Prerpints.org logo
Preprint
Article

An Efficient Trans Complementation System for In Vivo Replication of Defective Poliovirus Mutants

Altmetrics

Downloads

150

Views

94

Comments

0

A peer-reviewed article of this preprint also exists.

supplementary.pdf (2.25MB )

This version is not peer-reviewed

Submitted:

13 March 2024

Posted:

14 March 2024

You are already at the latest version

Alerts
Abstract
The picornavirus genome encodes a large single polyprotein that is processed by viral proteases to form an active replication complex. The replication complex is formed with the viral genome, host proteins, and viral proteins that are produced/translated directly from each of the viral genomes (cis-provided viral proteins). Efficient complementation in vivo of replication complex formation by trans-provided viral proteins, thus exogenous or ectopically expressed viral proteins, remains to be demonstrated. Here we report an efficient trans-complementation system for the replication of defective poliovirus (PV) mutants by a viral polyprotein precursor in HEK 293 cells. Viral 3AB in the polyprotein, but not 2BC, was processed exclusively in cis. Replication of a defective PV replicon mutant, with a disrupted cleavage site for viral 3Cpro protease between 3Cpro and 3Dpol (3C/D[A/G] mutant) could be rescued by a trans-provided viral polyprotein. Only a defect of 3Dpol activity, of the replicon could be rescued in trans; inactivating mutations in 2CATPase/hel, 3B, and 3Cpro of the replicon completely abrogated the trans-rescued replication. An intact N-terminus of the 3Cpro moiety, of the trans-provided 3CDpro, was essential for the trans-rescue activity. By using this trans-complementation system, a high-titer defective PV pseudovirus (> 107 infectious units per mL) could be produced with the defective mutants, whose replication was completely dependent on trans-complementation. This work reveals potential roles of exogenous viral proteins in PV replication and offers insights into protein/protein and protein/RNA interactions during picornavirus infection.
Keywords: 
Subject: Biology and Life Sciences  -   Virology

Importance

Viral polyprotein processing is an elaborately controlled step by viral proteases encoded in the polyprotein; fully processed proteins and processing intermediates need to be correctly produced for replication, which can be detrimentally affected even by a small modification of the polyprotein. Purified/isolated viral proteins can retain their enzymatic activities required for viral replication, such as protease, helicase, polymerase, etc. However, when these proteins of picornavirus are exogenously provided (also called trans-provided) to the viral replication complex with a defective viral genome, replication is generally not rescued/complemented, suggesting the importance of viral proteins endogenously provided (also called cis-provided) to the replication complex. In this study, we discovered that only the viral polymerase activity of poliovirus (the typical member of picornavirus family) could be efficiently rescued by exogenously expressed viral proteins. The current study reveals potential roles for exogenous viral proteins in viral replication and offers insights into interactions during picornavirus infection.

1. Introduction

Picornavirus is a small non-enveloped virus with a positive-sense single-stranded RNA genome of about 7,500 nt, including poliovirus (PV) as the typical member of this family (Enterovirus C species, the genus Enterovirus, in the family Picornaviridae) (1). The genome of PV encodes a single large polyprotein (about 2,200 amino acid[aa] residues) that is subsequently processed into each viral protein, and a small protein derived from an upstream open reading frame (uORF) (2). The polyprotein is initially processed into three precursor proteins, P1 (coding VP4VP2VP3VP1), P2 (coding 2A2B2C), and P3 (coding 3A3B3C3D), by viral proteases (2Apro and 3Cpro/3CDpro/3ABCpro) (3-5). Subsequently, P1 is processed into viral capsid proteins (VP4VP2[VP0], VP3, VP1), P2 is processed into proteins that have roles in viral RNA synthesis and also in virion production/release (2Apro protease, 2B viroporin, 2CATPase/hel ATPase/helicase) (3, 6-10), and P3 is processed into proteins that most directly serve for RNA synthesis (3A [unknown enzymatic function / recruitment of host proteins GBF1/ACBD3/PI4KB], 3B [also known as VPg, the primer for RNA synthesis], 3Cpro proteases, 3Dpol polymerase) (1, 11-17). The uORF protein might pose a tissue-specific role in virus growth in gut epithelial cells (2), thus is absent from some members of enterovirus (EV) (i.e., Enterovirus D and Rhinovirus), which prefer infection in the upper respiratory tract rather than in the gut.
As well as the completely processed viral proteins, processing intermediates, derived from P1, P2 or P3 (i.e., 2BC, 3AB, 3CDpro, etc.) are also produced from the polyprotein. Other processing intermediates that span these precursors (e.g., 2C3AB, 2ABC3AB) are produced but only in trace amounts (18, 19). Both processing intermediates and fully processed proteins have critical roles in replication, such as remodeling of the endoplasmic reticulum by 2BC and 3A (20), stimulation of 3Dpol activity by 3AB (21-23), efficient cleavage of P1 (4), switching of the viral genome from translation to RNA replication (24, 25), and stimulation of uridylylation of 3B by 3CDpro(26). Disruption of each of the processing intermediate was lethal for infectivity (27), indicating the importance of the processing intermediates in replication.
RNA replication of PV predominantly depends on cis-provided viral proteins (28-30). Processing is critically controlled by cis cleavage (i.e., cleavage of the polyprotein by 2Apro/3Cpro/3CDpro/3ABCpro, which are coded in the target polyprotein itself, thus authentic self-cleavage) and by trans cleavage (i.e., cleavage of polyprotein by the 2Apro/3Cpro/3CDpro/3ABCpro, which are coded in polyproteins other than the target polyprotein). Disruptions of the polyprotein downstream of the 2B (27) or introduction of mutations in the 2B2CP3 region without affecting the protease activity (31-35) interfered with cis cleavage, resulting in aberrant processing and lethality of virus, underscoring the importance of cis cleavage in picornavirus replication and of an intact 2B2CP3 precursor. Recently, involvement of a host PI4KB/OSBP family I (OSBP and OSBP2/ORP4) pathway (16, 36) in processing of 3AB was discovered (37-39). The pathway is essential for the development of a viral replication organelle (RO) (40), formation of the replication complex and synthesis of viral plus-strand RNA (41-43), and enhancement of viral growth and infectivity (44). PI4KB and OSBP family I are the target of anti-EV drug candidates (36, 45-50), suggesting that polyprotein processing is a promising target for antiviral development. Enigmatically, processing of 3AB occurs inefficiently especially in the early phase of replication (51); only 4% of 3AB is processed to provide 3A and 3B for RNA synthesis. Interestingly, resistant PV mutants against PI4KB/OSBP inhibitors have mutations in the 3A region, which enhance the processing of 3AB (37, 40), suggesting that cleavage of 3AB or the final products (3A and 3B) could be a target of exogenous intervention to control infection.
Here we have developed an efficient trans rescue system for in vivo replication of defective PV replicons targeting polyprotein processing. We established cell lines that could conditionally express an entire precursor protein and analyzed cis and trans roles of viral proteins. We found that cleavage of 3AB occur exclusively in cis in the polyprotein. Among the defective PV replicon mutants examined, only a mutant (3C/D[A/G]) that has a disrupted cleavage site between 3Cpro and 3Dpol showed an efficient trans-rescued replication and produced pseudovirus at a high titer, comparable to that of the WT replicon. We identified an intact 3CDpro as the minimal protein required for trans rescue.

