1. Introduction

2. Material and Methods

2.2. Experimental Design

Table 1. caption.

Table 1. caption.

Sl. No.	Groups	Treatment	No. of animals	Duration
1.	Control (CON)	Normal saline	06	21 days
2.	Dexamethasone (DEX)	70 µg/100 g body weights dexamethasone	06
3.	Dexamethasone (DEX) + Melatonin (MEL)	70 µg/100 g body weights DEX and 200µg/100g body weight MEL	06
4.	Melatonin (MEL)	200µg/100g body weight MEL	06

2.5. Parameters

2.5.1. q RT-PCR

Total RNA Extraction and reverse transcription

Sample Lyses and Phase Separation

To examine the expression of Mt1, Mt2, and AR genes in the testes were harvested and kept with RNA Later at 4⁰C overnight. Total RNA isolation was achieved by homogenization, and after phase separation, the upper layer containing RNA was collected. Precipitation and elution were performed to obtain pure RNA (SPINeasy^TMRNA Kit). The frozen tissue samples were homogenized using liquid nitrogen and transferred to a clean, nuclease-free 1.5 ml microcentrifuge tube. 1 ml Lysis Buffer R was added and mixed by vortexing then centrifuged at 14,000 × g for 5 min. Transfer lysate supernatant to a clean, nuclease-free 2 mL microcentrifuge tube. An equal volume of absolute ethanol was added (e.g., 750 μL ethanol to 750 μL Lysate supernatant) and mixed well by pipetting up and down. the mixture (750 μL) was transferred to column R with a collection tube. Centrifuged at 14,000 × g for 1 min. The above two steps were repeated to load the remaining mixture. A Wash Buffer of 500μl was added to the column. Centrifuged at 14,000 × g for 1 min. For DNase I digestion 1.5 ml of clean microcentrifuge tube was taken, and 5 μL of DNase I solution was added to 75 μL DNase I Buffer per preparation and mixed well then 80 μL was added to the center of the column membrane. At room temperature, it was incubated for 15 minutes. A Wash Buffer of 500μl was added to the column. Centrifuged at 14,000 × g for 1 min. Again, centrifuged at 14,000 × g for an additional 1 min to dry the column. The collection tube was removed and placed the column onto a clean 1.5 ml microcentrifuge tube. 100μl of Nuclease-free water was added to the center of the membrane. At room temperature, it was incubated for 1 min. Centrifuge at 8,000 × g for 1-2 min to elute RNA. Eluted RNA was collected in the microcentrifuge tube and pure RNA was obtained. The RNA concentration was assessed with a nanodrop at the A280/A260 wavelength. The purity of the RNA was confirmed by observing a ratio falling within the range of 1 to 2.

For the synthesis of full-length first-strand cDNA, cDNA synthesis was done by using a NeoScript 1^st strand cDNA synthesis Kit. So, the first step was RNA denaturation in which we made a total of 8 μL by adding Oligo-(dT), VN (50uM)- 1 μL, total RNA (10pg-5ug)- 3 μL and RNase free water- 4 μL. This was incubated at 65°C for 5min and then chilled on ice immediately for 2min. In step two RNase-free PCR tube was taken and the following components were mixed in a PCR tube by gentle pipetting. Mixture from step one- 8 μL, 2X RT mix 10 μL, and Neo Script 1st strand Enzyme mix 2 μL. In step 3 place in L18 Gradient Thermocycler PCR (TaKaRa PCR; Thermal Cycler Dice^TM Touch) for the 1^st strand cDNA synthesis and run for 25°C, 5min; 55°C 45min; 85°C, 5min. qPCR was done in the L18 Gradient Thermocycler (TaKaRa PCR; Thermal Cycler Dice^TM Touch) system using the master mix. Each reaction included 20 ng cDNA, 10pocomole of forward and reverse primers, and 2X Fast SYBR Green PCR Master Mix (TB Green Premix Ex Taq II, # RR820A). 10μl reaction volumes were used according as follows: Fast SYBR master mix (5 μL), nuclease-free water (3 μL), RT product (20 ng/μL-1 μL), F+R primer (10 pM-1) making a total volume of (10 μL).

