1. Introduction

2. Materials and Methods

2.3. Methods

2.3.1. Isolation

The isolation process involved collecting fragments from symptomatic organ tissues, encompassing both affected and healthy portions. These fragments underwent successive disinfection steps in ethanol (70 %), bleach (0.1 %) and were subsequently rinsed in sterile distilled water. Following this, the fragments were ground and suspended in 1 ml of sterile distilled water. The suspension was allowed to stand for a minimum of 30 minutes at room temperature, with intermittent stirring to facilitate bacterial diffusion. A 50 µl aliquot of the suspension was then evenly spread into Yeast Peptone Glucose Agar (LPGA) nutrient medium, supplemented with antibiotics such as kasugamycin (20 mg/l), cephalexin (40 mg/l), and propiconazole (fungicide at 40 mg/l).

Incubation was carried out for 72 to 96 hours, during which bacterial colonies exhibiting morphological characteristics (ivory-white) akin to the reference strain were selected and purified for pathogenicity tests.

2.3.2. Pathogenicity Testing

To assess the pathogenicity of Xcc strains, citrus plants cultivated under semi-controlled conditions were employed. Leaves were inoculated through infiltration with a bacterial suspension containing 10⁸ bacteria/ml, corresponding to an optical density (OD) of 0.2 at 600 nm. The OD measurement was determined by placing 1 ml of the bacterial suspension into a spectrophotometer cuvette, calibrated at 0.2 with an uncertainty of 10 %, as per the following formula :

$$\mathbf{V}\mathbf{o}\mathbf{l}\mathbf{u}\mathbf{m}\mathbf{e}\mathbf{o}\mathbf{f}\mathbf{s}\mathbf{t}\mathbf{e}\mathbf{r}\mathbf{i}\mathbf{l}\mathbf{e}\mathbf{d}\mathbf{i}\mathbf{s}\mathbf{t}\mathbf{i}\mathbf{l}\mathbf{l}\mathbf{e}\mathbf{d}\mathbf{w}\mathbf{a}\mathbf{t}\mathbf{e}\mathbf{r}\mathbf{t}\mathbf{o}\mathbf{b}\mathbf{e}\mathbf{a}\mathbf{d}\mathbf{d}\mathbf{e}\mathbf{d}=\frac{\mathrm{O}\mathrm{D}\mathrm{o}\mathrm{b}\mathrm{t}\mathrm{a}\mathrm{i}\mathrm{n}\mathrm{e}\mathrm{d}-\mathrm{O}\mathrm{D}\mathrm{r}\mathrm{e}\mathrm{q}\mathrm{u}\mathrm{i}\mathrm{r}\mathrm{e}\mathrm{d}}{\mathrm{O}\mathrm{D}\mathrm{r}\mathrm{e}\mathrm{q}\mathrm{u}\mathrm{i}\mathrm{r}\mathrm{e}\mathrm{d}\mathrm{x}\mathrm{V}\mathrm{r}}$$

Vr = Volume of bacterial suspension remaining after sampling 1 ml to measure OD.

A citrus plant was inoculated with sterile distilled water to serve as a control. Inoculated plants were incubated under semi-natural conditions : 28-30 °C under an average relative humidity of 75 %. Symptoms were observed visually from 7 days after inoculation.

2.3.3. Identification of Xcc Strains

For the identification of Xcc strains, specific primers were used in PCR amplification. The primer sequences were REP_FW ATG-TCC-GAC-ATG-AAA-GTT-AAT-T and REP_RV CGC-TTC-TCC-TGC-ATT. The PCR reaction mixture, with a volume of 25 µl per reaction, comprised 1X PCR buffer colored with 5X at 3 mM MgCl2 (25 mM), 1 µM REP_FW primer (10 µM), 1 µM REP_RV primer (10 µM), 0.2 mM of each deoxynucleotide triphosphate (dNTP) (2.5 mM), 0.25 U (5 U/µl) of Taq DNA polymerase and 2.5 µl of DNA sample at 20 ng/µl. The PCR program involved an initial denaturation phase at 95 ºC for 2 min, followed by 35 cycles at 95 ºC for 60 sec, 58 ºC for 70 sec, and 72 ºC for 75 sec, concluding with a final elongation phase at 72 ºC for 10 min. The resulting amplification products, expected to be 222 bp in size, were analyzed on a 2 % agarose gel in 0.5X Tris- Borate-EDTA (TBE) buffer after staining with Ethidium Bromide (BET).