2. Results

Doxycycline (DOX)-inducible expression of PV non-structural proteins. To analyze the potential role of trans-provided PV proteins in replication, we generated a HEK293 cell line (Tet-AG-PV-2B2CP3[WT]) that could express a polyprotein of PV non-structural proteins (2BC3ABCD) in the presence of DOX (1 mg/L) as a form of an N-terminally Azami green (AG)-fused protein, which allowed a high expression level of protein (52) (Figure 1). Expression of the AG-fused PV polyprotein caused rounded morphology of the cells, similar to the cytopathic effect observed in PV-infected cells. Localization of AG, which is cleaved from the polyprotein by 3Cpro, was in the nucleus and cytoplasm (Figure 1A). In the presence of a reversible 3Cpro inhibitor GC376 (53), a normal morphology of the cells was retained even after protein expression. In the presence of GC376, AG, which remained attached to the polyprotein, showed a dot-like localization in the cytoplasm, in contrast to that of free AG. Processing of the polyprotein was completely inhibited in the presence of GC376 or rupintrivir (also known as AG7088, an irreversible 3Cpro inhibitor) (54), and the polyprotein (161 kDa) remained as an intact precursor (Figure 1A). In the absence of, or at lower concentration of the 3Cpro inhibitors, processing intermediates (P3/3ABCD, 3CDpro) and a fully processed viral protein (3Dpol) was detected by anti-3Dpol antibody similar to those present in PV-infected cells (Figure 1B). These results suggested that Tet-AG-PV-2B2CP3(WT) cells could express a PV polyprotein precursor, which was subsequently processed in the absence of 3Cpro inhibitors.
Trans rescue of replication of defective PV replicons. Next, we attempted to trans rescue defective PV replicon mutants in Tet-AG-PV-2B2CP3(WT) cells (Figure 2A). Tet-AG-PV-2B2CP3(WT) cells were first treated with DOX and GC376 to induce expression of the unprocessed polyprotein. The cells were then washed to remove DOX and GC376, and then were transfected with RNA transcripts of the defective PV replicon mutants. Replication was monitored by firefly luciferase or mCherry reporters encoded in the replicons. PV replicon mutants that have disrupted cleavage sites (aa substitution of the conserved Q/G to A/G in the cleavage site) for 3Cpro between the viral proteins (37, 55, 56), to inhibit production of fully processed viral proteins (i.e., 2Apro, 2B, 2CATPas/hel, 3A, 3B, 3Cpro, and 3Dpol) or lack each of the viral genes were examined (Figure 2B).
In Tet-AG-PV-2B2CP3(WT) cells, without DOX treatment, only the WT and Δ2A mutant could replicate (Figure 3A), consistent with a previous report of a viable 2Apro deletion mutant (57). Other mutants produced only basal levels of signals in the cells, which are derived from initial protein synthesis from transfected RNA transcripts and could not be suppressed in the presence of a PV replication inhibitor GuHCl (a 2CATPas/hel inhibitor), suggesting no replication occurred. In Tet-AG-PV-2B2CP3(WT) cells treated with DOX and GC376 before RNA transfection, interestingly, a mutant (3C/D[A/G]) could replicate as well as the WT and Δ2A mutant. Replication of 2B/C(A/G) and Δ2B mutants could be detected, albeit at low levels (2- to 4-fold increment compared to that in GuHCl-treated cells) (Figure 3B). This suggested that each viral protein (i.e., 2B, 2CATPas/hel, 3A, 3B, 3Cpro, and 3Dpol) is essential for replication and can not be trans complemented. In addition, replication of a defective PV replicon, which could express 3CDpro but not 3Cpro and 3Dpol, could be efficiently trans rescued by a viral polyprotein.
Cis role of viral proteins in the replication of a PV 3C/D(A/G) mutant. Next, to determine the roles of cis-provided viral proteins in PV replication, mutations that inactivate activities of viral proteins were introduced into the 3C/D(A/G) mutant (Figure 4A): 2C-K153A aa substitution that disrupts ATPase activity of 2CATPas/hel) (6), 3B-Y3F aa substitution that inhibits uridylylation of the 3B protein (58), 3C-C147A aa substitution that inactivates the protease activity of 3Cpro/3CDpro by disruption of the catalytic triad (59), and 3D-D328N/D329N, aa substitutions that inactivate the polymerase activity of 3Dpol (60). In Tet-AG-PV-2B2CP3(WT) cells treated with DOX and GC376 before RNA transfection, no replication was observed for mutants with inactivated 2CATPas/hel, 3B, or 3Cpro/3CDpro (Figure 4B). In contrast, a mutant with inactivated 3Dpol (3C/D[A/G]-3D-D328N/D329N) replicated as well as the WT and parental 3C/D(A/G) mutant. This suggested that the polymerase activity of the 3C/D(A/G) mutant can be trans rescued and that cis activities of viral proteins (2CATPas/hel, 3B, and 3Cpro/3CDpro) are essential for replication.
Identification of minimal viral proteins required for trans rescue of the replication of defective PV replicons. Because the polymerase activity seemed to be the target of the trans rescue of the 3C/D(A/G) mutant, we generated a HEK293 cell line (Tet-AG-PV-3CD[WT]) that expresses PV 3CDpro as a form of an N-terminally AG-fused protein in the presence of DOX, which could be self-processed into 3Dpol with an intact N-terminus, which is essential for the polymerase activity (61) (Figure 5A). Fortuitously, a cell line (Tet-AG-PV-3CD[Δ4-5 aa]) that expresses a 3CDpro variant (deletion of aa 4 and 5 of 3Cpro, possibly derived from mutations in the oligo DNAs used for the cloning) was also produced. Both cell lines expressed AG-3CDpro and a processing intermediate 3CDpro and 3Dpol in the presence of DOX (Figure 5B). Surprisingly, replication of the 3C/D(A/G) mutant was rescued only in Tet-AG-PV-3CD(WT) cells, but not in Tet-AG-PV-3CD(Δ4-5 aa) cells (Figure 5C), suggesting that an intact 3CDpro is essential and sufficient for the trans rescue. Expression of N-terminally AG-fused 3Dpol, which could be processed by 3CDpro of the 3C/D(A/G) mutant to give intact 3Dpol, could only partially trans-rescue the replication of this mutant (Figure S1). The WT replicon replicated to similar levels in both cell lines, suggesting that the effect was specific to the trans-rescued replication. To further analyze the specificity of trans-provided PV 3CDpro, we attempted to rescue the replication of enterovirus 71 (EV-A71), which belongs to the Enterovirus A species, thus another species in EV. A mutation that disrupts the 3Cpro cleavage site between 3Cpro and 3Dpol was introduced in an EV-A71 replicon (EV-A71-3C/D[A/G] mutant), and then replication in cells was analyzed (Figure S2). In contrast to the PV replicon mutant, replication of the EV-A71-3C/D(A/G) mutant was not trans rescued by a PV polyprotein or 3CDpro. These results suggested that the intact 3Cpro region of 3CDpro and viral species-specific interaction of 3CDpro is essential for the trans-rescue activity.
Trans rescue of replication of defective PV replicons by 3CDpro. To clarify the role of 3Cpro for the trans rescue activity of 3CDpro, we introduced aa substitutions into the 3Cpro moiety of 3CDpro, focusing on those involved in the binding to viral RNA and phospholipids (4, 24, 26, 62). We introduced 3C-R13N, 3C-K82N, and 3C-R84S aa substitutions into 3CDpro, which abolish the binding to viral RNA and phospholipids (24, 26, 62-64). We also introduced a mutation to disrupt a 3Cpro cleavage site between AG and the 3Cpro region to analyze the effect of potential steric hinderance for the interaction with target molecules around the N-terminus of 3CD pro on the trans rescue.
We generated HEK293 cell lines that could express these 3CDpro variants, and analyzed the trans-rescue activity for PV1(Fluc)pv(3C/D[A/G]) infection (Figure 6A). Unexpectedly, the 3CDpro variants (3C-R13N, 3C-K82N, and 3C-R84S) efficiently rescued the infection, higher than that by the 3CD(Δ4-5 aa) variant. In contrast, the 3CDpro variants with uncleavable AG could not substantially rescue the infection irrespective of the deletion in the N-terminal region of 3Cpro. This suggested that the integrity of N-terminus of 3Cpro, but not the binding activity to viral RNA or phospholipids, is essential for the trans-rescue activity of 3CDpro.
To analyze the effect of N-terminal modification of 3CDpro on the trans activity, we generated HEK293 cell lines that could simultaneously express 3CDpro(WT) or 3CD(Δ4-5 aa) variant with a PV polyprotein (2BC3ABCD), which lacks 3Cpro protease activity with a 3C-C147A aa substitution (59) (Tet-AG-PV-2B2CP3[3C-C147A]+AG-PC-3CD[WT] cells and Tet-AG-PV-2B2CP3[3C-C147A]+AG-PC-3CD[Δ4-5 aa] cells) (Figure 6B). Due to the lack of 3Cpro activity, the polyprotein remained intact without producing processing intermediates, and could not trans-rescue the replication of the 3C/D(A/G]) mutant (Figure S3). Simultaneous expression of this polyprotein with 3CDpro (WT) or 3CDpro (Δ4-5 aa) variant showed similar profiles of the precursor and processing intermediates AG-2BC, 2BC, 2C and 3AB; interestingly, no 3A but only 3AB was observed in these cells, suggesting that 3AB is the target of cis cleavage (Figure 6B). Both 3A and 3AB were observed in Tet-AG-PV-2B2CP3(WT) cells or in PV1pv infected cells. The 3AB protein was detected in the most diluted lysates of infected cells, at levels lower than those in the Tet-AG-PV-2B2CP3[3C-C147A]+AG-PC-3CD(WT) cells and Tet-AG-PV-2B2CP3[3C-C147A]+AG-PC-3CD(Δ4-5 aa) cells, confirming the absence of 3A in these cells. These results suggested that 3CDpro (WT) and 3CDpro(Δ4-5 aa) have similar trans cleavage activities and that processing of 3AB occurs exclusively in cis in the context of the polyprotein.
Production of PV pseudovirus (PVpv) with defective PV replicons. To substantiate the observed high replication level of the defective PV replicons, we attempted to produce PVpv with the defective PV replicons and PV capsid proteins (65) (Figure 7). Replication-competent PV WT replicon could produce PVpv to a titer (107 to 108 infectious units [IU] per mL) comparable to that of PV virus (65, 66).
To produce PVpv, a plasmid expression vector for type 1 PV capsid proteins was transfected into Tet-AG-PV-3CD(WT) cells in the presence of DOX and GC376 (Figure 7A). After expression of the PV capsid proteins and AG-PV-3CD(WT), RNA transcripts of the 3C/D(A/G) mutants, with mCherry or firefly luciferase reporters, were transfected into the cells in the absence of DOX and GC376 for the production of PVpv (PV1[mCherry]pv[3C/D{A/G}] or PV1[Fluc]pv[3C/D{A/G}], respectively). As controls, PVpv were produced with the WT replicons with mCherry or firefly luciferase reporters (PV1[mCherry]pv[WT] or PV1[Fluc]pv[WT], respectively). Typical cytopathic effects were observed in the cells on day 1 post-transfection of the RNA transcripts, then the cells were harvested to determine the titer of PVpv. Collected PVpv was inoculated into Tet-AG-PV-3CD(WT) cells or Tet-AG-PV-3CD(Δ4-5 aa) cells (a control) pre-treated with DOX (or no DOX treatment as a control) before the infection, and then the signals of reporters (fluorescence of mCherry or luciferase activity) in the infected cells were analyzed (Figure 7B). We observed fluorescence of mCherry in the cells infected with PV1(mCherry)pv(WT), irrespective of the DOX treatment and the cell types. In contrast, substantial replication of PV1(mCherry)pv(3C/D[A/G]) was observed only in Tet-AG-PV-3CD(WT) cells after pre-treatment with DOX. The observed titer of PV1(mCherry)pv(3C/D[A/G]) was about 107 IU per mL, thus similar to that of PV1(mCherry)pv(WT). Replication in Tet-AG-PV-3CD(Δ4-5 aa) cells was significantly suppressed; about 1/100-fold or 1/100,000-fold lower than that of the WT replicon, in the presence or absence of DOX, respectively) (Figure 8A), supporting the weak trans-rescue activity of 3CDpro(Δ4-5 aa). Infectivity of PV1(Fluc)pv(3C/D[A/G]) showed similar cell-type specificity and dependency on DOX treatment than that of PV1(mCherry)pv(3C/D[A/G]). To further confirm the presence of PVpv in the preparations, we performed neutralization tests for PV1(mCherry)pv(3C/D[A/G]) with anti-PV antisera (Figure 8B). PV1(mCherry)pv(3C/D[A/G]) was incubated with type-specific anti-PV antibodies (i.e., anti-PV1, PV2, PV3 standard antisera), and then inoculated into Tet-AG-PV-3CD(WT) cells, pre-treated with DOX. Infection of PV1(mCherry)pv(3C/D[A/G]) was inhibited by pre-incubation with anti-PV1 antiserum, but not with anti-PV2 or PV3 antisera, suggesting that the type 1 PV antigenicity is retained on PV1(mCherry)pv(3C/D[A/G]) similar to PVpv produced with the WT replicon (66, 67). These results suggested that replication of defective PV replicons could be efficiently trans rescued and allow production of a high titer PVpv .

