groenewald, J.Z.; de Vries, M.; Stielow, J.B.; Thomma, B.P.H.J.; Crous, P.W. Alternaria section Alternaria: Species, formae speciales or pathotypes? Stud. Mycol. 2015, 1–21. [Google Scholar] [CrossRef]
  45. Giner, M.M.; Garcia, J.S.C.; Camacho, C.N. Airborne Alternaria spores in SE Spain (1993-98) - Occurrence patterns, relationship with weather variables and prediction models. GRANA 2001, 40, 111–118. [Google Scholar] [CrossRef]
  46. Cabral, L.D.; Rodriguez, A.; Delgado, J.; Patriarca, A. Understanding the effect of postharvest tomato temperatures on two toxigenic Alternaria spp. strains: growth, mycotoxins and cell-wall integrity-related gene expression. J. Sci. Food Agric. 2019, 99, 6689–6695. [Google Scholar] [CrossRef] [PubMed]
  47. Cao, X.M.; Li, Y.L.; Fan, J.L.; Zhao, Y.J.; Borriss, R.; Fan, B. Two Lysine Sites That Can Be Malonylated Are Important for LuxS Regulatory Roles in Bacillus velezensis. MICROORGANISMS 2021, 9. [Google Scholar] [CrossRef] [PubMed]
  48. Gisi, U.; Sierotzki, H. Fungicide modes of action and resistance in downy mildews. Eur. J. Plant Pathol. 2008, 122, 157–167. [Google Scholar] [CrossRef]
  49. Zhang, Y.C.; Zhang, B.; Luo, C.X.; Fu, Y.P.; Zhu, F.X. Fungicidal Actions and Resistance Mechanisms of Prochloraz to Penicillium digitatum. Plant Dis. 2021, 105, 408–415. [Google Scholar] [CrossRef]
  50. Stepanovic, M.; Vuksa, P.; Potocnik, I.; Milijasevic, S.; Rekanovic, E.; Todorovic, B. Integrated Management of Viral Sensitivity of Alternaria solani Isolates to Some Fungicides. In Proceedings of the II INTERNATIONAL SYMPOSIUM ON TOMATO DISEASES; 2009; pp. 377–380. [Google Scholar] [CrossRef]
  51. Wang, F.; Saito, S.; Xiao, C.L. Fungicide Resistance of Alternaria alternata and A. arborescens Isolates from Mandarin Fruit and Its Influence on Control of Postharvest Alternaria Rot. Plant Dis. 2023, 107, 1538–1543. [Google Scholar] [CrossRef]
Preprints 90935 g001
Figure 1. Symptoms of infected leaves in C. sinensis in the wild. A. Diseased leaves naturally. B. Close-up view of diseased leaves.
Figure 1. Symptoms of infected leaves in C. sinensis in the wild. A. Diseased leaves naturally. B. Close-up view of diseased leaves.
Preprints 90935 g001
Preprints 90935 g002
Figure 2. Pathogenicity of fungal isolates. A. Symptomless leaves of controls treated with PDA after 4 days. B-D. Symptoms on leaves inoculated with mycelium blocks of isolates 11, 12 and 13 after 4 days. E. Symptomless leaves of controls treated with sterile water after 5 days. F-H. Symptomless leaves of controls treated with sterile water after 5 days. Symptoms on leaves inoculated with 10 µl of conidial suspension (106 conidia/mL) of isolates 11, 12 and 13 after 5 days.
Figure 2. Pathogenicity of fungal isolates. A. Symptomless leaves of controls treated with PDA after 4 days. B-D. Symptoms on leaves inoculated with mycelium blocks of isolates 11, 12 and 13 after 4 days. E. Symptomless leaves of controls treated with sterile water after 5 days. F-H. Symptomless leaves of controls treated with sterile water after 5 days. Symptoms on leaves inoculated with 10 µl of conidial suspension (106 conidia/mL) of isolates 11, 12 and 13 after 5 days.
