Prerpints.org logo
Preprint
Article

Detection of Plasmid-Mediated Resistance against Colistin in Multi-Resistant Gram-Negative Bacilli Isolated from a Tertiary Hospital

Altmetrics

Downloads

114

Views

63

Comments

0

A peer-reviewed article of this preprint also exists.

Submitted:

03 July 2023

Posted:

03 July 2023

You are already at the latest version

Alerts
Abstract
The main aim of this study was to determine the prevalence of plasmid-mediated colistin resistance mcr-1 to mcr-5 genes among colistin and multi-drug resistant Enterobacterales, Pseudomonas aeruginosa and Acinetobacter sp strains isolated from patients in a tertiary hospital in the city of Toluca, Mexico. 241 strains were included in the study. The presence of mcr genes among these strains was assessed by PCR and sequencing. In the case of mcr-carrying E. coli, further PCR tests were performed to determine the presence of blaCTX-M and whether the strains belonged to the O25b-ST131 clone. Conjugation experiments were carried to assess plasmid-mediated colistin resistance horizontal transmission. 12 strains (5.0%), of which four were E. coli; four, P. aeruginosa; three, K. pneumoniae and one, E. cloacae, were found to be resistant to colistin. Of these strains, two E. coli isolates were found to carry mcr-1. Both mcr-1-carrying E. coli strains were found to co-express blaCTX-M, belong to the O25b-ST131 clone and horizontally transmit their colistin resistance. The results of this study confirm the presence of plasmid-mediated colistin resistance in hospitalized patients in Mexico and demonstrated that the multidrug-resistant O25b-ST131 E. coli clone can acquire mcr genes and transmit such resistance trait to other bacteria.
Keywords: 
Subject: Medicine and Pharmacology  -   Epidemiology and Infectious Diseases

1. Introduction

The use of antibiotics in humans and animals represents the cornerstone of modern medicine. Since their discovery, antibiotics have revolutionized the treatment of bacterial infections around the world. However, bacteria have evolved mechanisms to become resistant to these agents, and a steady increase in this phenomenon has made antimicrobial resistance one of the major health problems affecting humankind.
In the case of Gram-negative bacteria, infections caused by multi-drug resistant-Enterobacterales, Pseudomonas aeruginosa and Acinetobacter sp, are on the rise [1]. This reality has led to the use of old antibiotics, such as colistin, as a last-resort antimicrobial against these pathogens. Colistin, a polypeptide antibiotic also known as polymyxin E, was discovered in 1949 and was largely used in the 1950s; however, due to its neuro- and nephro-toxicity, it was abandoned in the 1980s in favor of other antibiotics [2]. Colistin exerts its antibacterial activity against Gram-negative organisms by electrostatically binding the negatively charged phosphate groups of lipid A in the bacterial lipopolysaccharide (LPS), disrupting the integrity of the bacterial membrane [3].
Currently, antibiotic resistance against colistin is not as worrisome as that against other antimicrobials; however, due to the overuse and misuse of this antibiotic among humans and animals, colistin resistance is on the rise, as described in several reports from different nations [4,5,6]. Resistance against this agent is attributed to the modification of LPS, through cationic substitutions, which reduces the net negative charge of this molecule, impeding the binding of the antibiotic [7]. Colistin resistance was originally described as being chromosomally encoded; however, in 2015, Liu et al described the first plasmid-mediated resistant gene against this antibiotic, mcr-1, in E. coli [8]. Shortly after its discovery, mcr-1 was identified in over 20 different countries and, to date, nine additional mcr-like genes have been described [9]. Furthermore, mcr genes have also been identified in Pseudomonas aeruginosa and Acinetobacter sp [10,11].
With the global spread of mcr genes among multi-drug resistant bacterial strains and their further horizontal transmission among bacteria, the effectiveness of colistin is under serious jeopardy. An additional factor that might facilitate the spread of colistin resistance is the likelihood of acquiring this plasmid-mediated resistant trait in multi-resistant E. coli clones such as O25b-ST131, the most common multidrug-resistant high-risk clone associated with extra-intestinal E. coli infections around the world [12]. This clone commonly carries resistance genes to antibiotics frequently prescribed in general practice, such as cephalosporins, which are mainly mediated by the blaCTX-M gene, as well as quinolones, and can easily be transmitted through the consumption of food [13]. These antibiotics can co-select for colistin-resistant strains and, thus, contribute to the spread of resistance against this agent. ST131 E. coli clones carrying colistin resistance genes have already been reported in environmental and clinical samples [14,15].
As the surveillance of antibiotic resistance and research is a key component of the global action plan against antimicrobial resistance [16], the purpose of the current study was to determine the prevalence of the plasmid-mediated colistin resistance genes mcr -1 to mcr -5 among colistin and multi-drug resistant Enterobacterales, Pseudomonas aeruginosa and Acinetobacter sp strains isolated from patients in a tertiary hospital in the city of Toluca, Mexico. Additionally, we sought to assess whether plasmid-mediated colistin-resistant E. coli strains isolated from these patients belonged to the ST131 clone and co-expressed blaCTX-M genes.

2. Materials and Methods

This was a prospective study conducted between May and October 2022 in coordination with the Microbiology laboratory from Centro Médico ISSEMYM Toluca, Mexico. Strains included in this research were isolated from cultures obtained by the clinical laboratory of the hospital as part of routine care for hospitalized patients, as instructed by their physician. No additional specimens were obtained for the purposes of this study and no personal information was obtained from patients; therefore, informed consent was not required.