3. Discussions

The importance of cis-provided proteins for replication of PV was initially suggested from analysis of defective interfering (DI) particles (28), which have in frame deletions in the capsid-coding region (P1 region) of the genome and retain an intact non-structural protein coding region (P2P3 region) (29). These results suggested that the functions of viral proteins encoded in the P2P3 region could not be complemented by exogenous viral proteins, thus in trans. The cis and trans roles of the viral proteins in replication were intensively studied in the 1990s by trans complementation (or trans rescue) of replication of defective PV mutants (30-33, 37, 68-73). Main conclusions drawn from these studies includes 1) trans rescue of defective PV mutants is inefficient, and 2) a large intact precursor of the non-structural proteins is required for replication. Beside viral proteins, conserved RNA structures, encoded in the P2P3 region, were identified, including the CRE, RNase L ciRNA, α, and β (26, 74-78). The CRE is required for replication in cis as the template for uridylylation of 3B (26, 79), confirming the cis role of the P2P3 region. These properties/roles of non-structural proteins and RNA structures in viral replication are generally conserved in picornavirus (80-84).
To elucidate the role of processing in viral replication, we established cell lines that could conditionally express a large precursor of PV non-structural proteins (2BC3ABCD) and performed trans rescue of defective PV replicons in cells instead of using helper virus/replicon (Figure 1). One major advantage of using these cell lines is the high expression level of the precursor protein in the presence of inhibitors against viral proteins and controllable expression for a short period to avoid cytotoxicity, especially that caused by viral proteases 3Cpro/3CDpro (85, 86). Processing of the 2BC3ABCD precursor gave both final and intermediate products, similar to those observed in PV-infected cells (27) (Figure 1 and Figure 6). We found that 2BC3ABCD could produce 2BC, 2B, 2CATPas/hel and 3AB (thus also 3CDpro) by trans-provided 3CDpro, but the processing of 3AB could occur only in cis (Figure 6), suggesting a possible role of the host PI4KB/OSBP family I pathway in the cis cleavage. In the trans rescue using the cell lines, replication was not detected for most of the mutants examined, except for a mutant with a disrupted cleavage site between 3Cpro and 3Dpol (3C/D[A/G] mutant), which showed comparable level of replication to that of the WT replicon (Figure 2 and Figure 3). This allowed further analysis of the cis role of viral proteins in this mutant, and revealed that only the activity of 3Dpol, but not those of 3B, 2CATPase/hel, or 3Cpro, could be trans rescued (Figure 4). PV 3CDpro lacks RNA polymerase activity (87, 88), thus the 3C/D(A/G) mutant, which could express only 3CDpro but not 3Cpro nor 3Dpol, was predicted to be deficient in polymerase activity irrespective of the introduction of inactivating mutations for 3Dpol activity (Figure 4). Previous reports suggested that 3Dpol activity could be trans rescued but with low efficiencies, similar to the rescue of 2CATPase/hel activity (30, 68, 69). The high expression level of the viral proteins in the cell lines might have improved the efficiency of trans rescue and provided all-or-none replication. Trans complementation of a PV mutant (EG mutant) with a partially defective cleavage site between 3B and 3Cpro has been reported (89), but we could not detect significant replication or trans-rescued replication of the corresponding mutant (3B/C[A/G] mutant, Figure 2 and Figure 3). This might suggest that partial or inefficient cis cleavage between 3B and 3Cpro is sufficient for the trans-rescued replication. Studies on foot-and-mouth disease virus (FMDV), which belongs to the genus Aphthovirus in the family Picornaviridae (90, 91), suggested that the defects in 3B uridylylation and 3Dpol activity could be trans rescued (34, 35). FMDV is unique in coding multiple copies of 3B (three tandem copies of 3B). In addition, the recently discovered mosavirus has two copies of 3B (92), which could not be stably maintained in the PV genome (93). FMDV does not depend on host PI4KB/OSBP family I pathway for replication (94) in contrast to EVs, thus the mechanism and/or the role of uridylylation of 3B might be different from those in PV replication, in terms of trans rescue. Collectively, these results suggest a conserved trans role of 3Dpol activity in picornavirus replication.
To provide trans 3Dpol activity, expression of 3CDpro, but not of 3Dpol, was essential and sufficient (Figure 5 and Figure S1); a large precursor was not necessarily essential in trans rescue. Unexpectedly, substitution of aa residues of 3Cpro, which are involved in binding to viral RNA elements or phospholipids (4, 24, 26, 62), did not abrogate the trans rescue activity. This is in contrast to requirements for 3CDpro in an in vitro trans complementation system; the interaction with RNA was essential for RNA synthesis and virus maturation (95, 96). This may suggest a critical difference between the pre-initiation complexes formed in vitro and in vivo, which could be trans-rescued by the 3CDpol activity, possibly via a different pathway. We found that the N-terminal region of 3Cpro is essential for in vivo trans rescue (Figure 6). Primary structures of the N-terminal region of 3Cpro are conserved within the viral species and protrude outside in the tertiary structure (Figure S4). PV non-structural proteins did not trans rescue a defective EV-A71 replicon, suggesting that the interaction is dependent on the viral species (Figure S2). We propose a model in which the trans-provided 3CDpro provides 3Dpol activity to the viral pre-initiation complex, formed by the defective replicons, via virus species specific protein-protein interactions (80) (Figure 9).
Based on the observations of DI particles, the capsid-coding region is dispensable for the replication of PV, PV replicons coding exogenous reporter genes in place of the capsid-coding region have been developed (24, 97). Subsequently, generation of PV pseudovirus (PVpv) that encapsidates engineered replicon with trans-provided PV capsid proteins have been established by using helper PV (98, 99), recombinant vaccinia virus systems (100, 101), or virus-free capsid-protein expression plasmid vector (65). PVpv could serve as a safe alternative to live PV in biological tests, because no infectious virus is produced in the infected cells (65, 102). A limitation of these methods is that only replication-competent replicon RNA could be encapsidated (98, 103). In the present study, we partially solve this limitation to produce PVpv with a defective PV replicon after trans-rescued replication (Figure 7 and Figure 8). This new generation of PVpv may be useful for biological tests with enhanced safety.
The limitations of this study include the detection limits of trans-rescued replication; defective replicons give signals of reporters (firefly luciferase or mCherry) derived from initial protein synthesis before replication (about 1/102 or 1/104 of the signals at plateau, in the RNA-transfected cells or in PVpv-infected cells, respectively). Therefore, inefficient initial replication resulting only in quasi infection (70) might be missed in this study. In processing of a polyprotein (2BC3ABCD), only the processing of 3AB could occur in cis. However, a requirement for 2Apro, which can be deleted from the genome but require a host factor SETD3 (104, 105), in cis processing remains to be elucidated.
Collectively, this work reveals potential roles of exogenous viral proteins in PV replication and offers insights into protein/protein interactions during picornavirus infection. This will aid elucidating the mechanism of multiple PV infection, including intra-species recombination that can reduce the effectiveness of novel PV vaccines toward eradication (106, 107). Our findings might be useful for the development of effective antivirals targeting the polyprotein processing.

4. Materials and Methods

Cells. RD cells (human rhabdomyosarcoma cells) and HEK293 cells (human embryonic kidney cells) were cultured as monolayers in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% foetal calf serum (FCS). RD cells were used for virus titration. HEK293 cells were used for expression of PV non-structural proteins and for production of PV pseudovirus (PVpv).
Viruses. PVpv was produced with a firefly luciferase-coding or a mCherry-coding type 1 PV (PV1) Mahoney strain (GenBank: V01149) replicon and capsid proteins of PV1(Mahoney)(PV1[Fluc]pv or PV1[mCherry]pv, respectively) (65).
Chemicals. Doxycycline (DOX) was purchased from FUJIFILM Wako Pure Chemical Corporation (049-31121). Guanidine hydrochloride (GuHCl, a 2C inhibitor) was purchased from SIGMA (G-9284). GC376 (a 3C inhibitor) was purchased from Selleck Chemicals (S0475). Rupintrivir (a 3C inhibitor) was purchased from SANTA CRUZ BIOTECHNOLOGY (sc-208317). Stock solutions of DOX (2 g/L) and GuHCl (2 M) were prepared in Milli-Q water. Stock solutions of GC376 (100 mM) and rupintrivir (10 mM) were prepared in dimethyl sulfoxide.
General methods for molecular cloning.Escherichia coli strain XL10gold (Stratagene) was used for the preparation of plasmids. Ligation of DNA fragments was performed using an In-Fusion HD Cloning Kit (Clontech). PCR was performed using KOD Plus DNA polymerase (Toyobo). DNA sequencing was performed using a BigDye Terminator v3.1 cycle sequencing ready reaction kit (Applied Biosystems) and then analyzed with a 3500xL genetic analyzer (Applied Biosystems).

5. Plasmids

5.1. Lentivirus Expression Vectors for PV Non-Structural Proteins

pTet-AG-PV-2B2CP3(WT):
A cDNA fragment of a polyprotein of PV non-structural proteins (2BC3ABCD) was obtained by PCR with pPV-Fluc mc (a plasmid encoding cDNA of a PV replicon) (108) as the template and following primer set 1. This DNA fragment was inserted into a DNA fragment of a lentivirus vector plasmid with a TRE3G promoter, which was obtained by PCR with pLJM1-TRE3G-His-AG-FLAG-PreScission-OSBP(406–807) (52) as the template and using primer set 2.
Primer set 1:
5’ GAAGTTCTGTTCCAGGGCCTCACCAATTACATAGAGTCAC 3’
5’ TCTGAGTCCGGATCAAAATGAGTCAAGCCAACGGCGGTAC 3’
Primer set 2:
5’ CTGGAACAGAACTTCCAGCTTGTCGTCATC 3’
5’ TGATCCGGACTCAGATCTCGAGCTCAAGC 3’
pTet-AG-PV-2B2CP3(3C-C147A):
Mutations for the 3C-C147A aa substitution (disruption of the catalytic triad of PV 3C at aa C147) (59) was introduced in pTet-AG-PV-2B2CP3(WT) by PCR with primer set 3.
Primer set 3:
5’ ACCAGAGCAGGACAGGCUGGTGGAGTCATCACATGTACTG 3’
5’ CTGTCCTGCTCTGGTTGGAAAGTTGTAC 3’
pTet-AG-PV-3CD(WT) and pTet-AG-PV-3CD(∆4-5 aa):
A deletion of the 2BC3AB-coding region was introduced in pTet-AG-PV-2B2CP3(WT) by PCR with primer set 4. Unexpected deletion in the primer region, causing a deletion of aa 4 and 5 in 3C region, was found in a clone, which was designated as pTet-AG-PV-3CD(∆4-5 aa).
Primer set 4:
5’ GAAGTTCTGTTCCAGGGACCAGGGTTCGATTACGCAGTGG 3’
5’ CTGGAACAGAACTTCCAGCTTGTCGTCATC 3’
pTet-AG-PV-3CD(3C-R13N, 3C-K82N, 3C-R84S):
Mutations for the aa substitutions that could affect interaction with negatively charged molecules (viral RNA and phospholipids) (3C-R13N, 3C-K82N, and 3C-R84S aa substitutions) (24, 62-64) were introduced in pTet-AG-PV-3CD(WT) by PCR with primer set 5 ,6, and 7, respectively.
Primer set 5:
5’ AACATTGTTACAGCAACTACTAGCAAG 3’
5’ TGCTGTAACAATGTTGTTTTTAGCCATAGCCACTGCGTAATCG 3’
Primer set 6:
5’ TTCAGAGACATTAGACCACATATACC 3’
5’ TCTAATGTCTCTGAAGTTTTCATTTCTCTTTAGAGTGATTATAG 3’
Primer set 7:
5’ GACATTAGACCACATATACCTACTC 3’
5’ ATGTGGTCTAATGTCGCTGAACTTTTCATTTCTCTTTAGAGTG 3’
pTet-AG-PV-3CD(WT-uncleavable AG, ∆4-5 aa-uncleavable AG):
A mutation that disrupts the cleavage site for the 3C protease between the AG and the 3CD was introduced in pTet-AG-PV-3CD(WT) or pTet-AG-PV-3CD(∆4-5 aa) by PCR with primer set 8.
Primer set 8:
5’ GGACCAGGGTACGCAGTGGCTATGGC 3’
5’ TGCGTACCCTGGTCCGGCGAACAGAACTTCCAGCTTGTCGTC 3’

5.2. PV Replicon Mutants

pPV-Fluc mc (2A/B[A/G], 2B/C[A/G], 2C/3A[A/G], 3A/B[A/G], 3B/C[A/G], and 3C/D[A/G]) and pPV-mCherry mc (3C/D[A/G]):
Mutants with disrupted cleavage sites for the 3C protease: The mutations between each viral gene (2A/B[A/G], 2B/C[A/G], 2C/3A[A/G], 3A/B[A/G], 3B/C[A/G], and 3C/D[A/G] mutations) were introduced in pPV-Fluc mc with a hammerhead ribozyme at the 5’end of the replicon (109, 110) by PCR with primer sets 9, 10, 11, 12, 13, and 14, respectively. The 3C/D[A/G] mutation was also introduced in pPV-mCherry mc with a hammerhead ribozyme at the 5’end of the replicon (110) by PCR with primer set 14.
Primer set 9:
5’ GGCCTCACCAATTACATAGAGTCACTTGGG 3’
5’ GTAATTGGTGAGGCCGGCTTCCATGGCTTC 3’
Primer set 10:
5’ TATGTCATCAAGGCCGGTGACAGTTGGTTGAAGAAGTTTACTG 3’
5’ GGCCTTGATGACATAAGGTATCTCCAGAACATCGC 3’
Primer set 11:
5’ GGACCACTCCAGTATAAAGACTTGAAAATTG 3’
5’ ATACTGGAGTGGTCCGGCAAACAAAGCCTCC 3’
Primer set 12:
5’ CTGTTTGCTGGACACGCCGGAGCATACACTGGTTTACCAAAC 3’
5’ GGCGTGTCCAGCAAACAGTTTATACATGAC 3’
Primer set 13:
5’ GGACCAGGGTTCGATTACGCAGTGGCTATG 3’
5’ ATCGAACCCTGGTCCGGCTACCTTTGCTGTC 3’
Primer set 14:
5’ TTCACTCAGAGTGCCGGTGAAATCCAGTGGATGAGACCTTCG 3’
5’ GGCACTCTGAGTGAAGTATGATCGCTTCAGGG 3’
pPV-Fluc mc (∆2A, ∆2B, ∆2C, ∆3A, ∆3B, ∆3C, and ∆3D):
Mutants with deletion of each viral gene: Deletion of each viral gene (∆2A, ∆2B, ∆2C, ∆3A, ∆3B, ∆3C, and ∆3D) were introduced in pPV-Fluc mc by PCR with following primer set 15, 16, 17, 18, 19, 20, and 21, respectively.
Primer set 15:
5’ GAAGCCATGGAACAAGGCCTCACCAATTAC 3’
5’ TTGTTCCATGGCTTCTGTGGTGAGCTCCAATTTG 3’
Primer set 16:
5’ GGTGACAGTTGGTTGAAGAAGTTTACTG 3’
5’ CAACCAACTGTCACCTTGTTCCATGGCTTCTTCTTCGTAGGCATAC 3’
Primer set 17:
5’ GGACCACTCCAGTATAAAGACTTGAAAATTG 3’
5’ ATACTGGAGTGGTCCTTGCTTGATGACATAAGGTATCTCCAGAAC 3’
Primer set 18:
5’ GGAGCATACACTGGTTTACCAAACAAAAAACC 3’
5’ ACCAGTGTATGCTCCTTGAAACAAAGCCTCCATACAATTGCCAATG 3’
Primer set 19:
5’ GGACCAGGGTTCGATTACGCAGTGGCTATG 3’
5’ ATCGAACCCTGGTCCCTGGTGTCCAGCAAACAGTTTATACATGAC 3’
Primer set 20:
5’ GGTGAAATCCAGTGGATGAGACCTTCGAAG 3’
5’ CCACTGGATTTCACCTTGTACCTTTGCTGTCCGAATGGTGGGCAC 3’
Primer set 21:
5’ TAGTAACCCTACCTCAGTCGAATTGGATTG 3’
5’ GAGGTAGGGTTACTATTGACTCTGAGTGAAGTATGATCGCTTCAG 3’
pPV-Fluc mc (3C/D[A/G-2C-K153A], 3C/D[A/G-3B-Y3F], and 3C/D[A/G-3D-D328N/D329N]):
Mutants encoding functionally inactive viral proteins (2C, 3B, and 3D) with a disrupted cleavage site for 3C protease between 3C and 3D: functionally inactivating mutations in PV 2C (a 2C-K153A aa substitution) (6), PV 3B (a 3B-Y3F aa substitution) (58), PV 3D (3D-D328N/D329N aa substitution) (60) were introduced in pPV-Fluc mc (3C/D[A/G]) by PCR with primer sets 22, 23, and 24, respectively.
Primer set 22:
5’ CCCGGAACAGGTGCCTCTGTAGCAACCAACCTGATTGCTAG 3’
5’ GGCACCTGTTCCGGGGCTGCCATGTACTAGC 3’
Primer set 23:
5’ ACACCAGGGAGCATTCACTGGTTTACCAAACAAAAAACCCAACG 3’
5’ ATGCTCCCTGGTGTCCAGCAAACAGTTTATAC 3’
Primer set 24:
5’ AATAATGTAATTGCTTCCTACCCCCATGAAG 3’
5’ AGCAATTACATTATTACCATAGGCAATCATTTTTAGG 3’

