1. Introduction

2. Materials and Methods

2.1. Samples

Ten avipoxvirus positive samples were detected at INIAV since 2017. Those positive samples were preserved at -80°C.

Table 1. Avipoxvirus positive samples diagnosed at INIAV since 2017 and used in this study.

Table 1. Avipoxvirus positive samples diagnosed at INIAV since 2017 and used in this study.

Host		Sequence ID	Accesion number	Country	Collection date	Isolation source
Common name	Scientific name
Flamingo	Phoenicopterus ruber	24569-17	OQ615872	Portugal: Lisboa	26/Sep/17	Pool of organs
Chicken	Gallus gallus	23049-18	OQ615873	Portugal: Porto Santo, Madeira	24/Jul/18	Pool of organs
Puffin	Fratercula	11612-19	OQ615874	Portugal: Lisboa	16/Apr/19	Cutaneous lesion
Canary	Serinus canaria	37026-19	OQ615875	Portugal: Freixianda, Ourém	22/Nov/19	Pool of organs
Canary	Serinus canaria	03779-20	OQ615876	Portugal	04/Feb/20	Pool of organs
Chicken	Gallus gallus	04482-20	OQ615877	Portugal	11/Feb/20	Cutaneous lesion
Blackbird	Turdus merula	16735-20	OQ615878	Portugal	09/Jun/20	Cutaneous lesion
Chicken	Gallus gallus	P-08508-21	OQ615879	Portugal: Maia, Porto	22/Sep/21	Pool of organs
Penguin	Spheniscidae	P-09292-22	OQ615880	Portugal: Avintes, Porto	17/Oct/22	Pool of organs
Chicken	Gallus gallus	00917-23	OQ615881	Portugal: Évora	16/Jan/23	Pool of organs

2.3. PCR amplification of P4b gene fragment

The amplification of the P4b gene fragment was performed by conventional PCR with primers described by Huw Lee and Hwa Lee [18], using NZYTaq II 2x Green Master Mix (0.2 U/μL) (NZYTech, Portugal). The reaction contained 0.5 μL of each primer (50 pmol/μL) (Table 2) and 5 μL of DNA, in a total of 25 μL. The PCR program was executed in an UNO II thermocycler thermoblock (Biometra, Germany) and consisted of an initial denaturation at 95°C for 2 min, followed by 50 cycles of denaturation at 95°C for 30 s, annealing at 60°C for 40 s, and extension at 72°C for 1 min. A final extension was performed at 72°C for 10 min. The PCR product was separated by a 1% agarose gel electrophoresis stained with GreenSafe Premium (NZYTech, Portugal). The expected fragments of 578 bp, corresponding to the P4b gene amplified fragment were excised and purified using NZYGelpure Kit (NZYTech, Portugal), according to the manufacturer’s instructions.

Table 2. Sequences of P4b primers used in PCR reactions, described by Huw Lee and Hwa Lee [18].

Table 2. Sequences of P4b primers used in PCR reactions, described by Huw Lee and Hwa Lee [18].

Primer	Sequence	bp	Tm (°C)	% GC
Pox-VP1	5’ – CAGCAGGTGCTAAACAACAA – 3’	20	62	45
Pox-VP2	5’ – CGGTAGCTTAACGCCGAATA – 3’	20	64	50

2.5. Phylogenetic analysis

To study the phylogenetic origin of the avipoxviruses detected and their phylogenetic relationship with the sequences published in GenBank (Table 3), a multiple alignment between them was performed using ClustalW method. Sequences from different countries, years, and clades were chosen, in order to get a reliable analysis. To generate the phylogenetic trees, maximum likelihood, neighbor-joining, and bayesian methods were used. Each tree was produced using MEGA11 with the Tamura 3-parameter G+I, determined as the best fit model also by MEGA11, and 1000 bootstrap replicates.

Table 3. Details of APVs sequences published in GenBank and used in this study.

Table 3. Details of APVs sequences published in GenBank and used in this study.

