To test if the original hyperactive version of the pBac transposase with the insect codon usage under the D. melanogaster hsp70 promoter (ihyPBase) [34] results in higher transposition efficiencies in the yellow fever mosquito, Ae. aegypti, embryos of the Higgs White Eye (HWE) strain were injected with varying concentrations of the phsp-ihyPBase helper plasmid in combination with two different donor plasmids, including a variation of helper-donor ratios. In parallel, the same injections were performed with the standard phsp-pBac plasmid [9]. Moreover, the results were compared to the transposition efficiencies obtained with the phsp-pBac plasmid in our laboratory over the years, which had as well been performed at various helper concentrations and helper/donor ratios in the attempt to optimize phsp-pBac-mediated transformation efficiencies (Table 1, Table S1). ihyPBase helper concentrations were chosen lower than the phsp-pBac concentrations typically used in expectance of higher transformation rates as observed in T. castaneum, D. melanogaster, and C. capitata [34].

In the three injections with the ihyPBase plasmid, the larval hatch rate was about 7-8% lower than primarily observed in phsp-pBac injections (between 10-24%) (Table 1). However, this difference was insignificant (p = 0.081, single factor ANOVA). No noticeable difference could be observed for the adult emergence rate, and also the fertility of the G₀ families was comparable with both helper plasmids (Table 1 and Figure S1a - d; p = 0.175, and p = 0.647, single factor ANOVA). The average transformation efficiency in our laboratory with the phsp-pBac plasmid over the years was 1.46% (13 experiments in total, including seven experiments with no transgenic event). In this set of parallel injections with the ihyPBase plasmid and phsp-pBac, no transgenic event was recovered (a total of more than 2200 injected embryos each, and 23000 screened G₁ for ihyPBase, and 34000 screened G₁ for phsp-pBac).

Shown are the injection data using the standard phsp-pBac piggyBac helper plasmid (pBac) collected over six years and injections performed using the phsp-HypB plasmid (HypB) containing the insect codon optimized hyperactive pBac. Injections 4, 14, and 15, as well as 5, 6, and 16 (printed in bold) were performed in parallel with the same donor plasmid and eggs from the same female cohort. “Injected embryos” represents the number of black embryos 24 h post injection; “hatch rate” = no. larvae / no. black eggs (%); “eclosion rate” = no. adults / no. larvae (%); “no. transg. events” is the number of independent transposition events observed; “transf. eff.” = the minimal transformation efficiency, calculated as: number of independent transpositions events/ total number of fertile G₀ adults. The actual transformation efficiency can be higher, because in group backcrosses of G₀ individuals, the number of infertile G₀ isn’t known. Therefore, all G₀ are included in the calculation; n.a. = not applicable; n.d. = not determined; avg = average; * this data has been published before in Häcker et al. 2017 [35].

The same ihyPBase helper plasmid was tested for transposition efficiency in the agricultural pest D. suzukii and compared to previous injections with the standard phsp-pBac helper. In D. suzukii, the standard injection mix concentration for the phsp-pBac helper over the years was predominantly 200 ng/µl helper and 500 ng/µl donor plasmid. These concentrations were also used for ihyPBase injections in two experiments. Moreover, both helper plasmids were mixed at equal concentrations in three independent injection experiments (Table 2). As in Ae. aegypti, the ihyPBase didn’t improve the transformation efficiency compared to the standard phsp-pBac plasmid. We also did not observe differences in development of injected embryos between phsp-pBac and ihyPBase injections (Table 2, Figure S1e - g).

Shown are the injection data using the standard phsp-pBac helper plasmid (pBac) (exp. Ds 1-18), and injections performed using phsp-HypB plasmid (hyPB) with insect codon optimized hyperactive pBac helper (Ds 22, 23) or a combination of both (Ds 19-21). The injections for AH443 [24], V220-223 [36], V146, V183-V185, V188, V213, V215, V226-229, V250-251 [37], V209 [38], and V265 [39], were performed across more than 10 years. All injected eggs were counted. “hatch rate” = no. larvae / no. injected eggs (%); “fertile eclosion rate” = no. fertile G₀ adults/ no. hatched larvae (%); “no. transg. lines” is the number of independent transgenic lines obtained (all G₀ were backcrossed individually, except injection Ds 18; here independent lines were identified from each family and confirmed by segregation analysis); “transf. eff.” = the transformation efficiency, calculated as: number of independent transgenic events / total number of fertile G₀ adults; n.d. = not determined; avg = average.