2.3.4. Analysis of Type 3 Effectors

From all the isolated Xcc strains, 11 highly polymorphic T3E genes, as per [14], were characterized (Table 2). DésoxyriboNucleic acid (DNA) extracted using the Promega Kit underwent PCR amplifications with a 20 ul reaction mixture consisting of 1X Go Taq Buffer (Promega), 200 mM dNTP, 0.5 µM of each primer, 0.4 U Go Taq Polymerase (final concentrations), and 1 µl of DNA (20 ng/µl).

The amplification conditions using T3E primers involved an initial denaturation phase of 2 min at 94 °C, followed by 30 reaction cycles comprising denaturation at 94 °C for 1 min, hybridization at 60 °C for 1 min, elongation at 72 °C for 2 min, and a final extension of 10 min at 72 °C [14]. The resulting amplicons were separated by 1 % agarose gel electrophoresis containing 2 % BET in 0.5X TAE buffer (Tris Acetate 50 mM, 1 mM) at 100 Volt for 40 min.

Table 2. List of T3Es used in this study.

Table 2. List of T3Es used in this study.

Oligo name	Sequence	Th °C	Size (bp)
xopB-F	ATG-AAG-GCA-GAG-CTC-ACA-CGA	49,2	1835
xopB-R	TCA-GGC-GCG-GGT-TGG-TGC-GAA-GTA	57,4
xopD-F	ATG-GAA-TAT-ATA-CCA-AGA-ATG-AAG-C	46	1638
xopD-R	CTA-GAA-CTT-TTT-CCA-CCA-CTT-GC	48,4
xopE2-F	ATG-GGG-CTA-TGC-AGT-TCA-AAG-C	49,7	393
xopE2-R	TCA-CCA-ACT-CAA-GGG-TGG-GC	64
xopO-F	ATG-ATC-AAC-ACT-TCC-GTC-AAG	45,3	636
xopO-R	TCA-CCT-GTT-TAT-CCG-ACG-AC	60
xopN-F	ATG-AAG-TCA-TCC-GCA-TCC-GTC	49,2	2090
xopN-R	GTG-CAG-TTC-CGT-CCC-CAA-GTT-CC	55,5
xopQ-F	ATG-CAG-CCC-ACC-GCA-ATC	58	1224
xopQ-R	TCA-GCG-CCC-GCG-TTG-CC	60
xopX-F	ATG-GAG-ATC-AAG-AAA-CAG-CAA-ACC	48,9	1865
xopX-R	TCA-GGA-CGA-AGG-CAC-AGT-GC	64
avrBs2-F	GGA-CTA-GTC-CTG-CCG-GTG-TTG-ATG-CAC-GA	60,7	2118
avrBs2-R	CCG-CTC-GAG-CGG-TGA-TCG-GTC-AAC-AGG-CTT-TC	64,4
avrBs1-F	ATG-TCC-GAC-ATG-AAA-GTT-AAT-T	42,3	1338
avrBs1-R	TTA-CGC-TTC-TCC-TGC-ATT-TG	58
avrXccA1-F	ATG-CCC-AAC-GCA-TCG-CCT-GCA	53,1	813
avrXccA1-R	CGC-AGG-TCT-GCA-CCG-AAC-TCA-G	55,3
avrXccA2-F	GTG-CTG-GAG-AGT-GCC-G	54	1442
avrXccA2-R	TCA-TCG-GCA-GGG-TTG-TGG	58

Source : Hajri et al. (2012) Th: Hybridisation temperature; bp: Base pair

2.3.5. Amplification of TAL Effectors

The primers REP_FW (GAGTTGAGAGGTCCACCGTTAC) and REP_RV (GGGAAGACGGCGATTGGTTC) described by [8] were used to amplify the TAL effectors of Xcc strains. They are positioned in the conserved regions of the TALEs close to the repeats. PCR assays were performed using 50 μl of reaction mixture containing 1 μl of DNA at 20 ng/µl, 10 μl of 5X Buffer, 1 µl of dNTPs (10 mM), 0.5µl of betaine (100 mM), 0.32 µl of 10X GO Taq buffer (Promega) and 1.5 µl of each primer (10 mM). The PCR programme included DNA denaturation at 95 °C for 2 min, 25 cycles comprising DNA denaturation at 95 °C for 40 sec, hybridisation at 58 °C for 40 sec and extension at 72 °C for 8 sec. PCR products were migrated by electrophoresis in a 1 % agarose gel in TAE 1X (TRIS-acetate 40 mM, EDTA 1 mM) for 2 h at 70 Volt and stained with BET (2 µg. mL-1).