Host		Accesion number	Country	Collection date	Clade
Common name	Scientific name
Turkey	Meleagris gallopavo	AY530304	Germany	2001	A1
Silver pheasant	Lophura nycthemera	HM481406	India	2008	A1
Chicken	Gallus gallus	KF722860	Tanzania	2012	A1
Chicken	Gallus gallus	KM974727	Portugal	2013	A1
Chicken	Gallus gallus	KP987214	Nigeria	2013	A1
Backyard turkey	Meleagris gallopavo	KU522210	Iran	2015	A1
Quail	Coturnix coturnix	DQ873809	India	-	A2
Indian little brown dove	Spilopelia senegalensis	HM481408	India	2009	A2
Eurasian stone-curlew	Burhinus oedicnemus	HM627224	Spain	1980	A2
Rock dove	Columba livia	KC017966	USA	1995	A2
Indian peafowl	Pavo cristatus	KC017975	Hungary	2003	A2
Booted eagle	Hieraaetus pennatus	KC017976	Spain	2000	A2
Pigeon	Columbidae	KJ913659	Tanzania	2013	A2
Wood-pigeon	Columba palumbus	EU798994	Czech Republic	2008	A3
Pelagic cormorant	Phalacrocorax pelagicus	KC017982	USA	1989	A3
Eurasian eagle owl	Bubo bubo	KC017983	South Korea	-	A3
Common murre	Uria aalge	KC017985	USA	1991	A3
Laysan albatross	Phoebastria immutabilis	KC017986	USA	1983	A3
Magellanic penguin	Spheniscus magellanicus	KC017987	Argentina	2007	A3
Falcon	Falco sp.	AY530306	United Arab Emirates	2002	A4
Red-footed falcon	Falco vespertinus	KC017989	Hungary	2007	A4
Trumpeter swan	Cygnus buccinator	KC017990	USA	1991	A5
Mottled duck	Anas fulvigula	KC017991	USA	2005	A5
Redhead duck	Aythya americana	KC017993	USA	1991	A5
Trumpeter swan	Cygnus buccinator	KC017995	USA	1989	A5
Wood duck	Aix sponsa	KC017996	USA	1991	A5
Domestic mallard duck	Anas platyrhynchos	KJ192189	China	2013	A5
Mourning dove	Zenaida macroura	KC018000	USA	1987	A6
Canada goose	Branta canadensis	KC018002	USA	1992	A6
Common buzzard	Buteo buteo	KC018009	Hungary	2000	A7
Stone curlew	Burhinidae	AY530310	United Arab Emirates	1998	B1
Palila	Loxioides bailleui	EF568381	USA	-	B1
Amakihi	Hemignathus virens	EF568401	USA	-	B1
Blue jay	Cyanocitta cristata	GQ487567	Canada	1998	B1
Canary	Serinus canaria	GU108510	Austria	2009	B1
Red crossbill	Loxia curvirostra	HM627227	Spain	1930	B1
Golden eagle	Aquila chrysaetos	KC018058	Spain	2000	B1
House sparrow	Passer domesticus	HM627220	Marocco	2009	B2
Flamingo	Phoenicopterus ruber	HQ875129	Portugal	2010	B2
Great bustard	Otis tarda	KC018066	Hungary	2005	B2
American crow	Corvus brachyrhynchos	DQ131891	USA	2003	B3
House finch	Haemorhous mexicanus	DQ131896	USA	2003	B3
Great blue heron	Ardea herodias	DQ131898	USA	2004	B3
Northern cardinal	Cardinalis cardinalis	DQ131899	USA	2003	B3
Red-tailed hawk	Buteo jamaicensis	DQ131901	USA	2003	B3
Chicken	Gallus gallus	AM050382	United Kingdom	1986	C
Parrot	Psittaciformes	AM050383	United Kingdom	1989	C
Lovebird	Agapornis	AY530311	Germany	-	C
Yellow-crowned amazon	Amazona ochrocephala	KC018069	USA	1980	C
Quail	Coturnix coturnix	GQ180200	Italy	-	D
Chicken	Gallus gallus	MW349699	Brazil	2019	E
Chicken	Gallus gallus	MW349701	Brazil	2019	E
Domestic mallard duck	Anas platyrhynchos	KJ192189	China	2013	A5
Mourning dove	Zenaida macroura	KC018000	USA	1987	A6

3. Results and Discussion

3.1. PCR amplification of P4b gene fragment

The amplification of the 578 bp P4b gene fragment was confirmed by 1% agarose gel electrophoresis. The results obtained are shown in Figure 1. It is possible to observe the presence of the expected fragment in all lanes except lanes 3, 4, and 5, which correspond to samples 11612-19 (puffin), 37026-19 (canary), and 03779-20 (canary), respectively. Amplification of DNA from samples 37026-19 and 03779-20 obtained in a previous extraction process was achieved (lanes 11 and 12) (Figure 1a). A new PCR reaction led to the amplification of the sample 11612-19 (Figure 1b).

