Preprint
Article

This version is not peer-reviewed.

Quantifying Genetic Parameters for Blackleg Resistance in Rapeseed: A Comparative Study

A peer-reviewed article of this preprint also exists.

Submitted:

30 August 2024

Posted:

02 September 2024

You are already at the latest version

Abstract
Selection is a fundamental part of the plant breeding process, enabling the identification and development of varieties with desirable traits. Thanks to advances in genetics and biotechnology, the selection process has become more precise and efficient, resulting in faster breeding progress and better adaptation of crops to environmental challenges. Genetic parameters related to gene additivity and epistasis play a key role and can influence decisions on the suitability of breeding material. In this study, 188 rapeseed doubled haploid lines were assessed in field conditions for resistance to Leptosphaeria spp. Through next-generation sequencing, a total of 133,764 molecular markers (96,121 SilicoDArT and 37,643 SNP) were obtained. The similarity of the DH lines at the phenotypic and genetic levels was calculated. The results indicate that the similarity at the phenotypic level was markedly different than the similarity at the genetic level. Genetic parameters related to additive gene action effects and epistasis (double and triple) were calculated using two methods: based on phenotypic observations only and using molecular marker observations. All evaluated genetic parameters (additive, additive-additive and additive-additive-additive) were statistically significant for both estimation methods. The parameters associated with the interaction (double and triple) had opposite signs depending on the estimation method.
Keywords: 
;  ;  ;  ;  ;  ;  ;  ;  

1. Introduction

Plant breeding plays a crucial role in agriculture by providing varieties with improved yield, disease resistance, and adaptation to different environmental conditions [1]. A central aspect of this process is selection, which allows for the identification and development of genotypes with desirable traits [2,3]. Modern selection methods, supported by advanced genetic technologies, have become more precise and efficient, contributing to significant progress in breeding [4,5]. Selection in plant breeding involves choosing genotypes with desired traits and further propagating them, leading to the improvement of the breeding population [6]. This process is based on the assumption that certain phenotypic traits are inherited and can be enhanced through appropriate crossing of selected individuals [7,8]. Selection is a key mechanism for improving traits such as yield, product quality, resistance to abiotic and biotic stresses, and adaptation to changing climatic conditions [9,10]. The history of selection in plant breeding dates back to the beginnings of agriculture, when farmers intuitively selected the best plants for propagation. Over time, this process was refined by introducing systematic selection methods based on Mendelian genetics principles. Modern approaches to selection, such as Marker-Assisted Selection (MAS) and genomic selection, have significantly increased the precision and efficiency of breeding [11,12]. Mass selection involves selecting plants with desirable traits from a population and using their seeds to create the next generation [13]. This method is relatively simple and inexpensive, but its effectiveness may be limited for traits with low heritability or complex genetic architecture. Pedigree selection involves tracking the lineage of selected plants over several generations [14,15]. This allows for a better understanding of how traits are inherited and enables more precise selection. This method is particularly useful in the breeding of polygenic traits [16]. Inbreeding line selection involves creating lines of plants with a high degree of homozygosity through repeated crossing within the same line [17,18]. This selection method allows for the stabilization of desirable traits and is crucial in the breeding of pure (homozygous) varieties [19]. Marker-Assisted Selection (MAS) is a modern approach that uses genetic markers to identify plants with desirable genotypes [20]. This method is particularly effective for traits that are difficult to assess based on phenotype, such as disease resistance. MAS allows for faster and more precise selection. Genomic selection is the most advanced form of selection, using full genotype profiles to predict the breeding value of plants [21,22]. This enables the selection of plants with desirable traits already at the seedling stage, significantly accelerating the breeding process. Genomic selection is particularly useful in the breeding of polygenic traits and traits with low heritability [23,24]. One of the main challenges in selection is the complexity of polygenic traits, which are controlled by many genes and can be strongly influenced by the environment. Precise selection of such traits requires advanced genetic and statistical methods [25,26]. Selection carried out over many generations can lead to a reduction in genetic diversity within breeding populations [27]. A narrow genetic pool can increase the risk of losing valuable adaptive traits and resistance to new pathogens [28]. Therefore, it is important to maintain adequate genetic diversity by incorporating wild relatives and diverse genetic materials into breeding programs.
The breeding process can be significantly shortened by using doubled haploid (DH) lines, which are one of the most important tools in modern plant breeding [29,30]. Due to their genetic stability and ability to rapidly achieve homozygosity, DH lines also enhance the precision of selecting desired traits [31,32,33]. Doubled haploid lines are fully homozygous plants created by doubling the chromosome number in haploid gametes (e.g., microspores or megaspores). This process results in lines with a constant, stable genetic structure, which is crucial for many breeding applications. Thanks to this stability, DH lines enable precise selection and predictable inheritance of traits in subsequent generations [34]. In plant breeding, DH lines are used for many purposes, including accelerating the development of new varieties, gene mapping, studying genetic interactions, and producing hybrid varieties [35]. Because these lines are fully homozygous, genetic variation is eliminated, making it easier to identify and select desirable traits. One of the main benefits of their use is the significant reduction in time required to introduce new varieties. The traditional breeding process requires many generations to achieve full homozygosity. With DH lines, fully homozygous material can be obtained in a single generation, speeding up selection and the introduction of new varieties to the market. They are also invaluable in genetic research, especially in gene mapping and the identification of quantitative trait loci (QTL). With full homozygosity, homozygous eliminate the issue of allele segregation, facilitating precise mapping and analysis of trait inheritance. DH lines are widely used in the production of hybrid varieties, where genetic stability is crucial. Fully homozygous DH lines can be used as parents in crosses, ensuring high genetic uniformity of hybrids and predictable trait expression. They are also a valuable tool in studies of genetic interactions, including epistasis and intergenic interactions. The genetic stability of DH lines allows for precise investigation of the effects of individual genes on phenotypic traits [36,37]. Use of DH lines have the potential for further development in combination with modern genetic technologies, such as genome editing (e.g., CRISPR/Cas9) and functional genomics. Integrating these technologies can lead to even faster and more precise creation of plant varieties with desired traits. DH lines can play a key role in precision breeding, where plant genotyping is used to select genotypes with optimal traits for specific environmental conditions. Thanks to their stability, these plants can be an ideal starting material for such advanced breeding programs [38].
The effectiveness of selection depends, among other factors, on the breeder’s decisions, which are based on accurate and reliable information about the genetic traits of the plants [39,40]. In this context, genetic parameters related to the additive effects of genes and epistasis play a crucial role and can influence decisions regarding the suitability of breeding material. Genetic variance is a measure of trait variability in a population that is caused by genetic differences between individuals [41]. It forms the basis of selection, as these genetic differences enable breeders to choose plants with desirable traits. The value of genetic variance determines how quickly and effectively a particular trait can be improved in a population [27]. If the research material is homozygous (DH lines, inbred lines), the genetic variance consists of additive and epistatic components [43,44,45]. Additive variance accounts for the effects of genes acting in an additive manner, meaning the effects of these genes sum up. Additive variance is particularly important in selection because it is easily inherited and accounts for changes in the average trait values in subsequent generations. Epistatic variance arises from interactions between different genes [46,47]. Epistasis can significantly influence the phenotype, but its complexity makes it difficult to predict the outcomes of selection [48,49]. Recently, attention has been drawn to triple interactions of QTL-QTL-QTL gene actions and their significant role in shaping the expression of quantitative traits [50,51,52,53,54]. High genetic variance in a population enables effective selection because there is greater phenotypic diversity from which to choose plants with desirable traits. In particular, additive variance is crucial, as it directly impacts the effectiveness of selection [55].
An earlier study [56] showed that the main effects of genotype were important for the degree of resistance to blackleg. The differences between the mean values of the DH lines were so large that it was decided to further test the structure of their differentiation phenotypically as well as genetically. The objectives of the study undertaken were (i) to assess the similarity of 188 DH lines at the phenotypic and genetic levels together with hierarchical clustering, and (ii) to estimate genetic parameters related to additive gene action, additive-additive interaction and additive-additive-additive interaction using two methods: based solely on phenotypic observations and also using observations of molecular markers.