To assess the efficiency of in vitro transcribed, capped mRNA as a pBac helper source, pBac mRNA injections were performed with six different donor plasmids (V19, V96, V97, V368, V369, V370) ranging from 7 to almost 12 kb in plasmid size and 3.6 to 6.5 kb in insert size. The minimal transformation efficiencies of these injections were compared to the phsp-pBac helper plasmid injections performed over the years in our laboratory with various donor plasmids (Table 3 and Table S2). Of the six donor plasmids used in pBac mRNA injections, V19 had previously been injected with the pBac helper plasmid. Moreover, the V370 donor plasmid used in mRNA injections is identical to the V258 donor injected with pBac helper plasmid except for an additional attB recombination site in V370. As all the plasmid helper and mRNA helper experiments were conducted at different time points, with different HWE female cohorts, by different experimenters, and some in a different laboratory (V369, V370), we also performed side-by-side injections with the phsp-pBac plasmid or pBac mRNA together with the V368 donor plasmid into embryos collected from the same batch of HWE females.

Injection numbers across all experiments ranged from 150 to more than 1000 injected embryos per experiment for the helper plasmid, and 110 to less than 600 embryos for the helper mRNA (Table 3 and Table S2). In helper plasmid injections, pBac and donor concentrations varied between 160 and 400 ng/µl, and 150 and 600 ng/µl, respectively. In mRNA injections, the donor concentration was kept constant at 300 ng/µl, and the mRNA concentration varied between 100 and 300 ng/µl. G₀ injection survivors were backcrossed individually or in groups of up to 15 individuals, depending on the number of G₀ survivors and the current insectary capacity, and the offspring (G₁) screened for fluorescent marker expression. For all mRNA injections and three of the pBac plasmid injections (exp. 2, 3, 9), a subset of positive G₁ of each G₀ family was analyzed for the transgene copy number in the genome via droplet digital PCR (ddPCR). In case of single integration events identified by ddPCR, inverse PCR was performed to determine and distinguish between genomic integration sites. Some individuals were sacrificed for the transformation event analysis only after individual backcrossing and successful mating. The minimum number of independent genomic integration events per G₀ family was determined by summing up the number of G₁ with a different copy number or integration sites. A copy number greater than one was counted as one independent event in this analysis. The complete set of data for the integration event analysis is summarized in Table S3.

Data from 13 injection experiments using the phsp-pBac helper plasmid over six years and nine injection experiments using pBac capped mRNA over five years are displayed. Exp. 1-13 are identical to the ones shown in Table 1. Exp. 12, 13, 21, and 22 (printed in bold) were performed in parallel with eggs from the same female cohort; Injections 14 and 15 were performed in the WT Orlando laboratory strain, and all other injections in the Higgs White Eye strain; “Injected embryos” represents the number of black embryos 24 h post injection; “hatch rate” = no. larvae / no. black eggs (%); “eclosion rate” = no. adults / no. larvae (%); “no. transg. events” is the number of independent transposition events observed (multiple genomic integrations in one individual were counted as one event); “no. of transg. events / G₀” = the maximum number of independent transposition events detected in a G₀ founder individual as determined by ddPCR and iPCR analysis of positive G₁. If the number is given as ‘≥ number’, then only a subset of positive G₁ was molecularly analyzed, and additional independent events might not have been detected; “transf. eff.” = the minimal transformation efficiency, calculated as: number of independent transgenic events/ total number of G₀ adults. The transformation efficiency in several families is assumed to be higher (see text); n.a. = not applicable; n.d. = not determined; avg = average; * detailed numbers of all transgenic events identified in each G₀ family and calculations see Tables S2 and S3; ** transformation efficiency of > 100% results from single G₀ founder individuals producing more than one independent transposition event (as determined by ddPCR and iPCR); *** this data has been published before in Häcker et al. 2017 [35].

Across all injections, we observed a lower but not significantly different larval hatch rate in the mRNA helper injections (Figure 1a; p = 0.06619, one-factor ANOVA), which seemed independent of the size of the injected donor construct. There was no difference in the G₀ adult eclosion rate and in the fertility of the G₀ families between plasmid and mRNA helper (Figure 1b, c; p = 0.2340 and p = 0.6204, respectively, one-factor ANOVA). However, using the mRNA helper, the transposition efficiency increased from an average of 1,49% with the helper plasmid to more than 50% on average (Figure 1g, p =1.646E-06). These numbers refer to the calculated minimal transformation efficiency, i.e., the number of obtained independent transgenic events divided by the total number of adult G₀ survivors of each injection. Different independent events within one G₀ family as determined by digital PCR and inverse PCR were counted separately. The actual transformation efficiency, however, in several cases might have been even higher than the numbers reported here for the following reasons: i) G₀ injection survivors were not always backcrossed individually (Table S2). Thus, in some cases, more than one positive G₀ could have been in a positive pool, resulting in more than one independent transgenic event, which ddPCR and inverse PCR wouldn’t have necessarily identified as only small numbers of G₁ individuals per family were assessed. This applies especially to the V369 and V370 injections (exp. 16, 17), the only mRNA injection experiments where the G₀ were exclusively backcrossed in large groups (12 individuals per cage, see Table S3). Moreover, of several G₀ families, the offspring was not molecularly characterized for copy number and integration sites. ii) All emerged G₀ adults were counted for the calculation, including sterile individuals, which on average, were about 40% (Table S4).