5.3. EV-A71 Replicon Mutants

pEV-A71-Fluc mc (WT and 3C/D[A/G] mutant):
A hammerhead ribozyme (109) was introduced in pEV71(Fluc-mc) (111) at the 5’end of an EV-A71 BrCr-TR strain (GenBank: AB204852) replicon coding firefly luciferase reporter by PCR with primer set 25.
Primer set 25:
5’ CGGTATCCCGGGTTCTTAAAACAGCCTGTGGGTTGCACCC 3’
5’ GAACCCGGGATACCGGGTTTTCGGCCTTTCGGCCTCATCAGTTAAAACACCCTATAGTGAGTCGTATTAATACGTAATTTCG 3’
The mutation between 3C and 3D (3C/D[A/G] mutations) were introduced in the above plasmid by PCR with primer set 26.
Primer set 26:
5’ GGCCTCGCTGGCAAAATAACTCCTCTTTAG 3’
5’ TTTGCCAGCGAGGCCGGAGAGATCCAGTGGATGAAGCCTAACAG 3’
RNA transfection. RNA transcripts of PV replicons were obtained using a RiboMAX Express Large Scale RNA Production System (Promega, P1320) with DraI-linearized plasmids of PV replicons. RNA transcripts (0.025 μL) were transfected into the cells (4 ⋅104 cells per well in 100 μL medium) in a 96-well plate (Corning Incorporated, 3595) using TransIT-mRNA Transfection Kit (Mirus, MIR 2250).
Preparation of PV pseudovirus (PVpv) with a defective PV replicon. Tet-AG-PV-3CD(WT) cells (1.6 ⋅106 cells per well in 4 mL medium) in a six-well plate (Corning Incorporated, 3516) were transfected with 4 μg of a PV1(Mahoney) capsid-expression vector (pKS435-EGFP-PV1(Mahoney) (108) per well using TransIT-PRO transfection kit (Mirus, MIR 5700) in the presence of DOX (1 mg/L) and GC376 (100 μM). The cells were incubated at 37 °C for 24 h, and then washed with the medium without DOX and GC376. RNA transcripts (1 μL) of defective PV replicons (3C/D[A/G]) with mCherry or firefly luciferase reporters were transfected into monolayers of Tet-AG-PV-3CD(WT) cells transiently expressing the capsid proteins and the 3CD protein in the absence of DOX and GC376. The cells were harvested at 24 h post-transfection of the RNA transcripts, and then stored at -20 °C.
Titration of defective PVpv. For the titration of PV1(mCherry)pv (3C/D[A/G]), Tet-AG-PV-3CD(WT) cells (4 ⋅104 cells per well in 100 μL medium) or Tet-AG-PV-3CD(∆4-5 aa) cells (a negative control of the infection) in a 96-well plate (Corning Incorporated, 3595) were incubated at 37 °C for 5 h in the presence of DOX (1 mg/L). The cells were inoculated with 10 μL of serially diluted PV1(mCherry)pv (3C/D[A/G]) solution (dilution of 1/1 to 1/105), and then incubated at 37 °C for 17 h. Infectious units (IU) of PV1(mCherry)pv (3C/D[A/G]) were determined by counting the number of the mCherry-fluoresence positive cells (44). Images were collected at 4× magnification using a BZ-9000 fluorescence microscopy (Keyence), and then analyzed by using CellProfiler software (112). For the titration of PV1(Fluc)pv (3C/D[A/G]), Tet-AG-PV-3CD(WT) cells (8 ⋅103 cells per well in 20 μL medium) or Tet-AG-PV-3CD(∆4-5 aa) cells (a negative control of the infection) in a 384-well plate (Greiner Bio-One, 781080) were incubated at 37 °C for 5 h in the presence of DOX (1 mg/L). The cells were inoculated with 5 μL of serially diluted PV1(Fluc)pv (3C/D[A/G]) solution (dilution of 1/1 to 1/105), and then incubated at 37 °C for 17 h. A 15 μL of the supernatant was removed from each well, and then 10 μL of Steady-Glo Reagent (Promega, E2520) was added to each well. Luciferase signals were measured using a 2030 ARVO X luminometer (Perkin-Elmer).
Neutralization of defective PVpv. PV1(mCherry)pv (WT or 3C/D[A/G] mutant) (2.0 × 103 IU in 10 μL medium) were mixed with 10 μL of standard anti-PV1, PV2, or PV3 antisera (26 U for each type of PV) at 4°C for 7 h. Tet-AG-PV-3CD(WT) cells (4 ⋅104 cells per well in 100 μL medium) in a 96-well plate (Corning Incorporated, 3595) was incubated at 37 °C for 5 h in the presence of DOX (1 mg/L). PV1(mCherry)pv (WT or 3C/D[A/G] mutant) (2.0 × 103 IU in 10 μL medium) was mixed with 10 μL of standard anti-PV1, PV2, or PV3 antisera (26 U for each type) at 4°C for 7 h, and then added to the DOX-treated Tet-AG-PV-3CD(WT) cells. The cells were incubated at 37 °C for 17 h, and then the number of the mCherry-fluoresence positive cells was counted as described the titration of PV1(mCherry)pv.
Western blot. The cells (8 ⋅ 105 cells) were collected in 20 μL of cell lysis buffer (21 mM HEPES buffer [pH 7.4], 0.7 mM disodium hydrogenphosphate, 137 mM NaCl, 4.8 mM KCl, 0.5% Nonidet P-40 and 5 mM EDTA, supplemented with complete-mini protease inhibitor cocktail tablet [Roche, 04 693 159 001]), and then were subjected to e-PAGEL 5-20% gradient polyacrylamide gel electrophoresis (Atto Corporation) in a Laemmli buffer system. Proteins in the gel were transferred to a polyvinylidene difluoride filter (Millipore, Immobilon) and blocked in iBindTM solution (Thermo Fischer Scientific). Filters were incubated with anti-PV 2C, 3A, and 3D antibodies (37) (rabbit antisera, 1:500, 1:200, and 1:250 dilution, respectively), then with secondary antibodies (Thermo Scientific, 32460, goat anti-rabbit IgG antibodies conjugated with horseradish peroxidase, 1:200 dilution) in iBindTM Western System (Thermo Fischer Scientific). Signals were detected with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific, 34095), then analyzed with ImageQuant 800 (cytiva).
Statistical analysis. Results of experiments are shown as means with standard deviations. Presented data are representative of at least two independent experiments with two or three biological replicates. Values of P<0.05 by one-tailed t test were considered to indicate a significant difference, and were indicated by asterisks (*P < 0.05, **P < 0.01, ***P < 0.001).

Supplementary Materials

The following supporting information can be downloaded at the website of this paper posted on Preprints.org.

Acknowledgments

I am grateful to Yuzuru Aoi for her excellent technical assistance. I thank Hiroyuki Shimizu, Masamichi Muramatsu, and Masanori Isogawa for their kind supports. I sincerely appreciate Aniko Paul for her critical reading, edition, and kind suggestions to improve the manuscript. This study was in part supported by AMED (Grant number: 23fk0108627j0002), and by JSPS KAKENHI (Grant Number: 22K07107) to M.A. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Disclosure

The author declares no conflict of interest.