2. Results

2.1. Phenotyping

Analysis of variance indicated that the main effects of genotype were significant for degree of resistance to blackleg [56]. The differences between the DH lines were so great that it was decided to further check the structure of the differentiation.
The similarity of DH lines in terms of blackleg (Leptosphaeria spp.) resistance calculated from formula (2) ranged from 0 (for five pairs of lines) to 1 (for 832 pairs of DH lines), with a mean of 0.837. A dendrogram showing phenotypic similarity among the 188 DH lines analyzed was constructed from similarity coefficients (2) using the UPGMA method of blackleg (Leptosphaeria spp.) resistance observations (Figure 1). The dendrogram distinguished five similarity groups containing four, 35, 58, 45 and 46 DH lines, respectively (Figure 1).
Estimates of all three genetic parameters calculated from observations of phenotypic blackleg (Leptosphaeria spp.) resistance only were statistically significant. The value of the parameter associated with the additive effect of genes was equal to 2.450. The estimated value of epistasis was equal to 0.435. In contrast, the effect of triple gene-gene-gene interaction was 0.952 (Table 1).

2.2. Genotyping

A total of 133764 molecular markers (96,121 SilicoDArT and 37,643 SNP) were obtained. Based on these markers, a dendrogram of genetic similarity between the 188 DH lines was constructed. Six groups of similarity were distinguished on the dendrogram (Figure 2). The grouping of DH lines at the genetic level did not coincide with the grouping at the phenotypic level. The correlation coefficient between the two similarities was equal to 0.0266. Although this was a statistical significance of 0.001 (with the number of degrees of freedom equal to 17576), no correlation can be said in this case.
Of the 15 molecular markers associated with resistance to blackleg (Leptosphaeria spp.) selected by association mapping in an earlier study [56], five were selected for a multiple model with significant additive main effects (Table 2).
These five markers, associated with QTLs determining the observed trait, were used to construct a multiple regression model including: main effects, double interaction effects of all QTL-QTL pairs, and interaction effects of all QTL-QTL-QTL triplets. The final regression model was of the form:
y = 1.287 + 0.776 · m 12134 + 0.548 · m 12232 + + 0.470 · m 12456 0.532 · m 11720 · m 12134 0.478 · m 7853 · m 12134 · m 12232 .
The final model (significant at the 0.001 level) explained 19.3% of the percentage of variation in blackleg (Leptosphaeria spp.) resistance. Estimates of all three genetic parameters calculated using molecular marker observations were statistically significant, as were those based on phenotypic observations only (Table 1). The total additive effect of genes was equal to 1.794. The interaction-related parameters had negative signs, in contrast to the phenotypic assessments, and were -0.532 and -0.478 for double interaction (epistasis) and triple interaction, respectively (Table 1).

3. Discussion

The selection of breeding materials is the foundation of the plant breeding process, allowing for the development of varieties with desirable traits [5]. As agriculture faces increasing challenges, such as climate change, growing food demand, and limited natural resources, effective selection methods are becoming crucial for the development of new crop varieties [57,58]. The lack of concordance between phenotypic similarity and genetic similarity complicates the selection process. Kozak et al. [59] previously noted that genetic diversity is not the same as phenotypic diversity. In the presented studies, this observation was confirmed by obtaining a linear correlation coefficient between phenotypic and genetic diversity equal to r=0.0266. Seyis et al. [60] analyzed genetic diversity of resynthesized rapeseed generated from interspecific hybridization between suitable forms of Brassica rapa L. (syn. campestris) and B. oleracea L. and obtained results similar to those obtained in the presented study.
The different clustering of DH lines at the phenotypic and genetic levels was likely the cause of the varying assessments of the genetic parameters evaluated using the two proposed methods. Other researchers have reached similar conclusions: Hannan et al. [61] examining 43 rice genotypes, Chen et al. [62] for 258 DH lines derivatives of a cross between a canola variety Quantum and a resynthesized B. napus line No.2127-17, and a fixed immortalized F2 population generated by randomly permutated intermating of these DHs. This was particularly significant for parameters related to gene interactions determining blackleg (Leptosphaeria spp.) resistance. The calculated assessments had opposite signs (which is not an issue, as this can be adjusted during the validation of selected markers) and showed considerable differences in values. Epistasis plays a crucial role in shaping the phenotypic traits of plants [63,64]. It is a phenomenon where one gene can mask or modify the effect of another gene, leading to complex patterns of inheritance and phenotypic variability [65]. Understanding and properly utilizing epistasis in plant breeding is essential for effective selection and the development of varieties with desirable traits [45]. Epistasis complicates classical inheritance patterns, which are based on Mendelian principles [66]. Since epistatic interactions can determine trait values, predicting phenotypes based on genotypes becomes more challenging [67,68]. This can lead to unexpected outcomes in breeding, where traits may not be inherited as expected. Selection in the presence of epistasis requires advanced strategies that account for gene interactions [69]. In traditional selection methods, which focus on individual genes, the effects of epistasis may be overlooked, leading to incomplete control over trait inheritance. Modern methods, such as genomic selection, allow for more precise management of epistasis in the breeding process [70,71,72].
The effects of additive gene action and epistasis for blackleg resistance in rapeseed were also evaluated by other authors [73,74,75,76,77]. Pang and Halloran [73] studied the genetic control of adult-plant blackleg [Leptosphaeria maculans (Desm.) Ces. et De Not.] resistance in rapeseed (B. napus L.) in the F2 and first-backcross populations. Kumar et al. [74] used three segregating populations derived from the resistant cv. Darmor and multi-year data available on oilseed rape panels to obtain a wide overview of the genomic regions involved in quantitative resistance to blackleg in oilseed rape. Pilet et al. [75] analyzed 152 DH lines derived from the F1‘Darmor-bzh’בYudal’ and obtained ten QTLs with significant additive effects. Zhao and Meng [76] studied rapeseed population of 128-F2:3 families derived from a cross between the male sterility restorer line H5200 and a partial resistant line Ning RS-1 and obtained three QTLs with additive effect. Additionally, observed epistasis effects for the resistance. Zhao and Meng [76] concluded that both single-locus QTLs and epistatic interactions played important roles in Sclerotinia resistance in rapeseed. Larkan et al. [77] obtained significant additive and additive-additive interaction effects for a population of 242 DH lines.
Genetic interactions play a crucial role in plant breeding, shaping the expression of phenotypic traits and determining the success of selecting genotypes with desirable characteristics [78]. While classical epistatic interactions involve interactions between two genes, more complex interactions, such as triple interactions that involve the influence of three different genes on a single phenotypic trait, are gaining increasing attention in breeding research [50,51]. Understanding these complex interactions is key to effective selection and the development of plant varieties with optimal characteristics. Triple interaction refers to a situation where three different genes interact to determine a phenotype. Compared to simple two-gene interactions, triple interactions can lead to much more complex inheritance patterns, where the effect of one gene is modified by the presence of two other genes [52,53,54]. This can result in unexpected phenotypes that are not predictable based on the interaction of individual genes alone. In plant breeding, triple interactions can play a crucial role in determining complex quantitative traits. Understanding these interactions will enable breeders to more precisely select genotypes that exhibit synergistic gene effects, leading to a higher level of desirable traits. Triple interactions may also contribute to the stabilization of phenotypic traits across different environmental conditions [54]. When traits are controlled by more than two genes, their expression may be more stable and less susceptible to environmental changes. Breeders can utilize this stability to select plants that exhibit consistent traits regardless of changing climatic conditions. Analyzing triple interactions is significantly more complex than analyzing simple two-gene interactions. It requires advanced statistical and bioinformatics methods that can account for multi-level interactions. Traditional genetic analysis methods may be insufficient for fully understanding these phenomena.

