Due to species barriers and poor adaptability to new host environments, few pathogens cause global pandemics. But, SARS-CoV-2 is one exception with its high transmissivity and delayed onset of symptoms. Fortunately, the world was able to tap on the technologies especially the maturing RT-qPCR designed to combat SARS to launch an initial offensive on SARS-CoV-2. These initial efforts may have bought time for scientists to develop more refined diagnostic tests that specifically target SARS-CoV-2. This article describes the effort put forth by the biotech industry and academia in Singapore to develop diagnostic tests that aid the early detection of positive cases, and thereby help contain the virus. Direct tests such as RT-qPCR and antigen rapid test profile the virus nucleic acid and surface proteins, respectively. But, of equal importance in case detection and treatment is serological tests that measure the relative abundance of IgM and IgG which is indicative of infection phase and quality of immune response in positive cases. Other tests such as isothermal amplification, CRISPR-based diagnostics and breath tests are also in development or at initial field deployment, and would undoubtedly provide valuable use experience useful for the development of molecular assays to detect and combat the next pathogen of global concern.

A land cover map of two arctic catchments, nearby the Abisko Scientific Research Station, was obtained from a classification of a Sentinel-2 satellite image and a ground survey performed in July 2022. The two contiguous catchments, Miellajokka and Stordalen, are covered by various ecotypes, from boreal forest to alpine tundra and peatland. The Random Forest algorithm correctly identified 83% of polygon pixels reserved for testing. The developed workflow relied solely on open source software and acquired ground observations. Space organization was directed by the altitude as shown by the intersection of the land cover with the topography. Comparison between this new land cover map and previous ones based on data acquired between 2008 and 2011 demonstrates some trends of vegetation cover evolution in response to climate change in the considered area. The potential applications in terms of permafrost modeling (hiperborea.omp.eu) are finally discussed.

Multidisciplinary research efforts on potential COVID-19 vaccine and therapeutic candidates have increased since the pandemic outbreak of SARS-CoV-2 in 2019. This search has become imperative due to the increasing emergences and limited widely available medicines. The presence of bioactive anti-SARS-CoV-2 molecules was examined from various plant sources. Among them is a group of proteins called lectins that can bind carbohydrate moieties. In this article, we present ten novel, chitin-specific Hevein-like lectins that were derived from Selaginella moellendorffii v1.0's genome. The capacity of these lectin homologs to bind with the spike protein of SARS-CoV-2 was examined. Using the HDOCK server, 3D-modeled Hevein-domains were docked to the spike protein's receptor binding domain (RBD). The Smo446851, Smo125663, and Smo99732 interacted with Asn343-located complex N-glycan and RBD residues, respectively, with binding free energies of -17.5, -13.0, and -26.5 Kcal/mol. The normal-state analyses via torsional coordinate association for the Smo99732-RBD complex using iMODS is characterized by overall higher stability and minimum deformity than the other lectin complexes. The three lectins interacting with carbohydrates were docked against five individual mutations that frequently occur in major SARS-CoV-2 variants. These were in the spike protein’s receptor-binding motif (RBM), while Smo125663 and Smo99732 only interacted with the spike glycoprotein in a protein-protein manner. The precursors for the Hevein-like homologs underwent additional characterization and their expressional profile in different tissues was studied. These in-silico findings offered potential lectin candidates targeting key N-glycan sites crucial to the virus's virulence and infection.

The aim of this study was to estimate the association between fear of COVID-19 and risk perception with preventive behavior in health professionals from three Latin American countries. An analytical cross-sectional study was conducted. Health professionals with on-site care in Colombia, Ecuador, Guatemala, and Peru were surveyed. Information was collected through an online self-report questionnaire. The main variables were preventive behavior as the dependent variable and fear of COVID-19 and risk perception as independent variables. Linear regression was used, and Beta coefficients and p-values were calculated. 435 health professionals were included, the majority were aged 42 years or older (45.29%, 95%CI: 40.65%-50.01%) and female (67.82%, 95%CI: 63.27%-72.05%). It was shown that the greater the fear of COVID-19, the greater the preventive behavior of COVID-19 infection (B=2.21, p=0.002 for total behavior; B=1.12, p=0.037 for additional protection at work; B=1.11, p<0.010 for hand washing). The risk perception of COVID-19 infection had a slight direct relationship with preventive behaviors (B=0.28, p=0.021 for total behavior; B=0.13, p=0.015 for hand washing), with the exception of the preventive behavior of using additional protection at work (p=0.339). We found that fear and risk perception are associated with increased practice of hand washing and use of additional protection at work. Further studies are required on the influence of working conditions, job performance and the occurrence of mental health problems in frontline personnel with regard to COVID-19.

The disease COVID-19 is brought on by the acute respiratory syndrome coronavirus 2 (SARS-CoV-2) First appeared in China in December 2019 and quickly spread around the world after being declared a worldwide pandemic by the World Health Organization in March 2020. COVID-19, Medical Laboratory Professionals, SARS-COV-2, Diagnostic, Importance and difficulties for testing were the selected terms to search the databases of PubMed and Google Scholar for previously published material. Many diagnostic tests are applied in corona virus detection like Droplet Digital PCR (ddPCR), Multiplex PCR, Loop-mediated Isothermal Amplification (LAMP) and more. There is a lack of availability of molecular and serologic tests that have been clinically validated or authorized by national or international regulatory bodies. Clinical laboratory experts are tackling threats to our global defense and wellness, including infectious diseases. The opportunity to express gratitude to the unsung medical laboratory heroes and COVID0-19 pandemic allies is now greater than ever. Each year, Medical Laboratory Professionals Week should honors those who contribute key diagnostic data that help save lives. This review article explore overall summary on testing methods including Important and Difficult Tasks for Medical Laboratories which will provide good message for better public health matter.