2.1. Bacterial strains, culture, identification and microbial susceptibility testing

Biological samples were plated on blood agar and MacConkey agars and cultured at 35 ± 2 °C for 18 hours. Strains growing on the latter medium were further identified using standard microbiological techniques and the VITEK Compact System (bioMerieux, Marcy l’E´toile, France). Only strains that belonged to the order Enterobacterales or the genus Pseudomonas aeruginosa or Acinetobacter spp were included in the study.
Minimum inhibitory concentrations (MIC) of different antibiotics against strains included in the study were determined using the VITEK Compact System (bioMerieux, Marcy l’E´toile, France) and compared to Clinical and Laboratory Standard Institute (CLSI) guidelines [17]. Only strains that fulfilled the multidrug-resistance (MDR), extensively drug-resistant (XDR) or pandrug-resistant criteria (PDR) established by Magiorakos et al [18] were included for further testing. MDR, XDR and PDR strains were initially tested for colistin resistance by the colistin broth disk elution test described by Simner et al [19]. The MIC of the strains determined to be resistant by this method (≥ 4 µg/mL) were further measured in duplicate using the micro broth dilution method according to CLSI guidelines [17] and only those confirmed to be colistin-resistant (MIC ≥ 4 µg/mL) were included in the study.

2.2. PCR amplification

DNA was extracted using the boil lysis method, and extracted DNA was tested via PCR for plasmid-encoded mcr -1 to mcr -5 genes using primers described in Table 1. Amplified PCR products were sequenced in both directions and nucleotide sequences were compared against the National Center for Biotechnology Information BLAST database [20]. In the case of colistin-resistant E. coli strains carrying mcr genes, the presence of the O25b-ST131 clone and blaCTX-M genes was determined using previously described PCR primers (Table 1).

2.3. Conjugation experiments

Conjugation experiments were carried out using E. coli J53, a sodium azide resistant strain, as the recipient organism, following the broth-mating method. Transconjugants were selected on Mueller Hinton agar plates containing 100 mg/mL sodium azide and 4 µg/mL of colistin. The presence of mcr genes in transconjugants was assessed via antimicrobial susceptibility testing using the micro broth dilution method, as suggested by CLSI [17], as well as PCR. The transmission of the blaCTX-M gene to transconjugants was confirmed by PCR, and its ESBL phenotype, by the CLSI confirmatory method [17].
For all experiments, a previously identified E.coli strain isolated from a swine farm, resistant to colistin carrying mcr-1 gene was included as a positive control [25].

3. Results

3.1. Colistin resistance

In total, 241 isolates of MDR, XDR and PDR strains of Enterobacterales, P. aeruginosa and Acinetobacter sp were collected at the clinical laboratory from Centro Médico ISSEMYM Toluca and included in this study. The number of isolates per each bacterial species identified is shown in Figure 1.
Among the 241 multi-drug resistant strains included in the study, 12 (5.0%) were found by the micro broth dilution method to be resistant against colistin (MIC ≥ 4 µg/mL) and included E. coli (N=4), P. aeruginosa (N=4), K. pneumoniae (N=3) and E. cloacae (N=1). The colistin MIC of these 12 strains and their isolation sites are shown in Table 2.
The antibiotic resistance profiles of the 12 strains found to be resistant to colistin against commonly used antibiotics and their respective classification as MDR, XDR or PDR are depicted in Table 3.

3.2. mcr prevalence

Of all 12 strains resistant to colistin, the multiplex PCR protocol amplified one fragment of approximately 320 bp in two E. coli isolates (2207 and 5891) and in the control strain, suggesting the presence of the mcr -1 gene. Sequencing in both directions of these amplicons confirmed that both strains carry this gene. PCR targeting was negative on all strains for the mcr -2 to – 5 genes. Both mcr -1-carrying E.coli strains were shown to be ESBL producers carrying the blaCTX-M gene and belonging to the O25b-ST131 clone.

3.3. Conjugation experiments

Conjugation experiments were conducted on strains 2207 and 5891, with both isolates transmitting the mcr -1 plasmid-mediated colistin resistance trait to the recipient J53 E. coli strain. The two parental strains also transmitted their blaCTX-M gene. Both transconjugants were shown to be PCR positive for the mcr -1 gene and blaCTX-M genes of the donor bacterial cell and confirmed to be ESBL producers by the CLSI confirmatory test [17] as well de novo resistant to colistin, as assessed by the micro broth dilution method (≥4 ug/mL). The strain 2207 transconjugant presented an identical MIC to that of the parental strain, while the 5891 transconjugant presented a one-two fold higher MIC.