4. Materials and Methods

4.1. Plant Material

188 doubled haploid (DH) lines of rapeseed derived from Strzelce Plant Breeding Ltd. (Strzelce, Poland) IHAR Group Borowo were used as a plant material in this study. To ensure that DH lines would represent a variety of disease response structure in the mapping population, intraspecific crossings of registered rapeseed varieties with confirmed blackleg resistance were performed.

4.2. Field Assessment

All of the doubled haploid lines were subjected to in-field assessment of blackleg resistance, conducted on testing fields belonging to Strzelce Plant Breeding Ltd. IHAR Group Borowo. The experiment was established in randomized complete block design, in three replicates. The level of blackleg resistance was evaluated during the BBCH 70-89 plant growth phase, by the use of 0-9 symptoms severity scale by Jędryczka [79], which was described in details in previous study by Starosta et al. [56].

4.3. DNA Extraction and Genotyping

Seeds of the 188 DH lines were sown on sterile Petri dishes to obtain young seedlings, from which whole genomic DNA was isolated using Genomic Mini AX Plant kit (A&A Biotechnology, Gdańsk, Poland). The concentration and purity of the DNA samples was tested and equal dilutions to 100 ng µL–1 were prepared. After placing in two 96-well plates, the samples were sent to Diversity Arrays Technology (University of Canberra, Australia) for DArTseq analysis. The latter procedure was a part of preceding study by Starosta et al. [56]. Briefly, it includes steps such as reducing the genome complexity, PCR amplification, and Illumina sequencing followed by filtering and identification of markers. Through next-generation sequencing, a total of 133,764 molecular markers (96,121 SilicoDArT and 37,643 SNP) were obtained.

4.4. Phenotypic and Genotypic Similarity

Phenotypic similarity ( s P ) of genotypes in terms of blackleg (Leptosphaeria spp.) resistance was calculated based on the proposed formula:
S P , i , j = 1 y ¯ i y ¯ j m a x y ¯ · ,
where S P , i , j denotes the phenotypic similarity between line i and line j, y ¯ i denotes the mean value of blackleg resistance of the i-th line, y ¯ j denotes the mean value of blackleg resistance of the j-th line, m a x y ¯ · denotes the highest mean value of blackleg resistance among the DH lines tested.
Genetic similarity among 188 rapeseed DH lines was estimated based on molecular marker observations by Nei measure [80,81]:
S G , i , j = 2 N i j N i + N j ,
where S G , i , j denotes the genetic similarity between lines i and line j, N i denotes the number of alleles present in i-th DH line, N j denotes the number of alleles present in j-th DH line, and N i j denotes the number of alleles present in both line i and line j.
The calculated similarity coefficients, phenotypic and genotypic, were used to group the DH lines using the unweighted pair group method with arithmetic mean (UPGMA) method. The results of the groupings (based on phenotypes and genotypes, independently) were presented as dendrograms.

4.5. Genetic Parameters

4.5.1. Estimation Based on the Phenotype

The total additive a P gene effect on the basis of phenotypic observations of blackleg (Leptosphaeria spp.) resistance can be estimated by the following formula [82]:
a P ^ = 1 2 L ¯ m a x L ¯ m i n ,
where L ¯ m a x and L ¯ m i n are the means for the extreme groups (maximal and minimal lines, respectively) [83]. Groups of extreme lines were identified by the quantile method [82] in which lines with mean values smaller (bigger) than 0.03 (0.97) quantile of the empirical distribution of means are assumed as minimal (maximal) lines.
The total additive by additive a a P epistasis interaction effect on the basis of phenotypic observations of blackleg resistance can be estimated by the following formula [84,85]:
a a P ^ = 1 2 L ¯ m a x + L ¯ m i n L ¯ ,
where L ¯ is the mean of all DH lines.
The total additive by additive by additive a a a P three-way interaction effect on the basis of phenotypic observations of blackleg (Leptosphaeria spp.) resistance can be estimated by the following formulas [50]:
a a a P ^ = 1 2 L ̿ m a x + L ̿ m i n L ¯ ,
where L ̿ m a x and L ̿ m i n are the means for 0.99 and 0.01 quantile, respectively, DH lines.
The test statistics to verify hypotheses about genetic parameters different than zero are given by:
F a P = M S a P M S e ,   F a a P = M S a a P M S e   and   F a a a P = M S a a a P M S e ,
where M S a P , M S a a P , M S a a a P , and M S e are mean squares for parameters a P , a a P , a a a P , and residual, respectively.