Aim: Exposure to polycyclic aromatic hydrocarbons (PAHs) has been in the past associated with adverse effects on human health among which belong also respiratory diseases. Our study is focused on the evaluation of PAH exposure by measuring the concentrations of their monohydroxylated metabolites (OH-PAHs) in urine and comparing their concentrations with the incidence of respiratory diseases in 2-year-old children from two locations of the Czech Republic – a control locality Ceske Budejovice and a previously highly contaminated mining district Most. Methods: The total number of 248 participants were sampled for urine samples that were analysed for the presence of 11 OH-PAHs using liquid-liquid extraction with ethyl acetate and clean-up employing dispersive solid phase extraction with a sorbent Z-Sep. Separation, identification and quantification of the target compounds was achieved by ultra-high performance liquid chromatography coupled to tandem mass spectrometry. The incidence of respiratory diseases was evaluated according to the questionnaires provided by the paediatricians. Results and discussion: The concentrations of measured OH-PAHs were higher in the urine samples collected from 2-year-old children living in Most compared to 2-year-old children from Ceske Budejovice. The same trend was observed also when the urine samples were analysed when these children were studied as newborns in our previous study. From all of the monitored respiratory diseases, only influenza due to unidentified influenza virus showed a difference between tested locations where the 2-year-old children living in Most were more frequently diagnosed with this disease. Conclusion: Even though the air pollution and lifestyle in both cities is very similar, we have observed higher incidence of respiratory diseases as well as higher concentration of OH-PAHs in urine of the 2-year-old children from Most. Therefore, we hypothesize that the population living in this previously highly contaminated location (in 1970s and 1980s) can carry some long-term health burden.

Currently SARS-CoV-2 is spreading around the world as an Omicron strain. Recently, the Omicron variants (BQ.1 and BQ.1.1) were identified as novel Variants of Concern. UpToDate, there is little information about the Omicron Variants BQ.1 and BQ.1.1. The widely altered Omicron variants are spread globally, providing a high risk of infection surges with devastating consequences in some areas. The Omicron type of SARS-CoV-2 has a harm risk of reinfection, according to early reported findings. COVID-19 Variants particularly, BQ.1 and BQ.1.1 have gained global attention and caused a worldwide sensation since their discovery. Therefore, this communication discusses the present status of COVID-19 Variants BQ.1 and BQ.1.1, and their consequences.

The detection of waste plastics in the marine and terrestrial environment using satellite Earth Observation data offers the possibility of large-scale mapping, and reducing on-the-ground manual investigation. In addition, costs are kept to a minimum by utilizing free-to-access Copernicus data. A Machine Learning based classifier was developed to run on Sentinel-1 and -2 data. In support of the training and validation, a dataset was created with terrestrial and aquatic cases by manually digitizing varying landcover classes alongside plastics under the sub-categories of greenhouses, plastic, tyres and waste sites. The trained classifier, including an Artificial Neural Network and post-processing decision tree, was verified using five locations encompassing these different forms of plastic. Although exact matchups are challenging to digitize, the performance has generated high accuracy statistics, and the resulting land cover classifications have been used to map the occurrence of plastic waste in aquatic and terrestrial environments.

Minigastrin (MG) analogs for therapy of CCK2R-expressing malignancies are limited by low stability in vivo or excessive accumulation in non-target organs. By modifying the C-terminal receptor-binding sequence, metabolization could be prevented and tumor targeting significantly improved. In this work, N-terminal changes of the peptide length were evaluated. Based on the amino acid sequence of DOTA-MGS5 (DOTA-DGlu-Ala-Tyr-Gly-Trp-(N-Me)Nle-Asp-1Nal-NH₂), two new MG analogs were synthesized, by either introduction of a penta-DGlu moiety or depletion of the four N-terminal amino acids and introduction of a non-charged hydrophilic linker. Two CCK2R-expressing cell lines were used to demonstrate receptor interaction. Stability of the ¹⁷⁷Lu-labeled peptide analogs was evaluated in human serum up to 24 h after incubation and in BALB/c mice up to 30 min after injection. The biodistribution profile and tumor targeting potential was evaluated in xenografted BALB/c nude mice. For both new MG analogs, the combination of strong receptor-specific cell interaction, high stability and enhanced tumor targeting could be demonstrated. Shortening of the peptide sequence lowered the absorption in the dose-limiting organs, whereas elongation increased uptake in renal tissue.

COVID-19, the infectious disease caused by SARS-CoV-2, has spread on a pandemic scale. The virus infection can evolve asymptomatically or generate severe symptoms, influenced by the presence of comorbidities. Lymphopenia in patients affected with COVID-19 according to the severity of symptoms is frequent. However, the profile of CD4+ and CD8+ T-cells regarding cytotoxicity and antiviral factor expression has not yet been completely elucidated in acute SARS-CoV-2 infections. The purpose of this study is to evaluate the phenotypic and functional profile of T-lymphocytes in patients with moderate and severe/critical COVID-19. During this pandemic period, we analyzed a cohort of 62 confirmed patients with SARS-CoV-2 (22 moderate cases and 40 severe/critical cases). Albeit lymphopenia, we observed an increase in the expression of CD28, co-stimulator molecule, and activation markers (CD38 and HLA-DR) in T-lymphocytes as well as an increase in the frequency of CD4+ T-cells, CD8+ T-cells, and NK cells that express the immunological checkpoint protein, PD-1, in patients with severe/critical condition compared to healthy controls. Regarding the cytotoxic profile of peripheral blood mononuclear cells, an increase in the response of CD4+ T-cells already at baseline level was observed, scarcely changed upon PMA and Ionomycin stimulation. Meanwhile, CD8+ T-lymphocytes decreased cytotoxic response, evidencing a profile of exhaustion in patients with severe COVID-19. As observed in the t-SNE technique CD4+ T-cytotoxic and CD8+ T with low granzyme production evidencing their dysfunctionality in severe/critical conditions. In addition, purified CD8+ T-lymphocytes from patients with severe COVID-19 showed an increased constitutive expression of differentially expressed genes associated with the caspase pathway, inflammasome, and antiviral factors, and curiously, reduced expression of TNF-α. The cytotoxic profile, by CD4+ T-cells, may compensate for the dysfunction/exhaustion of TCD8+ in acute SARS-CoV-2 infection. These findings may provide an understanding of the interplay of cytotoxicity between CD4+ T-cells and CD8+ T-cells in the severity of acute COVID-19 infection.