4. Discussion

Due to the increasing rates of resistance among Gram-negative bacilli against commonly used antibiotics, mainly in bacterial strains isolated form hospitalized patients, colistin has emerged as one of the last-resort antimicrobials in the treatment of these infections. Unfortunately, resistance against this agent is on the rise, particularly in Asia, which is mainly attributed to its overuse in veterinary medicine [26].
One of the main objectives of the current study was to determine the prevalence of colistin resistance among multi-resistant Enterobacterales, P. aeruginosa and Acinetobacter sp strains isolated from patients in a tertiary hospital in Mexico. In total, 241 strains were included in the study, of which 12 (5.0%) were found to be resistant to colistin according to the CLSI guidelines. Of the 12 colistin-resistant strains, 4 were P. aeruginosa, with a colistin-resistance prevalence of 7.5%, (4/53); 4 were E. coli, with a prevalence of 2.5% (4/162); 3 were K. pneumoniae, with a prevalence of 15.0% (3/20) and one, E. cloacae, with a prevalence of 50.0% (1/2). Although K. pneumoniae presented one of the highest prevalence levels of colistin resistance, no PDR strains were found, unlike P. aeruginosa, for which one strain was found to be resistant to all tested antibiotics. In this study, no Acinetobacter sp isolates were found to be colistin-resistant.
The antibiotic resistance profiles of the colistin-resistant strains found in this study are shown in Table 3. As all 241 strains included in the current study were multi-resistant isolates, antibiotic resistance to different types among them was high. In the case of P. aeruginosa, colistin-resistant strains presented an extremely high prevalence of resistance against carbapenems (100%), ceftazidime (100%), ciprofloxacin (100%) and amikacin (100%) and low resistance to tigecycline (25%). For Enterobacterales, higher rates of resistance were found against ciprofloxacin (100.0%), trimethoprim/sulfamethoxazole (87.5%), cephalosporines (62.5%), and ceftazidime (62.0%); no resistance was found against amikacin. Finally, resistance against at least one of the carbapenems was found in one E. coli (1/4) and one K. pneumoniae (1/3) strain.
The prevalence of colistin resistance in this study is in agreement with reports in different geographical areas of the world among muti-resistant strains isolated from hospitalized patients [10,27,28], but higher than the 1.26% worldwide prevalence reported by Dadashi et al [29]. In Mexico, reports on the prevalence of colistin-resistant strains are scarce; however, in a recent report by the Red Temática de Investigación y Vigilancia de la Farmacorresistencia (INVIFAR network), that included clinical strains isolated from different parts of the country, the colistin resistance prevalence among K. pneumoniae strains was 17.8% [30], a rate similar to that found in the current study among isolates of this bacterial species (3/20 = 15.0%). Unlike the INVIFAR report, where no resistance to colistin was found among E. coli strains, we found that 2.5% of E. coli strains included in the current study presented this resistance trait. These results confirm that colistin resistance among clinical isolates in our country is already a reality and should be carefully monitored.
As the world has witnessed an increase in resistance against colistin, this phenomenon has been mainly attributed to the emergence and dissemination of plasmid-mediated (mcr -1 to 10) genes among bacteria. The first mcr gene (mcr -1) was originally described in 2015 in China [8], and in Mexico, mcr -1 was first identified in 2019 in an E. coli strain isolated from a fecal sample from a child [31]. The presence of this plasmid-mediated gene in our country was recently confirmed in K. pneumoniae strains isolated from different clinical samples [30]. In the present study, only two E. coli strains, both isolated from female patients with urinary tract infections that required hospitalization, were found to carry the mcr -1 gene. No other mcr gene was found in the strains analyzed and no other bacterial species in addition to E. coli were found to carry plasmid-mediated colistin resistance genes. In this study, plasmid-mediated colistin resistance genes were not found in P. aeruginosa. However, as colistin is the last-resource antibiotic against strains of this organism resistant to carbapenems, reports of mcr genes among multi-resistant strains of this species have started to emerged [32,33] and horizontal transmission of mcr -1 genes has been shown to occur from P. aeruginosa to other bacterial species [34], the surveillance of mcr -carrying P. aeruginosa strains remains highly encouraged.
The relatively low prevalence of mcr genes among colistin-resistant Gram-negative bacteria found in this study (16.7%) is higher to the values reported for E.coli in Egypt (7.5%) [35] and similar to those described in Ecuador (20.0%) [36], but lower than the prevalence shown in a study in Nepal [37] and Peru [38], where the prevalence of strains that serve as carriers of mcr genes was reported to be high among colistin-resistant E. coli and K. pneumoniae. The results of the current research confirm the fact that plasmid-mediated colistin resistance has spread at different rates among different geographical areas of the world. It is also important to note that in this study, mcr genes were searched for in colistin-resistant strains and only multi-resistant isolates were included, but different studies have shown that colistin susceptible Enterobacterales can carry mcr genes [39,40]. Thus, the prevalence of mcr -carrying strains at the Microbiology laboratory from Centro Médico ISSEMYM Toluca, Mexico, could be higher than the levels indicated by the results in this study. The low prevalence of mcr genes found in this investigation among colistin-resistant strains suggest that in our population, resistance to this agent is mainly driven by chromosomal mutations or plasmid-mediated genes not included in the study. Further research is needed to understand additional mechanisms of colistin resistance to those identified in the current study.
