You are currently viewing a beta version of our website. If you spot anything unusual, kindly let us know.
Altmetrics
Downloads
122
Views
39
Comments
0
A peer-reviewed article of this preprint also exists.
This version is not peer-reviewed
Species | Isolate numbera | Phylogenetic | Host | Country | Real time PCR result |
---|---|---|---|---|---|
clade b | |||||
P. x alni subsp. alni | CREADC-Om293 | 7a | Alnus glutinosa | Germany | - |
P. x alni subsp. multiformis | CREADC-Om294 | 7a | Alnus glutinosa | The Netherlands | - |
P. x alni subsp. uniformis | CREADC-Om295/BBA7/03-2.3 | 7a | Alnus glutinosa | Germany | - |
P. cactorum | CREADC-Om60 | 1a | Juglans regia | Italy | - |
CREADC-Om61 | Juglans regia | Italy | - | ||
P. cambivora | CREADC-Om133 | 7a | Fagus | Italy | - |
CREADC-Om134 | Fagus | Italy | - | ||
P. capsici | CREADC-Om246 | 2b | Capsicum annum | Italy | - |
P. cinnamomi | CREADC-Om69 | 7c | Quercus rubra | France | + |
CREADC-Om70 | Juglans regia | Italy | + | ||
CREADC-Om74 | Juglans regia | Italy | + | ||
CREADC-Om76 | Juglans regia | Italy | + | ||
CREADC-Om119 | Juglans regia | Italy | + | ||
CREADC-Om194 | Juglans regia | Italy | + | ||
CREADC-Om202 | Juglans regia | Italy | + | ||
CREADC-Om274 | Juglans regia | Italy | + | ||
CREADC-Om281 | Juglans regia | Italy | + | ||
CREADC-Om283 | Juglans regia | Italy | + | ||
CREADC-Om139 | Castanea sativa | Spain | + | ||
CREADC-Om141 | Castanea sativa | Spain | + | ||
CREADC-Om142 | Castanea sativa | Spain | + | ||
CREADC-Om144 | Quercus sp. | Italy | + | ||
CREADC-Om145 | Quercus sp. | Italy | + | ||
P. citricola | CREADC-Om161 | 2c | Juglans regia | Italy | - |
P. cryptogea | CREADC-Om26 | 8a | Actinidia deliciosa | Italy | - |
CREADC-Om28 | Actinidia deliciosa | Italy | - | ||
P. drechsleri | CREADC-Om41/CBS292-35 | 8a | NA | NA | - |
CREADC-Om220 | NA | Germany | - | ||
P. gonapodyides | CREADC-Om261 | 6b | Juglans regia | Italy | - |
P. hedraiandra | CREADC-Om68 | 1a | Viburnum tinus | Italy | - |
P. hydropathica | CREADC-Om234 | 9a1 | Viburnum tinus | Italy | - |
CREADC-Om236 | Viburnum tinus | Italy | - | ||
P. kernoviae | CREADC-Om273/CBS 122049 | 10 | England | - | |
P. megasperma | CREADC-Om198 | 6b | Juglans regia | Italy | - |
CREADC-Om199 | Juglans regia | Italy | - | ||
CREADC-Om239 | Celtis australis | Italy | - | ||
CREADC-Om284 | Juglans regia | Italy | - | ||
P. nicotianae | CREADC-Om263 | 1c | Vinca | Italy | - |
CREADC-Om265 | Capsicum annuum | Italy | - | ||
P. niederhauserii | CREADC-Om153 | 7b | Hedera helix | Italy | - |
CREADC-Om154 | Hedera helix | Italy | - | ||
CREADC-Om242 | Heuchera sp. | Germany | - | ||
BBA NB 10045 | Hedera helix | Norway | - | ||
P. palmivora | CREADC-Om19 | 4 | Pittosporum tobira | Italy | - |