A Tata MD CHECK Express real-time PCR machine was used for the running of the programme i.e. (95°C → 30sec), and 40 cycles (95°C → 5sec, 58°C → 30sec) followed by Melting curve 60⁰C to 99⁰C. For data analysis, MyGo pro-PCR software 3.6 was used for experimental setup and data analysis. Based on the threshold cycle of all the concerned genes including the reference gene the fold change in gene expression was calculated. The 2^-ΔΔCT method was applied to measure the fold change in all genes.

For the expression of MT1, MT2, and AR, q RT-PCR was done

Table 2. Sequence of AR, MT1, MT2, and GAPDH Primers used in q RT-PCR.

Table 2. Sequence of AR, MT1, MT2, and GAPDH Primers used in q RT-PCR.

Sl. No.	Primer	Forward & Reverse	5ꞌ – 3ꞌ sequence
1.	AR	Forward	AGGAACTTGATCGCATCATTGC
		Reverse	CTGCCATCATTTCAGGAA
2.	MT1	Forward	CAGTACGACCCCCGGATCTA
		Reverse	GGCAATCGTGTACGCCG
3.	MT2	Forward	ATGTTCGCAGTGTTTGTGGTTT
		Reverse	ACTGCAAGGCCAATACAGTTGA
4.	GAPDH	Forward	CCTCAAGATTGTCAGCAATG
		Reverse	CAGTCTTCTGAGTGGCAGTG

AR, Androgen receptor, MT, Melatonin receptor, GAPDH, Glyceraldehyde 3-phosphate dehydrogenase.

2.5.2. Hormonal Assay

The blood sample was drawn from the heart of anesthetized subjects using a 2mL syringe, followed by centrifugation for 15 min. at 3000 rpm. The resulting serum was carefully pipetted out from the tube. Levels of serum testosterone, corticosterone, LH, FSH, and melatonin in all experimental groups were calculated using the instructions provided in the respective commercial kits: CSB – 55-TESMS-E01, 55-CORMS-E01, 11-LUTHU-E01, 11-FSHHU-E01, 12-MNTL-96-U respectively.

2.5.3. Histological Preparation

The tissue samples testis was rinsed with saline, and fixed in Bouin's solution. To get rid of extra picric acid, they were put in a small container with running water for 24 hours after being left for 2 to 8 hours. Subsequently, the tissue was stored in 70% alcohol until needed. The testicle was halved vertically, embedded in paraffin wax, and cut into sections of 5 µm thickness. The wax was removed from these paraffin pieces using xylene before being rehydrated in ethanol. After that, they were mounted in DPX resin after being stained with hematoxylin and eosin (H&E). The sections were studied and photographed under a fluorescence microscope (Axioscope-5, Carl-Zeiss, Germany).

2.5.4. Single-Cell Gel Electrophoresis (Comet Assay)

The comet assay was done following the method of [18] with some modifications [19]. The testes of both control and experimental group rats were separated and immediately stored at −80°C for comet assays. After that, these samples were homogenized in a pH 7.5 cold buffer that contained 24 mM disodium ethylenediaminetetraacetic acid (Na2EDTA) at pH 13-, and 75-mM sodium chloride (NaCl) to make a 10% tissue solution. The testis samples were treated and stored on ice using a homogenizer. Six microliters of the homogenate were put on 0.5% low melting agarose, which was then layered on frosted slides between layers of 0.6% normal melting agarose and another layer of 0.5% low melting agarose. Throughout the gel layer polymerization process, the slides were maintained on ice. A lysis solution was submerged in the slides comprising 1% sodium sarcosine, 2.5 M NaCl, 100 mM Na2EDTA, 10 mM Tris-HCl, 1% Triton X-100, and 10% DMSO at 4°C after the 0.6% agarose layer hardened. To aid in DNA unwinding, the slides were placed in an electrophoresis buffer (0.3 M NaOH, 1 mM Na2EDTA, pH 13) for ten minutes after an hour had passed. After that, 10 minutes of electrophoresis and a supply of 24 volts were carried out. After that, the slides were stained with 20 mg/mL ethidium bromide after being neutralized with Tris-HCl solution at pH 7.5. For analysis, every slide was examined using a fluorescence microscope (Axioscope-5, Carl-Zeiss, Germany).