Primary systemic treatment (PST) downsizes the tumor and improves pathological response. The aim of this study is to analyze the feasibility and tolerance of primary concurrent radio-chemotherapy (PCRT) in breast cancer patients. Patients with localized TN/HER2+ tumors were enrolled in this prospective study. Radiation is delivered concomitantly during the first 3 weeks of chemotherapy, and it is based on a 15 fractions scheme (40.5Gy/2.7Gy per fraction to whole breast and nodal levels I-IV. Chemotherapy is based on Pertuzumab-Trastuzumab-Paclitaxel followed by anthracyclines in HER2+ and CBDCA-Paclitaxel followed by anthracyclines in TN breast cancers patients. 58 patients were enrolled, 25 patients (43%) were TN and 33 patients HER2+ (57%). With a median follow-up of 24.2 months, 56 patients completed PCRT and surgery. A total of 35 patients (87.5%) achieved &gt;90% loss of invasive carcinoma cell in the surgical specimen. The 70.8% and the 53.1% of patients with TN and HER-2+ subtype respectively achieved complete pathological response (pCR). This is the first study of concurrent neoadjuvant treatment in breast cancer in which three strategies are applied simultaneously: fractionation of RT in 15 sessions, adjustment of CT to tumor phenotype and local planning by PET. The pCR rates are encouraging.

G‐quadruplexes (G4) are structures formed at the ends of the telomere, these are rich in guanines and were stabilized by molecules that bind to specific sites. TMPyP4 and Thymoquinone (TQ) are small molecules that bind to the G4, they have drawn attention because of their role as telomerase inhibitors. The aim of this study was to evaluate the effects of telomerase inhibitors on cellular proliferation, senescence, and death. Two cell lines LC‐HK2 (NSCLC) and RPE‐1 were treated with TMPyP4 (5μM) and TQ (10μM). Both inhibitors were effective in decreasing telomerase activity. TMPyP4 increased the percentage of cells with membrane damage associated with cell death and decreased the frequency of cells in the S‐phase. TMPyP4 changed the cell adhesion ability and modified the pattern of focal adhesion. TQ acted in a dose‐dependent manner, increasing the frequency of senescent cells, and inducing cell cycle arrest in the G1. In conclusion, the effects of both drugs on LC-HK2 and RPE-1 cell lines were different although both are telomerase inhibitors, because TMPyP4 decreased proteins of cell adhesion and TQ induces a decrease in cell viability.

Background: Some viruses cause outbreaks which require immediate attention. Neutralizing antibodies could be developed for viral outbreak management. However, development of monoclonal antibodies is often long, laborious, and unprofitable. Here we report a Norwegian platform for development of chicken polyclonal neutralizing antibodies with powerful therapeutic potential. Methods: Layers were immunized twice with 14-day interval using purified RBD of SARS-CoV-2. Eggs were harvested 14 days after the second immunization. Polyclonal IgY antibodies were extracted. Binding of anti-RBD IgY to RBD was measured by indirect ELISA. Neutralization capacity of anti-RBD IgYs was measured in Vero-E6 cells infected with SARS-CoV-2-mCherry strain using fluorescence and cell viability assay. In addition, the effect of IgYs on the expression of SARS-CoV-2 and host cytokine genes in lungs of Syrian Golden hamsters was examined using qRT-PCR. Results: Anti-RBD IgYs efficiently bind RBD of S protein of SARS-CoV-2 in situ, neutralize the virus in vitro, and lower viral RNA amplification without significant alteration of virus-mediated immune gene expression in vivo. Conclusions: Altogether, our results indicated that chicken polyclonal IgYs can be attractive targets for pre-clinical and clinical development for rapid management of outbreaks of emerging and re-emerging viruses.

The worldwide outbreak of SARS-CoV-2 in early 2020 caused numer- ous deaths and unprecedented measures to control its spread. We employed our Computational Analysis of Novel Drug Opportunities (CANDO) multiscale therapeutic discovery, repurposing, and design platform to identify small molecule inhibitors of the virus to treat its resulting indication, COVID-19. Initially, few experimental studies existed on SARS-CoV-2, so we optimized our drug candidate prediction pipelines using results from two independent high-throughput screens against prevalent human coronaviruses. Ranked lists of candidate drugs were generated using our open source cando.py software based on viral protein inhibition and proteomic interaction similarity. For the former viral protein inhibition pipeline, we computed interaction scores between all compounds in the corresponding candidate library and eighteen SARS-CoV proteins using an interaction scoring protocol with extensive parameter optimization which was then applied to the SARS-CoV-2 proteome for prediction. For the latter similarity based pipeline, we computed interaction scores between all compounds and human protein structures in our libraries then used a consensus scoring approach to identify candidates with highly similar proteomic interaction signatures to multiple known anti-coronavirus actives. We published our ranked candidate lists at the very beginning of the COVID-19 pandemic. Since then, 51 of our 276 predictions have demonstrated anti-SARS-CoV-2 activity in published clinical and experimental studies. These results illustrate the ability our platform to rapidly respond to emergent pathogens and provide greater evidence that treating compounds in a multitarget context more accurately describes their behavior in biological systems.