Figure 1. 1% agarose gel electrophoresis of the 578 bp P4b gene fragment PCR amplification. (a) Lane 1 corresponds to the molecular weight marker, NZYDNA Ladder V (NZYTech, Portugal). Lanes 2 to 9 correspond to the amplification of samples 24569-17 (flamingo), 11612-19 (puffin), 37026-19 (canary), 03779-20 (canary), 04482-20 (chicken), 16735-20 (blackbird), P-08508-21 (chicken), and 23049-18 (chicken), respectively. Lane 10 is the negative control. Lanes 11 and 12 correspond to samples 37026-19 (canary) and 03779-20 (canary) obtained in a previous extraction. (b) Lane 1 corresponds to the molecular weight marker, NZYDNA Ladder V. Lanes 2 and 3 correspond to sample 11612-19 (puffin) from different extraction reactions. Lanes 4 and 5 are the negative and positive controls, respectively.

Figure 1. 1% agarose gel electrophoresis of the 578 bp P4b gene fragment PCR amplification. (a) Lane 1 corresponds to the molecular weight marker, NZYDNA Ladder V (NZYTech, Portugal). Lanes 2 to 9 correspond to the amplification of samples 24569-17 (flamingo), 11612-19 (puffin), 37026-19 (canary), 03779-20 (canary), 04482-20 (chicken), 16735-20 (blackbird), P-08508-21 (chicken), and 23049-18 (chicken), respectively. Lane 10 is the negative control. Lanes 11 and 12 correspond to samples 37026-19 (canary) and 03779-20 (canary) obtained in a previous extraction. (b) Lane 1 corresponds to the molecular weight marker, NZYDNA Ladder V. Lanes 2 and 3 correspond to sample 11612-19 (puffin) from different extraction reactions. Lanes 4 and 5 are the negative and positive controls, respectively.

3.2. P4b gene fragment sequencing

The alignment of forward and reverse nucleotide sequences obtained, originated a sequence of 538 bp for all samples, except for sample 03779-20 (canary), after removing the primers sequences. Due to incomplete sequencing of the 3' end, only 513 bp were obtained for this sample. This result can be explained by DNA damage, incorrect amplification, or inadequate purification.

The representation of the alignment between the studied sequences is present in Figure 2, and its analysis is done in the following section, together with the phylogenetic analysis.

Figure 2. Alignment of the studied sequences.

Figure 2. Alignment of the studied sequences.

3.3. Phylogenetic analysis

The avipoxvirus nucleotide sequences obtained were phylogenetically analyzed using different algorithms, specifically maximum likelihood, neighbor-joining, and bayesian analysis. The three algorithms originated phylogenetic trees with similar topologies. However, the maximum likelihood tree originated a better resolution of the sequences, and therefore this was the chosen method (Figure 3). The phylogenetic tree obtained, including representatives from all subclades (except B4), shows that clades C and D have a common most recent ancestor, as observed in previous studies [5,14].

The phylogenetic analysis reveals that the samples from Portugal are quite distributed, with five samples belonging to subclade A1, one to subclade A2, three to subclade B1, and one to subclade B3. Moreover, their distribution is quite consistent with the nomenclature given, since samples from Gallus gallus belong to the fowlpox clade (clade A), while samples from Turdus merula and Serinus canaria, both passeriformes, belong to the canarypox clade (clade B). Phoenicopterus ruber, Fratercula, and Spheniscidae are not fowl or Passeriformes representatives. The viruses detected in the first two hosts were included in the fowlpox clade, while the penguinpox virus belongs to the canarypox clade.

When comparing the alignment (Figure 2) and the percent identity matrix of the sequences obtained in this study (Table 4), several conclusions can be reached. Sample 16735-20 (blackbird) is the most distinct of all, as it has several different nucleotides along the entire sequence. Therefore, it has a very low identity percentage relative to all the other sequences, with the highest identity percentage value being only 81.60%. The nucleotide sequence of sample 24569-17 (flamingo) is the second most distinct sequence, showing a maximum identity percentage of 90.52%. In addition, it contains an extra valine codon at position 23.