4.5.2. Estimation Based on the Genotypic Observations

The additive a G QTL effect, additive by additive a a G epistasis QTL-QTL interaction effect and additive by additive by additive a a a G three-way QTL-QTL-QTL interaction effect were estimated based on the methods proposed by Bocianowski and Krajewski [82], Bocianowski [84], and Cyplik and Bocianowski [50] respectively. In an earlier study [56], 15 molecular markers (nine SilicoDArT and six SNPs) associated with blackleg (Leptosphaeria spp.) resistance were selected based on association mapping. These markers, associated with QTLs determining the observed trait, were used to construct a multiple regression model including: main effects, double interaction effects of all QTL-QTL pairs, and interaction effects of all QTL-QTL-QTL triplets:
y l i j k s t u = μ + i a i · m i + j k a a j k · m j · m k + s t u a a a s t u · m s · m t · m u + e l i j k s t u ,
where y l i j k s t u is mean values of blackleg (Leptosphaeria spp.) resistance fot l-th DH line, m x denotes observation of x marker, e l i j k s t u denotes the random component. Markers chosen for model (8) were selected using a stepwise regression procedure [50]. In this case, a two-step algorithm was used, in which (i) selection of markers with main effects was carried out by backward stepwise search; and (ii) double and triple interactions were considered for markers selected in the first step. The final total additive effect of genes was calculated as the sum of the absolute values of the individual effects [82]. However, the total interaction effects of QTL-QTL and QTL-QTL-QTL genes were calculated as the sum of the individual double and triple interaction effects, respectively.
All analyses were conducted using the statistical package Genstat version 23.1 [86].

5. Conclusions

Doubled haploid lines are a key breeding material that significantly accelerates and enhances the selection process in plant breeding. Due to their complete homozygosity and genetic stability, DH lines are invaluable in the creation of new varieties, gene mapping, hybrid production, and genetic research. Despite certain technical challenges and limitations, DH lines have enormous potential in the further development of plant breeding, especially when combined with modern genetic technologies. Contemporary breeding increasingly employs a combination of different methods to optimize the selection process and achieve varieties with desirable traits in a shorter time. Genetic parameters play a crucial role in the selection process of breeding materials. Understanding and properly applying these parameters allows breeders to make more effective and informed selections, which in turn leads to the development of plant varieties with desirable traits. The results obtained indicate the necessity of considering various methods of estimating genetic parameters when making decisions related to the selection of materials in the breeding process. Double interaction (epistasis) and triple interaction of gene actions play a significant role in plant breeding, influencing the inheritance of traits, genetic variability, and the effectiveness of selection. Understanding and utilizing these interactions in breeding processes enables the development of plant varieties with desirable characteristics.

Author Contributions

Conceptualization, J.B.; methodology, J.B., E.S., J.S., M.J., M.G. and J.N.; software, J.B.; validation, J.B., E.S., J.S. and J.N.; formal analysis, J.B., E.S. and T.J.; investigation, J.B., E.S., J.S., M.J. and J.N.; resources, E.S., T.J., J.S., M.J., M.G. and J.N.; data curation, E.S., T.J. and J.B.; writing—original draft preparation, J.B. and J.N.; writing—review and editing, J.B., E.S., T.J., J.S., M.J., M.G. and J.N.; visualization, J.B.; supervision, J.B.; project administration, J.B.; funding acquisition, J.N. All authors have read and agreed to the published version of the manuscript.