2.3.6. Analysis of Strain Structuring

To analyse the structure of the strains and determine the links between them, classification and correlation parameters were studied. These were the Hierarchical Ascending Classification (HAC) and the correlation matrix (PCA). The AHC was represented by a dendrogram. The parameters concerned were the years of collection of the strains, their geographical origins and their T3E repertoires.

Results

3.1. Strains Isolated

Based on the symptoms shown in Figure 2A, laboratory isolations showed strains with pale yellow colonies, circular in shape and mucous in appearance (Figure 2B).

The pathogenicity test on the strains enabled us to observe symptoms characteristic of Xcc on C. reticulata × C. paradisi. This confirms that all the strains are pathogenic.

Following surveys carried out during the 2020 and 2021 periods in citrus-growing areas in Burkina Faso, 17 strains were isolated, including 7 strains isolated in 2020 and 10 strains isolated in 2021. Twelve (12) strains were isolated to C. reticulata × C. paradisi, tree (3) strains to Citrus maxima and two (2) to Citrus limon. Most of the strains isolated come from the Houet locality. The small number of strains used is linked to the extreme difficulty encountered during isolation and also to the storage conditions during which many strains were lost.

Table 3. Characteristics of strains used.

Table 3. Characteristics of strains used.

Strain code	Host plant	Provence	Site	Year of collection
80	C. maxima	Bazega	Timboué	2020
81	C. limon	Ziro	Lou	2020
82	C. reticulata × C. paradisi	Houet	Kodéni	2020
83	C. reticulata × C. paradisi	Kénédougou	Orodara	2020
84	C. reticulata × C. paradisi	Houet	Bobo Dioulasso	2020
85	C. reticulata × C. paradisi	Houet	Kodéni	2020
86	C. reticulata × C. paradisi	Houet	Bobo Dioulasso	2020
92	C. maxima	Bazega	Dayasmeré	2021
94	C. reticulata × C. paradisi	Houet	Kodéni	2021
95	C. reticulata × C. paradisi	Houet	Kodéni	2021
98	C. reticulata × C. paradisi	Ziro	Lou	2021
99	C. maxima	Bazega	Lilbouré	2021
100	C. reticulata × C. paradisi	Bazega	Lilbouré	2021
102	C. reticulata × C. paradisi	Houet	Bobo Dioulasso	2021
104	C. limon	Houet	Kodéni	2021
106	C. reticulata × C. paradisi	Houet	Bobo Dioulasso	2021
107	C. reticulata × C. paradisi	Ziro	Lou	2021

3.2. Distribution of Non-TAL Type 3 Effectors in Xcc Strains

The distribution pattern of the 11 T3Es among the 48 Xcc strains is outlined in table 4. Broadly, strains isolated in 2020 and 2021 exhibit a more diverse range of T3E repertoires compared to those from 2012. Specifically, the genes XopX, XopQ, XopD, XopO, and AvrBS1 were absent in strains collected in 2012 but were present in those isolated in 2020 and 2021. Moreover, all 11 screened effectors were identified in three strains, including one from 2020 (Xcc85) and two from 2021 (Xcc102 and Xcc104). The distribution of T3Es within strains isolated in 2012 demonstrated a nearly uniform pattern.

The percentage representation of T3Es indicates a widespread presence of three effectors, namely XopE2, XopN, and AvrBs2, across the strains. Conversely, the least prevalent effectors are AvrBS1 (16.4 %), XopO (16.7 %), and XopX (18.7 %).

Table 4. Distribution of the 11 T3Es within Xcc strains.

Table 4. Distribution of the 11 T3Es within Xcc strains.