A frequent observation with pBac mRNA injections were multiple transgene construct integrations in one individual, ranging from two to 18 integrations at the higher mRNA concentration, and two to 14 integrations at the lower concentration in the G₁ animals analyzed by ddPCR. Different integration frequencies were observed between the offspring of different G₀ founders and within the offspring of single-founder G₀ families, including individuals with single integrations at different genomic locations as determined by inverse PCR. On the contrary, from all phsp-pBac plasmid injections, only one individual with two integrations of a transgene construct was obtained. For the detailed results, see Tables S2 and S3.

The efficiency of capped pBac mRNA was also assessed for Ae. albopictus. In this experiment, no control injections with pBac helper plasmid were performed, as the primary purpose was to create landing site lines for RMCE. G₀ survivors were exclusively backcrossed in groups of 10-15 individuals, and the positive G₁ offspring was not further analyzed molecularly to identify different transposition events within a G₀ family. Nevertheless, this experiment indicated a similarly high transposition rate in Ae. albopictus as in Ae. aegypti, as 15 of the 19 G₀ families produced positive G₁ (Table 4). This percentage of positive families is comparable to the Ae. aegypti mRNA injection experiments #16 and 17, where G₀ were backcrossed in a similar scheme (mostly groups of 12). These group backcrosses produced a similar rate of positive families, i.e., 11 of 12 (exp. 16) and five of six families (exp. 17) (Table 3, Table S2). If only the number of positive families is counted as independent transposition events in these experiments, this results in a transformation efficiency of 7%, i.e., in the same range as observed for the Ae. albopictus mRNA injection. We, therefore, assume that the actual transformation efficiency in Ae. albopictus was much higher.

Displayed are data from one injection experiment using pBac capped mRNA in Ae. albopictus. “no. injected embryos” total number of injected embryos; “hatch rate” = no. larvae / total no of injected eggs (%); “eclosion rate” = no. adults / no. larvae (%); “no. transg. events” is the number of independent transposition events observed; “transf. eff.” = the minimal transformation efficiency, calculated as: number of independent transgenic events/ total number of G₀ adults. The actual transformation efficiency might be higher (see text). For more details in Ae. albopictus transformation data, please see Table S5. * In this plasmid, the D. melanogaster PUbCFP cassette was replaced with an Ae. aegypti PUbeCFP cassette from pSL1180-HR-PUbeCFP (Addgene plasmid 47917).

Based on the strong positive effect of capped mRNA on pBac transformation efficiencies, we subsequently tested the efficiency of capped mRNA in phiC31- and Cre-RMCE experiments in direct comparison to the respective helper plasmid.

For phiC31-RMCE, comparative injections were performed at two different helper/donor concentrations, 150/300 ng/µl and 300/500 ng/µl in Ae. aegypti. Concentrations were chosen to be in the same range as concentrations used in phiC31-RMCE experiments in two different landing site lines previously performed in our laboratory (Table S6). They were also comparable to the pBac mRNA concentrations. Five independent injections were performed for the lower concentration, two with the phiC31 helper plasmid and three with the phiC31 mRNA. For the higher concentration, two replicates each were performed (Table 5). No significant differences in the larval hatch rate, adult eclosion rate, or G₀ fertility were observed between helper plasmid and mRNA injections (p = 0.109, p = 0.181, p = 0.456, respectively, statistics done across all concentrations; see also Fig. S2;). Based on the numbers obtained with pBac mRNA, one transgenic event would have been expected for about every 50th injected embryo, assuming a similar efficiency. However, the overall recombination efficiency was very low. Only in one of the three replicates with mRNA at the lower helper/donor concentration, we observed one RMCE event. In comparison, we identified one donor plasmid integration event in one of the two replicates with helper plasmid at the higher helper/donor concentration (Table 5). The corresponding recombination efficiencies within the replicates were 10 and 6.45%, respectively, and 3.34 and 3.23% across the replicates.

The efficiencies obtained with the helper plasmid were in the same range as those observed in the previous experiments, performed with the same or different donor constructs into different landing site lines (Table S6, exp. I - V).