Several reports have shown that Gram-negative bacilli can co-harbor mcr genes and other plasmid-mediated antibiotic resistance traits such as those encoding for carbapenemase and ESBL production. Since colistin is mainly indicated as a last-resource antibiotic, the co-expression of colistin and carbapenemase resistance is worrisome among the medical community and, understandably, has been more thoroughly studied and more commonly demonstrated among Enterobacterales [30,41] than its co-expression with extended-spectrum-β-lactamases. However, bacterial strains co-harboring mcr and ESBL genes should also be carefully monitored. In addition to encode for intrinsic resistance against cephalosporines, penicillins and monobactams, plasmids carrying ESBL-encoding genes, can also harbor resistance genes against other commonly used antibiotics such as ciprofloxacin, trimethoprim/sulfametoxazol and aminoglycosides [42]. When administered, any of these antibiotics could co-select for colistin-resistant strains and contribute to the spread of resistance against this antimicrobial. In the present study, the two mcr-1-carrying E.coli strains were additionally found to carry blaCTX-M genes, a phenomenon that has also been demonstrated in human isolates in Qatar [43], Peru [44] and the Indian Ocean Commission [45], showing that the co-expression of plasmid-mediated resistance against colistin and ESBL production has spread to different regions of the world.
In the current study, both mcr-1- and CTXM-carrying E. coli strains were able to horizontally transmit their colistin resistance and ESBL production to the recipient strain, suggesting that conjugation may play a role in the spread of colistin resistance. In this study, only a minority of colistin-resistant isolates were found to carry mcr genes and in the two mcr-1-carrying strains no carbapenem resistance was detected, leaving other therapeutic options available for the treatment of infections caused by these strains. However, as different studies have shown that the horizontal transmission of mcr-1 genes occurs in food [46] and animals [47], this mechanism might be responsible around the globe for the steady increase in colistin resistance among Gram-negative bacilli.
The highly antibiotic resistant clone ST131, predominantly serogroup O25b, is considered the dominant extraintestinal pathogenic E. coli around the world, including being a frequent cause of urinary tract infections [12,13]. In the current study, the two E. coli strains carrying mcr-1 and blaCTX-M genes were isolated from patients with urinary tract infections and were resistant to most classes of antibiotics, demonstrating sensitivity only to the carbapenems and, in the case of one strain (2207), to cefepime. In addition, these two strains were found to belong to the ST131-O25b clone, an E. coli clone that commonly exhibits resistance to quinolones, trimethoprim-sulfamethoxazole and aminoglycosides, and is recognized as the primary lineage responsible for the spread of blaCTX-M genes [48]. The results of this study support previous findings on strains isolated from humans [15,49], showing that the already highly resistant clone ST131 can acquire plasmid-mediated colistin resistance genes. As this clone can be transmitted from person to person and through the consumption of contaminated food [13], and given that its prevalence in the feces of healthy humans is on the rise [50], the spread of this multi-resistant clone could be facilitated by a lack of hygiene, which suggests that less privileged areas of the world might see an increase in the prevalence of this clone. If mcr-1-carrying O25b-ST131 E. coli clones expand to different geographical areas, commonly used antibiotics, such as ciprofloxacin, cephalosporines and trimethoprim-sulfametoxazol, could co-select for colistin-resistant strains and contribute to the spread of resistance against this last-resort antibiotic.
Limitations of the current study include its small sample size, unicentric design and short timeframe. Lastly, not all known mcr variants were analyzed; thus, the actual plasmid-mediated colistin resistance prevalence at our institution might be higher than the levels suggested by these results.
In conclusion, this study, albeit small, demonstrated that the emergence and spread of mcr-carrying strains among humans is a reality in Mexico. In addition, the presence of this resistant trait among the highly resistant and easily transmissible O25b-ST131 E. coli clone further complicates the antibiotic resistance scenario in our country. Further surveillance studies are needed among other hospitals and ambulatory patients in Mexico to determine the magnitude of the problem of colistin resistance, especially that mediated by mcr genes, in order to establish policies aimed at optimizing antibiotic stewardship programs to reduce the dissemination of resistance against this last-resource antibiotic.