CREADC-Om22 | Pittosporum tobira | Italy | - | ||
P. parvispora | BBA 65507/ CREADC-Om298 | 7c | Beaucameare curvata | Mexico | - |
P. ramorum | CREADC-Om229 | 8c | Viburnus tinus | Italy | - |
P. tropicalis | CREADC-Om210 | 2b | Rhododendron sp. | Italy | - |
CREADC-Om212 | Rhododendron sp. | Italy | - | ||
CREADC-Om237 | 2b | Albizia julibrissin | Italy | - | |
Pythium chamaehyphon | CREADC-Om162 | Juglans regia | Italy | - | |
Pythium sterilum | CREADC-Om164 | Juglans regia | Italy | - | |
a Isolates present in CREA-DC collection and tested in vivo. Julius Kuehn-Institute (JKI, derived from the former Federal Biological Research Centre for Agriculture and Forestry [BBA]); Centraal Bureau voor Schimmelcultures (CBS); Consiglio per la Ricerca in Agricoltura e l’Analisi dell’Economia Agraria (CREA)-Centro di Ricerca Difesa e Certificazione (CREA-DC) cultures (Om) | |||||
b In accordance with Yang et al. [1] |
Primers or Probe | Sequences (5’-3’) | Tm (°C) | DNA region | Positiona (bp) |
Product size (bp) | Reference |
P. cinn 3.4F |
TTTGTGAGTGCCGAGACAAG |
58,42 |
Intron3/Ypt1 |
4-23 |
75 |
This study |
P. cinn 3.78R |
GCACAGAAACAACAACGACG |
58,55 |
Intron3/Ypt1 |
31-52 |
75 |
This study |
P. cinn 3.31Probeb |
[FAM]-CCTGTCTGCCCCATTCAACAGA-[BHQ] |
63,48 |
Intron3/Ypt1 |
59-78 |
-- |
This study |
YPh1F |
CGACCATKGGTGTGGACTTT | ̴ 450 | [21] |
|||
YPh2R | ACGTTCTCMCAGGCGTATCT | ̴ 450 | [21] | |||
a Position of the primer or probe considering GenBank accession no. DQ162959as reference sequence. b FAM 6-carboxyfluorescein, BHQ1 Black Hole Quencher 1, registered trademark of Bioresearch Technologies, Inc. |
Host | Tree condition | qPCR | Mean quantity* pg of pathogen DNA /mg host tissue |
---|---|---|---|
Walnut Zn 3/18 | Symptomatic | Positive | 24,1 |
Walnut Zn 8/19 | Symptomatic | Positive | 19,6 |
Walnut Tas10/8 | Asymptomatic | Negative | UD |
Walnut Tas 3/9 | Asymptomatic | Negative | UD |
Walnut Tas 7/12 | Asymptomatic | Negative | UD |
Walnut Tas 9/20 | Symptomatic | Positive | 18.1 |
Walnut Tas11/18 | Symptomatic | Positive | 14,5 |
Walnut Tas13/13 | Symptomatic | Positive | 9,4 |
Walnut BD5/6 | Symptomatic | Positive | 12.75 |
Chestnut |
Symptomatic | Positive | 15,4 |
Chestnut |
Symptomatic | Positive | 2,3 |
Chestnut |
Symptomatic | Positive | 10,1 |
Oak |
Symptomatic | Positive | 1,6 |
Oak |
Symptomatic | Positive | 17,3 |
Walnut tree | Distance from the tree | Depth | Sample I | qPCR result | Sample II | qPCR result |
---|---|---|---|---|---|---|
Zn 3/18 | ||||||
0,5m | 20 | 3A | P1 P2 | 3.1 | P1 P2 | |
1,5m | 20 | 3B | P1 P2 | 3.2 | P1 X2 | |
2,5m | 20 | 3C | X1 X2 | 3.3 | X1 X2 | |
3,5m | 20 | 3D | P1 X2 | 3.4 | X1 P2 | |
inter-row 1,5m | 20 | 3E | X1 X2 | 3.5 | X1 P2 | |