2.5.5. Biochemical Parameters

Lipid Peroxidation Assay

The lipid peroxidation assay was used to determine MDA levels [20]. The primary technique makes use of spectrophotometric analysis of the color produced by the interaction of thiobarbituric acid (TBA) with malondialdehyde (MDA), an outcome of lipid breakdown. To do this, 100 mg of tissues were homogenized in 1 mL of a pH 7.4 20 mM Tris-HCl buffer. Three milliliters of 1% phosphoric acid and one milliliter of 0.6% TBA were added to an equivalent volume of homogenate and BHT (250 µL). After 45 minutes of heating, the sample combination underwent 10 minutes of centrifugation at 1500 rpm. It was extruding the supernatant that allowed for the measurement of optical density at 535.

Analysis of Protein

The protein content of the testes tissue homogenates was determined using the [21] technique. Solution A: Mixture of Na₂CO₃ and Cu₂SO₄ (dissolved in distilled water respectively). Solution B: Sodium Potassium Tartrates (dissolved in distilled water). Solution C: Mixture of Solution A and Solution B (Freshly prepared).

Superoxide Dismutase (SOD) Assay

The antioxidant enzyme superoxide dismutase (SOD) is in charge of balancing the superoxide anion that the body produces. Following the methodology of Ohkhawa [22], the overall SOD activity was determined. The principle of the method is based on the Xanthine oxidase system’s inhibition of Nitroblue Tetrazolium (NBT) reduction as a source of superoxide. The tissue was homogenated with potassium buffer which has a pH of 7.4. The sample spun at 3500 rpm for 15 minutes. The supernatant was removed, and 1.2 mL of sodium pyrophosphate, 0.1 mL PMS, and 0.3 mL NBT were added to the sample solution. 0.2 mL of NADH and 1 mL of glacial acetic acid were also mixed in. At 560 nm, the absorption was then determined.

Estimation of Catalase (CAT) Activity

Beers and Sizer's method was used to quantify CAT activity [23]. The principle is based on determining the rate constant for hydrogen peroxide breakdown. By measuring the absorbance change per minute, the enzyme's rate constant has been found. The tissue was homogenated using phosphate buffer and followed by a 15-minute centrifugation at 3000 rpm. The supernatant was extracted. The mixture was mixed in the dark with 3 mL H₂O₂ and phosphate buffer. A 240 nm measurement was made for the absorbance.

Reduced Glutathione (GSH) Assay

Glutathione is a vital antioxidant that donates one of its electrons to reduce hydroperoxides. Glutathione activity was assessed using the Sedlak and Lindsay [24]. To start the enzymatic reaction of reduced glutathione, H₂O₂ was introduced. A mixture of 0.1 gm of tissue and 1 mL of sucrose was mixed, and then 1.5 mL of a 0.2 molar Tris-Buffer was incorporated into the sample. To this mixture, 0.1 mL of DTNB was added, and the volume was adjusted to 10 mL by the addition of methanol. The solution was left to incubate for 30 minutes and was subsequently centrifuged for 15 minutes at 3000 rpm. After centrifugation, 200 µL of the supernatant was extracted and at 412 nm, the absorbance was determined.

Glutathione Reductase (GR) Assay

Glutathione reductase activity was measured following Goldberg and Spooner's [25] protocol. The glutathione reductase enzyme catalyzes the following reaction: although the GR process is reversible, the strongly preferred result is the production of GSH. The measurement of catalytic activity involves following the oxidation of NADPH, which causes a drop in absorbance at 340 nm. A reaction mixture (1.5 mL of phosphate buffer, 0.3 mM), including 0.5 mL of EDTA, 0.2 mL of GSSG, and 0.1 mL of NADPH was added one after the other in a stepwise manner to 0.2 mL of tissue homogenate in a test tube. At 340 nm, OD was taken. Results were given in units/min/mg of protein.