List of Abbreviations

aa: amino acid
aa: amino acid
PV: poliovirus
PV1pv: type 1 PV pseudovirus

References

  1. Kitamura, N.; Semler, B.L.; Rothberg, P.G.; Larsen, G.R.; Adler, C.J.; Dorner, A.J.; Emini, E.A.; Hanecak, R.; Lee, J.J.; van der Werf, S.; et al. Primary structure, gene organization and polypeptide expression of poliovirus RNA. Nature 1981, 291, 547–553. [Google Scholar] [CrossRef] [PubMed]
  2. Lulla, V.; Dinan, A.M.; Hosmillo, M.; Chaudhry, Y.; Sherry, L.; Irigoyen, N.; Nayak, K.M.; Stonehouse, N.J.; Zilbauer, M.; Goodfellow, I.; et al. An upstream protein-coding region in enteroviruses modulates virus infection in gut epithelial cells. Nat. Microbiol. 2018, 4, 280–292. [Google Scholar] [CrossRef] [PubMed]
  3. Toyoda, H.; Nicklin, M.J.; Murray, M.G.; Anderson, C.W.; Dunn, J.J.; Studier, F.; Wimmer, E. A second virus-encoded proteinase involved in proteolytic processing of poliovirus polyprotein. Cell 1986, 45, 761–770. [Google Scholar] [CrossRef] [PubMed]
  4. Ypma-Wong, M.F.; Dewalt, P.G.; Johnson, V.H.; Lamb, J.G.; Semler, B.L. Protein 3CD is the major poliovirus proteinase responsible for cleavage of the p1 capsid precursor. Virology 1988, 166, 265–270. [Google Scholar] [CrossRef] [PubMed]
  5. Campagnola, G.; Peersen, O. Co-folding and RNA activation of poliovirus 3Cpro polyprotein precursors. J. Biol. Chem. 2023, 299, 105258. [Google Scholar] [CrossRef]
  6. Xia, H.; Wang, P.; Qin, C.-F.; Hu, Y.; Zhou, X.; Wang, G.-C.; Yang, J.; Sun, X.; Wu, W.; Qiu, Y.; et al. Human Enterovirus Nonstructural Protein 2CATPase Functions as Both an RNA Helicase and ATP-Independent RNA Chaperone. PLoS Pathog. 2015, 11, e1005067. [Google Scholar] [CrossRef]
  7. Nieva, J.L.; Madan, V.; Carrasco, L. Viroporins: Structure and biological functions. Nat. Rev. Microbiol. 2012, 10, 563–574. [Google Scholar] [CrossRef]
  8. Yeager, C.; Carter, G.; Gohara, D.W.; Yennawar, N.H.; Enemark, E.J.; Arnold, J.J.; E Cameron, C. Enteroviral 2C protein is an RNA-stimulated ATPase and uses a two-step mechanism for binding to RNA and ATP. Nucleic Acids Res. 2022, 50, 11775–11798. [Google Scholar] [CrossRef]
  9. Liu, Y.; Wang, C.; Mueller, S.; Paul, A.V.; Wimmer, E.; Jiang, P. Direct Interaction between Two Viral Proteins, the Nonstructural Protein 2CATPase and the Capsid Protein VP3, Is Required for Enterovirus Morphogenesis. PLOS Pathog. 2010, 6, e1001066. [Google Scholar] [CrossRef]
  10. van Kuppeveld, F.J.; Hoenderop, J.G.; Smeets, R.L.; Willems, P.H.; Dijkman, H.B.; Galama, J.M.; Melchers, W.J. Coxsackievirus protein 2B modifies endoplasmic reticulum membrane and plasma membrane permeability and facilitates virus release. EMBO J. 1997, 16, 3519–3532. [Google Scholar] [CrossRef]
  11. Nomoto, A.; Detjen, B.; Pozzatti, R.; Wimmer, E. The location of the polio genome protein in viral RNAs and its implication for RNA synthesis. Nature 1977, 268, 208–213. [Google Scholar] [CrossRef] [PubMed]
  12. Sasaki, J.; Ishikawa, K.; Arita, M.; Taniguchi, K. ACBD3-mediated recruitment of PI4KB to picornavirus RNA replication sites. EMBO J. 2011, 31, 754–766. [Google Scholar] [CrossRef] [PubMed]
  13. Greninger, A.L.; Knudsen, G.M.; Betegon, M.; Burlingame, A.L.; DeRisi, J.L. The 3A Protein from Multiple Picornaviruses Utilizes the Golgi Adaptor Protein ACBD3 To Recruit PI4KIIIβ. J. Virol. 2012, 86, 3605–3616. [Google Scholar] [CrossRef] [PubMed]
  14. Wessels, E.; Duijsings, D.; Niu, T.-K.; Neumann, S.; Oorschot, V.M.; de Lange, F.; Lanke, K.H.; Klumperman, J.; Henke, A.; Jackson, C.L.; et al. A Viral Protein that Blocks Arf1-Mediated COP-I Assembly by Inhibiting the Guanine Nucleotide Exchange Factor GBF1. Dev. Cell 2006, 11, 191–201. [Google Scholar] [CrossRef]
  15. Belov, G.A.; Feng, Q.; Nikovics, K.; Jackson, C.L.; Ehrenfeld, E. A Critical Role of a Cellular Membrane Traffic Protein in Poliovirus RNA Replication. PLOS Pathog. 2008, 4, e1000216. [Google Scholar] [CrossRef]
  16. Hsu, N.-Y.; Ilnytska, O.; Belov, G.; Santiana, M.; Chen, Y.-H.; Takvorian, P.M.; Pau, C.; van der Schaar, H.; Kaushik-Basu, N.; Balla, T.; et al. Viral Reorganization of the Secretory Pathway Generates Distinct Organelles for RNA Replication. Cell 2010, 141, 799–811. [Google Scholar] [CrossRef]
  17. Dorobantu, C.M.; van der Schaar, H.M.; Ford, L.A.; Strating, J.R.P.M.; Ulferts, R.; Fang, Y.; Belov, G.; van Kuppeveld, F.J.M. Recruitment of PI4KIIIβ to Coxsackievirus B3 Replication Organelles Is Independent of ACBD3, GBF1, and Arf1. J. Virol. 2014, 88, 2725–2736. [Google Scholar] [CrossRef] [PubMed]
  18. A Pallansch, M.; Kew, O.M.; Semler, B.L.; Omilianowski, D.R.; Anderson, C.W.; Wimmer, E.; Rueckert, R.R. Protein processing map of poliovirus. J. Virol. 1984, 49, 873–880. [Google Scholar] [CrossRef]
  19. Takegami, T.; Semler, B.L.; Anderson, C.W.; Wimmer, E. Membrane fractions active in poliovirus RNA replication contain VPg precursor polypeptides. Virology 1983, 128, 33–47. [Google Scholar] [CrossRef]
  20. Suhy, D.A.; Giddings, T.H.; Kirkegaard, K. Remodeling the Endoplasmic Reticulum by Poliovirus Infection and by Individual Viral Proteins: An Autophagy-Like Origin for Virus-Induced Vesicles. J. Virol. 2000, 74, 8953–8965. [Google Scholar] [CrossRef]
  21. Paul, A.V.; Cao, X.; Harris, K.S.; Lama, J.; Wimmer, E. Studies with poliovirus polymerase 3Dpol. Stimulation of poly(U) synthesis in vitro by purified poliovirus protein 3AB. J. Biol. Chem. 1994, 269, 29173–29181. [Google Scholar] [CrossRef]
  22. Lama, J.; Paul, A.; Harris, K.; Wimmer, E. Properties of purified recombinant poliovirus protein 3aB as substrate for viral proteinases and as co-factor for RNA polymerase 3Dpol. J. Biol. Chem. 1994, 269, 66–70. [Google Scholar] [CrossRef] [PubMed]
  23. Richards, O.C.; Ehrenfeld, E. Effects of Poliovirus 3AB Protein on 3D Polymerase-catalyzed Reaction. J. Biol. Chem. 1998, 273, 12832–12840. [Google Scholar] [CrossRef] [PubMed]
  24. Andino, R.; Rieckhof, G.; Achacoso, P.; Baltimore, D. Poliovirus RNA synthesis utilizes an RNP complex formed around the 5′-end of viral RNA. EMBO J. 1993, 12, 3587–3598. [Google Scholar] [CrossRef] [PubMed]
  25. Gamarnik, A.V.; Andino, R. Switch from translation to RNA replication in a positive-stranded RNA virus. Minerva Anestesiol. 1998, 12, 2293–2304. [Google Scholar] [CrossRef] [PubMed]
  26. Paul, A.V.; Rieder, E.; Kim, D.W.; van Boom, J.H.; Wimmer, E. Identification of an RNA Hairpin in Poliovirus RNA That Serves as the Primary Template in the In Vitro Uridylylation of VPg. J. Virol. 2000, 74, 10359–10370. [Google Scholar] [CrossRef] [PubMed]
  27. Paul, A.V.; Mugavero, J.; Molla, A.; Wimmer, E. Internal Ribosomal Entry Site Scanning of the Poliovirus Polyprotein: Implications for Proteolytic Processing. Virology 1998, 250, 241–253. [Google Scholar] [CrossRef] [PubMed]
  28. Cole, C.N.; Smoler, D.; Wimmer, E.; Baltimore, D. Defective Interfering Particles of Poliovirus I. Isolation and Physical Properties. J. Virol. 1971, 7, 478–485. [Google Scholar] [CrossRef]
  29. Kuge, S.; Saito, I.; Nomoto, A. Primary structure of poliovirus defective-interfering particle genomes and possible generation mechanisms of the particles. J. Mol. Biol. 1986, 192, 473–487. [Google Scholar] [CrossRef]
  30. E Novak, J.; Kirkegaard, K. Coupling between genome translation and replication in an RNA virus. Genes Dev. 1994, 8, 1726–1737. [Google Scholar] [CrossRef]
  31. Kuhn, R.J.; Tada, H.; Ypma-Wong, M.F.; Semler, B.L.; Wimmer, E. Mutational analysis of the genome-linked protein VPg of poliovirus. J. Virol. 1988, 62, 4207–4215. [Google Scholar] [CrossRef] [PubMed]
  32. Paul, A.V.; Molla, A.; Wimmer, E. Studies of a Putative Amphipathic Helix in the N-Terminus of Poliovirus Protein 2C. Virology 1994, 199, 188–199. [Google Scholar] [CrossRef] [PubMed]
  33. Li, X.; Lu, H.H.; Mueller, S.; Wimmer, E. The C-terminal residues of poliovirus proteinase 2A(pro) are critical for viral RNA replication but not for cis- or trans-proteolytic cleavage. J Gen Virol. 2001, 82 (Pt 2) Pt 2, 397–408. [Google Scholar] [CrossRef]
  34. Herod, M.R.; Gold, S.; Lasecka-Dykes, L.; Wright, C.; Ward, J.C.; McLean, T.C.; Forrest, S.; Jackson, T.; Tuthill, T.J.; Rowlands, D.J.; et al. Genetic economy in picornaviruses: Foot-and-mouth disease virus replication exploits alternative precursor cleavage pathways. PLOS Pathog. 2017, 13, e1006666. [Google Scholar] [CrossRef]
  35. Pierce, D.M.; Hayward, C.; Rowlands, D.J.; Stonehouse, N.J.; Herod, M.R. Insights into Polyprotein Processing and RNA-Protein Interactions in Foot-and-Mouth Disease Virus Genome Replication. J. Virol. 2023, 97, e0017123. [Google Scholar] [CrossRef] [PubMed]
  36. Arita, M.; Kojima, H.; Nagano, T.; Okabe, T.; Wakita, T.; Shimizu, H. Oxysterol-Binding Protein Family I Is the Target of Minor Enviroxime-Like Compounds. J. Virol. 2013, 87, 4252–4260. [Google Scholar] [CrossRef] [PubMed]
  37. Arita, M. Mechanism of Poliovirus Resistance to Host Phosphatidylinositol-4 Kinase III β Inhibitor. ACS Infect. Dis. 2015, 2, 140–148. [Google Scholar] [CrossRef]
  38. Lyoo, H.; Dorobantu, C.M.; van der Schaar, H.M.; van Kuppeveld, F.J. Modulation of proteolytic polyprotein processing by coxsackievirus mutants resistant to inhibitors targeting phosphatidylinositol-4-kinase IIIβ or oxysterol binding protein. Antivir. Res. 2017, 147, 86–90. [Google Scholar] [CrossRef]
  39. Melia, C.E.; van der Schaar, H.M.; Lyoo, H.; Limpens, R.W.; Feng, Q.; Wahedi, M.; Overheul, G.J.; van Rij, R.P.; Snijder, E.J.; Koster, A.J.; et al. Escaping Host Factor PI4KB Inhibition: Enterovirus Genomic RNA Replication in the Absence of Replication Organelles. Cell Rep. 2017, 21, 587–599. [Google Scholar] [CrossRef]
  40. Arita, M.; Bigay, J. Poliovirus Evolution toward Independence from the Phosphatidylinositol-4 Kinase III β/Oxysterol-Binding Protein Family I Pathway. ACS Infect. Dis. 2019, 5, 962–973. [Google Scholar] [CrossRef]
  41. Ishitsuka, H.; Ohsawa, C.; Ohiwa, T.; Umeda, I.; Suhara, Y. Antipicornavirus flavone Ro 09-0179. Antimicrob. Agents Chemother. 1982, 22, 611–616. [Google Scholar] [CrossRef]
  42. A Heinz, B.; Vance, L.M. The antiviral compound enviroxime targets the 3A coding region of rhinovirus and poliovirus. J. Virol. 1995, 69, 4189–4197. [Google Scholar] [CrossRef]