Data from comparative injection experiments are displayed at two different helper/donor concentrations into the same landing site line; “no. injected embryos” represents the number of black embryos 24 h post injection; “hatch rate” = no. larvae / no. black eggs (%); “eclosion rate” = no. adults / no. larvae (%), “no. transg. events” is the number of independent recombination events observed; “recomb. eff.” is the minimal recombination efficiency, calculated as: number of transgenic events/ total number of G₀ adults. The recombination efficiency can be higher, as in group backcrosses of G₀, the number of infertile G₀ is unknown. All positive individuals obtained showed the RMCE phenotype. * one additional family with transient donor phenotype; parental phenotype in next generation; ** one family with transient donor phenotype; parental phenotype in next generation

In phiC31-RMCE injections, the positive effect of the mRNA could not be observed when mRNA concentrations similar to the pBac transformations were used. Thus, concentrations were increased for Cre-RMCE injections to 450 ng/µl helper and 350 ng/µl donor. Helper plasmid and mRNA injections were performed in three independent replicates each. Similar to the phiC31 experiments, only one plasmid or mRNA replicates produced recombination events. In one of the plasmid helper injections, one family produced an RMCE phenotype, and another one offspring with a donor plasmid integration phenotype, corresponding to an overall minimum recombination efficiency of 2.44% (0.8% across all replicates, Table 6). In the mRNA injections, a single family produced offspring with an integration phenotype, corresponding to a minimum recombination efficiency of 3% (1% across all replicates). For complete injection, crossing, and screening data, see Table S7.

Data from comparative injection experiments are displayed at two different helper/donor concentrations into the same landing site line; “no. injected embryos” represents the number of black embryos 24 h post injection; “hatch rate” = no. larvae / no. black eggs (%); “eclosion rate” = no. adults / no. larvae (%); “no. transg. events” is the number of independent recombination events observed; “recomb. eff.” is the minimal recombination efficiency, calculated as: number of transgenic events/ total number of G₀ adults. The recombination efficiency can be higher, as in group backcrosses of G₀, the number of infertile G₀ is unknown. * 1 integration, one RMCE phenotype; ** integration phenotype.

We also performed Cre-RMCE injections in Ae. albopictus into two different landing site lines. In one line (17A1), we tested injecting with either 150 ng/µl phsp CRE or 190 ng/µl helper mRNA. From 34 fertile families of G₀ founders injected with helper plasmid, one showed expression of the donor transgene in addition to the original landing site marker, indicating an integration event. This translates into a recombination efficiency with Cre helper plasmid of 2.27 % (Table S8). None of the 46 fertile families made of G₀ founders injected with helper mRNA showed expression of the transgene.

In a second line (1A3), the landing site integrated 1.3 Mb upstream of the Nix locus as determined via inverse PCR, and marker fluorescence was only observed in males. Thus, all injected embryos were heterozygous for the landing site. Notably, in this line, the Ae. aegypti PUbeCFP expression was not visible, but PCR could confirm the presence of the sequence. This line was only injected with 150 ng/µl phsp-CRE, and one showed expression of the donor plasmid fluorescence marker from a total of six fertile families. PCR of the animals that showed transgene expression suggested both excision of the original PUbeCFP sequence and multiple, potentially tandem, integrations of the plasmid, i.e., non-canonical recombination events.

Aedes aegypti wild-type strains and transgenic lines were reared in an insectary at constant conditions of 27°C, 70% RH, and a 12:12 hrs light:dark cycle. Larvae were fed on Tetra TabiMin fish food pellets. The adult mosquito diet was sterile-filtered 10% (w/v) sucrose solution. Moreover, adult females were fed once per week with pig blood purchased from a butcher shop. Aedes aegypti laboratory strains used in the experiments were the Orlando wild type strain and the Higgs White Eye (HWE) strain (a spontaneous white eye mutant strain of the Rexville D strain from Puerto Rico [43]).

A lab colony of Aedes albopictus was established with pupae and larvae collected from an auto-salvage yard in Manassas, Virginia, in 2018. Animals were reared under standard laboratory conditions at 21-26°C, 80% RH, 16 h light:8 h dark for three generations prior to injections for pBac-mediated transformation [44]. Larvae were fed on a MWF schedule with 1 ml of a larval food slurry consisting of 1 liter DI water, 120 g dog food (Nutro Ultra Small Breed Puppy, Nutro Products Inc., Franklin, TN, USA), and 40 g frozen brine shrimp (Sally’s Frozen Brine Shrimp, San Francisco Bay Brand, Newark, CA, USA) [45]. Adult females were provisioned with organic raisins (Newman’s Own, Westport, CT, USA) to allow ad libitum sugar feeding. They were allowed to blood feed on a human host for egg production. The Georgetown University IRB has determined that mosquito blood feeding is not human research and does not require IRB approval; however, the blood feeding protocol has been approved by the Georgetown University OHS office.

The wild-type D. suzukii USA strain and transgenic lines were maintained at 25°C and 55–60% humidity with a 12 h photoperiod. Flies were briefly anesthetized with CO₂ for screening and to set up crosses.