By comparing the alignment of all the sequences present in the phylogenetic tree, it is observable that sample 16735-20 (blackbird) has two unique mutations. It contains a cytosine in position nt 63 instead of a thymine, and a thymine at position nt 148, instead of a guanine or an adenine.

Interestingly, when analyzing the percentage identity matrix between the sequences of the A1 subclade, it can be observed that the puffin (Fratercula) isolate sequence is not completely identical with any other sequence, but the identity percentages are quite high, showing that the sequences are very similar.

On the other hand, all the chicken (Gallus gallus) isolates have an identity percentage of 100%, except sample sequence 04482-20. Yet the identity percentage is still very high, 99.63%, with only two nucleotides differing. It can also be observed that the sequences of the samples isolated from turkey (Meleagris, Germany, 2001) and wild turkey (Meleagris gallopavo, Iran, 2015) are also similar to those isolated from chickens. By analyzing the position of the remaining sequences in the phylogenetic tree, it is possible to verify the presence of samples isolated from chickens also in subclades C and E. When comparing those of subclade A1 with these, it is found that the percentage of identity is quite low, approximately 74%, confirming the classification in different clades.

Regarding the sequences of A2 subclade, it is possible to observe that the sequence of the sample isolated from the flamingo (Phoenicopterus ruber) is different from all the other sequences. However, the percentages are quite high, varying between 92.15% (pigeon) (Columbia livia, USA, 1995) and 99.63% (pigeon) (Columbidae, Tanzania, 2013). Additionally, it can be seen that both APVs isolated from flamingos in Portugal belong to different clades, the one from 2010 belongs to B2 and the one from 2017 to A2. Indeed, the identity percentage between them is only 75.84%. When they are aligned, it can be noticed that the 2010 sequence has an extra isoleucine codon at position nt 24, while the 2017 has an extra phenylalanine codon at location nt 60.

The analysis of the sequences of subclade B1 shows that both isolates of canaries (Serinus canaria) from Portugal share the same nucleotide sequence. The canary’s isolate from Austria is not 100% identical with these canaries’ sequences, however it is very similar, having an identity percentage of 99.81%, with only one nucleotide differing. The sequence from the penguin (Spheniscidae) isolate is 100% identical with the sequences from three other isolates, the golden eagle isolate (Aquila chrysaetos, Spain, 2000), the stone-curlew isolate (Burhinidae, United Arab Emirates, 1998) and the crossbill isolate (Loxia curvirostra, Spain, 1930). Comparing the sequence of the avipoxvirus isolated from the penguin in Portugal with the one from Argentina, it is found that they are classified in distinct subclades, B1 and A3, respectively. These two sequences show several mutations between them, showing a percentage of identity of only 72.68%.

Comparing the sequences of the B3 subclade, it is possible to verify that the blackbird (Turdus merula) isolate sequence is not completely identical with any other sequence. However, the percentage of identity is quite high among all of the sequences (97.03% to 97.58%).

The results of this study indicate that the APVs circulating in Portugal in chickens and canaries are quite similar, since the nucleotide sequences of the isolates did not undergo considerable changes. However, the isolates from flamingos show the opposite situation, since the virus that circulated in 2010 is very different from that circulating in 2017. This suggests the occurrence of a second viral introduction in Portugal. Finally, as the nucleotide sequence of the isolate from penguin is very similar to that isolated from golden eagle, stone-curlew, and crossbill, it is possible to hypothesize that there was a third viral introduction in Portugal.

Figure 3. Evolutionary analysis by Maximum Likelihood method. The evolutionary history was inferred by using the Maximum Likelihood method and Tamura 3-parameter model [19]. The tree with the highest log likelihood (-3505.45) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories (+G, parameter = 1.4400)). The rate variation model allowed for some sites to be evolutionarily invariable ([+I], 36.73% sites). The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. This analysis involved 62 nucleotide sequences. Codon positions included were 1st+2nd+3rd+Noncoding. There were a total of 485 positions in the final dataset. Evolutionary analyses were conducted in MEGA X [20].