Funding

Identification of molecular markers linked to genes conditioning resistance to blackleg (Leptosphaeria spp.), using advanced molecular techniques” (project number 27). The project is implemented with a grant from the Ministry of Agriculture and Rural Development, Poland.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Qaim, M. Role of New Plant Breeding Technologies for Food Security and Sustainable Agricultural Development. Appl. Econ. Perspect. Policy 2020, 42, 129–150. [Google Scholar] [CrossRef]
  2. Benakanahalli, N.K.; Sridhara, S.; Ramesh, N.; Olivoto, T.; Sreekantappa, G.; Tamam, N.; Abdelbacki, A.M.M.; Elansary, H.O.; Abdelmohsen, S.A.M. A Framework for Identification of Stable Genotypes Basedon MTSI and MGDII Indexes: An Example in Guar (Cymopsis tetragonoloba L.). Agronomy 2021, 11, 1221. [Google Scholar] [CrossRef]
  3. Xu, P.; Wang, X.; Dai, S.; Cui, X.; Cao, X.; Liu, Z.; Shen, J. The multilocular trait of rapeseed is ideal for high-yield breeding. Plant Breed. 2021, 140, 65–73. [Google Scholar] [CrossRef]
  4. Ahmar, S.; Gill, R.A.; Jung, K.-H.; Faheem, A.; Qasim, M.U.; Mubeen, M.; Zhou, W. Conventional and Molecular Techniques from Simple Breeding to Speed Breeding in Crop Plants: Recent Advances and Future Outlook. Int. J. Mol. Sci. 2020, 21, 2590. [Google Scholar] [CrossRef] [PubMed]
  5. Salgotra, R.K.; Stewart, C.N.Jr. Functional Markers for Precision Plant Breeding. Int. J. Mol. Sci. 2020, 21, 4792. [Google Scholar] [CrossRef] [PubMed]
  6. Fehr, W.R. Principles of Cultivar Development, vol. 1, Theory and Technique. Macmillan Publishing Co., 866 Third Avenue, New York, N.Y. 536 pp, 1987.
  7. Cooper, M.; Powell, O.; Voss-Fels, K.P.; Messina, C.D.; Gho, C.; Podlich, D.E.; Technow, F.; Chapman, S.C.; Beveridge, C.A.; Ortiz-Barrientos, D.; Hammer, G.L. Modelling selection response in plant-breeding programs using crop models as mechanistic gene-to-phenotype (CGM-G2P) multi-trait link functions. In silico Plants 2021, 3, diaa016. [Google Scholar] [CrossRef]
  8. Bernardo, R. Reinventing quantitative genetics for plant breeding: something old, something new, something borrowed, something BLUE. Heredity 2020, 125, 375–385. [Google Scholar] [CrossRef]
  9. González Guzmán, M.; Cellini, F.; Fotopoulos, V.; Balestrini, R.; Arbona, V. New approaches to improve crop tolerance to biotic and abiotic stresses. Physiol. Plant. 2022, 174, e13547. [Google Scholar] [CrossRef]
  10. Golebiowska-Paluch, G.; Dyda, M. The Genome Regions Associated with Abiotic and Biotic Stress Tolerance, as Well as Other Important Breeding Traits in Triticale. Plants 2023, 12, 619. [Google Scholar] [CrossRef]
  11. Collard, B.C.Y.; Mackill, D.J. Marker-assisted selection: an approach for precision plant breeding in the twenty-first century. Phil. Trans. R. Soc. B 2008, 363, 557–572. [Google Scholar] [CrossRef]
  12. Song, L.; Wang, R.; Yang, X.; Zhang, A.; Liu, D. Molecular Markers and Their Applications in Marker-Assisted Selection (MAS) in Bread Wheat (Triticum aestivum L.). Agriculture 2023, 13, 642. [Google Scholar] [CrossRef]
  13. Arrones, A.; Vilanova, S.; Plazas, M.; Mangino, G.; Pascual, L.; Díez, M.J.; Prohens, J.; Gramazio, P. The Dawn of the Age of Multi-Parent MAGIC Populations in Plant Breeding: Novel Powerful Next-Generation Resources for Genetic Analysis and Selection of Recombinant Elite Material. Biology 2020, 9, 229. [Google Scholar] [CrossRef] [PubMed]
  14. Muranty, H.; Denancé, C.; Feugey, L.; Crépin, J.L.; Barbier, Y.; Tartarini, S.; Ordidge, M.; Troggio, M.; Lateur, M.; Nybom, H.; Paprstein, F.; Laurens, F.; Durel, C.E. Using whole-genome SNP data to reconstruct a large multi-generation pedigree in apple germplasm. BMC Plant Biol. 2020, 20, 2. [Google Scholar] [CrossRef]
  15. Sinha, D.; Maurya, A.K.; Abdi, G.; Majeed, M.; Agarwal, R.; Mukherjee, R.; Ganguly, S.; Aziz, R.; Bhatia, M.; Majgaonkar, A.; et al. Integrated Genomic Selection for Accelerating Breeding Programs of Climate-Smart Cereals. Genes 2023, 14, 1484. [Google Scholar] [CrossRef]
  16. Scott, M.F.; Fradgley, N.; Bentley, A.R.; Brabbs, T.; Corke, F.; Gardner, K.A.; Horsnell, R.; Howell, P.; Ladejobi, O.; Mackay, I.J.; Mott, R.; CockraM, J. Limited haplotype diversity underlies polygenic trait architecture across 70 years of wheat breeding. Genome Biol. 2021, 22, 137. [Google Scholar] [CrossRef] [PubMed]
  17. Hussain, A.; Arshad, K.; Abdullah, J.; Aslam, A.; Azam, A.; Bilal, M.; Asad, M.; Hamza, A.; Abdullah, M. A Comprehensive Review on Breeding Technologies and Selection Methods of Self-pollinated and Cross-Pollinated Crops. Asian J. Biotechnol. Genet. Eng. 2021, 4, 35–47. [Google Scholar]
  18. Muthoni, J.; Shimelis, H. Mating designs commonly used in plant breeding: A review. Aust. J. Crop Sci. 2020, 14, 1855–1869. [Google Scholar] [CrossRef]
  19. Tiwari, A.; Tikoo, S.K.; Angadi, S.P.; Kadaru, S.B.; Ajanahalli, S.R.; Vasudeva Rao, M.J. Inbred Line Development and Hybrid Breeding. In: Market-Driven Plant Breeding for Practicing Breeders. Springer, Singapore, 2022. [CrossRef]
  20. Boopathi, N.M. Marker-Assisted Selection (MAS). In: Genetic Mapping and Marker Assisted Selection. Springer, Singapore, 2020. [CrossRef]
  21. Merrick, L.F.; Carter, A. Comparison of genomic selection models for exploring predictive ability of complex traits in breeding programs. Plant Genome 2021, 14, e20158. [Google Scholar] [CrossRef]
  22. Gemenet, D.C.; Lindqvist-Kreuze, H.; De Boeck, B.; da Silva Pereira, G.; Mollinari, M.; Zeng, Z.B.; Yencho, G.C.; Campos, H. Sequencing depth and genotype quality: accuracy and breeding operation considerations for genomic selection applications in autopolyploid crops. Theor. Appl. Genet. 2020, 133, 3345–3363. [Google Scholar] [CrossRef]
  23. Merrick, L.F.; Herr, A.W.; Sandhu, K.S.; Lozada, D.N.; Carter, A.H. Optimizing Plant Breeding Programs for Genomic Selection. Agronomy 2022, 12, 714. [Google Scholar] [CrossRef]