Objective: To evaluate the effect of rectal Ozone (O3) in severe COVID-19 pneumonia in two different cohorts differing in location (Madrid vs Zilina), ethnicity (Slovakian vs Spanish cohorts) and age. Material and Methods: In a multicenter-study, 32 severe bilateral-COVID-19-pneumonia patients and (+) RT-PCR (reverse transcriptase polymerase chain reaction) SARS-CoV-2 were evaluated (16 from each cohort). Primary outcomes: a) clinical (O2-saturation); b) biochemical (Lymphocyte-count, Fibrinogen, D-Dimer, Urea, Ferritin, LDH [lactate dehydrigenase], IL-6 and CRP [c-reactive protein]); and c) radiological improvement. Secondary outcomes: a) days-of-hospitalization, b) mortality-rate before discharge. The Ozone-protocol consisted of 10 sessions of intra-rectal Ozone, total dose 5.25 mg (150 mL volume, 35 g/ml concentration). The Standard-of-care protocol included O2 supply, antivirals (Remdesivir / Isoprinosine), corticosteroids (Dexamethasone / Metilprednisolone), monoclonal antibodies (Anakinra / Tocilizumab), antibiotics (Azytromicine), anticoagulants (Enoxaparine / Fraxiparine). Protocol was approved by Health Care Ethics Committee (Report 15/4/2020) of our Hospital and by Ethics Committee for Medical Investigation of La Princesa’s Hospital (ACTA CEIm 12/20, 28/5/20, Registry 4146). Results: Patients in Slovakian cohort were younger (53.38 vs 84.69 years). Grade of severity was worse in Spanish-cohort (4.78 vs 3.30 points). Length of stay was superior in Spanish-cohort (27.38 vs 10.07 days). Both cohorts improved O2-saturation and Lymphocyte-count. Inflammation biomarkers (Fibrinogen, D-Dimer, Urea, Ferritin, LDH, CRP and IL-6) decreased in both cohorts. In Spanish-cohort, Urea and Ferritin improvement was not significant (p>0.05), while in Slovakian-cohort, Urea, Fibrinogen and LDH were not significant (p>0.05) Radiological signs of bilateral pneumonitis decreased on both cohorts. Mortality was similar (12.5%). Conclusion: After Standard of care protocol, Rectal Ozone improved O2-saturation, decreased inflammation biomarkers and improved Taylor’s radiological scale in both cohorts. Although age, grade of severity and days of hospitalization were inferior in Slovakian cohort, mortality was similar in both cohorts, but inferior if compared to an external control cohort.

Crop-type mapping is an important intermediate step for cost-effective crop management at the field level, as an overview of all fields with a particular crop type can be used for monitoring or yield forecasting, for instance. Our study used a data set with 2400 fields and corresponding satellite observations from the federal state of Bavaria, Germany. The study classified corn, winter wheat, winter barley, sugar beet, potato, and winter rapeseed as the main crops grown in Upper Bavaria. We additionally experimented with a rejection class "Other", which summarised further crop types. Corresponding Sentinel-2 data included the normalised difference vegetation index (NDVI) and raw bands from 2016 to 2018 for each selected field. The influence of raw bands compared to NDVI was analysed and the classification algorithms, i.e. support vector machine (SVM) and random forest (RF), were compared. The study showed that the use of an index should be critically questioned and that raw bands provided a wider spectral bandwidth, which significantly improved the mapping of crop types. The results underline the use of RF with raw bands and achieved overall accuracies (OA) of up to 92%. We also predicted crop types in an unknown year with significantly different weather conditions and several months before the end of the growing season. Thus, the influence of climate anomalies and the accuracy depending on the time of prediction were assessed. The crop types of a test site and year without labels could be determined with an OA of up to 86%. The results demonstrate the usefulness of the proof-of-concept and its readiness for use in real applications.

The KRAS mutant population has been undruggable for 40 years. G12C inhibitors and immunotherapy are the beginning of success. It is necessary to summarize the successful experience of the existing treatment model and explore the direction of the next treatment. In this review, we discuss the latest developments in targeted therapy and immunotherapy for KRAS-mutation NSCLC, aiming to provide direction or enlightenment for future treatment strategies.

Abstract: Commercialization of extra virgin olive oil (EVOO) requires a best before date recom-mended at up to 24 months after bottling, stored under specific conditions. Thus, it is expected that the product retains its chemical properties and preserves its ‘extra virgin’ category. However, in-adequate storage conditions could alter the properties of EVOO. In this study, Arbequina EVOO was exposed to five storage conditions for up to one year to study the effects on the quality of the oil and the compounds responsible for flavor. Every 15 or 30 days, samples from each storage condition were analyzed determining physicochemical parameters, the profiles of phenols, volatile compounds, α-tocopherol and antioxidant capacity. Principal component analysis was utilized to better elucidate the relationships between composition of EVOOs and the storage conditions. EVOOs stored at -23 and 23 °C in darkness and 23 °C with light, differed from the oils stored at 30 and 40 °C in darkness. The former were associated with higher quantity of non-oxidized phenolic compounds and the latter with higher elenolic acid, oxidized oleuropein and ligstroside derivatives, which also increased with storage time. E-2-Nonenal (detected at trace levels in fresh oil) was selected as a marker of the degradation of Arbequina EVOO quality over time, with significant linear regressions identified for the storage conditions at 30 and 40 °C. Therefore, early oxidation in EVOO could be monitored by measuring E2-Nonenal levels.