Authors Contributions

Conceptualization, Mario Galindo-Méndez; Formal analysis, Humberto Navarrete-Salazar, Devanhi Quintas-de la Paz, Reinaldo Pacheco-Vásquez, Isabel Baltazar-Jiménez and Laura Guadarrama-Monroy; Investigation, Mario Galindo-Méndez, Humberto Navarrete-Salazar, Devanhi Quintas-de la Paz, Isabel Baltazar-Jiménez and Jose Santiago-Luna; Project administration, Humberto Navarrete-Salazar; Resources, Mario Galindo-Méndez, Reinaldo Pacheco-Vásquez and Laura Guadarrama-Monroy; Validation, Reinaldo Pacheco-Vásquez and Jose Santiago-Luna; Writing – original draft, Mario Galindo-Méndez; Writing – review & editing, Devanhi Quintas-de la Paz, Isabel Baltazar-Jiménez and Jose Santiago-Luna.

Ethical Approval

Not required.

Funding

This research received no external funding.

Acknowledgments

The authors thank Dr. Jesús Silva for providing the J53 E. coli strain for the conjugation experiments and Dr. Todd Michael Pitts for reviewing this manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Nagvekar, V.; Sawant, S.; Amey, S. Prevalence of multidrug-resistant Gram-negative bacteria cases at admission in a multispeciality hospital. J Glob Antimicrob Resist. 2020, 22, 457–461. [Google Scholar] [CrossRef] [PubMed]
  2. Olaitan, A.O.; Morand, S.; Rolain, J.M. Mechanisms of polymyxin resistance: acquired and intrinsic resistance in bacteria. Front Microbiol. 2014, 5, 643. [Google Scholar] [CrossRef] [PubMed]
  3. Andrade, F.F.; Silva, D.; Rodrigues, A.; Pina-Vaz, C. Colistin Update on Its Mechanism of Action and Resistance, Present and Future Challenges. Microorganisms. 2020, 8, 1716. [Google Scholar] [CrossRef]
  4. Monaco, M.; Giani, T.; Raffone, M.; Arena, F.; García-Fernández, A.; Pollini, S. Colistin resistance superimposed to endemic carbapenem-resistant Klebsiella pneumoniae: a rapidly evolving problem in Italy, November 2013 to April 2014. Euro Surveill. 2014, 19, 20939. [Google Scholar] [CrossRef]
  5. Pena, I.; Picazo, J.J.; Rodríguez-Avial, C.; Rodríguez-Avial, I. Carbapenemase-producing Enterobacteriaceae in a tertiary hospital in Madrid, Spain: high percentage of colistin resistance among VIM-1-producing Klebsiella pneumoniae ST11 isolates. Int J Antimicrob Agents 2014, 43, 460–464. [Google Scholar] [CrossRef]
  6. Meletis, G.; Oustas, E.; Botziori, C.; Kakasi, E.; Koteli, A. Containment of carbapenem resistance rates of Klebsiella pneumoniae and Acinetobacter baumannii in a Greek hospital with a concomitant increase in colistin, gentamicin and tigecycline resistance. New Microbiol. 2015, 38, 417–421. [Google Scholar]
  7. Binsker, U.; Käsbohrer, A.; Hammerl, J.A. Global colistin use: a review of the emergence of resistant Enterobacterales and the impact on their genetic basis. FEMS Microbiol Rev. 2022, 46, fuab049. [Google Scholar] [CrossRef]
  8. Liu, Y.Y.; Wang, Y.; Walsh, T.R.; Yi, L.X.; Zhang, R.; Spencer, J.; et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef]
  9. Baron, S.; Hadjadj, L.; Rolain, J.M.; Olaitan, A.O. Molecular mechanisms of polymyxin resistance: knowns and unknowns. Int J Antimicrob Agents. 2016, 48, 583–591. [Google Scholar] [CrossRef]
  10. Ejaz, H.; Younas, S.; Qamar, M.U.; Junaid, K.; Abdalla, A.E.; Abosali, K.O.A.; et al. Molecular Epidemiology of Extensively Drug-Resistant mcr Encoded Colistin-Resistant Bacterial Strains Co-Expressing Multifarious β-Lactamases. Antibiotics (Basel). 2021, 10, 467. [Google Scholar] [CrossRef]
  11. Hameed, F.; Khan, M.A.; Muhammad, H.; Sarwar, T.; Bilal, H.; Rehman, T.U. Plasmid-mediated mcr-1 gene in Acinetobacter baumannii and Pseudomonas aeruginosa: first report from Pakistan. Rev Soc Bras Med Trop. 2019, 52, e20190237. [Google Scholar] [CrossRef]
  12. Peirano, G.; Pitout, J.D. Molecular epidemiology of Escherichia coli producing CTX-M beta-lactamases: the worldwide emergence of clone ST131 O25:H4. Int J Antimicrob Agents. 2010, 35, 316–321. [Google Scholar] [CrossRef] [PubMed]
  13. Nicolas, M.H.; Bertrand, X.; Madec, J.Y. Escherichia coli ST131, an intriguing clonal group. Clin Microbiol Rev. 2014, 27, 543–574. [Google Scholar] [CrossRef]
  14. Lopes, R.; Furlan, J.P.R.; Dos Santos, L.D.R.; Gallo, I.F.L.; Stehling, E.G. Colistin-Resistant mcr-1-Positive Escherichia coli ST131-H22 Carrying blaCTX-M-15 and qnrB19 in Agricultural Soil. Front Microbiol. 2021, 12, 659900. [Google Scholar] [CrossRef]