  24. Obšteter, J.; Jenko, J.; Gorjanc, G. Genomic Selection for Any Dairy Breeding Program via Optimized Investment in Phenotyping and Genotyping. Front. Genet. 2021, 12, 637017. [Google Scholar] [CrossRef] [PubMed]
  25. Wang, B.; Lin, Z.; Li, X.; Zhao, Y,; Zhao, B. ; Wu, G.; Ma, X.; Wang, H.; Xie, Y.; Li, Q.; Song, G.; Kong, D.; Zheng, Z.; Wei, H.; Shen, R.; Wu, H.; Chen, C.; Meng, Z.; Wang, T.; Li, Y.; Li, X.; Chen, Y.; Lai, J.; Hufford, M.B.; Ross-Ibarra, J.; He, H.; Wang, H. Genome-wide selection and genetic improvement during modern maize breeding. Nat. Genet. 2020, 52, 565–571. [Google Scholar] [CrossRef] [PubMed]
  26. Wang, G.; Sarkar, A.; Carbonetto, P.; Stephens, M. A Simple New Approach to Variable Selection in Regression, with Application to Genetic Fine Mapping. J. R. Stat. Soc. B 2020, 82, 1273–1300. [Google Scholar] [CrossRef] [PubMed]
  27. Swarup, S.; Cargill, E.J.; Crosby, K.; Flagel, L.; Kniskern, J.; Glenn, K.C. Genetic diversity is indispensable for plant breeding to improve crops. Crop Sci. 2021, 61, 839–852. [Google Scholar] [CrossRef]
  28. Gibson, A.K. Genetic diversity and disease: The past, present, and future of an old idea. Evolution 2022, 76(s1), 20–36. [Google Scholar] [CrossRef]
  29. Tuvesson, S.D.; Larsson, CT.; Ordon, F. Use of Molecular Markers for Doubled Haploid Technology: From Academia to Plant Breeding Companies. In: Segui-Simarro, J.M. (eds) Doubled Haploid Technology. Methods in Molecular Biology, 2021, 2288. Humana, New York, NY. [CrossRef]
  30. Hooghvorst, I.; Nogués, S. Chromosome doubling methods in doubled haploid and haploid inducer-mediated genome-editing systems in major crops. Plant Cell Rep. 2021, 40, 255–270. [Google Scholar] [CrossRef]
  31. Yali, W. Haploids and Doubled Haploid Technology Application in Modern Plant Breeding. J. Plant Sci. 2022, 10, 71–75. [Google Scholar] [CrossRef]
  32. Maqbool, M.A.; Beshir, A.; Khokhar, E.S. Doubled haploids in maize: Development, deployment, and challenges. Crop Sci. 2020, 60, 2815–2840. [Google Scholar] [CrossRef]
  33. Hu, H.; Meng, Y.; Liu, W.; Chen, S.; Runcie, D.E. Multi-Trait Genomic Prediction Improves Accuracy of Selection among Doubled Haploid Lines in Maize. Int. J. Mol. Sci. 2022, 23, 14558. [Google Scholar] [CrossRef]
  34. Hale, B.; Ferrie, A.M.R.; Chellamma, S.; Samuel, J.P.; Phillips, G.C. Androgenesis-Based Doubled Haploidy: Past, Present, and Future Perspectives. Front. Plant Sci. 2022, 12, 751230. [Google Scholar] [CrossRef]
  35. Hooghvorst, I.; Nogués, S. Chromosome doubling methods in doubled haploid and haploid inducer-mediated genome-editing systems in major crops. Plant Cell Rep. 2021, 40, 255–270. [Google Scholar] [CrossRef] [PubMed]
  36. Yang, J.; Liu, Z.; Chen, Q.; Tang, J.; Lübberstedt, T.; Li, H. Mapping of QTL for Grain Yield Components Based on a DH Population in Maize. Sci. Rep. 2020, 10, 7086. [Google Scholar] [CrossRef]
  37. Zhang, J.; She, M.; Yang, R.; Jiang, Y.; Qin, Y.; Zhai, S.; Balotf, S.; Zhao, Y.; Anwar, M.; Alhabbar, Z.; et al. Yield-Related QTL Clusters and the Potential Candidate Genes in Two Wheat DH Populations. Int. J. Mol. Sci. 2021, 22, 11934. [Google Scholar] [CrossRef]
  38. Cazzola, F.; Bermejo, C.J.; Gatti, I.; Cointry, E. Speed breeding in pulses: an opportunity to improve the efficiency of breeding programs. Crop Pasture Sci. 2021, 72, 165–172. [Google Scholar] [CrossRef]
  39. Bocianowski, J.; Kozak, M.; Liersch, A.; Bartkowiak-Broda, I. A heuristic method of searching for interesting markers in terms of quantitative traits. Euphytica 2011, 181, 89–100. [Google Scholar] [CrossRef]
  40. Robert, P.; Auzanneau, J.; Goudemand, E.; Oury, F.X.; Rolland, B.; Heumez, E.; Bouchet, S.; Le Gouis, J.; Rincent, R. Phenomic selection in wheat breeding: identification and optimisation of factors influencing prediction accuracy and comparison to genomic selection. Theor. Appl. Genet. 2022, 135, 895–914. [Google Scholar] [CrossRef] [PubMed]
  41. Pélabon, C.; Hilde, C.H.; Einum, S.; Gamelon, M. On the use of the coefficient of variation to quantify and compare trait variation. Evol. Lett. 2020, 4, 180–188. [Google Scholar] [CrossRef] [PubMed]
  42. Labroo, M.R.; Studer, A.J.; Rutkoski, J.E. Heterosis and Hybrid Crop Breeding: A Multidisciplinary Review. Front. Genet. 2021, 12, 643761. [Google Scholar] [CrossRef]
  43. Lanzl, T.; Melchinger, A.E.; Schön, C.C. Influence of the mating design on the additive genetic variance in plant breeding populations. Theor. Appl. Genet. 2023, 136, 236. [Google Scholar] [CrossRef]
  44. Aakanksha; Yadava, S. K.; Yadav, B.G.; Gupta, V.; Mukhopadhyay, A.; Pental, D.; Pradhan, A.K. Genetic Analysis of Heterosis for Yield Influencing Traits in Brassica juncea Using a Doubled Haploid Population and Its Backcross Progenies. Front. Plant Sci. 2021, 12, 721631. [Google Scholar] [CrossRef]
  45. Mackay, T. Epistasis and quantitative traits: using model organisms to study gene–gene interactions. Nat. Rev. Genet. 2014, 15, 22–33. [Google Scholar] [CrossRef]
  46. Gjuvsland, A.B.; Hayes, B.J.; Omholt, S.W.; Carlborg, Ö. Statistical Epistasis Is a Generic Feature of Gene Regulatory Networks. Genetics 2007, 175, 411–420. [Google Scholar] [CrossRef] [PubMed]
  47. Jones, A.; Bürger, R.; Arnold, S. Epistasis and natural selection shape the mutational architecture of complex traits. Nat. Commun. 2014, 5, 3709. [Google Scholar] [CrossRef]
  48. Bocianowski, J. Epistasis interaction of QTL effects as a genetic parameter influencing estimation of the genetic additive effect. Genet. Mol. Biol. 2013, 36, 93–100. [Google Scholar] [CrossRef] [PubMed]
  49. Bocianowski, J.; Nowosad, K. Mixed linear model approaches in mapping QTLs with epistatic effects by a simulation study. Euphytica 2015, 202, 459–467. [Google Scholar] [CrossRef]
  50. Cyplik, A.; Bocianowski, J. Analytical and numerical comparisons of two methods of estimation of additive × additive × additive interaction of QTL effects. J. Appl. Genet. 2022, 63, 213–221. [Google Scholar] [CrossRef]