Strains Code	Type 3 effectors
	XopB	XopE2	XopN	XopX	XopQ	XopD	XopO	AvrxccA1	AvrxccA2	AvrBS1	AvrBs2
Strains isolated in 2020
Xcc80	+	+	+	-	+	-	-	+	-	-	+
Xcc81	-	+	+	-	+	-	-	+	-	-	+
Xcc82	+	+	+	-	+	-	-	+	-	-	+
Xcc83	+	+	+	-	+	-	-	+	-	-	+
Xcc84	+	+	+	+	+	+	+	+	+	-	+
Xcc85	+	+	+	+	+	+	+	+	+	+	+
Xcc86	+	+	+	+	+	+	-	+	+	+	+
Strains isolated in 2021
Xcc92	+	+	+	-	+	-	-	+	-	-	+
Xcc94	+	+	+	-		-	-	-	-	-	+
Xcc95	+	+	+	-	+	-	-	-	-	-	+
Xcc98	+	+	+	+	+	+	+	+	+	-	+
Xcc99	-	+	+	-	+	-	-	-	+	-	+
Xcc100	-	+	+	+	+	+	+	+	+	+	+
Xcc102	+	+	+	+	+	+	+	+	+	+	+
Xcc104	+	+	+	+	+	+	+	+	+	+	+
Xcc106	+	+	+	-	+	+	-	+	+	+	+
Xcc107	-	+	+	-	-	+	-	+	+	+	+
Strains isolated in 2022
Xcc864	+	+	+	-	-	-	-	+	+	-	+
Xcc865	+	+	+	-	-	-	-	+	+	-	+
Xcc866	+	+	+	-	-	-	-	+	+	-	+
Xcc867	+	+	+	-	-	-	-	-	-	-	+
Xcc868	+	+	+	-	-	-	-	+	+	-	+
Xcc869	+	+	+	-	-	-	-	+	+	-	+
Xcc870	+	+	+	-	-	-	-	+	+	-	+
Xcc871	+	+	+	-	-	-	-	+	+	-	+
Xcc872	+	+	+	-	-	-	-	+	+	-	+
Xcc873	+	+	+	-	-	-	-	+	+	-	+
Xcc874	+	+	+	-	-	-	-	+	+	-	+
Xcc875	+	+	+	-	-	-	-	+	+	-	+
Xcc876	+	+	+	-	-	-	-	+	+	-	+
Xcc877	+	+	+	-	-	-	-	+	+	-	+
Xcc878	+	+	+	-	-	-	-	+	+	-	+
Xcc879	+	+	+	-	-	-	-	+	+	-	+
Xcc880	+	+	+	-	-	-	-	+	+	-	+
Xcc881	+	+	+	-	-	-	-	+	+	-	+
Xcc882	+	+	+	-	-	-	-	+	+	-	+
Xcc883	+	+	+	-	-	-	-	+	+	-	+
Xcc884	+	+	+	-	-	-	-	+	+	-	+
Xcc885	+	+	+	-	-	-	-	+	+	-	+
Xcc886	+	+	+	-	-	-	-	+	+	-	+
Xcc887	+	+	+	-	-	-	-	+	+	-	+
Xcc888	+	+	+	-	-	-	-	+	+	-	+
Xcc889	+	+	+	-	-	-	-	+	+	-	+
Xcc890	+	+	+	-	-	-	-	+	+	-	+
Xcc891	+	+	+	-	-	-	-	+	+	-	+
Xcc895	+	+	+	-	-	-	-	+	+	-	+
Xcc896	+	+	+	-	-	-	-	+	+	-	+
Xcc897	+	+	+	-	-	-	-	+	+	-	+
Attendance percentage (%)
+	91,6	100	100	18,7	27,1	27,1	16,7	91,6	84,4	16,7	100

- : absent, + : Present.

3.5. Distribution of TALEs by Strain

The descriptive analysis of TALE distribution, as presented in table 4, highlights that TALEs B and C are universally distributed (100 %) and are common to all isolated Xcc strains. TALE A, on the other hand, was present in 68.7 % of the isolates.

Profile characterization reveals that out of the 48 tested Xcc strains, 37 strains exhibit Profile 1, while the remaining 11 strains display Profile 2. Among the 11 Profile 2, Xcc80 and Xcc84 strains, collected in 2020, Xcc92 and Xcc102 in 2021, and the remaining seven (Xcc871, Xcc879, Xcc881, Xcc882, Xcc887, Xcc896, Xcc897) in 2012.

Table 5. Distribution of TALEs by Xcc strain.

Table 5. Distribution of TALEs by Xcc strain.