0,5m | 40 | 3F | P1 P2 | 3.6 | P1 P2 | |
1,5m | 40 | 3G | X1 P2 | 3.7 | P1 P2 | |
2,5m | 40 | 3H | X1 X2 | 3.8 | X1 X2 | |
3,5m | 40 | 3I | X1 X2 | 3.9 | X1 X2 | |
Inter-row 1,5m | 40 | 3L | P1 P2 | 3.10 | P1 P2 | |
Zn 8/19 | ||||||
0,5m | 20 | 8A | P1 P2 | 8.1 | P1 P2 | |
1,5m | 20 | 8B | X1 X2 | 8.2 | P1 P2 | |
2,5m | 20 | 8C | P1 X2 | 8.3 | P1 X2 | |
3,5m | 20 | 8D | P1 X2 | 8.4 | P1 X2 | |
Inter-row 1,5m | 20 | 8E | P1 X2 | 8.5 | X1 X2 | |
0,5m | 40 | 8F | P1 P2 | 8.6 | P1 P2 | |
1,5m | 40 | 8G | P1 X2 | 8.7 | P1 X2 | |
2,5m | 40 | 8H | X1 P2 | 8.8 | X1 P2 | |
3,5m | 40 | 8I | X1 P2 | 8.9 | P1 X2 | |
Inter-row 1,5m | 40 | 8L | X1 P2 | 8.10 | X1 X2 |
Plant for soil samples | Tree Condition | Soil Sample and Depth | qPCR results | Mean Ct and standard deviation | Mean quantity* pg of pathogen DNA /g of soil |
---|---|---|---|---|---|
Rhododendron | Symptomatic | Potted soil sample | Positive | 29,95 ± 0,08 | 140,4 |
Rhododendron | Symptomatic | Potted soil sample | Positive | 30,18 ± 0,03 | 123,5 |
Rhododendron | Symptomatic | Potted soil sample | Positive | 28,47 ± 0,18 | 390,1 |
Walnut Zn 7/18 | Symptomatic | 20 cm | positive | 37,98 ± 0,51a | <0,25 |
40 cm | positive | Pos nested qPCR | <0,25 | ||
Walnut Tas 10/8 | Asymptomatic | 20 cm | Negative | UD | - |
40 cm | Negative | UD | - | ||
Walnut Tas 3/9 | Asymptomatic | 20 cm | Negative | UD | - |
40 cm | Negative | UD | - | ||
Walnut Tas 7/12 | Asymptomatic | 20 cm | Negative | UD | - |
40 cm | Negative | UD | - | ||
Walnut Tas 9/20 | Symptomatic | 20 cm | positive | 36,99 ± 1,47 | 0,61 |
40 cm | positive | Pos nested qPCR | < 0,25 | ||
Walnut Tas 11/18 | Symptomatic | 20 cm | positive | 30,47 ±0,07 | 134 |
40 cm | positive | 29,21 ±0,16 | 267 | ||
Walnut Tas 13/13 | Symptomatic | 20 cm | positive | 34,47 ±1,028 | 15 |
40 cm | positive | 34,99 ±1,57 | 13,9 | ||
Walnut Tas 16/12 | Symptomatic | 20 cm | positive | 35,47 ± 1,19 | 8,7 |
40 cm | positive | 31,21 ± 0,14 | 89,8 | ||
Walnut Dossei 1 | Symptomatic | 20 cm | Positive | 38,06 ± 1,05a | <0.25 |
40 cm | positive | Pos nested qPCR | < 0.25 | ||
Walnut Dossei 2 | Asymptomatic | 20 cm | positive | Pos nested qPCR | < 0.25 |
40 cm | positive | Pos nested qPCR | < 0.25 | ||
Walnut Dossei 3 | Symptomatic | 20 cm | positive | Pos nested qPCR | < 0.25 |
40 cm | positive | 35,32 ± 1,56 | 2,8 | ||
Walnut BD 5/6 | Symptomatic | 20 cm | positive | 35,47 ± 0,27 | 2,49 |
Walnut BD 9/10 |
Symptomatic | 20 cm | positive | 33,99 ± 0,12 | 6,67 |
40cm | positive | 35,16 ± 0,81 | 3,03 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
supplementary.docx (88.81KB )
Submitted:
30 May 2024
Posted:
30 May 2024
You are already at the latest version
A peer-reviewed article of this preprint also exists.