Transposase, recombinase-encoding helper plasmids, or in vitro transcribed, capped mRNA were mixed with the corresponding donor plasmids at the final concentrations specified in Table 1, Table 2, Table 3, Table 4 and Table 5 in RNAse-free 1x embryonic injection buffer (5 mM KCl, 0.1 mM NaPO4, pH 6.8). To remove particles and dust that could clog the injection needles, the injection mixes were centrifuged at 13000 rpm for 30 min at 4°C. The supernatant was taken carefully without disturbing a possible pellet and stored in 5 µl aliquots at -80°C until further use.

Injections for pBac-mediated transformation: Ae. aegypti transgenic lines were created by injecting preblastodermal embryos of the HWE strain with the phsp-pBac helper plasmid [9] or pBac in vitro transcribed, capped mRNA and a donor plasmid at varying concentrations (see Table 1 and 3), in 1x embryonic injection buffer (EIB; 5 mM KCl, 0.1 mM NaPO4, pH 6.8). Injected embryos were kept moist for two days to allow completion of embryonic development before transferring to water with some TabiMin fish food for hatching. Survivors were sexed in the pupal stage and backcrossed to HWE in small groups or individually. G₁ offspring was collected for 3-6 gonotrophic cycles and screened for the presence of the transgenic marker (DsRed or eGFP fluorescent protein) at the larval or pupal stage. Positive G₁ were again backcrossed individually or in groups to establish transgenic lines.

Injections for recombinase-mediated cassette exchange: preblastoderm embryos of the Ae. aegypti landing site lines for phiC31-RMCE (lines V19-M2M1, V19-M26M3m2; V19 landing site construct = attP_3xP3-eGFP_attPrev) or Cre-RMCE (line V3-M30M1; V3 landing site construct = FRT_3xP3-DsRed_FRT3_loxN_3xP3-FRT5_AmCyan-lox2272-loxP_attP220rev) were injected with the recombinase helper plasmid or in vitro transcribed, capped recombinase mRNA and a donor plasmid at varying concentrations (see Table 4 and Table 5), in 1x EIB. Further rearing and crossing were identical to pBac injections described above.

Germline transformation with piggyBac constructs was carried out as previously described [11]. A mixture of the piggyBac donor construct (500 or 700 ng/µl) and the phsp-pBac or the phsp-HypB transposase helper (200 or 300 ng/µl) was injected into WT embryos. In a third series of experiments, the two helper plasmids were combined at 200 ng/µl each with 500 ng/µl donor plasmid. G₀ adults were individually (unless otherwise stated) crossed to WT flies, and G₁ flies were screened for fluorescence. Segregation tests were conducted by outcrossing the transformants to WT flies, and transgenic lines were established from single G₁-positive adults.

The number of genomic integrations of the transgene cassettes in Ae. aegypti was analyzed by ddPCR probing for the eGFP or DsRed marker genes. The reference gene was mEF1, a one-copy gene in the Ae. aegypti genome. ddPCR was performed with the Biorad QX200 and Auto-DG System. 20 µl CNV reactions contained 20-100 ng Ae. aegypti genomic DNA, 1x ddPCR Supermix for probes (Biorad #1863010), 1x primer-probe mix target gene (FAM-labeled), 1x primer-probe mix reference gene (HEX-labeled), and 1U EcoRI (NEB: EcoRI cuts within the transgene constructs but not within the PCR amplicons). Droplets were generated with the Automated Droplet Generator. PCR cycling conditions (deep well block) were: 95°C for 10 min, 40x [94°C for 30 sec, 60°C for 1 min], 98°C for 10 min, 4°C hold. The ramp rate was 2°C /sec. Primer and probes were prepared and stored as a 20x primer-probe mix consisting of 18 µM each of forward and reverse primer and 5 µM probe (the final concentration of primers and probe in the reaction was 900 nM and 250 nM, respectively). Primers and probe used for target gene EGFP were: EGFP-for (P106) = 5’caaagaccccaacgagaagc, EGFP-rev (P108) = 5’gtccatgccgagagtgatcc, EGFP-probe = 5’ FAM-cgatcacatggtcctgctgg-BHQ1. Primers and probe used for target gene DsRed were: DsRed-for (P49) = 5’gatccacaaggccctgaagc, DsRed-rev (P50) = 5’gctccacgatggtgtagtcc, DsRed-probe = 5’ FAM-tcgttgtgggaggtgatgtc-BHQ1. Primers and probe used for reference gene mEF1 were: mEF-for (P63) = 5’tccggtttgcctacgatacc, mEF-rev (P64) = 5’actgggcagttgtactcacg, mEF-probe = 5’ HEX-tcgggaatgggtgaattgca-BHQ1.

The distribution of positive and negative droplets in each well was analyzed individually and the threshold corrected manually if necessary.