  51. Cyplik, A.; Sobiech, A.; Tomkowiak, A.; Bocianowski, J. Genetic Parameters for Selected Traits of Inbred Lines of Maize (Zea mays L.). Appl. Sci. 2022, 12, 6961. [Google Scholar] [CrossRef]
  52. Cyplik, A.; Bocianowski, J. A Comparison of Methods to Estimate Additive–by–Additive–by–Additive of QTL×QTL×QTL Interaction Effects by Monte Carlo Simulation Studies. Int. J. Mol. Sci. 2023, 24, 10043. [Google Scholar] [CrossRef] [PubMed]
  53. Cyplik, A.; Czyczyło-Mysza, I.M.; Jankowicz-Cieslak, J.; Bocianowski, J. QTL×QTL×QTL Interaction Effects for Total Phenolic Content of Wheat Mapping Population of CSDH Lines under Drought Stress by Weighted Multiple Linear Regression. Agriculture 2023, 13, 850. [Google Scholar] [CrossRef]
  54. Cyplik, A.; Piaskowska, D.; Czembor, P.; Bocianowski, J. The use of weighted multiple linear regression to estimate QTL × QTL × QTL interaction effects of winter wheat (Triticum aestivum L.) doubled-haploid lines. J. Appl. Genet. 2023, 64, 679–693. [Google Scholar] [CrossRef]
  55. Hill, W.G.; Goddard, M.E.; Visscher, P.M. Data and Theory Point to Mainly Additive Genetic Variance for Complex Traits. PLoS Genet. 2008, 4, e1000008. [Google Scholar] [CrossRef]
  56. Starosta, E.; Jamruszka, T.; Szwarc, J.; Bocianowski, J.; Jędryczka, M.; Grynia, M.; Niemann, J. DArTseq-Based, High-Throughput Identification of Novel Molecular Markers for the Detection of Blackleg (Leptosphaeria spp.) Resistance in Rapeseed. Int. J. Mol. Sci. 2024, 25, 8415. [Google Scholar] [CrossRef]
  57. Tian, Z.; Wang, J.-W.; Li, J.; Han, B. Designing future crops: challenges and strategies for sustainable agriculture. Plant J. 2021, 105, 1165–1178. [Google Scholar] [CrossRef]
  58. Habib-ur-Rahman, M.; Ahmad, A.; Raza, A.; Hasnain, M.U.; Alharby, H.F.; Alzahrani, Y.M.; Bamagoos, A.A.; Hakeem, K.R.; Ahmad, S.; Nasim, W.; Ali, S.; Mansour, F.; EL Sabagh, A. Impact of climate change on agricultural production; Issues, challenges, and opportunities in Asia. Front. Plant Sci. 2022, 13, 925548. [Google Scholar] [CrossRef]
  59. Kozak, M.; Bocianowski, J.; Liersch, A.; Tartanus, M.; Bartkowiak-Broda, I.; Piotto, F.A.; Azevedo, R.A. Genetic divergence is not the same as phenotypic divergence. Mol. Breed. 2011, 28, 277–280. [Google Scholar] [CrossRef]
  60. Seyis, F.; Snowdon, R.J.; Luhs, W.; Friedt, W. Molecular characterization of novel resynthesized rapeseed (Brassica napus) lines and analysis of their genetic diversity in comparison with spring rapeseed cultivars. Plant Breed. 2003, 122, 473–478. [Google Scholar] [CrossRef]
  61. Hannan, A.; Islam, M.M.; Rahman, M.S.; Hoque, M.N.; Sagor, G.H.M. Morpho-genetic Evaluation of Rice Genotypes (Oryza sativa L.) Including Some Varieties and Advanced Lines Based on Yield and Its Attributes. Journal of the Bangladesh Agricultural University 2024, 18, 923–933. [Google Scholar] [CrossRef]
  62. Chen, W.; Zhang, Y.; Liu, X.; Chen, B.; Tu, J.; Tingdong, F. Detection of QTL for six yield-related traits in oilseed rape (Brassica napus) using DH and immortalized F2 populations. Theor. Appl. Genet. 2007, 115, 849–858. [Google Scholar] [CrossRef]
  63. Carlborg, Ö.; Haley, C.S. Epistasis: too often neglected in complex trait studies? Nat. Rev. Genet. 2004, 5, 618–625. [Google Scholar] [CrossRef]
  64. Miko, I. Epistasis: gene interaction and phenotype effects. Nature Education 2008, 1, 197. [Google Scholar]
  65. Phillips, P.C. Epistasis—the essential role of gene interactions in the structure and evolution of genetic systems. Nat. Rev. Genet. 2008, 9, 855–867. [Google Scholar] [CrossRef]
  66. Germain, D.P.; Jurca-Simina, I.E. Principles of Human Genetics and Mendelian Inheritance. In: Burlina, A. (eds) Neurometabolic Hereditary Diseases of Adults. Springer, Cham, 2018. [CrossRef]
  67. Schrodi, S.J.; Mukherjee, S.; Shan, Y.; Tromp, G.; Sninsky, J.J.; Callear, A.P.; Carter, T.C.; Ye, Z.; Haines, J.L.; Brilliant, M.H.; Crane, P.K.; Smelser, D.T.; Elston, R.C.; Weeks, D.E. Genetic-based prediction of disease traits: prediction is very difficult, especially about the future. Front. Genet. 2014, 5, 162. [Google Scholar] [CrossRef]
  68. Sun, X.; Ma, P.; Mumm, R.H. Nonparametric Method for Genomics-Based Prediction of Performance of Quantitative Traits Involving Epistasis in Plant Breeding. PLoS ONE 2012, 7, e50604. [Google Scholar] [CrossRef]
  69. Li, M.; Lou, X.Y.; Lu, Q. On Epistasis: A Methodological Review for Detecting Gene-Gene Interactions Underlying Various Types of Phenotypic Traits. Recent Pat. Biotechnol. 2012, 6, 230–236. [Google Scholar] [CrossRef]
  70. Raffo, M.A.; Sarup, P.; Guo, X.; Liu, H.; Andersen, J.R.; Orabi, J.; Jahoor, A.; Jensen, J. Improvement of genomic prediction in advanced wheat breeding lines by including additive-by-additive epistasis. Theor. Appl. Genet. 2022, 135, 965–978. [Google Scholar] [CrossRef]
  71. Das, A.K.; Choudhary, M.; Kumar, P.; Karjagi, C.G.; KR, Y.; Kumar, R.; Singh, A.; Kumar, S.; Rakshit, S. Heterosis in Genomic Era: Advances in the Molecular Understanding and Techniques for Rapid Exploitation. Crit. Rev. Plant Sci. 2021, 40, 218–242. [Google Scholar] [CrossRef]
  72. Jeon, D.; Kang, Y.; Lee, S.; Choi, S.; Sung, Y.; Lee, T.-H.; Kim, C. Digitalizing breeding in plants: A new trend of next-generation breeding based on genomic prediction. Front. Plant Sci. 2023, 14, 1092584. [Google Scholar] [CrossRef]
  73. Pang, E.C.K.; Halloran, G.M. The genetics of blackleg [Leptosphaeria maculans (Desm.) Ces, et De Not.] resistance in rapeseed (Brassica napus L.). Theor. Appl. Genet. 1996, 93, 932–940. [Google Scholar] [CrossRef]
  74. Kumar, V.; Paillard, S.; Fopa-Fomeju, B.; Falentin, C.; Deniot, G.; Baron, C.; Vallée, P.; Manzanares-Dauleux, M.J.; Delourme, R. Multi-year linkage and association mapping confirm the high number of genomic regions involved in oilseed rape quantitative resistance to blackleg. Theor. Appl. Genet. 2018, 131, 1627–1643. [Google Scholar] [CrossRef]