  43. Arita, M. Phosphatidylinositol-4 kinase III beta and oxysterol-binding protein accumulate unesterified cholesterol on poliovirus-induced membrane structure. Microbiol. Immunol. 2014, 58, 239–256. [Google Scholar] [CrossRef] [PubMed]
  44. Arita, M. High-Order Epistasis and Functional Coupling of Infection Steps Drive Virus Evolution toward Independence from a Host Pathway. Microbiol. Spectr. 2021, 9, e0080021. [Google Scholar] [CrossRef] [PubMed]
  45. Wikel, J.H.; Paget, C.J.; DeLong, D.C.; Nelson, J.D.; Wu, C.Y.E.; Paschal, J.W.; Dinner, A.; Templeton, R.J.; Chaney, M.O. Synthesis of syn and anti isomers of 6-[[(hydroxyimino)phenyl]methyl]-1-[(1-methylethyl)sulfonyl]-1H-benzimidazol-2-amine. Inhibitors of rhinovirus multiplication. J. Med. Chem. 1980, 23, 368–372. [Google Scholar] [CrossRef] [PubMed]
  46. Arita, M.; Kojima, H.; Nagano, T.; Okabe, T.; Wakita, T.; Shimizu, H. Phosphatidylinositol 4-Kinase III Beta Is a Target of Enviroxime-Like Compounds for Antipoliovirus Activity. J. Virol. 2011, 85, 2364–2372. [Google Scholar] [CrossRef] [PubMed]
  47. Delang, L.; Paeshuyse, J.; Neyts, J. The role of phosphatidylinositol 4-kinases and phosphatidylinositol 4-phosphate during viral replication. Biochem. Pharmacol. 2012, 84, 1400–1408. [Google Scholar] [CrossRef] [PubMed]
  48. MacLeod, A.M.; Mitchell, D.R.; Palmer, N.J.; Van de Poël, H.; Conrath, K.; Andrews, M.; Leyssen, P.; Neyts, J. Identification of a Series of Compounds with Potent Antiviral Activity for the Treatment of Enterovirus Infections. ACS Med. Chem. Lett. 2013, 4, 585–589. [Google Scholar] [CrossRef] [PubMed]
  49. Strating, J.R.; van der Linden, L.; Albulescu, L.; Bigay, J.; Arita, M.; Delang, L.; Leyssen, P.; van der Schaar, H.M.; Lanke, K.H.; Thibaut, H.J.; et al. Itraconazole Inhibits Enterovirus Replication by Targeting the Oxysterol-Binding Protein. Cell Rep. 2015, 10, 600–615. [Google Scholar] [CrossRef] [PubMed]
  50. Matsui, T.; Fujita, M.; Ishibashi, Y.; Nomanbhoy, T.; Rosenblum, J.S.; Nagasawa, M. 134. KRP-A218, an Orally Active and Selective PI4KB Inhibitor with Broad-Spectrum Anti-Rhinovirus Activity, Has Potent Therapeutic Antiviral Activity In vivo. Open Forum Infect. Dis. 2021, 8, S82–S82. [Google Scholar] [CrossRef]
  51. Semler, B.L.; Anderson, C.W.; Hanecak, R.; Dorner, L.F.; Wimmer, E. A membrane-associated precursor to poliovirus VPg identified by immunoprecipitation with antibodies directed against a synthetic heptapeptide. Cell 1982, 28, 405–412. [Google Scholar] [CrossRef]
  52. Kobayashi, J.; Arita, M.; Sakai, S.; Kojima, H.; Senda, M.; Senda, T.; Hanada, K.; Kato, R. Ligand Recognition by the Lipid Transfer Domain of Human OSBP Is Important for Enterovirus Replication. ACS Infect. Dis. 2022, 8, 1161–1170. [Google Scholar] [CrossRef]
  53. Kim, Y.; Lovell, S.; Tiew, K.-C.; Mandadapu, S.R.; Alliston, K.R.; Battaile, K.P.; Groutas, W.C.; Chang, K.-O. Broad-Spectrum Antivirals against 3C or 3C-Like Proteases of Picornaviruses, Noroviruses, and Coronaviruses. J. Virol. 2012, 86, 11754–11762. [Google Scholar] [CrossRef]
  54. Matthews, D.A.; Dragovich, P.S.; Webber, S.E.; Fuhrman, S.A.; Patick, A.K.; Zalman, L.S.; Hendrickson, T.F.; Love, R.A.; Prins, T.J.; Marakovits, J.T.; et al. Structure-assisted design of mechanism-based irreversible inhibitors of human rhinovirus 3C protease with potent antiviral activity against multiple rhinovirus serotypes. Proc. Natl. Acad. Sci. 1999, 96, 11000–11007. [Google Scholar] [CrossRef] [PubMed]
  55. Kräusslich, H.-G.; Nicklin, M.J.; Lee, C.-K.; Wimmer, E. Polyprotein processing in picornavirus replication. Biochimie 1988, 70, 119–130. [Google Scholar] [CrossRef]
  56. Laitinen, O.H.; Svedin, E.; Kapell, S.; Nurminen, A.; Hytönen, V.P.; Flodström-Tullberg, M. Enteroviral proteases: Structure, host interactions and pathogenicity. Rev. Med Virol. 2016, 26, 251–267. [Google Scholar] [CrossRef] [PubMed]
  57. Igarashi, H.; Yoshino, Y.; Miyazawa, M.; Horie, H.; Ohka, S.; Nomoto, A. 2A Protease Is Not a Prerequisite for Poliovirus Replication. J. Virol. 2010, 84, 5947–5957. [Google Scholar] [CrossRef]
  58. Reuer, Q.; Kuhn, R.J.; Wimmer, E. Characterization of poliovirus clones containing lethal and nonlethal mutations in the genome-linked protein VPg. J. Virol. 1990, 64, 2967–2975. [Google Scholar] [CrossRef] [PubMed]
  59. Hämmerle, T.; Hellen, C.U.; Wimmer, E. Site-directed mutagenesis of the putative catalytic triad of poliovirus 3C proteinase. J. Biol. Chem. 1991, 266, 5412–5416. [Google Scholar] [CrossRef] [PubMed]
  60. A Jablonski, S.; Morrow, C.D. Mutation of the aspartic acid residues of the GDD sequence motif of poliovirus RNA-dependent RNA polymerase results in enzymes with altered metal ion requirements for activity. J. Virol. 1995, 69, 1532–1539. [Google Scholar] [CrossRef] [PubMed]
  61. A Thompson, A.; Peersen, O.B. Structural basis for proteolysis-dependent activation of the poliovirus RNA-dependent RNA polymerase. EMBO J. 2004, 23, 3462–3471. [Google Scholar] [CrossRef] [PubMed]
  62. Shengjuler, D.; Chan, Y.M.; Sun, S.; Moustafa, I.M.; Li, Z.-L.; Gohara, D.W.; Buck, M.; Cremer, P.S.; Boehr, D.D.; Cameron, C.E. The RNA-Binding Site of Poliovirus 3C Protein Doubles as a Phosphoinositide-Binding Domain. Structure 2017, 25, 1875–1886. [Google Scholar] [CrossRef] [PubMed]
  63. Blair, W.S.; Parsley, T.B.; Bogerd, H.P.; Towner, J.S.; Semler, B.L.; Cullen, B.R. Utilization of a mammalian cell-based RNA binding assay to characterize the RNA binding properties of picornavirus 3C proteinases. RNA 1998, 4, 215–25. [Google Scholar] [PubMed]
  64. Amero, C.D.; Arnold, J.J.; Moustafa, I.M.; Cameron, C.E.; Foster, M.P. Identification of the oriI-Binding Site of Poliovirus 3C Protein by Nuclear Magnetic Resonance Spectroscopy. J. Virol. 2008, 82, 4363–4370. [Google Scholar] [CrossRef]
  65. Arita, M.; Nagata, N.; Sata, T.; Miyamura, T.; Shimizu, H. Quantitative analysis of poliomyelitis-like paralysis in mice induced by a poliovirus replicon. J. Gen. Virol. 2006, 87, 3317–3327. [Google Scholar] [CrossRef] [PubMed]
  66. Arita, M.; Iwai-Itamochi, M. Evaluation of antigenic differences between wild and Sabin vaccine strains of poliovirus using the pseudovirus neutralization test. Sci. Rep. 2019, 9, 1–9. [Google Scholar] [CrossRef] [PubMed]
  67. Arita, M.; Iwai, M.; Wakita, T.; Shimizu, H. Development of a Poliovirus Neutralization Test with Poliovirus Pseudovirus for Measurement of Neutralizing Antibody Titer in Human Serum. Clin. Vaccine Immunol. 2011, 18, 1889–1894. [Google Scholar] [CrossRef] [PubMed]
  68. A Charini, W.; Burns, C.C.; Ehrenfeld, E.; Semler, B.L. trans rescue of a mutant poliovirus RNA polymerase function. J. Virol. 1991, 65, 2655–2665. [Google Scholar] [CrossRef]
  69. Teterina, N.L.; Zhou, W.D.; Cho, M.W.; Ehrenfeld, E. Inefficient complementation activity of poliovirus 2C and 3D proteins for rescue of lethal mutations. J. Virol. 1995, 69, 4245–4254. [Google Scholar] [CrossRef]
  70. Cao, X.; Wimmer, E. Intragenomic Complementation of a 3AB Mutant in Dicistronic Polioviruses. Virology 1995, 209, 315–326. [Google Scholar] [CrossRef]
  71. Towner, J.S.; Mazanet, M.M.; Semler, B.L. Rescue of defective poliovirus RNA replication by 3AB-containing precursor polyproteins [In Process Citation]. Journal of virology. 1998, 72, 7191–200. [Google Scholar] [CrossRef] [PubMed]
  72. Liu, Y.; Franco, D.; Paul, A.V.; Wimmer, E. Tyrosine 3 of Poliovirus Terminal Peptide VPg(3B) Has an Essential Function in RNA Replication in the Context of Its Precursor Protein, 3AB. J. Virol. 2007, 81, 5669–5684. [Google Scholar] [CrossRef] [PubMed]
  73. Lu, H.H.; Li, X.; Cuconati, A.; Wimmer, E. Analysis of picornavirus 2A(pro) proteins: Separation of proteinase from translation and replication functions. J. Virol. 1995, 69, 7445–7452. [Google Scholar] [CrossRef] [PubMed]
  74. Goodfellow, I.; Chaudhry, Y.; Richardson, A.; Meredith, J.; Almond, J.W.; Barclay, W.; Evans, D.J. Identification of a cis-Acting Replication Element within the Poliovirus Coding Region. J. Virol. 2000, 74. [Google Scholar] [CrossRef] [PubMed]
  75. Han, J.-Q.; Townsend, H.L.; Jha, B.K.; Paranjape, J.M.; Silverman, R.H.; Barton, D.J. A Phylogenetically Conserved RNA Structure in the Poliovirus Open Reading Frame Inhibits the Antiviral Endoribonuclease RNase L. J. Virol. 2007, 81, 5561–5572. [Google Scholar] [CrossRef] [PubMed]
  76. Townsend, H.L.; Jha, B.K.; Han, J.-Q.; Maluf, N.K.; Silverman, R.H.; Barton, D.J. A viral RNA competitively inhibits the antiviral endoribonuclease domain of RNase L. RNA 2008, 14, 1026–1036. [Google Scholar] [CrossRef]
  77. Song, Y.; Liu, Y.; Ward, C.B.; Mueller, S.; Futcher, B.; Skiena, S.; Paul, A.V.; Wimmer, E. Identification of two functionally redundant RNA elements in the coding sequence of poliovirus using computer-generated design. Proc. Natl. Acad. Sci. 2012, 109, 14301–14307. [Google Scholar] [CrossRef] [PubMed]
  78. Burrill, C.P.; Westesson, O.; Schulte, M.B.; Strings, V.R.; Segal, M.; Andino, R. Global RNA Structure Analysis of Poliovirus Identifies a Conserved RNA Structure Involved in Viral Replication and Infectivity. J. Virol. 2013, 87, 11670–11683. [Google Scholar] [CrossRef]
  79. Paul, A.V.; Yin, J.; Mugavero, J.; Rieder, E.; Liu, Y.; Wimmer, E. A “Slide-back” Mechanism for the Initiation of Protein-primed RNA Synthesis by the RNA Polymerase of Poliovirus. J. Biol. Chem. 2003, 278, 43951–43960. [Google Scholar] [CrossRef]
  80. Bell, Y.C.; Semler, B.L.; Ehrenfeld, E. Requirements for RNA Replication of a Poliovirus Replicon by Coxsackievirus B3 RNA Polymerase. J. Virol. 1999, 73, 9413–9421. [Google Scholar] [CrossRef]
  81. van Kuppeveld, F.J.M.; Hurk, P.J.J.C.v.D.; Schrama, I.W.J.; Galama, J.M.D.; Melchers, W.J.G. Trans-complementation of a genetic defect in the coxsackie B3 virus 2B protein. J. Gen. Virol. 2002, 83, 341–350. [Google Scholar] [CrossRef]
  82. van Ooij, M.J.M.; Vogt, D.A.; Paul, A.; Castro, C.; Kuijpers, J.; van Kuppeveld, F.J.M.; Cameron, C.E.; Wimmer, E.; Andino, R.; Melchers, W.J.G. Structural and functional characterization of the coxsackievirus B3 CRE(2C): Role of CRE(2C) in negative- and positive-strand RNA synthesis. J. Gen. Virol. 2006, 87, 103–113. [Google Scholar] [CrossRef] [PubMed]
  83. Sun, M.; Lin, Q.; Wang, C.; Xing, J.; Yan, K.; Liu, Z.; Jin, Y.; Cardona, C.J.; Xing, Z. Enterovirus A71 2B Inhibits Interferon-Activated JAK/STAT Signaling by Inducing Caspase-3-Dependent Karyopherin-α1 Degradation. Front. Microbiol. 2021, 12, 762869. [Google Scholar] [CrossRef] [PubMed]