Glutathione Peroxidase (GPX) Assay

The GPX was performed according to Paglia and Valentine [26]. H₂O₂ was exposed to a predefined quantity of enzyme preparation in the presence of GSH for a specified period. 0.4 mL of 0.4 M phosphate buffer and 0.2 mL of tissue homogenate were combined in a test tube, and tissue homogenate (0.2 mL) was mixed with 0.1 mL 2.5 mM H₂O₂, 0.2 mL GSH, and 0.4 mL 0.4 M phosphate buffer. After that, the homogenate received this mixture. Ten minutes were spent heating the reaction mixture to 37°C. Following the addition of 0.5 mL of 10% TCA to halt the reaction, the tubes were centrifuged at 2000 rpm. After centrifugation, the pellet was taken out of the mixture and the supernatant was transferred to another test tube. Following that, 1 mL of 0.04% DTNB and 0.3 mL of 0.3 mM disodium hydrogen phosphate were combined with this supernatant. At 420 nm, the absorption was taken. The glutathione oxidized nanomoles per milligram of protein were used to express the GPX activity (µmol/unit/mg protein). Protein results were given as units/min/mg.

Glutathione-6- Peroxidase (G6PDH) Assay

From the testes, the glucose 6-phosphate dehydrogenase was assessed using a modified Ellis and Kirkman [27] technique. The cells were homogenized and broken down to isolate this enzyme. This enzyme turns Glucose-6-phosphate into 6-phosphogluconate Along the way, the coenzyme NADP is converted into NADPH, which increases the rate of absorption at 340 nm. The reaction mixture contained 1.0 ml of tris buffer, 0.1 ml of magnesium chloride, 0.1 mL of NADP+, 0.5 ml of phenazine methosulfate, and 0.4 ml of a dye solution. The tissue was homogenized, and 3.3 mL of the supernatant was obtained and added. After adding 0.5 mL of glucose-6-phosphate, the reaction mixture was left to oxidize for 10 minutes at room temperature. After that, absorbance values at 640 nm were determined using a UV spectrometer at minute intervals throughout 3.5 minutes.

Glutathione- S-Transferase (GST) Assay

The procedure described by Habig [28] was used to measure the activity of glutathione-S-transferase (GST). The catalytic reaction of GST, GSH, and the GST substrate CDNB (1-chloro-2,4-dinitrobenzene) interact throughout this process. For CDNB and glutathione to interact, active GST must exist under certain conditions. Through the observation of variations in absorbance at 340 nm, the glutathione-S-transferase activity was identified. Phosphate buffer, 0.1 mL of GSH, 0.1 mL of CDNB, and 0.1 mL of each make up the entire reaction mixture. 100 µl of the sample was added to begin the reaction. Using distilled water as the blank for at least three minutes, the rate of absorbance at 340 nm was measured using a spectrophotometer (Perkin Elmer) every fifteen seconds. The tissue sample was utilized to look at nonspecific substrate binding whereas the test combination, which contained all the reagents, served as a reference. Unit/Min/Mg Protein was used to express the results.