Bone marrow derived adult human mesenchymal stem cells (hMSCs) possess therapeutic qualities that enable them to enhance wound repair. However, the mechanisms by which this occurs remains poorly understood. Basic mechanisms may include the directed migration of delivered cells to target sites and/or the production and release of soluble factors that act at a distance. Allogeneic and even xenogeneic cells may effectively participate in wound repair. Labeled hMSCs were delivered to full-thickness skin wounds that were created in immunologically competent mice. The delivery occurred on day 3 post-wounding using two different carriers; one which released cells and one which retained cells. The fates of the delivered cells were tracked for up to 25 days. During this period, released cells migrated as a tight cohort deep into the wound to reach the subdermal vascular plexus. Simultaneously, enhanced formation of granulation tissue was evident. This migration of hMSCs was not essential in that enhanced granulation tissue formation and wound contraction occurred when cells were retained in the carrier matrix. This provided further evidence for the release of therapeutic factors by hMSCs to sites of injury.

Novel Coronavirus (2019-nCOV) causes inflammatory response with worsening symptoms. Classification of potential anti-viral and anti-inflammatory drugs in managing the symptoms of the COVID-19 and reducing morbidity is important. The objective of this study is to identify a group of drugs, best suited for COVID-19 treatment based on recent developments in clinical trials, FDA drug evaluation, directions and developments and from drug therapies globally. Online literature search was done on Medline, PubMed and google scholar databases for studies on various treatments and drug therapies for COVID-19 and relevant studies were identified and the identified drugs are described in detail as per their Pharmacological, pharmaceutical properties of the drugs, mechanism of action, current COVID-19 drug therapy, contraindications and drug-drug interactions Certain drugs can inhibit action against viral infection and protect lungs from severe inflammatory response. This article summarizes several drugs like Hydroxychloroquine, Chloroquine, Remdesivir, Favipiravir, Lopinavir, Ritonavir, Dexamethasone, Ivermectin, Baricitinib, Casirivimab / imdevimab, Bamlanivimab along with auxiliary treatment like convalescent plasma transfusion. Remdesivir is first drug approved by FDA. Hydroxychloroquine, dexamethasone and remdesivir are showing results against COVID-19 but it is important to test the efficacy and safety of such drugs though some drugs have shown remarkable results.

Hadhramout Initiative Against Corona (HIAC ) formed a working group of clinicians relevant to the management of COVID-19 to formulate clinical practice guidelines (CPG) for clinicians caring for the patients infected with COVID-19 in Yemen. The regional guidelines on the management of COVID-19 were thoroughly reviewed and its applicability was assessed for Yemen. HIAC’s recommendations covered (2) sections: the first one is the diagnosis, including case definition, risk stratification of the affected cases, investigations (prioritization of reverse transcription-polymerase chain reaction (RT-PCR) testing, D-dimer, chest x-ray, and chest computed tomography, while the second part covers the treatments (mainly Favipiravir, Remdesivir, Hydroxychloroquine, and Glucocorticoid, Anticoagulants, and Supportive measures). In conclusion, the adoption of cost-effective and evidence-based guidelines in Yemen will standardize the management of the patients infected with COVID-19 and protect both the patients and the health care workers from malpractice.

The emergence of COVID-19 has prompted an unprecedented scientic publication with the aim of better understanding this new disease. This study assessed the scientic impact and disciplinary priorities of the published papers on the pandemic by comparing epidemiological (EP) and social sciences (SS) research interests. Papers were identified via keywords searching using Google Scholar and Scopus databases. From an initial 1720 papers, we identified 597 relevant articles, of which 347 were for EP researches and 250 for SS studies. We extracted information, such as authors' countries, and research thematic related to EP and SS. The results revealed that most papers were authored by Asian (37.5%), European (30.5%) and American (19.6%) scientists. Only 10.1% and 2.3% of authors were aliated with African and Oceanian institutions, respectively, indicating that the regions most affected by the pandemic mainly contributed to the scientic publications. In total, 26 research themes were recorded from both EP and SS studies. There was a high signicant dierence among themes in both research fields (Chi-square = 1204.3, df = 1, p-value < 0.001). EP papers mostly dealt with clinical trials (54.5%) and diagnosis (53.3%). These papers assessed the incidence and epidemiological characteristics of the disease (incubation period, symptomatic period, recovering or death), testing tests developed, drugs and vaccines used. SS papers were mainly concerned with the sociocultural analyses (78%) and economic impact (55.6%) of the pandemic. They mainly focused on behavioral changes induced by the pandemic and strategies developed to mitigate its impacts. This study highlights the difference between regions and gaps between scientific disciplines concerning the proposed responses to control the pandemic. It is important to promote collaborative and interdisciplinary studies for health emergencies.

In December 2019, an unusual cluster of pneumonia cases were reported in Wuhan and promptly confirmed to be caused by a new virus known as severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) of which the disease it caused would be known as COVID-19. In March 2020, in the absence of any vaccines, and in response to the global spread of SARS-CoV-2 the UK implemented non-pharmaceutical intervention (NPI) measures in the form of a national lockdown to decelerate the spread. Compliance with NPIs can have significant impact on reducing disease transmission however there are currently no studies measuring compliance within the horse ownership world which naturally brings groups of people together during everyday caregiving activities. This article describes the reported horse owner compliance during the COVID-19 pandemic from March 2020 to December 2020 as deduced from 1036 respondents which completed an anonymous online survey between December 30th, 2020 and January 11th, 2021. Where rules/guidance did exist, there was good compliance with 92.76% of respondents indicating that they were following them. The most common rule/guidance implemented was social distancing, which was also the most common rule/guidance to be breached. Riding with others whilst at the yard (hacking or in an arena) and meeting up with non-household members (family and friends) when off the yard were also common rules/guidelines breached. Respondents who kept their horses at either DIY livery, or on a private yard were most likely to breach rules/regulations whereas respondents who kept their horses at full livery were least likely to breach rules/regulations. The results indicate that compliance of horse owners with COVID-19 rules/guidance is high when rules/guidance exists. However, just under half of respondents indicated that there were no rules/guidelines on their yards indicating that there is room for an increased contribution from the horse owning community by encouraging more yards to impose control measures where they currently do not exist.