For linkage analysis, the CNV experiment was once conducted with restriction digest and once without and the results were compared. If two transgene cassettes are linked on the same chromosome, the copy number obtained from the undigested reaction is approximately ½ of the digested reaction. Linkage analysis requires cautious preparation of genomic DNA to avoid shearing forces. Depending on the extent of shearing and the distance of the two integration sites, the value obtained from undigested DNA can converge towards the value of the digested sample.

Genomic locations of the transgene constructs were determined by inverse plus nested PCR according to the following protocol: genomic DNA (600 ng) was digested with 4 U MspI in a 20 µl reaction for 1 hr at 37°C. Digested DNA was immediately precipitated, pelleted, and re-dissolved in 50 µl TE buffer. The complete amount of MspI-digested DNA (50 µl) was used for the subsequent self-ligation reaction in 350 µl total volume containing 1x T4 Ligation Buffer and 2 µl T4 DNA ligase (NEB, 400,000 U/ml) overnight at 16°C. Ligated DNA was precipitated and dissolved in 50 µl. 3 µl DNA was PCR amplified in 20 µl containing 1x Phusion Flash High-Fidelity Polymerase Mastermix (Thermo Scientific F548S) and 500 nM of each primer. Cycling conditions for touchdown inverse PCR (iPCR) were: 98°C for 10 sec, 5x [98°C for 1 sec; Tm + 5°C for 5 sec, reduced by 2°C per cycle; 72°C for 1 min], 30x [98°C for 1 sec; Tm + 5°C for 5 sec; 72°C for 1 min], 72°C for 1 min, 12°C hold. The annealing temperature was adjusted for each primer pair.

The iPCR reaction was either directly purified by agarose gel electrophoresis and sent to sequencing, or diluted 1:100, and 1 µl used for the (semi-) nested PCR. (Semi-) nested PCR reactions were identical to the iPCR reactions. Cycling conditions for (semi-) nested PCR (nPCR) were: 98°C for 10 sec, 30x [98°C for 1 sec, Tm minus 5°C for 5 sec, 72°C for 1 min], 72°C for 1 min, 12°C hold. Primers for probing the 3’ piggyBac integration site were mfs12 (5’CCTCGATATACAGACCGATAAAACAC)/P139 (5’CTTTTATCGAATTCCTGCAGC) (iPCR) and mfs34 (5’CGTACGTCACAATATGATTATCTTTCTAGG)/P139 (nPCR), and for probing the 5’ piggyBac integration site mfs10 (5’ACGACCGCGTGAGTCAAAATGACG)/ mfs11 (5’ATCAGTGACACTTACCGCATTGACA) (iPCR) and mfs10/mfs31 (5’CGACTGAGATGTCCTAAATGCACAG) (nPCR).

Minimal transformation efficiency was calculated as the number of obtained independent transgenic lines divided by the total number of adult G₀ survivors of each injection. The actual transformation efficiency in several cases was higher than the numbers reported here for several reasons. All emerged G₀ adults were counted for efficiency calculation, including sterile individuals who are often excluded from such calculations; this was necessary to avoid bias in efficiency calculation between the individual backcross and the group backcross experiments, where sterile individuals would not have been detected. Moreover, not all potentially present independent integration events were detected because i) only the individuals with CN = 1 were analyzed for their genomic integration site by inverse PCR. Thus, potentially different integration events in individuals with CN > 1 were not detected; ii) only a subset of positive G₁ offspring of most G₀ families was individually backcrossed and analyzed, while the rest was group backcrossed and kept as backup; iii) in some experiments with lots of positive G₀ families not all families were further characterized (V19, V369, V370); iv) some G₁ found dead in cages did not produced sufficient quality DNA for digital and inverse PCR. Finally, it has to be noted that individual backcrossing in V369 and V370 injections was only started at the G₃ generation after two generations of group backcrosses of positive individuals. Not all positive G₁ were used for backcrossing. Some integration events might have been lost.

Differences in fitness parameters and transgenesis efficiencies between phsp-pBac and phsp-HypB injections or helper plasmid and helper mRNA injections were analyzed with single factor ANOVA, at alpha = 0.05.