Years	Strains	TALE			Profil
		A	B	C
2020	Xcc80	+	+	+	2
	Xcc81	-	+	+	1
	Xcc82	-	+	+	1
	Xcc83	-	+	+	1
	Xcc84	+	+	+	2
	Xcc85	-	+	+	1
	Xcc86	-	+	+	1
2021	Xcc92	+	+	+	2
	Xcc94	-	+	+	2
	Xcc95	-	+	+	1
	Xcc98	-	+	+	1
	Xcc99	-	+	+	1
	Xcc100	-	+	+	1
	Xcc102	+	+	+	1
	Xcc104	-	+	+	1
	Xcc106	-	+	+	1
	Xcc107	-	+	+	1
2012	Xcc864	-	+	+	1
	Xcc865	-	+	+	1
	Xcc866	-	+	+	1
	Xcc867	-	+	+	1
	Xcc868	-	+	+	1
	Xcc869	-	+	+	1
	Xcc870	-	+	+	1
	Xcc871	+	+	+	2
	Xcc872	-	+	+	1
	Xcc873	-	+	+	1
	Xcc874	-	+	+	1
	Xcc875	-	+	+	1
	Xcc876	-	+	+	1
	Xcc877	-	+	+	1
	Xcc878	-	+	+	1
	Xcc879	+	+	+	2
	Xcc880	-	+	+	1
	Xcc881	+	+	+	2
	Xcc882	+	+	+	2
	Xcc883	-	+	+	1
	Xcc884	-	+	+	1
	Xcc885	-	+	+	1
	Xcc886	-	+	+	1
	Xcc887	+	+	+	2
	Xcc888	-	+	+	1
	Xcc889	-	+	+	1
	Xcc890	-	+	+	1
	Xcc891	-	+	+	1
	Xcc895	-	+	+	1
	Xcc896	+	+	+	2
	Xcc897	+	+	+	2
Attendance percentage (%)
Present		68,7	100	100