  15. Ortiz de la Tabla, V.; Ortega, A.; Buñuel, F.; Pérez-Vázquez, M.; Marcos, B.; Oteo, J. Detection of the high-risk clone ST131 of Escherichia coli carrying the colistin resistance gene mcr-1 and causing acute peritonitis. Int J Antimicrob Agents. 2017, 49, 115–116. [Google Scholar] [CrossRef]
  16. World Health Organization. Global action plan on antimicrobial resistance. 2016;45. Accessed January 10, 2023.
  17. Clinical and Laboratory Standards Institute. M100 Performance Standards for Antimicrobial Susceptibility Testing, 33rd Edition; 2023.
  18. Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, G.C.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef]
  19. Simner, P.J.; Bergman, Y.; Trejo, M.; Roberts, A.A.; Marayan, R.; Tekle, T.; et al. Two-Site Evaluation of the Colistin Broth Disk Elution Test To Determine Colistin In Vitro Activity against Gram-Negative Bacilli. J Clin Microbiol. 2019, 57, e01163–18. [Google Scholar] [CrossRef]
  20. BLAST Sequence Analysis Tool. National Center for Biotechnology Information. 2013. Accessed February 17, 2023.
  21. Rebelo, A.R.; Bortolaia, V.; Kjeldgaard, J.S.; Pedersen, S.K.; Leekitcharoenphon, P.; Hansen, I.M.; et al. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. Euro Surveill. 2018, 23, 17–00672. [Google Scholar] [CrossRef]
  22. Borowiak, M.; Fischer, J.; Hammerl, J.A.; Hendriksen, R.S.; Szabo, I.; Malorny, B. Identification of a novel transposon-associated phosphoethanolamine transferase gene, mcr-5, conferring colistin resistance in d-tartrate fermenting Salmonella enterica subsp. enterica serovar Paratyphi B. J Antimicrob Chemother. 2017, 72, 3317–3324. [Google Scholar] [CrossRef] [PubMed]
  23. Clermont, O.; Dhanji, H.; Upton, M.; et al. Rapid detection of the O25b-ST131 clone of Escherichia coli encompassing the CTX-M-15-producing strains. J Antimicrob Chemother. 2009, 64, 274–277. [Google Scholar] [CrossRef] [PubMed]
  24. Edelstein, M.; Pimkin, M.; Palagin, I.; Edelstein, I.; Stratchounski, L. Prevalence and molecular epidemiology of CTX-M extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae in Russian hospitals. Antimicrob Agents Chemother. 2003, 47, 3724–3732. [Google Scholar] [CrossRef]
  25. Garza, U.; Tamayo, E.; Arellano, D.M.; et al. Draft Genome Sequence of a Multidrug- and Colistin-Resistant mcr-1-Producing Escherichia coli Isolate from a Swine Farm in Mexico. Genome Announc. 2018, 6, e00102–18. [Google Scholar] [CrossRef]
  26. Gogry, F.A.; Siddiqui, M.T.; Sultan, I.; Haq, Q.M.R. Current Update on Intrinsic and Acquired Colistin Resistance Mechanisms in Bacteria. Front Med (Lausanne). 2021, 8, 677720. [Google Scholar] [CrossRef] [PubMed]
  27. Zafer, M.M.; El-Mahallawy, H.A.; Abdulhak, A.; Amin, M.A.; Al-Agamy, M.H.; Radwan, H.H. Emergence of colistin resistance in multi-drug resistant Klebisella pneumoniae and Escherichia coli strains isolated from cancer patients. Ann Clin Microbiol Antimicrobiano. 2019, 18, 40. [Google Scholar] [CrossRef]
  28. Saavedra, S.Y.; Diaz, L.; Wiesner, M.; Correa, A.; Arévalo, S.A.; Reyes, J.; et al. Genomic and Molecular Characterization of Clinical Isolates of Enterobacteriaceae Harboring mcr-1 in Colombia, 2002 to 2016. Antimicrob Agents Chemother. 2017, 61, e00841–17. [Google Scholar] [CrossRef] [PubMed]
  29. Dadashi, M.; Sameni, F.; Bostanshirin, N.; Yaslianifard, S.; Khosravi-Dehaghi, N.; et al. Global prevalence and molecular epidemiology of mcr-mediated colistin resistance in Escherichia coli clinical isolates: a systematic review. J Glob Antimicrob Resist. 2022, 29, 444–461. [Google Scholar] [CrossRef] [PubMed]
  30. Garza-Ramos, U.; Silva-Sánchez, J.; López-Jácome, L.E.; Hernández-Durán, M.; Colín-Castro, C.A.; Sánchez-Pérez, A.; et al. Carbapenemase-Encoding Genes and Colistin Resistance in Gram-Negative Bacteria During the COVID-19 Pandemic in Mexico: Results from the Invifar Network. Microb Drug Resist. 2022. [Google Scholar] [CrossRef] [PubMed]
  31. Merida-Vieyra, J.; De Colsa-Ranero, A.; Arzate-Barbosa, P.; Arias-de la Garza, E.; Méndez-Tenorio, A.; Murcia-Garzón, J.; et al. First clinical isolate of Escherichia coli harboring mcr-1 gene in Mexico. PLoS One. 2019, 14, e0214648. [Google Scholar] [CrossRef]