Preprints 90935 g002
Preprints 90935 g003
Figure 3. Morphological characteristics of fungal isolates. A. 7-day-old front and back view colony of 11 on PDA. B-C. Conidial chain and conidia of isolate 11, Bars: E = 100 μm, F =10 μm. D. 7-day-old front and back view colony of 12 on PDA. E-F. Conidial chain and conidia of isolate 12, Bars: I = 100 μm, J =10 μm. G. 7-day-old front and back view colony of 13 on PDA. H-I. Conidial chain and conidia of isolate 13, Bars: M = 100 μm, N =10 μm.
Figure 3. Morphological characteristics of fungal isolates. A. 7-day-old front and back view colony of 11 on PDA. B-C. Conidial chain and conidia of isolate 11, Bars: E = 100 μm, F =10 μm. D. 7-day-old front and back view colony of 12 on PDA. E-F. Conidial chain and conidia of isolate 12, Bars: I = 100 μm, J =10 μm. G. 7-day-old front and back view colony of 13 on PDA. H-I. Conidial chain and conidia of isolate 13, Bars: M = 100 μm, N =10 μm.
Preprints 90935 g003
Preprints 90935 g004
Figure 4. Phylogenetic relationship of 11, 12 and 13 and related taxa derived from concatenated sequences of the ITS, GAPDH, TEF1-α, RPB2 and Alt a 1 genes using the maximum likelihood algorithm and Bayesian analysis. Bootstrap values >75% (1,000 replications) and Bayesian posterior probability (PP ≥ 0.90) are shown at the nodes (ML/PP). Alternaria alternantherae (CBS 124392) was used as an outgroup. Bar = 0.002 substitutions per nucleotide position. T indicates ex-types.
Figure 4. Phylogenetic relationship of 11, 12 and 13 and related taxa derived from concatenated sequences of the ITS, GAPDH, TEF1-α, RPB2 and Alt a 1 genes using the maximum likelihood algorithm and Bayesian analysis. Bootstrap values >75% (1,000 replications) and Bayesian posterior probability (PP ≥ 0.90) are shown at the nodes (ML/PP). Alternaria alternantherae (CBS 124392) was used as an outgroup. Bar = 0.002 substitutions per nucleotide position. T indicates ex-types.
Preprints 90935 g004
Preprints 90935 g005
Figure 5. Colony formation of isolates 11, 12, and 13 isolated from Celtis sinensis hatched for 7 days on different media at 25°C. A-F. Colony morphology of isolate 11 cultured on PDA, CDA, Richard, CMA, OA, and PSA media for 7 days. G-L. Colony morphology of isolate 12 cultured on PDA, CDA, Richard, CMA, OA, and PSA media for 7 days. M-R. Colony morphology of isolate 13 cultured on PDA, CDA, Richard, CMA, OA, and PSA media for 7 days.
Figure 5. Colony formation of isolates 11, 12, and 13 isolated from Celtis sinensis hatched for 7 days on different media at 25°C. A-F. Colony morphology of isolate 11 cultured on PDA, CDA, Richard, CMA, OA, and PSA media for 7 days. G-L. Colony morphology of isolate 12 cultured on PDA, CDA, Richard, CMA, OA, and PSA media for 7 days. M-R. Colony morphology of isolate 13 cultured on PDA, CDA, Richard, CMA, OA, and PSA media for 7 days.
Preprints 90935 g005
Preprints 90935 g006
Figure 6. The impact of temperature on the growth of colony diameters in isolates 11, 12, and 13 after 7 days of culture on PDA media.
Figure 6. The impact of temperature on the growth of colony diameters in isolates 11, 12, and 13 after 7 days of culture on PDA media.
Preprints 90935 g006
Preprints 90935 g007
Figure 7. The suppression effect on isolates 11, 12 and 13 on plates by corresponding doses of four different fungicides (prochloraz, myclobutanil, tebuconazole, and pyraclostrobin) based on fresh PDA for 7 days.
Figure 7. The suppression effect on isolates 11, 12 and 13 on plates by corresponding doses of four different fungicides (prochloraz, myclobutanil, tebuconazole, and pyraclostrobin) based on fresh PDA for 7 days.