Figure 3. Evolutionary analysis by Maximum Likelihood method. The evolutionary history was inferred by using the Maximum Likelihood method and Tamura 3-parameter model [19]. The tree with the highest log likelihood (-3505.45) is shown. The percentage of trees in which the associated taxa clustered together is shown next to the branches. Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood (MCL) approach, and then selecting the topology with superior log likelihood value. A discrete Gamma distribution was used to model evolutionary rate differences among sites (5 categories (+G, parameter = 1.4400)). The rate variation model allowed for some sites to be evolutionarily invariable ([+I], 36.73% sites). The tree is drawn to scale, with branch lengths measured in the number of substitutions per site. This analysis involved 62 nucleotide sequences. Codon positions included were 1st+2nd+3rd+Noncoding. There were a total of 485 positions in the final dataset. Evolutionary analyses were conducted in MEGA X [20].

Table 4. Percent identity matrix between APVs sequences isolated in this study.

Table 4. Percent identity matrix between APVs sequences isolated in this study.

		1	2	3	4	5	6	7	8	9	10
1	Phoenicopterus ruber (24569-17)		90.52	89.78	89.78	89.78	90.15	75.46	72.68	73.05	72.71
2	Fratercula (11612-19)	90.52		99.26	99.26	99.26	98.88	76.39	74.54	74.91	74.66
3	Gallus gallus (23049-18)	89.78	99.26		100.00	100.00	99.63	76.21	74.35	74.72	74.46
4	Gallus gallus (P-08508-21)	89.78	99.26	100.00		100.00	99.63	76.21	74.35	74.72	74.46
5	Gallus gallus (00917-23)	89.78	99.26	100.00	100.00		99.63	76.21	74.35	74.72	74.46
6	Gallus gallus (04482-20)	90.15	98.88	99.63	99.63	99.63		76.39	74.72	75.09	74.85
7	Turdus merula (16735-20)	75.46	76.39	76.21	76.21	76.21	76.39		81.60	81.60	81.48
8	Spheniscidae (P-09292-22)	72.68	74.54	74.35	74.35	74.35	74.72	81.60		99.63	99.81
9	Serinus canaria (37026-19)	73.05	74.91	74.72	74.72	74.72	75.09	81.60	99.63		100.00
10	Serinus canaria (03779-20)	72.71	74.66	74.46	74.46	74.46	74.85	81.48	99.81	100.00