3. Results

4. Discussion

5. Conclusions

Conflicts of Interest and Disclosure Statement

References

1. Galano A: Reiter, RJ. Melatonin and its metabolites vs oxidative stress: From individual actions to collective protection. Journal of Pineal Research. 2018 Aug;65(1):e12514.
2. Singh, M. and Jadhav, H.R., 2014. Melatonin: functions and ligands. Drug discovery today, 19(9), pp.1410-1418.
3. Tan DX, Manchester LC, Reiter RJ et al. Melatonin directly scavenges hydrogen peroxide: a potentially new metabolic pathway of melatonin biotransformation. Free Radic Biol Med 2000; 29:1177–1185.
4. Tan DX, Manchester LC, Terron MP et al. Melatonin as a naturally occurring co-substrate of quinone reductase-2, the putative melatonin membrane receptor: hypothesis and significance. J Pineal Res 2007; 43:317–320.
5. Kurutas EB, Senoglu M, Yuksel KZ, Unsal V, Altun I. Oxidative/nitrosative stress in patients with modic changes: preliminary controlled study. Spine. 2015 Jul 15;40(14):1101-7.
6. Saleh, S.R.; Manaa, A.; Sheta, E.; Ghareeb, D.A.; Abd-Elmonem, N.M. The Synergetic. Effect of Egyptian Portulaca oleracea L. (Purslane) and Cichorium intybus L. (Chicory) Extracts against Glucocorticoid-Induced Testicular Toxicity in Rats through Attenuation of Oxidative Reactions and Autophagy. Antioxidants 2022, 11, 1272. [Google Scholar] [CrossRef] [PubMed]
7. Ventimiglia, E.; Pozzi, E.; Capogrosso, P.; Boeri, L.; Alfano, M.; Cazzaniga, W.; Matloob, R.; Abbate, C.; Viganò, P.; Montorsi, F.; et al. Extensive Assessment of Underlying Etiological Factors in Primary Infertile Men Reduces the Proportion of Men With Idiopathic Infertility. Front. Endocrinol. 2021, 12, 801125 [PubMed]. [Google Scholar] [CrossRef]
8. Sharma, A. Male infertility; evidences, risk factors, causes, diagnosis and management in human. Ann. Clin. Lab. Res. 2017, 5, 188. [Google Scholar] [CrossRef]
9. Lettieri, G.; D’Agostino, G.; Mele, E.; Cardito, C.; Esposito, R.; Cimmino, A.; Giarra, A.; Trifuoggi, M.; Raimondo, S.; Notari, T.; et al. Discovery of the Involvement in DNA Oxidative Damage of Human Sperm Nuclear Basic Proteins of Healthy Young Men Living in Polluted Areas. Int. J. Mol. Sci. 2020, 21, 4198. [Google Scholar] [CrossRef] [PubMed]
10. Orazizadeh, M.; Khorsandi, L.; Hashemitabar, M. Toxic effects of dexamethasone on mouse testicular germ cells. Andrologia 2010, 42, 247–253. [Google Scholar] [CrossRef] [PubMed]
11. Hanafy AM, Khalil HA. Influence of Chronic Dexamethasone Administration on Reproductive Parameters and Semen Traits in Male of Japanese Quail. Asian J Poultry Sci. 2015;9(4):223-232. [CrossRef]
12. Sadi-Guettaf, H.; Bekkouche, F.H. Dexamethasone: Impact on testicular activity. Int. J. Med. Health Sci. 2014, 8, 759–762. [Google Scholar]
13. Buckingham, JC. Glucocorticoids: exemplars of multi-tasking. British journal of pharmacology. 2006; 147(S1):S258-S68.
14. Hashemitabar M, Orazizadeh M, Khorsandi L. Effect of Dexamethasone on Fas Ligand Expression in Mouse Testicular Germ Cells. ZUMS Journal. 2008;16(62):17-26.
15. Danek, J. , 2008. Effect of dexamethasone on the changes of semen quality induced by endotoxin in stallion. Bulletin of the Veterinary Institute in Puawy, 52, 581–589.
16. Gametchu B, Watson CS. Correlation of membrane glucocorticoid receptor levels with glucocorticoid-induced apoptotic competence using mutant leukemic and lymphoma cells lines. Journal of cellular biochemistry. 2002;87(2):133-46.