Wheat is one of the global strategic crops and ranks third in terms of cereals production. Wheat crop is exposed to many fungal infections during the cultivation stages, some of which have the ability to secrete numbers of toxic secondary metabolites that threaten the quality of grains, consumer health, producer economics and global trade exchange. Fifty-four random samples were collected from wheat which originated from different countries. The samples included 14 of soft wheat to study the extent of their contamination with Deoxynivalenol (DON) and T-2 toxin by auto-ELISA technology and r-biopharm Microtiter plate. All samples were contaminated with DON toxin except one sample, and the contamination average ranged between 40.7 and 1018.8 µg kg-1. The highest contamination rates were in Lithuanian and the lowest in Indian wheat. Meanwhile the highest average level of T-2 toxin contamination was in Lithuanian wheat grains with a rate of 377.4µg kg-1 and the lowest in Polish wheat with an average of 115.3µg kg-1. GC-MS/MS and multiple reaction monitoring mode (MRM), was used to detect 15 triazole derivatives in collected samples, which may be used to combat fungal diseases on wheat during the growing season. Only 9 derivatives were found; Simeconazole, Penconazole, Hexaconazole, Cyproconazole, Diniconazole, Tebuconazole, Metconazole, Fenbuconazole and Difenoconazole. These derivatives varied according to the origin of wheat samples as well as their its concentration whereas, another 6 derivatives were not detected in all samples. A direct inverse relationship was found between the DON concentration in the samples and the residues of Simeconazole, Penconazole, Diniconazole, Tebuconazole, Metconazole, Fenbuconazole and Difenoconazole and the T-2 toxin showed the same relationship except for Tebuconazole. The safe and rational use of some triazole derivatives may be a new approach and a promising strategy not only to reduce plant diseases and their problems, but also to get rid of some mycotoxins as contaminates.

Therapeutic options for the highly pathogenic human Severe Acute Respiratory Syndrome-Coronavirus 2 (SARS-CoV-2) causing the current pandemic Coronavirus disease (COVID-19) are urgently needed. COVID-19 is associated with viral pneumonia and acute respiratory distress syndrome causing significant morbidity and mortality. The proposed treatments for COVID-19, such as hydroxychloroquine, remdesivir and lopinavir/ritonavir, have shown little or no effect in the clinic. Additionally, bacterial and fungal pathogens contribute to the SARS-CoV-2 mediated pneumonia disease complex. The antibiotic resistance in pneumonia treatment is increasing at an alarming rate. Therefore, carbon-based nanomaterials (CBNs), such as fullerene, carbon dots, graphene, and their derivatives constitute a promising alternative due to their wide-spectrum antimicrobial activity, biocompatibility, biodegradability and capacity to induce tissue regeneration. Furthermore, the antimicrobial mode of action is mainly physical (e.g. membrane distortion), which is characterized by a low risk of antimicrobial resistance. In this review, we evaluated the literature on the antiviral activity and broad-spectrum antimicrobial properties of CBNs. CBNs had antiviral activity against 12 enveloped positive-sense single-stranded RNA viruses similar to SARS-CoV-2. CBNs with low or no toxicity to the humans are promising therapeutics against COVID-19 pneumonia complex with other viruses, bacteria and fungi, including those that are multidrug-resistant.

Tissue resident memory T cells (TRM) were first described in 2009. While initially the major focus was on CD8 TRM, there has been recently an increased interest in defining the phenotype and the role of CD4 TRM in diseases. Circulating CD4 T cells seed tissue CD4 TRM, but there also appears to be an equilibrium between CD4 TRM and blood CD4 T cells. CD4 TRM are more mobile than CD8 TRM, usually localized deeper within the dermis/lamina propria and yet may exhibit synergy with CD8 TRM in disease control. This has been demonstrated in herpes simplex infections in mice. In human recurrent herpes infections, both CD4 and CD8 TRM persisting between lesions may control asymptomatic shedding through interferon gamma secretion, although this has been more clearly shown for CD8 T cells. The exact role of the CD4/CD8 TRM axis in the trigeminal ganglia and/or cornea in controlling recurrent herpetic keratitis is unknown. In HIV, CD4 TRM have now been shown to be a major target for productive and latent infection in cervix. In HSV and HIV co-infections, CD4 TRM persisting in the dermis support HIV replication. Further understanding of the role of CD4 TRM and their induction by vaccines may help control sexual transmission by both viruses.

The COVID-19 pandemic caused by SARS-CoV-2 has been showing a speedy growth in the number of infected patients with a remarkable mortality rate, thus it has become a worldwide public health concern. From March 8, 2020, the disease was confirmed to start spreading in Bangladesh. Since then, people got infected so exponentially that the country positions at the list of top infected countries in the world. Therefore, the objective of this comprehensive review was representing overall scenario of COVID-19 in different sectors of Bangladesh, particularly prioritizing the health sector. Up to 14 September 2020, 339,332 confirmed cases and 4,759 deaths were reported. An alarming fact is that while the global mutation rate of coronavirus is 7.23 % in average, the rate is 12.6 % in Bangladesh. Although the government ruled preventive strategies such as nationwide lockdown, social distancing, contact monitoring, quarantine and isolation, it was difficult to implement those due to lack of public awareness, inappropriate attitudes and so on. Moreover, the overburdened healthcare system had a weak response at initial stage because of insufficient healthcare facilities. Consequently, this pandemic affected severely almost all the important sectors of the country, specifically the economy, agriculture and health sectors. Hence, focusing on healthcare system as well as maintaining social distance and other essential precautions can limit the spread of infection and help to alleviate the severity of the pandemic.