4. Conclusions

References

1. Murphy, F.A.; Gibbs, E.P.J.; Horzinek, M.C.; Studdert, M.J. Veterinary Virology; 3rd ed.; Academic Press: San Diego, 1999; ISBN 978-0-12-511340-3.
2. Brennan, G.; Stoian, A.M.M.; Yu, H.; Rahman, M.J.; Banerjee, S.; Stroup, J.N.; Park, C.; Tazi, L.; Rothenburg, S. Molecular Mechanisms of Poxvirus Evolution. mBio 2023, 14. [Google Scholar] [CrossRef] [PubMed]
3. Sarker, S.; Athukorala, A.; Raidal, S.R. Molecular Characterisation of a Novel Pathogenic Avipoxvirus from an Australian Passerine Bird, Mudlark (Grallina Cyanoleuca). Virology 2021, 554, 66–74. [Google Scholar] [CrossRef] [PubMed]
4. Manarolla, G.; Pisoni, G.; Sironi, G.; Rampin, T. Molecular Biological Characterization of Avian Poxvirus Strains Isolated from Different Avian Species. Vet. Microbiol. 2010, 140, 1–8. [Google Scholar] [CrossRef] [PubMed]
5. Chacón, R.D.; Astolfi-Ferreira, C.S.; Pereira, P.C.; Assayag, M.S.; Campos-Salazar, A.B.; De la Torre, D.; de Sá, L.R.M.; de Almeida, S.R.Y.; Rici, R.E.G.; Piantino Ferreira, A.J. Outbreaks of Avipoxvirus Clade E in Vaccinated Broiler Breeders with Exacerbated Beak Injuries and Sex Differences in Severity. Viruses 2022, 14. [Google Scholar] [CrossRef] [PubMed]
6. Mapaco, L.P.; Lacerda, Z.; Monjane, I.V.A.; Gelaye, E.; Sussuro, A.H.; Viljoen, G.J.; Dundon, W.G.; Achá, S.J. Identification of Clade E Avipoxvirus, Mozambique, 2016. Emerg. Infect. Dis. 2017, 23, 1602–1604. [Google Scholar] [CrossRef] [PubMed]
7. Bányai, K.; Palya, V.; Dénes, B.; Glávits, R.; Ivanics, É.; Horváth, B.; Farkas, S.L.; Marton, S.; Bálint, Á.; Gyuranecz, M.; et al. Unique Genomic Organization of a Novel Avipoxvirus Detected in Turkey (Meleagris Gallopavo). Infect. Genet. Evol. 2015, 35, 221–229. [Google Scholar] [CrossRef] [PubMed]
8. Recent Advances in Animal Virology; Malik, Y.S., Singh, R.K., Yadav, M.P., Eds.; Springer Singapore: Singapore, 2019; ISBN 9789811390722.
9. Bolte, A.L.; Meurer, J.; Kaleta, E.F. Avian Host Spectrum of Avipoxviruses. Avian Pathol. 1999, 28, 415–432. [Google Scholar] [CrossRef] [PubMed]
10. Henriques, A.M.; Fagulha, T.; Duarte, M.; Ramos, F.; Barros, S.C.; Luís, T.; Bernardino, R.; Fernandes, T.L.; Lapão, N.; Da Silva, J.F.; et al. Avian Poxvirus Infection in a Flamingo (Phoenicopterus Ruber) of the Lisbon Zoo. J. Zoo Wildl. Med. 2016, 47, 161–174. [Google Scholar] [CrossRef] [PubMed]
11. Wittek, R. Organization and Expression of the Poxvirus Genome. Experientia 1982, 38, 285–297. [Google Scholar] [CrossRef] [PubMed]
12. Jarmin, S.; Manvell, R.; Gough, R.E.; Laidlaw, S.M.; Skinner, M.A. Avipoxvirus Phylogenetics: Identification of a PCR Length Polymorphism That Discriminates between the Two Major Clades. J. Gen. Virol. 2006, 87, 2191–2201. [Google Scholar] [CrossRef] [PubMed]
13. Kirubaharan, J.J.; Rajasekaran, R.; Shilpa, P.; Vidhya, M.; Rajalakshmi, S. Isolation, Molecular Detection and Phylogenetic Analysis of Avipox Virus Obtained from Pigeon. Indian J. Vet. Sci. Biotechnol. 2018, 14. [Google Scholar] [CrossRef]
14. Van Der Meer, C.S.; Paulino, P.G.; Jardim, T.H.A.; Senne, N.A.; Araujo, T.R.; Dos Santos Juliano, D.; Massard, C.L.; Peixoto, M.P.; Da Costa Angelo, I.; Santos, H.A. Detection and Molecular Characterization of Avipoxvirus in Culex Spp. (Culicidae) Captured in Domestic Areas in Rio de Janeiro, Brazil. Sci. Rep. 2022, 12, 13496. [Google Scholar] [CrossRef] [PubMed]
15. Boyle, D.B. Genus Avipoxvirus. In Poxviruses; Mercer, A.A., Schmidt, A., Weber, O., Eds.; Birkhäuser Basel: Basel, 2007; pp. 217–251. ISBN 978-3-7643-7556-0. [Google Scholar]
16. Ghalyanchilangeroudi, A.; Hosseini, H.; Morshed, R. Molecular Characterization and Phylogenetic Analysis of Avian Pox Virus Isolated from Pet Birds and Commercial Flocks, in Iran. Slov. Vet. Res. 2018, 55. [Google Scholar] [CrossRef]
17. Loc, G.L.; Bertagnoli, S.; Ducatez, M.; Camus-Bouclainville, C.; Guérin, J.-L. Diversity of Avipoxviruses in Captive-Bred Houbara Bustard. Vet. Res. 2014, 45. [Google Scholar] [CrossRef]
18. Lee, L.H.; Lee, K.H. Application of the Polymerase Chain Reaction for the Diagnosis of Fowl Poxvirus Infection. J. Virol. Methods 1997, 63, 113–119. [Google Scholar] [CrossRef] [PubMed]
19. Tamura, K. Estimation of the Number of Nucleotide Substitutions When There Are Strong Transition-Transversion and G+C-Content Biases. Mol. Biol. Evol. 1992. [Google Scholar] [CrossRef]
20. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]