3. Discussion

Conclusion

References

1. Ference, C. M.; Gochez, A. M.; Behlau, F.; Wang, N.; Graham, J. H.; Jones, J. B. Recent advances in the understanding of Xanthomonas citri ssp. citri pathogenesis and citrus canker disease management. Mol. Plant Pathol. 2018, 19, 1302–1318. [Google Scholar] [CrossRef] [PubMed]
2. Wang, N. The citrus hanglongbing crisis and potential solutions. Mol. Plant 2019, 12, 607–609. [Google Scholar] [CrossRef] [PubMed]
3. Juhasz, C. C.; Leduc, A.; Boyer, C.; Guérin, F.; Vernière, C.; Pruvost, O.; Wonni, I.; Ouedraogo, L. First report of Xanthomonas citri pv. citri Causing Asiatic Citrus Canker in Burkina Faso. Plant Dis. 2013, 97, 1653–1653. [Google Scholar] [CrossRef] [PubMed]
4. Zerbo, K. B. F.; Wonni, I.; Yameogo, F.; Somda, I. , Antibacterial activity of some substances against citrus bacterial canker caused by Xanthomonas citri pv. citri (Hasse) in Burkina Faso. Afr. J. Plant Sci. 2022, 16, 138–147. [Google Scholar]
5. Young, J. M.; Park, D.-C.; Shearman, H. M.; Fargier, E. A Multilocus Sequence Analysis of the Genus Xanthomonas. Syst. Appl. Microbiol. 2008, 31, 366–377. [Google Scholar] [CrossRef] [PubMed]
6. Pruvost, O.; Richard, D.; Boyer, K.; Javegny, S.; Boyer, C.; Chiroleu, F.; Grygiel, P.; Parvedy, E.; Robène, I.; Maillot-Lebon, V.; Hamza, A.; Lobin, K. K.; Naiken, M.; Vernière, C. Diversity and geographical structure of Xanthomonas citri pv. citri on Citrus in the South West Indian Ocean Region. Microorganisms 2021, 9. [Google Scholar] [CrossRef]
7. Bui Thi Ngoc, L.; Vernière, C.; Belasque, J.; Vital, K.; Boutry, S.; Gagnevin, L.; Pruvost, O. Ligation-Mediated PCR, a fast and reliable technique for insertion sequence-based typing of Xanthomonas citri pv. citri. FEMS Microbiol. Lett. 2008, 288, 33–39. [Google Scholar] [CrossRef]
8. 8. Aline Escalon. Evolution et spécialisation du pouvoir pathogène de Xanthomonas citri pv. citri : Rôle des effecteurs de Type 3. Agritop.
9. Kay, S.; Hahn, S.; Marois, E.; Wieduwild, R.; Bonas, U. Detailed analysis of the DNA recognition motifs of the Xanthomonas Type III Effectors AvrBs3 and AvrBs3Δrep16. Plant J. 2009, 59, 859–871. [Google Scholar] [CrossRef]
10. Da Silva, A. C. R.; Ferro, J. A.; Reinach, F. C.; Farah, C. S.; Furlan, L. R.; Quaggio, R. B.; Monteiro-Vitorello, C. B.; Sluys, M. A. V.; Almeida, N. F.; Alves, L. M. C.; Do Amaral, A. M.; Bertolini, M. C.; Camargo, L. E. A.; Camarotte, G.; Cannavan, F.; Cardozo, J.; Chambergo, F.; Ciapina, L. P.; Cicarelli, R. M. B.; Coutinho, L. L.; Cursino-Santos, J. R.; El-Dorry, H.; Faria, J. B.; Ferreira, A. J. S.; Ferreira, R. C. C.; Ferro, M. I. T.; Formighieri, E. F.; Franco, M. C.; Greggio, C. C.; Gruber, A.; Katsuyama, A. M.; Kishi, L. T.; Leite, R. P.; Lemos, E. G. M.; Lemos, M. V. F.; Locali, E. C.; Machado, M. A.; Madeira, A. M. B. N.; Martinez-Rossi, N. M.; Martins, E. C.; Meidanis, J.; Menck, C. F. M.; Miyaki, C. Y.; Moon, D. H.; Moreira, L. M.; Novo, M. T. M.; Okura, V. K.; Oliveira, M. C.; Oliveira, V. R.; Pereira, H. A.; Rossi, A.; Sena, J. A. D.; Silva, C.; De Souza, R. F.; Spinola, L. A. F.; Takita, M. A.; Tamura, R. E.; Teixeira, E. C.; Tezza, R. I. D.; Trindade Dos Santos, M.; Truffi, D.; Tsai, S. M.; White, F. F.; Setubal, J. C.; Kitajima, J. P. Comparison of the genomes of two Xanthomonas pathogens with differing host specificities. Nature 2002, 417, 459–463. [Google Scholar] [CrossRef] [PubMed]
11. Castiblanco, L. F.; Gil, J.; Rojas, A.; Osorio, D.; Gutiérrez, S.; Muñoz-Bodnar, A.; Perez-Quintero, A. L.; Koebnik, R.; Szurek, B.; López, C.; Restrepo, S.; Verdier, V.; Bernal, A. J. TALE 1 from Xanthomonas axonopodis pv. manihotis acts as a Transcriptional Activator in plant cells and is important for pathogenicity in cassava Plants. Mol. Plant Pathol. 2013, 14, 84–95. [Google Scholar] [CrossRef] [PubMed]
12. Boch, J.; Bonas, U.; Lahaye, T. TAL Effectors – pathogen strategies and plant resistance engineering. New Phytol. 2014, 204, 823–832. [Google Scholar] [CrossRef] [PubMed]
13. Leduc, A.; Traoré, Y. N.; Boyer, K.; Magne, M.; Grygiel, P.; Juhasz, C. C.; Boyer, C.; Guerin, F.; Wonni, I.; Ouedraogo, L.; Vernière, C.; Ravigné, V.; Pruvost, O. Bridgehead invasion of a monomorphic plant pathogenic bacterium: Xanthomonas citri pv. citri, an emerging citrus pathogen in Mali and Burkina Faso. Environ. Microbiol. 2015, 17, 4429–4442. [Google Scholar] [CrossRef] [PubMed]
14. Hajri, A.; Pothier, J. F.; Fischer-Le Saux, M.; Bonneau, S.; Poussier, S.; Boureau, T.; Duffy, B.; Manceau, C. Type three effector gene distribution and sequence analysis provide new insights into the pathogenicity of plant-pathogenic Xanthomonas arboricola. Appl. Environ. Microbiol. 2012, 78, 371–384. [Google Scholar] [CrossRef] [PubMed]
15. Escalon, A.; Javegny, S.; Vernière, C.; Noël, L. D.; Vital, K.; Poussier, S.; Hajri, A.; Boureau, T.; Pruvost, O.; Arlat, M.; Gagnevin, L. Variations in Type III Effector repertoires, pthological phenotypes and host range of Xanthomonas citri pv. citri pathotypes. Mol. Plant Pathol. 2013, 14, 483–496. [Google Scholar] [CrossRef] [PubMed]
16. Jaciani, F. J.; Ferro, J. A.; Ferro, M. I. T.; Vernière, C.; Pruvost, O.; Belasque, J. Genetic Diversity of a Brazilian strain collection of Xanthomonas citri subsp. citri based on the Type III Effector Protein Genes. Plant Dis. 2012, 96, 193–203. [Google Scholar] [CrossRef] [PubMed]
17. Schulze-Lefert, P.; Panstruga, R. A Molecular evolutionary concept connecting nonhost resistance, pathogen host range, and pathogen speciation. Trends Plant Sci. 2011, 16, 117–125. [Google Scholar] [CrossRef] [PubMed]