supplementary.docx (88.81KB )
This version is not peer-reviewed
Submitted:
30 May 2024
Posted:
30 May 2024
You are already at the latest version
Species | Isolate numbera | Phylogenetic | Host | Country | Real time PCR result |
---|---|---|---|---|---|
clade b | |||||
P. x alni subsp. alni | CREADC-Om293 | 7a | Alnus glutinosa | Germany | - |
P. x alni subsp. multiformis | CREADC-Om294 | 7a | Alnus glutinosa | The Netherlands | - |
P. x alni subsp. uniformis | CREADC-Om295/BBA7/03-2.3 | 7a | Alnus glutinosa | Germany | - |
P. cactorum | CREADC-Om60 | 1a | Juglans regia | Italy | - |
CREADC-Om61 | Juglans regia | Italy | - | ||
P. cambivora | CREADC-Om133 | 7a | Fagus | Italy | - |
CREADC-Om134 | Fagus | Italy | - | ||
P. capsici | CREADC-Om246 | 2b | Capsicum annum | Italy | - |
P. cinnamomi | CREADC-Om69 | 7c | Quercus rubra | France | + |
CREADC-Om70 | Juglans regia | Italy | + | ||
CREADC-Om74 | Juglans regia | Italy | + | ||
CREADC-Om76 | Juglans regia | Italy | + | ||
CREADC-Om119 | Juglans regia | Italy | + | ||
CREADC-Om194 | Juglans regia | Italy | + | ||
CREADC-Om202 | Juglans regia | Italy | + | ||
CREADC-Om274 | Juglans regia | Italy | + | ||
CREADC-Om281 | Juglans regia | Italy | + | ||
CREADC-Om283 | Juglans regia | Italy | + | ||
CREADC-Om139 | Castanea sativa | Spain | + | ||
CREADC-Om141 | Castanea sativa | Spain | + | ||
CREADC-Om142 | Castanea sativa | Spain | + | ||
CREADC-Om144 | Quercus sp. | Italy | + | ||
CREADC-Om145 | Quercus sp. | Italy | + | ||
P. citricola | CREADC-Om161 | 2c | Juglans regia | Italy | - |
P. cryptogea | CREADC-Om26 | 8a | Actinidia deliciosa | Italy | - |
CREADC-Om28 | Actinidia deliciosa | Italy | - | ||
P. drechsleri | CREADC-Om41/CBS292-35 | 8a | NA | NA | - |
CREADC-Om220 | NA | Germany | - | ||
P. gonapodyides | CREADC-Om261 | 6b | Juglans regia | Italy | - |
P. hedraiandra | CREADC-Om68 | 1a | Viburnum tinus | Italy | - |
P. hydropathica | CREADC-Om234 | 9a1 | Viburnum tinus | Italy | - |
CREADC-Om236 | Viburnum tinus | Italy | - | ||
P. kernoviae | CREADC-Om273/CBS 122049 | 10 | England | - | |
P. megasperma | CREADC-Om198 | 6b | Juglans regia | Italy | - |
CREADC-Om199 | Juglans regia | Italy | - | ||
CREADC-Om239 | Celtis australis | Italy | - | ||
CREADC-Om284 | Juglans regia | Italy | - | ||
P. nicotianae | CREADC-Om263 | 1c | Vinca | Italy | - |
CREADC-Om265 | Capsicum annuum | Italy | - | ||
P. niederhauserii | CREADC-Om153 | 7b | Hedera helix | Italy | - |
CREADC-Om154 | Hedera helix | Italy | - | ||
CREADC-Om242 | Heuchera sp. | Germany | - | ||
BBA NB 10045 | Hedera helix | Norway | - | ||
P. palmivora | CREADC-Om19 | 4 | Pittosporum tobira | Italy | - |
CREADC-Om22 | Pittosporum tobira | Italy | - | ||