  75. Pilet, M.; Delourme, R.; Foisset, N.; Renard, M. Identification of loci contributing to quantitative field resistance to blackleg disease, causal agent Leptosphaeria maculans (Desm.) Ces. et de Not., in Winter rapeseed (Brassica napus L.). Theor. Appl. Genet. 1998, 96, 23–30. [Google Scholar] [CrossRef]
  76. Zhao, J.; Meng, J. Genetic analysis of loci associated with partial resistance to Sclerotinia sclerotiorum in rapeseed (Brassica napus L.). Theor. Appl. Genet. 2003, 106, 759–764. [Google Scholar] [CrossRef]
  77. Larkan, N.J.; Raman, H.; Lydiate, D.J.; Robinson, S.J.; Yu, F.; Barbulescu, D.M.; Raman, R.; Luckett, D.J.; Burton, W.; Wratten, N.; Salisbury, P.A.; Rimmer, S.R.; Borhan, M.H. Multi-environment QTL studies suggest a role for cysteine-rich protein kinase genes in quantitative resistance to blackleg disease in Brassica napus. BMC Plant Biol. 2016, 16, 183. [Google Scholar] [CrossRef] [PubMed]
  78. Cobb, J.N.; DeClerck, G.; Greenberg, A.; Clark, R.; McCouch, S. Next-generation phenotyping: requirements and strategies for enhancing our understanding of genotype–phenotype relationships and its relevance to crop improvement. Theor. Appl. Genet. 2013, 126, 867–887. [Google Scholar] [CrossRef] [PubMed]
  79. Jędryczka, M. Epidemiology and Damage Caused by Stem Canker of Oilseed Rape in Poland. Ph.D. Thesis, Dissertations and Monographs, Abstract of Habilitation Thesis Institute of Plant Genetics, Polish Academy of Sciences, Poznań, Poland, 2006; pp. 42, 150. (In Polish, with English abstract).
  80. Nei, M. Genetic distance between populations. Am. Nat. 1972, 106, 283–292. [Google Scholar] [CrossRef]
  81. Bocianowski, J.; Niemann, J.; Jagieniak, A.; Szwarc, J. Comparison of Six Measures of Genetic Similarity of Interspecific Brassicaceae Hybrids F2 Generation and Their Parental Forms Estimated on the Basis of ISSR Markers. Genes 2024, 15, 1114. [Google Scholar] [CrossRef]
  82. Bocianowski, J.; Krajewski, P. Comparison of the genetic additive effect estimators based on phenotypic observations and on molecular marker data. Euphytica 2009, 165, 113–122. [Google Scholar] [CrossRef]
  83. Choo, T.M.; Reinbergs, E. Analyses of Skewness and Kurtosis for Detecting Gene Interaction in a Doubled Haploid Population. Crop Sci. 1982, 22, 231–235. [Google Scholar] [CrossRef]
  84. Bocianowski, J. A comparison of two methods to estimate additive-by-additive interaction of QTL effects by a simulation study. J. Theor. Biol. 2012, 308, 20–24. [Google Scholar] [CrossRef]
  85. Bocianowski, J. Analytical and numerical comparisons of two methods of estimation of additive  additive interaction of QTL effects. Sci. Agric. 2012, 69, 240–246. [Google Scholar] [CrossRef]
  86. VSN International Genstat for Windows 23nd Edition. VSN International, Hemel Hempstead, UK, 2023.
Figure 1. Dendrogram showing phenotypic similarity of blackleg (Leptosphaeria spp.) resistance of 188 doubled haploid (DH) lines, constructed from the UPGMA method based a measure (2).
Figure 1. Dendrogram showing phenotypic similarity of blackleg (Leptosphaeria spp.) resistance of 188 doubled haploid (DH) lines, constructed from the UPGMA method based a measure (2).
Preprints 116760 g001
Figure 2. Dendrogram showing the genetic similarity between 188 DH lines constructed based on the observation of 133764 molecular markers. DH lines marked with dots of each color indicate groups formed on a dendrogram constructed from phenotypic observations of blackleg (Leptosphaeria spp.) resistance (Figure 1).
Figure 2. Dendrogram showing the genetic similarity between 188 DH lines constructed based on the observation of 133764 molecular markers. DH lines marked with dots of each color indicate groups formed on a dendrogram constructed from phenotypic observations of blackleg (Leptosphaeria spp.) resistance (Figure 1).
Preprints 116760 g002
Table 1. The additive, epistasis (additive by additive interaction) and triple interaction (additive by additive by additive) effects for blackleg (Leptosphaeria spp.) resistance of 188 DH lines of rapeseed estimated on the basis phenotypic and genotypic methods.
Table 1. The additive, epistasis (additive by additive interaction) and triple interaction (additive by additive by additive) effects for blackleg (Leptosphaeria spp.) resistance of 188 DH lines of rapeseed estimated on the basis phenotypic and genotypic methods.
Genetic parameter Phenotypic method Genotypic method
additive, a 2.450 *** 1.794 ***
additive-additive, aa 0.435 * -0.532 **
additive-additive-additive, aaa 0.952 ** -0.478 *
* p<0.05; ** p<0.01; *** p<0.001.
Table 2. SilicoDArT and SNP molecular markers significantly associated with resistance of B. napus to blackleg [56] selected for a multiple model.
Table 2. SilicoDArT and SNP molecular markers significantly associated with resistance of B. napus to blackleg [56] selected for a multiple model.
Marker Number Marker Type Chromosome Marker Position on Chromosome (bp) Marker Sequence
7853 SilicoDArT A06 5,968,268–5,968,337 TGCAGAAAATGGAATGTTCTTGAGAGATCCTAGTGGAGAATGGGTGACAAATATGCCTCAAGACATGAA
11720 SNP (18:A>T) C06 34,959,583–34,959,652 TGCAGAAGCAGCCATGAGACAGTATTGCTGTTGAGATATATTGTTGCTGTACCTTGGGGAGGAAGCAAC
12134 SNP (29:G>A) C06 random 2,170,846–2,170,777 TGCAGCTTCTACTTTTAGTTGGACAGAGCGCTCAAAGTCAACAATTACAGATCGGAAGAGCGGTTCAGC
12232 SNP (46:T>A) C03 1,024,177–1,024,246 TGCAGAAAAAGATTCAGGTTCCCGGGACCTGAAGATCACTGGATTGTCTGATGCTGTGTTAGGATGCAT
12456 SNP (45:A>C) A08 13,650,920–13,650,989 TGCAGTTTCTACACGTACATATCCAATATTTTAGTTTACTTAGGAAGAAATTTGAAATTTGATTTTATT
*SNP positions within the markers are underlined.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.
Prerpints.org logo

Preprints.org is a free preprint server supported by MDPI in Basel, Switzerland.

Subscribe

Disclaimer

Terms of Use

Privacy Policy

Privacy Settings

© 2026 MDPI (Basel, Switzerland) unless otherwise stated