  84. Lalzampuia, H.; Ganji, V.K.; Elango, S.; Krishnaswamy, N.; Umapathi, V.; Reddy, G.R.; Sanyal, A.; Hj, D. Expression of foot-and-mouth disease virus non-structural protein 3A upregulates the expression of autophagy and immune response genes in vitro. Virus Res. 2020, 292, 198247. [Google Scholar] [CrossRef]
  85. Barco, A.; Feduchi, E.; Carrasco, L. Poliovirus Protease 3Cpro Kills Cells by Apoptosis. Virology 2000, 266, 352–360. [Google Scholar] [CrossRef] [PubMed]
  86. Kuyumcu-Martinez, N.M.; Van Eden, M.E.; Younan, P.; Lloyd, R.E. Cleavage of Poly(A)-Binding Protein by Poliovirus 3C Protease Inhibits Host Cell Translation: A Novel Mechanism for Host Translation Shutoff. Mol. Cell. Biol. 2004, 24, 1779–1790. [Google Scholar] [CrossRef] [PubMed]
  87. Rothstein, M.A.; Richards, O.C.; Amin, C.; Ehrenfeld, E. Enzymatic activity of poliovirus RNA polymerase synthesized in Escherichia coli from viral cDNA. Virology 1988, 164, 301–308. [Google Scholar] [CrossRef]
  88. Harris, K.S.; Reddigari, S.R.; Nicklin, M.J.; Hämmerle, T.; Wimmer, E. Purification and characterization of poliovirus polypeptide 3CD, a proteinase and a precursor for RNA polymerase. J. Virol. 1992, 66, 7481–7489. [Google Scholar] [CrossRef] [PubMed]
  89. Oh, H.S.; Pathak, H.B.; Goodfellow, I.G.; Arnold, J.J.; Cameron, C.E. Insight into Poliovirus Genome Replication and Encapsidation Obtained from Studies of 3B-3C Cleavage Site Mutants. J. Virol. 2009, 83, 9370–9387. [Google Scholar] [CrossRef]
  90. Carroll, A.; Rowlands, D.; Clarke, B. The complete nucleotide sequence of the RNA coding for the primary translation product of foot and mouth disease virus. Nucleic Acids Res. 1984, 12, 2461–2472. [Google Scholar] [CrossRef]
  91. Forss, S.; Strebel, K.; Beck, E.; Schaller, H. Nucleotide sequence and genome organization of foot-and-mouth disease virus. Nucleic Acids Res. 1984, 12, 6587–6601. [Google Scholar] [CrossRef]
  92. Phan, T.G.; Kapusinszky, B.; Wang, C.; Rose, R.K.; Lipton, H.L.; Delwart, E.L. The Fecal Viral Flora of Wild Rodents. PLOS Pathog. 2011, 7, e1002218. [Google Scholar] [CrossRef]
  93. Cao, X.; Kuhn, R.J.; Wimmer, E. Replication of poliovirus RNA containing two VPg coding sequences leads to a specific deletion event. J. Virol. 1993, 67, 5572–5578. [Google Scholar] [CrossRef]
  94. Berryman, S.; Moffat, K.; Harak, C.; Lohmann, V.; Jackson, T. Foot-and-mouth disease virus replicates independently of phosphatidylinositol 4-phosphate and type III phosphatidylinositol 4-kinases. J. Gen. Virol. 2016, 97, 1841–1852. [Google Scholar] [CrossRef]
  95. Franco, D.; Pathak, H.B.; Cameron, C.E.; Rombaut, B.; Wimmer, E.; Paul, A.V. Stimulation of poliovirus RNA synthesis and virus maturation in a HeLa cell-free in vitro translation-RNA replication system by viral protein 3CDpro. Virol. J. 2005, 2, 86. [Google Scholar] [CrossRef]
  96. Spear, A.; Ogram, S.A.; Morasco, B.J.; Smerage, L.E.; Flanegan, J.B. Viral precursor protein P3 and its processed products perform discrete and essential functions in the poliovirus RNA replication complex. Virology 2015, 485, 492–501. [Google Scholar] [CrossRef] [PubMed]
  97. Percy, N.; Barclay, W.S.; Sullivan, M.; Almond, J.W. A poliovirus replicon containing the chloramphenicol acetyltransferase gene can be used to study the replication and encapsidation of poliovirus RNA. J. Virol. 1992, 66, 5040–5046. [Google Scholar] [CrossRef] [PubMed]
  98. Hagino-Yamagishi, K.; Nomoto, A. In vitro construction of poliovirus defective interfering particles. J. Virol. 1989, 63, 5386–5392. [Google Scholar] [CrossRef] [PubMed]
  99. Barclay, W.; Percy, N.; Almond, J.W.; Moon, D.; Richardson, A.; Evans, D.J.; Li, Q.; Hutchinson, G. Encapsidation studies of poliovirus subgenomic replicons. J. Gen. Virol. 1998, 79, 1725–1734. [Google Scholar] [CrossRef] [PubMed]
  100. Ansardi, D.C.; Porter, D.C.; Morrow, C.D. Complementation of a poliovirus defective genome by a recombinant vaccinia virus which provides poliovirus P1 capsid precursor in trans. J. Virol. 1993, 67, 3684–3690. [Google Scholar] [CrossRef] [PubMed]
  101. Jia, X.-Y.; Van Eden, M.; Busch, M.G.; Ehrenfeld, E.; Summers, D.F. trans -Encapsidation of a Poliovirus Replicon by Different Picornavirus Capsid Proteins. J. Virol. 1998, 72, 7972–7977. [Google Scholar] [CrossRef]
  102. Arita, M.; Iwai-Itamochi, M. High-throughput analysis of anti-poliovirus neutralization antibody titre in human serum by the pseudovirus neutralization test. Sci. Rep. 2022, 12, 1–9. [Google Scholar] [CrossRef]
  103. Nugent, C.I.; Johnson, K.L.; Sarnow, P.; Kirkegaard, K. Functional Coupling between Replication and Packaging of Poliovirus Replicon RNA. J. Virol. 1999, 73, 427–435. [Google Scholar] [CrossRef]
  104. Diep, J.; Ooi, Y.S.; Wilkinson, A.W.; Peters, C.E.; Foy, E.; Johnson, J.R.; Zengel, J.; Ding, S.; Weng, K.-F.; Laufman, O.; et al. Enterovirus pathogenesis requires the host methyltransferase SETD3. Nat. Microbiol. 2019, 4, 2523–2537. [Google Scholar] [CrossRef]
  105. Peters, C.E.; Schulze-Gahmen, U.; Eckhardt, M.; Jang, G.M.; Xu, J.; Pulido, E.H.; Bardine, C.; Craik, C.S.; Ott, M.; Gozani, O.; et al. Structure-function analysis of enterovirus protease 2A in complex with its essential host factor SETD3. Nat. Commun. 2022, 13, 1–15. [Google Scholar] [CrossRef] [PubMed]
  106. Yeh, M.T.; Smith, M.; Carlyle, S.; Konopka-Anstadt, J.L.; Burns, C.C.; Konz, J.; Andino, R.; Macadam, A. Genetic stabilization of attenuated oral vaccines against poliovirus types 1 and 3. Nature 2023, 619, 135–142. [Google Scholar] [CrossRef] [PubMed]
  107. World Health Organization. Two years since rollout of novel oral polio vaccine type 2 (nOPV2): How’s it all working out? 2023. Available online: https://polioeradicationorg/news-post/two-years-since-rollout-of-novel-oral-polio-vaccine-type-2-nopv2-hows-it-all-working-out/.
  108. Arita, M.; Wakita, T.; Shimizu, H. Characterization of pharmacologically active compounds that inhibit poliovirus and enterovirus 71 infectivity. J. Gen. Virol. 2008, 89, 2518–2530. [Google Scholar] [CrossRef] [PubMed]
  109. Herold, J.; Andino, R. Poliovirus Requires a Precise 5′ End for Efficient Positive-Strand RNA Synthesis. J. Virol. 2000, 74, 6394–6400. [Google Scholar] [CrossRef] [PubMed]
  110. Arita, M. Essential Domains of Oxysterol-Binding Protein Required for Poliovirus Replication. Viruses 2022, 14, 2672. [Google Scholar] [CrossRef] [PubMed]
  111. Arita, M.; Ami, Y.; Wakita, T.; Shimizu, H. Cooperative Effect of the Attenuation Determinants Derived from Poliovirus Sabin 1 Strain Is Essential for Attenuation of Enterovirus 71 in the NOD/SCID Mouse Infection Model. J. Virol. 2008, 82, 1787–1797. [Google Scholar] [CrossRef] [PubMed]
  112. Kamentsky, L.; Jones, T.R.; Fraser, A.; Bray, M.-A.; Logan, D.J.; Madden, K.L.; Ljosa, V.; Rueden, C.; Eliceiri, K.W.; Carpen-ter, A.E. Improved structure, function and compatibility for CellProfiler: Modular high-throughput image analysis software. Bioinformatics 2011, 27, 1179–1180. [Google Scholar] [CrossRef] [PubMed]
Preprints 101247 g001
Figure 1. Doxycycline (DOX)-inducible expression of PV non-structural proteins in Tet-AG-PV-2B2CP3(WT) cells. (A) Expression of PV non-structural proteins in Tet-AG-PV-2B2CP3(WT) cells. PV non-structural proteins were expressed as a form of an N-terminally Azami green (AG)-fused single polyprotein in the presence of doxycycline (DOX). The cells were treated with DOX (1 mg/L) for 17 h in the presence of absence of a 3C protease inhibitor GC376 (100 μM). Fluorescent microscope images of the cells with or without DOX treatment are shown. (B) Western blot analysis of the expressed proteins in the cells. Tet-AG-PV-2B2CP3(WT) cells were treated with or without DOX for 17 h in the presence of absence of 3C protease inhibitors GC376 (1, 10, or 100 μM) or rupintrivir (0.1, 1, or 10 μM). Processing intermediates of the polyprotein were detected with an anti-3D antibody.
Figure 1. Doxycycline (DOX)-inducible expression of PV non-structural proteins in Tet-AG-PV-2B2CP3(WT) cells. (A) Expression of PV non-structural proteins in Tet-AG-PV-2B2CP3(WT) cells. PV non-structural proteins were expressed as a form of an N-terminally Azami green (AG)-fused single polyprotein in the presence of doxycycline (DOX). The cells were treated with DOX (1 mg/L) for 17 h in the presence of absence of a 3C protease inhibitor GC376 (100 μM). Fluorescent microscope images of the cells with or without DOX treatment are shown. (B) Western blot analysis of the expressed proteins in the cells. Tet-AG-PV-2B2CP3(WT) cells were treated with or without DOX for 17 h in the presence of absence of 3C protease inhibitors GC376 (1, 10, or 100 μM) or rupintrivir (0.1, 1, or 10 μM). Processing intermediates of the polyprotein were detected with an anti-3D antibody.
Preprints 101247 g001
Preprints 101247 g002
Figure 2. Experimental design of trans rescue of replication of defective PV replicons. (A) Schematic view of the trans-rescue experiment. PV non-structural proteins were expressed in the presence of DOX (1 mg/mL) and GC376 (100 μM) at 37°C for 17 h. Then, RNA transcripts of each PV replicon mutants that have firefly luciferase or mCherry reporters were transfected into cells in the absence of DOX and GC376. The luciferase signals or fluorescence of mCherry in the cells were analyzed at 7 h p.t. of RNA transcripts. (B) Schematic view of PV replicon mutants. Firefly luciferase or mCHerry was used as reporters for replication. Introduced amino acid substitutions in the cleavage sites by 3Cpro or deletions of each viral gene are shown.
Figure 2. Experimental design of trans rescue of replication of defective PV replicons. (A) Schematic view of the trans-rescue experiment. PV non-structural proteins were expressed in the presence of DOX (1 mg/mL) and GC376 (100 μM) at 37°C for 17 h. Then, RNA transcripts of each PV replicon mutants that have firefly luciferase or mCherry reporters were transfected into cells in the absence of DOX and GC376. The luciferase signals or fluorescence of mCherry in the cells were analyzed at 7 h p.t. of RNA transcripts. (B) Schematic view of PV replicon mutants. Firefly luciferase or mCHerry was used as reporters for replication. Introduced amino acid substitutions in the cleavage sites by 3Cpro or deletions of each viral gene are shown.