  32. Abd El-Baky, R.M.; Masoud, S.M.; Mohamed, D.S.; Waly, N.G.; Shafik, E.A.; Mohareb, D.A.; et al. Prevalence and Some Possible Mechanisms of Colistin Resistance Among Multidrug-Resistant and Extensively Drug-Resistant Pseudomonas aeruginosa. Infect Drug Resist. 2020, 13, 323–332. [Google Scholar] [CrossRef]
  33. Snesrud, E.; Maybank, R.; Kwak, Y.I.; Jones, A.R.; Hinkle, M.K.; McGann, P. Chromosomally Encoded mcr-5 in Colistin-Nonsusceptible Pseudomonas aeruginosa. Antimicrob Agents Chemother. 2018, 62, e00679–18. [Google Scholar] [CrossRef]
  34. Chen, H.; Mai, H.; Lopes, B.; Wen, F.; Patil, S. Novel Pseudomonas aeruginosa Strains Co-Harbouring blaNDM-1 Metallo β-Lactamase and mcr-1 Isolated from Immunocompromised Paediatric Patients. Infect Drug Resist. 2022, 15, 2929–2936. [Google Scholar] [CrossRef]
  35. Anan, M.M.G.; El-Seidi, E.A.; Mostafa, M.S.; Rashed, L.A.; El-Wakil, D.M. Detection of Plasmid-Mediated Mobile Colistin Resistance Gene (mcr-1) in Enterobacterales Isolates from a University Hospital. Infect Drug Resist. 2021, 14, 3063–3070. [Google Scholar] [CrossRef] [PubMed]
  36. Ortega-Paredes, D.; Barba, P.; Zurita, J. Colistin-resistant Escherichia coli clinical isolate harbouring the mcr-1 gene in Ecuador. Epidemiol Infect. 2016, 144, 2967–2970. [Google Scholar] [CrossRef]
  37. Karki, D.; Dhungel, B.; Bhandari, S.; Kunwar, A.; Joshi, P.R.; Shesthra, B.; et al. Antibiotic resistance and detection of plasmid mediated colistin resistance mcr-1 gene among Escherichia coli and Klebsiella pneumoniae isolated from clinical samples. Gut Pathog. 2021, 13, 45. [Google Scholar] [CrossRef] [PubMed]
  38. Ugarte, R.G.; Olivo, J.M.; Corso, A.; Pasteran, F.; Albornoz, E.; Sahuanay, Z.P. Resistencia a colistín mediado por el gen mcr-1 identificado en cepas de Escherichia coli y Klebsiella pneumoniae. Primeros reportes en el Perú. An Fac Med. 2018, 79, 213–217. [Google Scholar] [CrossRef]
  39. Carroll, L.M.; Gaballa, A.; Guldimann, C.; Sullivan, G.; Henderson, L.O.; Wiedmann, M. Identification of Novel Mobilized Colistin Resistance Gene mcr-9 in a Multidrug-Resistant, Colistin-Susceptible Salmonella enterica Serotype Typhimurium Isolate. mBio. 2019, 10, e00853–19. [Google Scholar] [CrossRef]
  40. Terveer, E.M.; Nijhuis, R.H.T.; Crobach, M.J.T.; Knetsch, C.; Veldkamp, K.E.; Gooskens, J.; et al. Prevalence of colistin resistance gene (mcr-1) containing Enterobacteriaceae in feces of patients attending a tertiary care hospital and detection of a mcr-1 containing, colistin susceptible E. coli. PLoS One. 2017, 12, e0178598. [Google Scholar] [CrossRef] [PubMed]
  41. Mendes, A.C.; Novais, Â.; Campos, J.; Rodrigues, C.; Santos, C.; Antunes, P.; et al. mcr-1 in Carbapenemase-Producing Klebsiella pneumoniae with Hospitalized Patients, Portugal, 2016-2017. Emerg Infect Dis. 2018, 24, 762–766. [Google Scholar] [CrossRef]
  42. Östholm, Å.; Tärnberg, M.; Monstein, H.J.; Hällgren, A.; Hanberger, H.; Nilsson, L.E. High frequency of co-resistance in CTX-M-producing Escherichia coli to non-beta-lactam antibiotics, with the exceptions of amikacin, nitrofurantoin, colistin, tigecycline, and fosfomycin, in a county of Sweden. Scand J Infect Dis. 2013, 45, 271–278. [Google Scholar] [CrossRef]
  43. Tsui, C.K.M.; Sundararaju, S.; Mana, H.A.; Hasan, M.R.; Tang, P.; Perez, A. Plasmid-mediated colistin resistance encoded by mcr-1 gene in Escherichia coli co-carrying blaCTX-M-15 and blaNDM-1 genes in pediatric patients in Qatar. J Glob Antimicrob Resist. 2020, 22, 662–663. [Google Scholar] [CrossRef]
  44. Yauri-Condor, K.; Zavaleta-Apestegui, M.; Sevilla-Andrade, C.R.; Piscoya-Sara, J.; Villoslado-Espinosa, C.; Taboada, W.V.; et al. Extended-spectrum beta-lactamase-producing Enterobacterales carrying the mcr-1 gene in Lima, Peru. Rev Perú Med Exp. Salud Publica 2020, 37, 711–715. [Google Scholar] [CrossRef]
  45. Leroy, A.G.; Naze, F.; Dortet, L.; Naas, T.; Jaubert, J. Plasmid-mediated colistin resistance gene mcr-1 in a clinical Escherichia coli isolate in the Indian Ocean Commission. Med Mal Infect. 2018, 48, 426–428. [Google Scholar] [CrossRef] [PubMed]
  46. Luo, X.; Matthews, K.R. The conjugative transfer of plasmid-mediated mobile colistin resistance gene, mcr-1, to Escherichia coli O157:H7 and Escherichia coli O104:H4 in nutrient broth and in mung bean sprouts. Food Microbiol. 2023, 111, 104188. [Google Scholar] [CrossRef] [PubMed]