The developments of confirmed daily Sars-CoV-2 infections can be modeled a posteriori in a comparatively simple and satisfactory way by means of a special exponential function: its exponential coefficient varies exponentially with time itself. This property enables the function to directly simulate the „daily case“ curve fragments observed for the first waves of the current epidemics in a number of counties and countries. Linear combinations of two or more of the functions allow for the modeling of the complete curves observed in the vast majority of all regions for which case number developments have been tabulated.

Although RNA modifications were discovered decades ago, the identification of enzymes that write, read, and erase RNA modifications enabled their functional study and spawned the field of epitranscriptomics. Coupling that knowledge to new methods has enabled the precise pinpointing of epitranscriptomic modifications across the transcriptome plus the elucidation of their functional consequences. PCIF1 (Phosphorylated CTD Interacting Factor 1) was shown to add N6, 2’-O-dimethyladenosine (m⁶Am) marks at the first nucleotide after the 5’ N7-methylguanosine (m⁷G) cap. In this review, we discuss the epitranscriptomic regulation of mRNA in general, and focus on m⁷G cap-adjacent m⁶Am in particular. m⁶Am positions can now be distinguished from N6-methyladenosine (m⁶A) using new techniques leveraging PCIF1-knockout cells. Although m⁶Am modification sites can be detected precisely, conflicting data have been published regarding how cap-adjacent m⁶Am marks affect their host mRNA. Discrepancies in the data mean that the effects of cap-adjacent m⁶Am on mRNA stability, decapping, and translation continue to be debated. Finally, while PCIF1 is predominantly nuclear, a subset of results suggest a possible cytoplasmic role as well. Taken together, these contradictory results which employed different methodologies and cell lines means that further experiments are required to determine the ultimate biological function(s) of m⁷G cap-adjacent m⁶Am.

Hepatic encephalopathy (HE) is a form of brain dysfunction that is specifically caused by liver insufficiency and/or portal-systemic shunt. The exact nature of HE is debated, so that conflicting uses of the term HE may cause inconsistencies in its detection and, in turn, issues with its management. This review highlights the meaning of the term HE on the basis of both its historical origins and current consensus. It also provides criteria for the diagnosis of the condition, on the basis of its phenotypes and the risk factors for its occurrence. The procedure for differential diagnosis from other conditions which result in similar phenotypes is considered, together with precipitants and confounders. Finally, the current multidimensional approach for the correct clinical recording of HE episodes is discussed.

(1) Background: A global pandemic due to COVID-19 emerged in November 2019 and hit France in early March 2020. It not only resulted in a loss of lives but also in very strict confinement measures. The objective of this study was to understand what the determinants of the change in participants’ behavior and mental state were during the confinement. (2) Methods: An online survey was launched on April 23rd, 2020, and closed on May 7th, 2020. The final sample included 1454 participants from 24 to 65 years old. Descriptive and multivariate analyses were then performed. (3) Results: 28.7% reported having a more balanced diet, against 17.1% with a less balanced diet. 22.7% of respondents reported an increased alcohol consumption, as opposed to only 12.2% declaring a decrease and 11.2% of respondents increased their tobacco consumption, while 6.3% decreased it. 50.6% of the participants reported being more depressed, stressed, or irritable since the beginning of the lockdown. Confinement had a negative effect on every behavior studied in this survey, except for nutrition. We also found that negative mental state changes were strongly associated with nutrition, sleep, physical activity, and alcohol consumption changes.

RaTG13 (a bat derived SARS-like CoV) is the closest relative sequence of SARS-CoV-2 reported till date. The sample from which RaTG13 was sequenced was a bat fecal swab collected in 2013 from Tongguan, Mojiang, Yunnan province, China. The Illumina based sequence of RaTG13, MN996532.1, was deposited on 27^th Jan 2020 and the raw data (Illumina), https://www.ncbi.nlm.nih.gov/sra/SRX7724752[accn]. There are discrepancies in dates about when the metagenome sequencing of RaTG13 sample was done (2018 or 2020), both stated by the same corresponding author. Comparison of the RNA Seq data of RaTG13 fecal swab to the corresponding data from the bat fecal swabs deposited by the same working group using the same methods indicated that the RaTG13 raw data seemed to be different in various aspects. The fecal swab sample showed abnormally less read of bacterial reads in the swab was exceptionally low, i.e. 0.7%, compared to the 20-90% abundance in other fecal swabs from bats processed by similar methods. Also, another raw data in the form of amplicon sequences was deposited in May 2020; however, the dates mentioned on the files of the sequenced amplicons were older (2017, 2018). The genome assembly of RaTG13 could not be done de-novo and the average coverage of the genome ~8%. Also, literature indicates that RaTG13 RBD cannot bind to Rhinolophus ACE-2 receptors. Collectively, the anomalies in the raw data of RaTG13 and other issues pose an important question about the overall authenticity of the RaTG13 genome sequence.

Pediatric inflammatory multisystem syndrome (PIMS) is a new entity in children, likely associated with previous coronavirus disease 19 (COVID-19). Most of reports about PIMS come from countries particularly hit by the COVID-19 pandemic. Our aim was to investigate the nature of inflammatory syndromes in Poland (a country with low COVID-19 prevalence) and to perceive the emergence of PIMS in our country. On May 25th, we have launched a nationwide survey of inflammatory syndromes in children for retrospective (since 4th March 2020) and prospective data collection. Up to 28th July, 39 reported children met inclusion criteria. We stratified them according to age (&lt;5 and ≥ 5 years old) and COVID-19 status. The majority of children had clinical and laboratory features of Kawasaki disease, probably non-associated with COVID-19. However, children ≥5 years of age had PIMS characteristics, and 9 children had COVID-19 confirmation. This is the first to our knowledge report of PIMS register from the country with low COVID-19 prevalence, and it proves that PIMS may emerge in any area involved in the COVID-19 pandemic. In a context of limited COVID-19 testing availability, other risk factors of PIMS, e.g. older age should be considered in the differential diagnosis of inflammatory syndromes in children.