Preprints 90935 g007
Table 1. Primers used for PCR amplification in the molecular identification of three isolates (11–13).
Table 1. Primers used for PCR amplification in the molecular identification of three isolates (11–13).
Gene Primer Sequence (5’-3’) PCR amplification cycle parameters:
Internal transcribed spacer
(ITS)		 ITS1
ITS4		 TCCGTAGGTGAACCTGCGG
TCCTCCGCTTATTGATATGC		 95 °C: 3 min, (95 °C: 30 s, 55 °C: 30 s,72 °C: 45 s) × 30 cycles, 72 °C: 10 min
Elongation factor 1-alpha
(TEF1-α)		 EF1-728F
EF1-986R		 CATCGAGAAGTTCGAGAAGG
TACTTGAAGGAACCCTTACC		 95 °C: 3 min, (95 °C: 30 s, 59 °C: 30 s, 72 °C: 20 s) × 30 cycles, 72 °C: 10 min
Glycerol-3-phosphate
dehydrogenase (GAPDH)		 GPD1
GPD2		 CAACGGCTTCGGTCGCATTG
GCCAAGCAGTTG GTTGT		 95 °C: 3 min, (95 °C: 30 s, 59.5 °C: 30 s, 72 °C: 45 s) × 30 cycles, 72 °C: 10 min
RNA polymerase second
largest subunit (RPB2)		 RPB2-5F2
RPB2-7cR		 GGGGWGAYCAGAAGA AGGC
CCCATRGCTTGTYYRCCCAT		 95 °C: 3 min, (95 °C: 30 s, 53 °C: 30 s, 72 °C: 50 s) × 30 cycles, 72 °C: 10 min
Alternaria major allergen gene
(Alt a 1)		 Alt-al-for
Alt-al-rev		 ATGCAGTTCACCACCATCGC
ACGAGGGTGAYGTAGGCGTC		 95 °C: 3 min, (95 °C: 30 s, 60.5 °C: 30 s, 72 °C: 30 s) × 30 cycles, 72 °C: 10 min
Table 2. The isolates of Alternaria species used in this study for phylogenetic analysis.
Table 2. The isolates of Alternaria species used in this study for phylogenetic analysis.
Species Isolate Accession Numbers
ITS GAPDH TEF1-α RPB2 Alt a 1
Alternaria alstroemeriae CBS 118809T KP124297 KP124154 KP125072 KP124765 KP123845
Alternaria sp. CBS 108.27 KC584236 KC584162 KC584727 KC584468 -
A. alternantherae CBS 124392 KC584179 KC584096 KC584633 KC584374 KP123846
A. alternata CBS 916.96T AF347031 AY278808 KC584634 KC584375 AY563301
A. alternata 11 OP476716 OP609771 OP609768 OP604538 OP609775
A. alternata 13 OP476718 OP609773 OP609770 OP604540 OP609776
A. arctoseptata MFLUCC
21-0139T 		- OK236702 0K236608 OK236655 OK236755
A. baoshanensis MFLUCC
21-0124T 		MZ622003 OK236706 OK236613 OK236659 OK236760
A. betae-kenyensis CBS 118810T KP124419 KP124270 KP125197 KP124888 KP123966
A. breviconidiophora MFLUCC
22-0075T 		MZ621997 OK236698 OK236604 OK236651 -
A. burnsii CBS 107.38T KP124420 JQ646305 KP125198 KP124889 KP123967
A. doliconidium KUN-HKAS
100840T 		NR158361 - - - -
A. ellipsoidialis MFLUCC
21-0132T 		MZ621989 OK236690 OK236596 OK236643 OK236743
A. eupatoriicola MFLUCC
21-0122T 		MZ621982 OK236683 OK236589 OK236636 OK236736
A. eichhorniae CBS 489.92T KC146356 KP124276 KP125204 KP124895 KP123973
A. eichhorniae CBS 119778 KP124426 KP124277 KP125205 KP124896 KP123973
A. falcata MFLUCC
21-0123T 		MZ621992 OK236693 OK236599 OK236646 OK236746
A. gaisen CBS 632.93 KC584197 KC584116 KC584658 KC584399 KP123974