P. parvispora | BBA 65507/ CREADC-Om298 | 7c | Beaucameare curvata | Mexico | - |
P. ramorum | CREADC-Om229 | 8c | Viburnus tinus | Italy | - |
P. tropicalis | CREADC-Om210 | 2b | Rhododendron sp. | Italy | - |
CREADC-Om212 | Rhododendron sp. | Italy | - | ||
CREADC-Om237 | 2b | Albizia julibrissin | Italy | - | |
Pythium chamaehyphon | CREADC-Om162 | Juglans regia | Italy | - | |
Pythium sterilum | CREADC-Om164 | Juglans regia | Italy | - | |
a Isolates present in CREA-DC collection and tested in vivo. Julius Kuehn-Institute (JKI, derived from the former Federal Biological Research Centre for Agriculture and Forestry [BBA]); Centraal Bureau voor Schimmelcultures (CBS); Consiglio per la Ricerca in Agricoltura e l’Analisi dell’Economia Agraria (CREA)-Centro di Ricerca Difesa e Certificazione (CREA-DC) cultures (Om) | |||||
b In accordance with Yang et al. [1] |
Primers or Probe | Sequences (5’-3’) | Tm (°C) | DNA region | Positiona (bp) |
Product size (bp) | Reference |
P. cinn 3.4F |
TTTGTGAGTGCCGAGACAAG |
58,42 |
Intron3/Ypt1 |
4-23 |
75 |
This study |
P. cinn 3.78R |
GCACAGAAACAACAACGACG |
58,55 |
Intron3/Ypt1 |
31-52 |
75 |
This study |
P. cinn 3.31Probeb |
[FAM]-CCTGTCTGCCCCATTCAACAGA-[BHQ] |
63,48 |
Intron3/Ypt1 |
59-78 |
-- |
This study |
YPh1F |
CGACCATKGGTGTGGACTTT | ̴ 450 | [21] |
|||
YPh2R | ACGTTCTCMCAGGCGTATCT | ̴ 450 | [21] | |||
a Position of the primer or probe considering GenBank accession no. DQ162959as reference sequence. b FAM 6-carboxyfluorescein, BHQ1 Black Hole Quencher 1, registered trademark of Bioresearch Technologies, Inc. |
Host | Tree condition | qPCR | Mean quantity* pg of pathogen DNA /mg host tissue |
---|---|---|---|
Walnut Zn 3/18 | Symptomatic | Positive | 24,1 |
Walnut Zn 8/19 | Symptomatic | Positive | 19,6 |
Walnut Tas10/8 | Asymptomatic | Negative | UD |
Walnut Tas 3/9 | Asymptomatic | Negative | UD |
Walnut Tas 7/12 | Asymptomatic | Negative | UD |
Walnut Tas 9/20 | Symptomatic | Positive | 18.1 |
Walnut Tas11/18 | Symptomatic | Positive | 14,5 |
Walnut Tas13/13 | Symptomatic | Positive | 9,4 |
Walnut BD5/6 | Symptomatic | Positive | 12.75 |
Chestnut |
Symptomatic | Positive | 15,4 |
Chestnut |
Symptomatic | Positive | 2,3 |
Chestnut |
Symptomatic | Positive | 10,1 |
Oak |
Symptomatic | Positive | 1,6 |
Oak |
Symptomatic | Positive | 17,3 |
Walnut tree | Distance from the tree | Depth | Sample I | qPCR result | Sample II | qPCR result |
---|---|---|---|---|---|---|
Zn 3/18 | ||||||
0,5m | 20 | 3A | P1 P2 | 3.1 | P1 P2 | |
1,5m | 20 | 3B | P1 P2 | 3.2 | P1 X2 | |
2,5m | 20 | 3C | X1 X2 | 3.3 | X1 X2 | |
3,5m | 20 | 3D | P1 X2 | 3.4 | X1 P2 | |
inter-row 1,5m | 20 | 3E | X1 X2 | 3.5 | X1 P2 | |
0,5m | 40 | 3F | P1 P2 | 3.6 | P1 P2 | |
