This study discovered two new orthohepadnaviruses in buffalos and hamsters (
Figure 3A). The buffalo hepadnavirus was the closest to the previously reported sheep hepadnavirus [
14]. Hamster hepadnavirus was similar to shrew hepadnaviruses [
17,
18,
19], as they both have similar genomic structures, whereas it was distinct from the newly discovered frog hepadnavirus in mice (
Figure 3B). The hamster in which the virus was identified was a long-tailed pygmy rice rat (
Oligoryzomys longicaudatus) from
Cricetidae family (
Figure 3C). Whether rodent model animals such as Syrian hamsters or Chinese striped hamsters from the same Cricetidae family can be infected by this hamster hepadnavirus thus represents an extremely meaningful question. To assess this possibility, the whole genomic sequences of mouse frog hepadnavirus and hamster hepadnavirus were synthesized and hepadnavirus 1.1-fold replicons were constructed [
42]. In the cell supernatant of Huh7 cells, a peak similar to the hepadnavirus Dane particle peak could be detected at a density of approximately 1.18–1.22 g/mL (
Figure 3D,E). The mouse frog hepadnavirus did not exhibit a corresponding naked particle peak to that observed for human HBV and hamster hepadnavirus at a density of 1.28–1.32 g/mL, indicating that this frog hepadnavirus cannot be released in the form of naked virions. Negative stain electron microscopy showed that hamster hepadnavirus and mouse frog hepadnavirus particles are slightly larger than human HBV, spherical, and 40–60 nm in diameter. However, preliminary mouse and hamster viral infection experiments were unsuccessful for unknown reasons (data not shown). In addition to the hamster hepadnavirus, it is worth noting that a common novel unknown insert sequence in HBV was present in rat, pig, gammarid, yellow croaker, and Varunidae samples (
Figure 3A). As this 39-bp insert sequence (CCCCAACTGGGGTAACCTTTGGGCTCCCCGGGCGCGACC) was first found in gammarids (
Gammarus pisinnus), it was named as gamm-insert (
Figure 3F). The gamm-insert was located before the ATG start codon in the preS gene. To the best of our knowledge, there have been no studies on engineering modifications of the gamm-insert in the preS gene despite its presence in samples from many animals. In addition, the D-genotype HBV preS1 gene exhibited a 33-bp sequence that was absent when compared with other HBV genotypes, corresponding to an 11 aa polypeptide, but the reason for this is currently unknown (
Figure 3H). In this study, two D-genotype HBV genomes were simultaneously identified from a single soil sample. Specifically, soil-soil880-D-aspilia contained the 33-bp insert, while soil-soil880 lacked the insert. The 33-bp insert (TCATGGGAGGTTGGTCATCAAAACCTCGCAAAG) was designated as the aspilia-insert due to its discovery in soil near the flowering plant
Aspilia grazielae. It is possible that the D-genotype HBV found in humans originated from a virus with the aspilia-insert.