17. Chang CS, Chen YT, Yeh SD, Xu QQ, Wang RS, Guillou F (2004) Infertility with defective spermatogenesis and hypotestosteronemia in male mice lacking the androgen receptor in Sertoli cells. Proc Natl Acad Sci 101:6876–6881.
18. Tice RR, Agurell E, Anderson D, Burlinson B, Hartmann A, Kobayashi H, Miyamae Y, Rojas E, Ryu JC, Sasaki YF. Single cell gel/comet assay: guidelines for in vitro and in vivo genetic toxicology testing. Environ Mol Mutagen 2000; 35: 206-221.
19. Singh NP, McCoy MT, Tice RR, Schneider EL. A simple technique for quantitation of low levels of DNA damage in individual cells. Exp Cell Res 1988; 175(1):184-191.
20. H. Ohkawa, N. H. Ohkawa, N. Ohishi, K. Yagi, Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem. 95 (1979) 351-358.
21. Lowry, N.J. Rosebrough, AL. Farr, J. Rose, Randall, Protein measurement with the Folin phenol reagent, J. Biol. Chem. 193 (1951) 265-275.
22. P. Kakkar, B. P. Kakkar, B. Das, P.N.Viswanathan, A modified spectrophotometric assay of superoxide dismutase. Indian J. Biochem. Biophys. 21 (1983) 192-205.
23. R.F. Beers, I.W. R.F. Beers, I.W. Sizer, A spectrophotometric method for measuring the breakdown of hydrogen peroxide by catalase, J, Biol. Chem. 195 (1952) 133-140.
24. Sedlak J, Lindsay RH. Estimation of total, protein-bound, and nonprotein sulfhydryl groups in tissue with Ellman's reagent. Anal Biochem. 1968; 25:192-205. [CrossRef]
25. Goldberg, D. M. (1984). Glutathione reductase. Methods of enzymatic analysis, 3, 258-265.
26. Paglia, D. E., & Valentine, W. N. (1967). Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase. The Journal of laboratory and clinical medicine, 70(1), 158-169.
27. H.A. Ells, H.N. H.A. Ells, H.N. Kirkman, A colorimetric method for assay of erythrocytic glucose-6-phosphate dehydrogenase. Proc. Soc. Exp. Biol. Med. 106 (1961) 607-609.
28. Habig, W. H. , Pabst, M. J., & Jakoby, W. B. (1974). Glutathione S-transferases: the first enzymatic step in mercapturic acid formation. Journal of biological Chemistry, 249(22), 7130-7139.
29. <b>29. </b>H. Jia, T. H. Jia, T. Yamashita, X. Li, H. Kato, Laurel attenuates dexamethasone-induced skeletal muscle atrophy in vitro and in a rat model, Nutrients 14 (2022) 2029.
30. S.P. Kamani, J.K. S.P. Kamani, J.K. Waguia, D. Miaffo, M. Nchouwet, C.D. Kadji, M.W. Kamgaing, R. D. Djimeli, J.M. Ngnitedem, A. Kamanyi, S.W. Ngnokam, Efficacy of Emilia coccinea aqueous extract on inhibition of α-amylase enzyme activity and insulin resistance in dexamethasone treated-rats, Metab. Open (2022), 100193.
31. Santos CL, Rafacho A, Bosqueiro JR (2007) Efeitos da administração de dexametasona in vivo sobre glicemia, insulinemia e substrates circulantes são dependentes do tempo de tratamento. Biosci J 23(3):101–110.
32. Rafacho A, Giozzet VA, Boschero AC, Bosqueiro JR (2008) Functional alterations in endocrine pancreas of rats with diVerent degrees of dexamethasone-induced insulin resistance. Pancreas 36(3):284–293.
33. V.S. Kumar, M.N. V.S. Kumar, M.N. Inamdar, G.L. Viswanatha, Protective effect of lemongrass oil against dexamethasone induced hyperlipidemia in rats: possible role of decreased lecithin cholesterol acetyl transferase activity, Asian Pac. J. Trop. Med. 4 (2012) 658–660.