1,5m | 40 | 3G | X1 P2 | 3.7 | P1 P2 | |
2,5m | 40 | 3H | X1 X2 | 3.8 | X1 X2 | |
3,5m | 40 | 3I | X1 X2 | 3.9 | X1 X2 | |
Inter-row 1,5m | 40 | 3L | P1 P2 | 3.10 | P1 P2 | |
Zn 8/19 | ||||||
0,5m | 20 | 8A | P1 P2 | 8.1 | P1 P2 | |
1,5m | 20 | 8B | X1 X2 | 8.2 | P1 P2 | |
2,5m | 20 | 8C | P1 X2 | 8.3 | P1 X2 | |
3,5m | 20 | 8D | P1 X2 | 8.4 | P1 X2 | |
Inter-row 1,5m | 20 | 8E | P1 X2 | 8.5 | X1 X2 | |
0,5m | 40 | 8F | P1 P2 | 8.6 | P1 P2 | |
1,5m | 40 | 8G | P1 X2 | 8.7 | P1 X2 | |
2,5m | 40 | 8H | X1 P2 | 8.8 | X1 P2 | |
3,5m | 40 | 8I | X1 P2 | 8.9 | P1 X2 | |
Inter-row 1,5m | 40 | 8L | X1 P2 | 8.10 | X1 X2 |
Plant for soil samples | Tree Condition | Soil Sample and Depth | qPCR results | Mean Ct and standard deviation | Mean quantity* pg of pathogen DNA /g of soil |
---|---|---|---|---|---|
Rhododendron | Symptomatic | Potted soil sample | Positive | 29,95 ± 0,08 | 140,4 |
Rhododendron | Symptomatic | Potted soil sample | Positive | 30,18 ± 0,03 | 123,5 |
Rhododendron | Symptomatic | Potted soil sample | Positive | 28,47 ± 0,18 | 390,1 |
Walnut Zn 7/18 | Symptomatic | 20 cm | positive | 37,98 ± 0,51a | <0,25 |
40 cm | positive | Pos nested qPCR | <0,25 | ||
Walnut Tas 10/8 | Asymptomatic | 20 cm | Negative | UD | - |
40 cm | Negative | UD | - | ||
Walnut Tas 3/9 | Asymptomatic | 20 cm | Negative | UD | - |
40 cm | Negative | UD | - | ||
Walnut Tas 7/12 | Asymptomatic | 20 cm | Negative | UD | - |
40 cm | Negative | UD | - | ||
Walnut Tas 9/20 | Symptomatic | 20 cm | positive | 36,99 ± 1,47 | 0,61 |
40 cm | positive | Pos nested qPCR | < 0,25 | ||
Walnut Tas 11/18 | Symptomatic | 20 cm | positive | 30,47 ±0,07 | 134 |
40 cm | positive | 29,21 ±0,16 | 267 | ||
Walnut Tas 13/13 | Symptomatic | 20 cm | positive | 34,47 ±1,028 | 15 |
40 cm | positive | 34,99 ±1,57 | 13,9 | ||
Walnut Tas 16/12 | Symptomatic | 20 cm | positive | 35,47 ± 1,19 | 8,7 |
40 cm | positive | 31,21 ± 0,14 | 89,8 | ||
Walnut Dossei 1 | Symptomatic | 20 cm | Positive | 38,06 ± 1,05a | <0.25 |
40 cm | positive | Pos nested qPCR | < 0.25 | ||
Walnut Dossei 2 | Asymptomatic | 20 cm | positive | Pos nested qPCR | < 0.25 |
40 cm | positive | Pos nested qPCR | < 0.25 | ||
Walnut Dossei 3 | Symptomatic | 20 cm | positive | Pos nested qPCR | < 0.25 |
40 cm | positive | 35,32 ± 1,56 | 2,8 | ||
Walnut BD 5/6 | Symptomatic | 20 cm | positive | 35,47 ± 0,27 | 2,49 |
Walnut BD 9/10 |
Symptomatic | 20 cm | positive | 33,99 ± 0,12 | 6,67 |
40cm | positive | 35,16 ± 0,81 | 3,03 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
Ofir Degani
et al.
JoF,
2020
Yuan Chen
et al.
IJMS,
2022
Filip Gazdik
et al.
Microorganisms,
2021
© 2024 MDPI (Basel, Switzerland) unless otherwise stated