  47. Li, X.P.; Sun, R.Y.; Song, J.Q.; Fang, L.X.; Zhang, R.M.; Lian, X.L.; et al. Within-host heterogeneity and flexibility of mcr-1 transmission in chicken gut. Int J Antimicrob Agents. 2020, 55, 105806. [Google Scholar] [CrossRef]
  48. Novais, A.; Pires, J.; Ferreira, H.; Costa, L.; Montenegro, C.; Vuotto, C.; et al. Characterization of globally spread Escherichia coli ST131 isolates (1991 to 2010). Antimicrob Agents Chemother. 2012, 56, 3973–3976. [Google Scholar] [CrossRef]
  49. Li, G.; Li, X.; Wu, Y.; Xu, J.; He, F. Genomic Insights into the Colistin Resistant mcr-Carrying Escherichia coli Strains in a Tertiary Hospital in China. Antibiotics (Basel). 2022, 11, 1522. [Google Scholar] [CrossRef]
  50. Kudinha, T.; Kong, F. Possible step-up in prevalence for Escherichia coli ST131 from fecal to clinical isolates: inferred virulence potential comparative studies within phylogenetic group B2. J Biomed Sci. 2022, 29, 78. [Google Scholar] [CrossRef]
Preprints 78329 g001
Figure 1. Number of strains isolated per bacterial species.
Figure 1. Number of strains isolated per bacterial species.
Preprints 78329 g001
Table 1. Primers and PCR conditions used to determine the presence of mcr and blaCTX-M genes and O25b-ST131 clone.
Table 1. Primers and PCR conditions used to determine the presence of mcr and blaCTX-M genes and O25b-ST131 clone.
Amplified gene Primers sequence (5´- 3´) Reference
mcr -1-fw AGTCCGTTTGTTCTTGTGGC [21]
mcr -1-rv AGATCCTTGGTCTCGGCTTG
mcr -2-fw CAAGTGTGTTGGTCGCAGTT [21]
mcr 2-rv TCTAGCCCGACAAGCATACC
mcr-3-fw AAATAAAAATTGTTCCGCTTATG [21]
mcr-3-rv AATGGAGATCCCCGTTTTT
mcr-4-fw TCACTTTCATCACTGCGTTG [21]
mcr-4-rv TTGGTCCATGACTACCAATG
mcr-5-fw ATGCGGTTGTCTGCATTTATC [22]
mcr-5-rv TCATTGTGGTTGTCCTTTTCTG
pabB-fw TCCAGCAGGTGCTGGATCGT [23]
pabB-rv GCGAAATTTTTCGCCGTACTGT
blaCTX-M-fw TTTGCGATGTGCAGTACCAGTA [24]
blaCTX-M-rv CGATATCGTTGGTGGTGCCATA
Table 2. Colistin MIC of strains identified as resistant and their isolation sites.
Table 2. Colistin MIC of strains identified as resistant and their isolation sites.
Strain Micoorganism Colistin MIC (µg/mL) Isolation site
744 P. aeruginosa 8 Blood
1308 K. pneumoniae 16 Respiratory secretions
2207 E. coli 4 Respiratory secretions
2230 E. coli 4 Urine
2445 E. coli 8 Renal abscess
2892 P. aeruginosa 16 Respiratory secretions
3148 P. aeruginosa 8 Urine
3172 K. pneumoniae 4 Blood
3196 P. aeruginosa 4 Urine
3202 K. pneumoniae 4 Respiratory secretions
3271 E. cloacae 16 Respiratory secretions
5891 E. coli 4 Urine
Table 3. Antibiotic resistance profile of colistin resistant strains.
Table 3. Antibiotic resistance profile of colistin resistant strains.
Colistin resistant bacteria Antibiotic Antibiotic Resistance prevalence Acquired
resistance profile
P. aeruginosa
(N=4)		 Ceftazidime 4/4 (100%) MDR: 0
Cefepime 4/4 (100%) XDR: 3
Amikacin 4/4 (100%) PDR: 1
Ciprofloxacin 4/4 (100%)
Piperacilin/tazobactam 2/4 (50.0%)
Imipenem 4/4 (100%)
Ceftazidime 4/4 (100%)
Meropenem 4/4 (100%)
Gentamicin 4/4 (100%)
Tigecyclin 1/4 (25%)
E. coli
(N=4)		 Ampicilin/sulbactam 3/4 (75%) MDR: 2
Cefuroxime 3/4 (75%) XDR: 2
Cefotaxime 3/4 (75%) PDR: 0
Ceftazidime 3/4 (75%)
Ceftriaxone 3/4 (75%)
Cefepime 2/4 (50%)
Ertapenem 1/4 (25%)
Meropenem 0/4 (0%)
Amikacin 0/4 (0%)
Gentamicin 2/4 (50%)
Ciprofloxacin 4/4 (100%)
Trimethoprim/sulfamethoxazol 4/4 (100%)
K. pneumoniae
(N=3)		 Ampicilin/sulbactam 3/3 (100%) MDR: 1
Cefuroxime 2/3 (66.7%) XDR: 2
Cefotaxime 2/3 (66.7%) PDR: 0
Ceftazidime 2/3 (66.7%)
Ceftriaxone 2/3 (66.7%)
Cefepime 2/3 (66.7%)
Ertapenem 1/3 (33.3%)
Meropenem 0/3 (0%)
Amikacin 0/3 (0%)
Gentamicin 2/3 (66.7%)
Ciprofloxacin 3/3 (100%)
Trimethoprim/sulfamethoxazol 3/3 (100%)
E. cloacae
(N=1)		 Cefuroxime 1/1 (100%) MDR: 1
Cefotaxime 0/1 (0%) XDR: 0
Ceftazidime 0/1 (0%) PDR: 0
Ceftriaxone 0/1 (0%)
Cefepime 0/1 (0%)
Ertapenem 0/1 (0%)
Meropenem 0/1 (0%)
Amikacin 0/1 (0%)
Gentamicin 1/1 (100%)
Ciprofloxacin 1/1 (100%)
Trimethoprim/sulfamethoxazol 0/1 (100%)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.
Prerpints.org logo

Preprints.org is a free preprint server supported by MDPI in Basel, Switzerland.

facebook logotwitter logolinkedin logo
MDPI Initiatives
Important Links
Subscribe

Disclaimer

Terms of Use

Privacy Policy

© 2024 MDPI (Basel, Switzerland) unless otherwise stated