34. Hasona, N.A. , 2018. Grape seed extract attenuates dexamethasone-induced testicular and thyroid dysfunction in male albino rats. Andrologia, 50(5), p.e13002.
35. Khorsandi L, Mirhoseini M, Mohamadpour M, Orazizadeh M, Khaghani S. Effect of curcumin on dexamethasone induced testicular toxicity in mice. Pharm Biol. 2013;51(2):206-212. [CrossRef]
36. Nkono, B. L. N. Y., Sokeng, S. D., Désiré, D. D. P., & Kamtchouing, P. (2014). Antihyperglycemic and antioxydant properties of alstonia boonei De wild. (Apocynaceae) stem bark aqueous extract in dexamethasone-induced hyperglycemic rats. Int. J. Diabetes Res, 3(3), 27-35.
37. Patel, S. , & Rai, S. (2023). Glucocorticoid-Induced Dose-Dependent Reproductive Impairments in Male Albino Rat. Journal of Endocrinology and Reproduction, 27(2), 99–108. [CrossRef]
38. Gao HB, Tong MH, Hu YQ, et al. Mechanisms of glucocorticoid-induced Leydig cell apoptosis. Mol Cell Endocrinol. 2003;199(1-2):153-163. [CrossRef]
39. Ing, N. H., Brinsko, S. P., Curley, K. O., Forrest, D. W., Love, C. C., Hinrichs, K., … Welsh, T. H. (2015). Dexamethasone acutely regulates endocrine parameters in stallions and subsequently affects gene expression in testicular germ cells. Animal Reproduction Science, 152, 47–54. [CrossRef] [PubMed]
40. Chen, Y., Wang, Q., Wang, F. F., Gao, H. B., & Zhang, P. (2012). Stress induces glucocorticoid-mediated apoptosis of rat Leydig cells in vivo. Stress, 15, 74–84.
41. Jeje SO, Akindele OO, Balogun ME, Raji Y. Maternal treatment with dexamethasone during lactation delays male puberty and disrupts reproductive functions via hypothalamic-pituitary-gonadal axis alterations. Pathophysiology. 2016;23(1):43-49.
42. Yun, H. J., Ji-Yeon, L., & Myoung, H. K. (2016). Prenatal exposure to dexamethasone disturbs sex-determining gene expression and fetal testosterone production in male embryos. Biochemical and Biophysical Research Communications, 471, 149–155.
43. Hu GX, Lian QQ, Lin H, et al. Rapid mechanisms of glucocorticoid signaling in the Leydig cell. Steroids 2008; 73(9–10): 1018–1024.
44. Arab Dolatabadi A, Rezaei Zarchii S. The effect of prescription of different Dexamethasone doses on reproductive system. Biomed Res. 2015;26(4):656-660.
45. Mohamadpour M, Mollajani R, Sarabandi F, Hosseini F, Mohsenkia M, Erfanizadeh M, Soleimani A, Kargar E, Mosallaei H, Yavarahmadi M. Protective effect of grape seed extract on dexamethasone-induced testicular toxicity in mice. Crescent Journal of Medical and Biological Sciences. 2020;7(1):59-65.
46. Wang FF, Wang Q, Chen Y, Lin Q, Gao HB, Zhang P. Chronic stress induces ageing-associated degeneration in rat Leydig cells. Asian J Androl. 2012;14(4):643-648. [CrossRef]
47. Sadeghzadeh, F.; Mehranjani, M.S.; Mahmoodi, M. Vitamin C ameliorates the adverse effects of dexamethasone on sperm motility, testosterone level, and spermatogenesis indexes in mice. Hum. Exp. Toxicol. 2019, 38, 409–418. [Google Scholar] [CrossRef] [PubMed]
48. El-Sokkary GH, Abdel-Rahman GH, Kamel ES (2005) Melatonin protects against lead-induced hepatic and renal toxicity in male rats. Toxicology 213: 25–33.
49. Kumi-Diaka J, Townsend J. Effects of genistein isoflavone (4′, 5′, 7-trihydroxyisoflavone) and dexamethasone on functional characteristics of spermatozoa. J Med Food. 2001;4(1):39-47. [CrossRef]