The following supporting information can be downloaded at the website of this paper posted on Preprints.org. Table S2: Comparative pBac helper plasmid and pBac mRNA injection data in Ae. aegypti. Data from 13 injection experiments using the phsp-pBac helper plasmid over six years and nine injection experiments using capped pBac mRNA over five years are displayed. Exp. 1-13 are identical to the ones shown in Suppl. Table S1. Exp. 12, 13, 21, and 22 were performed in parallel with eggs from the same female cohort. Injections 14 and 15 were performed in the WT Orlando laboratory strain and all other injections in the Higgs White Eye strain. Both V368 plasmid helper injections (# 12, 13) yielded just 14 adult survivors versus 34 from the mRNA helper injections. Therefore, a larger experiment might have produced transgenic offspring from the plasmid injections. It can still be said with confidence, however, that the transposition efficiency is much lower than that using mRNA, as with an average of one transgenic event per three G₀ adults, at a similar efficiency to the mRNA injections, the plasmid injections should have resulted in five to seven independent transgenic events for these 14 G₀. “no. injected embryos” represents the number of black embryos 24 h post injection; “hatch rate” = no. larvae / no. black eggs (%); “eclosion rate” = no. adults / no. larvae (%), “no. single/group crossed” shows the number of G₀ backcrossed individually or in groups, respectively. “group size” refers to the number of G₀ individuals per family; “no. transgenic events” refers to the number of independent transposition events observed, which can be higher than the number of transgenic families if more than one founder per family was positive or/and if more than one independent event occurred in a G₀ individual. In the case of the mRNA injections, these numbers are given as minimal numbers, as in none of the families all positive G₁ offspring were analyzed molecularly. Therefore, additional independent transformation events might have been missed. This is especially the case for the V369 and V370 injections, where G₀ were backcrossed mostly in large groups, and only a small subset of G₃ of some of the positive families analyzed molecularly; “total number G₁ of transg. fam.” refers to the total number of G₁ screened across all positive families; “no. pos. G₁ of transg. fam.” refers to the number of positive G₁ across all positive families within one injection experiment; “G₁ with multiple integrations” = given is the number of G₁ individuals with more than one donor construct integration out of the total number of G₁ analyzed molecularly; “max. no. integr. / individual” = max. number of donor construct integrations detected within one individual by ddPCR; “transf. eff.” is the minimal transformation efficiency, calculated as: number of independent transgenic events/ total number of G₀ adults. The transformation efficiency in several families is assumed to be higher (see text). n.a. = not applicable; n.d. = not determined; avg = average; M = male; F = female. Table S3: Integration event analysis in pBac mRNA injections in Ae. aegypti. The detailed backcrossing schemes and integration event analysis are shown for the positive G₁, G₂, and G₃ generations of the pBac mRNA injections. The integration copy number was determined by ddPCR. Subsequently, the genomic integration position for individuals with only one integration was determined by inverse PCR. Individuals with more than one integration (by ddPCR) were not further investigated by iPCR for the genomic integration site. For the injections of the donor plasmids V369 and V370, the individual backcrossing of positive individuals was started at the G₃ generation due to limited rearing capacity in the G₁ and G₂ generations. The positive G₁ and G₂ individuals were backcrossed to the parental WT line (HWE) as male or female groups. This most likely is the reason why in these two injections, only one to two copies of the donor plasmid per individual were counted by ddPCR, as integrations located on different chromosomes or with sufficient distance on the same chromosome will have segregated in the G₁ and G₂ generation backcrosses. Table S4: Determination of the fertility rate of microinjected Ae. aegypti G₀ adults. Across all injections with pBac helper plasmid or mRNA, the experiments with single G₀ backcrosses were identified. If three or more G₀ were individually backcrossed in one experiment, it was included in this table to determine the G₀ fertility in the individual backcrosses. The information regarding the total number of individually backcrossed G₀, the number of fertile individual G₀ founders, and the percentage of fertile individual founders is boxed. The percentage of fertile G₀ individuals was calculated as no. of fertile single founder families / no. indiv. backcrossed G₀ adults * 100. Table S5: pBac mRNA injection data in Ae. albopictus. Displayed are detailed data from an injection experiment using capped pBac mRNA. “no. injected embryos” represents the number of black embryos 24 h post injection; “hatch rate” = no. larvae / no. black eggs (%); “eclosion rate” = no. adults / no. larvae (%), “no. single/group crossed” shows the number of G₀ backcrossed individually or in groups, respectively. “group size” refers to the number of G₀ individuals per family; “no. transgenic events” refers to the number of independent transposition events observed, which can be higher than the number of transgenic families if more than one founder per family was positive or/and if more than one independent event occurred in a G₀ individual. These numbers are given as minimal numbers, as the positive G₁ offspring were not analyzed molecularly. Therefore, additional independent transformation events were likely missed, because G₀ individuals were backcrossed in large groups; “total number G₁ of transg. fam.” refers to the