A. gaisen CBS 118488 KP124427 KP124278 KP125206 KP124897 KP123975
A. gossypina CBS 104.32T KP124430 JQ646312 KP125209 KP124900 JQ646395
A. gossypina CBS 107.36T KP124431 JQ646310 KP125210 KP124901 JQ646393
A. iridiaustralis CBS 118404 KP124434 KP124283 KP125213 KP124904 KP123980
A. iridiaustralis CBS 118486T KP124435 KP124284 KP125214 KP124905 KP123981
A. jacinthicola CBS 878.95 KP124437 KP124286 KP125216 KP124907 KP123983
A. jacinthicola CBS 133751T KP124438 KP124287 KP125217 KP124908 KP123984
A. koreana SPL2-1
(KACC49833)T 		LC621613 LC621647 LC621715 LC621681 LC631831
A. koreana SPL2-4 LC621615 LC621649 LC621717 LC621683 LC631832
A. koreana 12 OP476717 OP609772 OP609769 OP604539 OP609774
A. lathyri MFLUCC
21-0140T 		MZ621974 OK236675 OK236581 OK236628 OK236728
A. longipes CBS 539.94 KP124441 KP124290 KP125220 KP124911 KP123987
A. longipes CBS 540.94 AY278835 AY278811 KC584667 KC584409 AY563304
A. macroconidia MFLUCC
21-0134T 		MZ622001 OK236704 OK236610 OK236657 OK236757
A. minimispora MFLUCC
21-0127T 		MZ621980 OK236681 OK236587 OK236634 OK236734
A. muriformispora MFLUCC
22-0073T 		MZ621976 OK236677 OK236583 OK236630 OK236730
A. ovoidea MFLUCC
14-0427T 		MZ622005 OK236708 OK236614 OK236661 OK236761
A. phragmiticola MFLUCC
21-0125T 		MZ621994 OK236696 OK236602 OK236649 OK236749
A. pseudoinfectoria MFLUCC
21-0126T 		MZ621984 OK236685 OK236591 OK236638 OK236738
A. rostroconidia MFLUCC
21-0136T 		MZ621969 OK236670 OK236576 OK236623 OK236723
A. salicicola MFLUCC
22-0072T 		MZ621999 OK236700 OK236606 OK236653 OK236753
A. setosa YZU 191101T OP341770 OP352306 OP374459 OP352294 OP293717
A. tectorum YZU 161050T OP341728 OP352303 OP374456 OP352291 OP293714
A. tectorum YZU 161052 OP341817 OP352304 OP374457 OP352292 OP293715
A. tomato CBS 103.30 KP124445 KP124294 KP125224 KP124915 KP123991
A. tomato CBS 114.35 KP124446 KP124295 KP125225 KP124916 KP123992
A. torilis MFLUCC
14-0433T 		MZ621988 OK236688 OK236594 OK236641 OK236741
A. vitis MFLUCC
17-1109T 		MG764007 - - - -
T ex-type isolate; bolded are the isolates for this study.
Table 3. Concentration at 50% of Maximum Effect (EC50 values) of isolates.
Table 3. Concentration at 50% of Maximum Effect (EC50 values) of isolates.
Fungicide EC50 Values (µg/mL)
11 12 13
Prochloraz 2.92 3.89 3.98
Myclobutanil 84.54 54.86 17.23
Tebuconazole 34.1 17.23 141.9
Pyraclostrobin 50.21 32.27 421.1
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.
Prerpints.org logo

Preprints.org is a free preprint server supported by MDPI in Basel, Switzerland.

facebook logotwitter logolinkedin logo
MDPI Initiatives
Important Links
Subscribe

Disclaimer

Terms of Use

Privacy Policy

© 2024 MDPI (Basel, Switzerland) unless otherwise stated