50. Mukherjee A, Haldar C, Vishwas DK. Melatonin prevents dexamethasone-induced testicular oxidative stress and germ cell apoptosis in golden hamster, M esocricetus auratus. Andrologia. 2015 Oct;47(8):920-31.
51. Tang HY, Ho HY, Wu PR, Chen SH, Kuypers FA, Cheng ML, Chiu DT. Inability to maintain GSH pool in G6PD-deficient red cells causes futile AMPK activation and irreversible metabolic disturbance. Antioxid Redox Signal. 2015 Mar 20;22(9):744-59. [CrossRef] [PubMed]
52. Rizk SM, Zaki HF, Mina MA. Propolis attenuates doxorubicin-induced testicular toxicity in rats. Food and chemical toxicology. 2014 May 1;67:176-86.
53. Othman AI, Edrees GM, El-Missiry MA, Ali DA, Aboel-Nour M, Dabdoub BR. Melatonin controlled apoptosis and protected the testes and sperm quality against bisphenol A-induced oxidative toxicity. Toxicology and Industrial Health. 2016 Sep;32(9):1537-49.
54. Reiter RJ, Tan DX, Osuna C, et al. (2000) Actions of melatonin in the reduction of oxidative stress. Journal of Biomedical Science 7: 444–458.
55. Zhu LJ, Hardy MP, Inigo IV, Huhtaniemi I, Bardin CW, Moo-Young AJ (2000) Effects of androgen-on-androgen receptor expression in rat testicular and epididymal cells: a quantitative immunohistochemical study. Biol Reprod 63:368–376.
56. Wang L, Su DZ, Wang WS (1994) Studies on the aluminum content in wheat flour products. Biomed Environ Sci 7(1):91–99.
57. Blok LJ, Themmen AP, Peters AH, Trapman J, Baarends WM, Hoogerbrugge JW, Grootegoed JA (1992) Transcriptional regulation of androgen receptor gene expression in Sertoli cells and other cell types. Mol Cell Endocrinol 88:153–164.
58. Sun H, Hu C, Jia L, Zhu Y, Zhao H, Shao B, Wang N, Zhang Z, Li Y. Effects of aluminum exposure on serum sex hormones and androgen receptor expression in male rats. Biological trace element research. 2011 Dec;144:1050-8.
59. Dubocovich ML, Markowska M. Functional MT 1 and MT 2 melatonin receptors in mammals. Endocrine. 2005 Jul;27:101-10.
60. Izzo, G.; Francesco, A.; Ferrara, D.; Campitiello, M.R.; Serino, I.; Minucci, S.; d’Istria, M. Expression of melatonin (MT1, MT2) and melatonin-related receptors in the adult rat testes and during development. Zygote 2010, 3, 257–264 [CrossRef] [PubMed]. [Google Scholar] [CrossRef] [PubMed]
61. Rocha, C.S.; Martins, A.D.; Rato, L.; Silva, B.M.; Oliveira, P.F.; Alves, M.G. Melatonin alters the glycolytic profile of Sertoli cells: Implications for male fertility. Mol. Hum. Reprod. 2014, 20, 1067–1076. [Google Scholar] [CrossRef] [PubMed]
62. McLachlan, R.I.; Wreford, N.G.; O’Donnell, L.; de Kretser, D.M.; Robertson, D.M. The endocrine regulation of spermatogenesis: Independent roles for testosterone and FSH. J. Endocrinol. 1996, 148, 1–9. [Google Scholar] [CrossRef] [PubMed]
63. Heindel, J.J.; Jackson, F.L.; Berkowitz, A.S. Role of the pineal in the alteration of hamster Sertoli cell responsiveness to FSH during testicular regression. J. Androl. 1984, 5, 211–215 [PubMed]. [Google Scholar] [CrossRef] [PubMed]
64. Zhang H, Zhang Y. Melatonin: a well-documented antioxidant with conditional pro-oxidant actions. Pineal Res 2014; 57: 131-146.
65. Gupta S, Haldar C. Nycthemeral variation in melatonin receptor expression in the lymphoid organs of a tropical seasonal breeder Funambulus pennanti. Journal of Comparative Physiology A. 2014 Dec; 200:1045-55.