total number of G₁ screened across all positive families; “no. pos. G₁ of transg. fam.” refers to the number of positive G₁ across all positive families within one injection experiment; “G₁ with multiple integrations” = given is the number of G₁ individuals with more than one donor construct integration out of the total number of G₁ analyzed molecularly; “max. no. integr. / individual” = max. number of donor construct integrations detected within one individual by ddPCR; “transf. eff.” is the minimal transformation efficiency, calculated as: number of independent transgenic events/ total number of G₀ adults. The transformation efficiency in several families is assumed to be higher (see above). n.a. = not applicable; n.d. = not determined; avg = average; M = male; F = female. Table S6: Comparison of phiC31-RMCE injection data in Ae. aegypti using phsp-phiC31 helper plasmid or capped phiC31 mRNA. Displayed are data from comparative injection experiments at two different helper/donor concentrations into the same landing site line (LSL) (exp. 1 -9); previous phiC31-RMCE injections with the helper plasmid (exp I – V) had been performed in different landing site lines and at different helper/donor concentrations (400/600 and 200/300 ng/µl). The landing site line used in exp. I – III turned out to have two linked, non-segregating landing site construct integrations, as determined by ddPCR after the injections had been performed. Therefore, in some individuals, we found an RMCE event at one landing site and an integration event at the other landing site. These were counted here only as one recombination event per individual. The LSL used for exp. IV and V had only one genomic integration site; “no. injected embryos” represents the number of black embryos 24 h post injection; “hatch rate” = no. larvae / no. black eggs (%); “eclosion rate” = no. adults / no. larvae (%), “no. transg. events” is the number of independent recombination events observed; “recomb. eff.” is the minimal recombination efficiency, calculated as: number of transgenic events/ total number of G₀ adults. The recombination efficiency can be higher, as in group backcrosses of G_0, the number of infertile G₀ is unknown. M = male; F = female; a) RMCE phenotype; one additional family with transient donor phenotype that showed parental phenotype in next generation; b) both integration events; c) one family with transient donor phenotype that showed parental phenotype in next generation; d) all injected eggs counted; e) mixed larvae either from the 400/600 or 200/300 injection; f) 2 RMCE and 2 integration events; g) 1 RMCE and 1 integration event. Table S7: Comparison of Cre-RMCE injection data in Ae. aegypti using phsp-Cre helper plasmid or capped Cre mRNA. Data from comparative injection experiments are displayed at two different helper/donor concentrations into the same landing site line; “no. injected embryos” represents the number of black embryos 24 h post injection; “hatch rate” = no. larvae / no. black eggs (%); “eclosion rate” = no. adults / no. larvae (%); “no. transg. events” is the number of independent recombination events observed; “recomb. eff.” is the minimal recombination efficiency, calculated as: number of transgenic events/ total number of G₀ adults. The actual recombination efficiency can be higher, as in group backcrosses of G_0, the number of infertile G₀ isn’t known; M = male; F = female. Table S8: Comparison of Cre-RMCE injection data in Ae. albopictus using phsp-Cre helper plasmid or capped Cre mRNA. Displayed are data from comparative injection experiments. Plasmid helper injections were performed into two different landing site lines. Exp. 1 was performed with LSL line 1A3, where the landing-site construct integrated 1.3 Mbp upstream of the Nix locus. Thus, all injected embryos were heterozygous for the landing site. Exp. 2 was performed with LSL line 17A1; “no. injected embryos” represents the number of black embryos 24 h post-injection; “hatch rate” = no. larvae / no. black eggs (%); “eclosion rate” = no. adults / no. larvae (%); “total number G₁ of transg. fam.” refers to the total number of G₁ screened across all positive families; “no. pos. G₁ of transg. fam.” refers to the number of positive G₁ across all positive families within one injection experiment; “no. transg. events” is the number of independent recombination events observed; “recomb. eff.” is the minimal recombination efficiency, calculated as: number of transgenic events/ total number of G₀ adults. The recombination efficiency can be higher, as in group backcrosses of G_0, the number of infertile G₀ isn’t known; M = male; F = female. Figure S1: Effect of phsp-pBac helper plasmid and phsp-hyPB helper plasmid in Ae. aegypti and D. suzukii. Box and whisker plots (exclusive median) are displayed on the data presented in Table 1 and Table 2 for Ae. aegypti larval hatch rate (a), G₀ adult eclosion rate (b), G₀ fertility (percentage of fertile G₀ families in each experiment) (c), and the minimal transformation efficiency (%) (d), as well as D. suzukii larval hatch rate (e), G₀ adult eclosion rate (f),) and the minimal transformation efficiency (%) (g). The horizontal line represents the median, the cross (x) represents the mean; n.s. = no significant difference (p > 0.05, single factor ANOVA). Figure S2: Effect of phsp-phiC31 helper plasmid and phiC31 mRNA injections in Ae. aegypti on larval hatch rate (a), G₀ adult eclosion rate (b), G₀ fertility (c), and the minimal transformation efficiency (%) (d). Results from injections at low (150/300 ng/µl, exp. 1-5, Table 5) and high (300/500 ng/µl, exp. 6-9, Table 5) helper/donor concentrations were combined for data analysis. Box and whisker plots (exclusive median) are displayed in the data presented in Table 4. The horizontal line represents the median, the cross represents the mean; n.s. = no significant difference (p > 0.05, single factor ANOVA). .