Preprints 101247 g002
Preprints 101247 g003
Figure 3. Trans rescue of replication of defective PV replicons in Tet-AG-PV-2B2CP3(WT) cells. Without DOX treatment (A) or after DOX and GC376 treatment (B), the cells were transfected with RNA transcripts of each replicon that have firefly luciferase reporter, in the presence of absence of GuHCl (a 2C inhibitor). The luciferase signals measured at 7 h p.t. of the RNA transcripts are shown.
Figure 3. Trans rescue of replication of defective PV replicons in Tet-AG-PV-2B2CP3(WT) cells. Without DOX treatment (A) or after DOX and GC376 treatment (B), the cells were transfected with RNA transcripts of each replicon that have firefly luciferase reporter, in the presence of absence of GuHCl (a 2C inhibitor). The luciferase signals measured at 7 h p.t. of the RNA transcripts are shown.
Preprints 101247 g003
Preprints 101247 g004
Figure 4. Cis roles of viral proteins in trans-rescued replication of defective PV replicons. (A) Schematic view of defective PV replicon mutants with a disrupted cleavage site between the 3C and 3D regions. Firefly luciferase was used as reporter of the replication. (B) Trans rescue of replication of defective PV replicon mutants in Tet-AG-PV-2B2CP3(WT) cells. After DOX and GC376 treatment for 17 h, the cells were transfected with each RNA transcript of the replicon that has firefly luciferase reporter, in the presence of absence of GuHCl. The luciferase signals measured at 7 h p.t. of the RNA transcripts are shown.
Figure 4. Cis roles of viral proteins in trans-rescued replication of defective PV replicons. (A) Schematic view of defective PV replicon mutants with a disrupted cleavage site between the 3C and 3D regions. Firefly luciferase was used as reporter of the replication. (B) Trans rescue of replication of defective PV replicon mutants in Tet-AG-PV-2B2CP3(WT) cells. After DOX and GC376 treatment for 17 h, the cells were transfected with each RNA transcript of the replicon that has firefly luciferase reporter, in the presence of absence of GuHCl. The luciferase signals measured at 7 h p.t. of the RNA transcripts are shown.
Preprints 101247 g004
Preprints 101247 g005
Figure 5. Trans rescue of replication of defective PV replicons by 3CDpro. (A) Generation of HEK293 cell lines (Tet-AG-3CD(WT) and Tet-AG-3CD(Δ4-5 aa) that expresses PV 3CD proteins (WT or a Δ4-5 aa variant) in the presence of DOX. Fluorescent microscope images of the cells for AG after DOX treatment for 17 h are shown. (B) Western blot analysis of the expressed proteins in the cells. The cells were treated with or without DOX for 17 h. Processing intermediates of the 3CD proteins were detected by anti-3D antibody. (C) Trans rescue of replication of a defective PV replicon in Tet-AG-3CD(WT) and Tet-AG-3CD(Δ4-5 aa) cells. After the DOX and GC376 treatment for 17 h, the cells were transfected with each RNA transcript of the replicon that has firefly luciferase reporter, in the presence or absence of GuHCl. The luciferase signals measured at 7 h p.t. of the RNA transcripts are shown.
Figure 5. Trans rescue of replication of defective PV replicons by 3CDpro. (A) Generation of HEK293 cell lines (Tet-AG-3CD(WT) and Tet-AG-3CD(Δ4-5 aa) that expresses PV 3CD proteins (WT or a Δ4-5 aa variant) in the presence of DOX. Fluorescent microscope images of the cells for AG after DOX treatment for 17 h are shown. (B) Western blot analysis of the expressed proteins in the cells. The cells were treated with or without DOX for 17 h. Processing intermediates of the 3CD proteins were detected by anti-3D antibody. (C) Trans rescue of replication of a defective PV replicon in Tet-AG-3CD(WT) and Tet-AG-3CD(Δ4-5 aa) cells. After the DOX and GC376 treatment for 17 h, the cells were transfected with each RNA transcript of the replicon that has firefly luciferase reporter, in the presence or absence of GuHCl. The luciferase signals measured at 7 h p.t. of the RNA transcripts are shown.
Preprints 101247 g005
Preprints 101247 g006
Figure 6. Effect of modifications of 3CDpro on trans-rescue activity. (A) Effects of amino acid substitutions that affect the interaction of 3CD with RNA or of N-terminal modification by addition of uncleavable AG on the trans-rescue activity. Cells expressing each AG-3CD variant were treated with DOX (1 mg/mL) at 37°C for 5 h, and then infected with PV1(Fluc)pv(3C/D[A/G]) at an MOI of 0.05, in the presence of absence of GuHCl. The luciferase signals measured at 17 h p.i. are shown. (B) Trans-cleavage activity of 3CD (WT and a Δ4-5 aa variant). Western blot analysis for the processing intermediates derived from a polyprotein are shown. Cells were treated with or without DOX for 17 h to co-express a polyprotein without the 3C protease activity conferred by a 3C-C147A substitution and AG-3CD (WT or a Δ4-5 aa variant). Processing intermediates derived from the polyprotein were detected by anti-2C or 3A antibodies. Lysates of Tet-AG-2B2CP3(WT) cells and serially diluted lysates of PV1(Fluc)pv infected cells (dilution of 1/1 to 1/16) were taken as positive controls for the processing intermediates.
Figure 6. Effect of modifications of 3CDpro on trans-rescue activity. (A) Effects of amino acid substitutions that affect the interaction of 3CD with RNA or of N-terminal modification by addition of uncleavable AG on the trans-rescue activity. Cells expressing each AG-3CD variant were treated with DOX (1 mg/mL) at 37°C for 5 h, and then infected with PV1(Fluc)pv(3C/D[A/G]) at an MOI of 0.05, in the presence of absence of GuHCl. The luciferase signals measured at 17 h p.i. are shown. (B) Trans-cleavage activity of 3CD (WT and a Δ4-5 aa variant). Western blot analysis for the processing intermediates derived from a polyprotein are shown. Cells were treated with or without DOX for 17 h to co-express a polyprotein without the 3C protease activity conferred by a 3C-C147A substitution and AG-3CD (WT or a Δ4-5 aa variant). Processing intermediates derived from the polyprotein were detected by anti-2C or 3A antibodies. Lysates of Tet-AG-2B2CP3(WT) cells and serially diluted lysates of PV1(Fluc)pv infected cells (dilution of 1/1 to 1/16) were taken as positive controls for the processing intermediates.
Preprints 101247 g006
Preprints 101247 g007
Figure 7. Production of defective PVpv. (A) Experimental design for trans rescue of PVpv production. Tet-AG-3CD(WT) cells were transfected with a PV capsid expression vector in the presence of DOX (1 mg/mL) and GC376 (100 μM) to express the 3CD protein at 37°C for 17 h. Then, RNA transcripts of each PV replicon (WT or 3C/D[A/G] mutant) were transfected to the cells in the absence of DOX and GC376. The cells were collected at around 24 h p.t. of the RNA transcripts. (B) Infectivity of PVpv produced with a defective PV replicon with mCherry reporter. Tet-AG-3CD(WT) or Tet-AG-3CD(Δ4-5 aa) cells were treated with or without DOX (1 mg/mL) at 37°C for 5 h. The cells were infected with 10 μL of PVpv solution and then incubated at 37°C for 17 h. Fluorescent microscope images of the cells for mCherry and the observed titers of PVpv (infectious unit [IU]/100 μL) are shown. .
Figure 7. Production of defective PVpv. (A) Experimental design for trans rescue of PVpv production. Tet-AG-3CD(WT) cells were transfected with a PV capsid expression vector in the presence of DOX (1 mg/mL) and GC376 (100 μM) to express the 3CD protein at 37°C for 17 h. Then, RNA transcripts of each PV replicon (WT or 3C/D[A/G] mutant) were transfected to the cells in the absence of DOX and GC376. The cells were collected at around 24 h p.t. of the RNA transcripts. (B) Infectivity of PVpv produced with a defective PV replicon with mCherry reporter. Tet-AG-3CD(WT) or Tet-AG-3CD(Δ4-5 aa) cells were treated with or without DOX (1 mg/mL) at 37°C for 5 h. The cells were infected with 10 μL of PVpv solution and then incubated at 37°C for 17 h. Fluorescent microscope images of the cells for mCherry and the observed titers of PVpv (infectious unit [IU]/100 μL) are shown. .
Preprints 101247 g007
Preprints 101247 g008
Figure 8. Titer and antigenicity of defective PVpv. (A) Titer of defective PVpv (3C/D[A/G] mutant) with mCherry or firefly luciferase reporter. Observed titer of PV1(mCherry)pv (IU/100 μL) and luciferase signals in the cells infected with 5 μL of PV1(Fluc)pv are shown. (B) Neutralization of PV1(mCherry)pv. PV1(mCherry)pv (2.0 × 103 IU) were incubated with standard anti-PV1, PV2, or PV3 standard antisera (26 U for each type) at 4°C for 7 h, and then added to the DOX-treated Tet-AG-3CD(WT) cells. The numbers of the cells positive for mCherry fluorescence was counted at 17 h p.i. PV1(mCherry)pv infection in the absence of antisera is taken 100%.
Figure 8. Titer and antigenicity of defective PVpv. (A) Titer of defective PVpv (3C/D[A/G] mutant) with mCherry or firefly luciferase reporter. Observed titer of PV1(mCherry)pv (IU/100 μL) and luciferase signals in the cells infected with 5 μL of PV1(Fluc)pv are shown. (B) Neutralization of PV1(mCherry)pv. PV1(mCherry)pv (2.0 × 103 IU) were incubated with standard anti-PV1, PV2, or PV3 standard antisera (26 U for each type) at 4°C for 7 h, and then added to the DOX-treated Tet-AG-3CD(WT) cells. The numbers of the cells positive for mCherry fluorescence was counted at 17 h p.i. PV1(mCherry)pv infection in the absence of antisera is taken 100%.
Preprints 101247 g008
Preprints 101247 g009
Figure 9. A model of PV replication by trans-provided 3CDpro. Trans provided 3CDpro provides 3Dpol activity to the pre-initiation complex via virus species specific protein-protein interactions.
Figure 9. A model of PV replication by trans-provided 3CDpro. Trans provided 3CDpro provides 3Dpol activity to the pre-initiation complex via virus species specific protein-protein interactions.
Preprints 101247 g009
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.
Prerpints.org logo

Preprints.org is a free preprint server supported by MDPI in Basel, Switzerland.

facebook logotwitter logolinkedin logo
MDPI Initiatives
Important Links
Subscribe

Disclaimer

Terms of Use

Privacy Policy

© 2024 MDPI (Basel, Switzerland) unless otherwise stated