COVID-19, previously known as “2019 novel coronavirus”, is a newly discovered virus which causes severe acute respiratory syndrome, similar to corona virus 2 (SARS-CoV-2), which has spread widely through human to human contact and was declared a pandemic by the WHO in March 2020. To cope with this pandemic many countries have adopted nationwide lockdowns which restrict nonessential activities and encourage their populations to avoid public transport, work from hone wherever possible, and to maintain social distancing at all times. While the severity of these shutdowns has varied with country, large geographic regions of the world (including China, India, Iran, Italy, Spain, and the USA) have all been severely affected, not just in the loss of human life, but also in terms of the financial impacts the lockdowns will have on their countries future prosperityIt was previously reported that a number of environmental factors, including humidity and temperature, played an important role in development and spread of the SARS-Corona Virus infection with the virus retaining viability for over 5 days at temperatures between 22–25^oC and relative humidity (RH) of 40–50%. Whereas, elevated temperatures and higher RH (38^oC, and >95% RH) decreased virus viability (Kroumpouzos et al., 2020). The spread of COVID-19 started in low temperature areas of China, with major outbreaks subsequently occurring in Iran, Japan, Northern Italy and South Korea. These new virus epicenters all had similar temperature and latitude, along the 30-50^◦N” zone. Subsequently, the virus was spread to regions of elevated temperature, such as India, the Middle East and Thailand, due to international travel (Kroumpouzos et al., 2020).The aim of this study was to consider the environmental impact of COVID-19, including water pollution. The paper is divided into four sections. In the first section the current literature related to COVID-19 is reviewed. In the second section a recent update on COVID-19 globally is presented, followed by a descriptive impact on the environment in the third section and finally in the fourth section the COVID-19 related worldwide environmental impact is discussed. Since COVID-19 is a currently an active pandemic with no end in sight, while constructive conclusions can only be made on the limited data currently, which may be prone to high errors. However, these conclusions may provide some preliminary suggestions for assisting in assessing spreading patterns of COVID-19 across the globe, and may be of long-term significances with respect to assessing the environmental impact of lockdown policies due to COVID-19 worldwide.

The COVID-19 pandemic continues to ravage the world, with the United States being highly affected. A vaccine provides the best hope for a permanent solution to controlling the pandemic. However, to be effective, a vaccine must be accepted and used by a large majority of the population. Structural equation modelling was used to analyze the relationships of several factors with attitudes toward potential COVID-19 vaccination. The survey was administered to 316 respondents across the United States by a survey corporation. Prior vaccine usage and attitudes predicted attitudes towards COVID-19 vaccination. Assessment of the severity of COVID-19 for the United States was also predictive. Approximately 68% of all respondents were supportive of being vaccinated for COVID-19, but side effects, efficacy, and length of testing remained concerns. Longer testing, increased efficacy and development in the United States were significantly associated with increased vaccine acceptance. Messages promoting COVID-19 vaccination should seek to alleviate the concerns of those who are already vaccine-hesitant. Messaging directed at the benefits of vaccination for the United States as a country would address the second predictive factor. Enough time should be taken to allay concerns about both short and long-term side effects before a vaccine is released.

This tutorial is organized into three major sections—viruses, vaccines and the race for a Covid-19 vaccine. The goal is to provide enough background on viruses, history of vaccines, and the science of vaccinology founded on the principles of immunity. The hope is that this will enable us to understand the challenges, methods and prospects for developing a safe and effective vaccine against SARS-CoV-2. Many important viruses such as smallpox, HIV, HCV and SARS-CoV-2 which is responsible for causing the Coronavirus disease 2019 (Covid-19) are presented in detail, which is then followed by a description of different vaccine development methods and strategies. The tutorial then discusses different candidate SARS-CoV-2 vaccines and provides specific details of many of the prospective vaccines on the leader-board which are undergoing clinical trials. The tutorial concludes with a realistic projection for a safe and effective vaccine against SARS-CoV-2 based on the historical scientific record.

Coronavirus disease is the current cause of global concern. The massive outbreak of COVID-19 has led the World Health Organization (WHO) to declare this as a pandemic situation. The Severe Acute Respiratory Syndrome Coronavirus-2 (SARSCoV-2) is responsible for COVID-19 leading to acute respiratory distress and substantial mortality in humans. However, the first laboratory confirmation of SARS-CoV-2 in a pet dog in Hong Kong has shown the possibility of human-to-animal transmission (zooanthroponotic) of the virus. Thereafter, many animals including cat, tiger, lion and mink have also been reported to acquire the virus in several countries. In this situation the role of veterinarian assumes important in treating the animals, helping in food security, disease diagnosis, surveillance and boosting the economy of livestock stakeholders at the grassroot level. In the absence of any selective vaccine or drug against SARS-CoV-2, the world is anticipated to triumph over this pandemic with collaborative, multisectoral, and transdisciplinary approach linking human, animal and environmental health. This article gives an insight into the confirmed SARS-CoV-2 outbreaks in animals, including the factors behind the shuffling of the virus among variety of species and also emphasizes on the role of veterinarian in managing and safeguarding public health so as to pave the way for adopting one health approach in order to conserve biodiversity.

IIAEK (Ile-Ile-Ala-Glu-Lys, lactostatin) is a novel pentapeptide from bovine milk β-lactoglobulin which lowers cholesterol levels. However, the molecular mechanisms underlying the suppression of intestinal cholesterol absorption by IIAEK are unknown. Therefore, we evaluated the effects of IIAEK on intestinal cholesterol metabolism in Caco-2 cells in a human intestinal model. We found that IIAEK significantly reduced the expression of intestinal cholesterol metabolism-associated genes, particularly that of the ATP-binding cassette transporter A1 (ABCA1) protein. Subsequently, we chemically synthesized a novel molecular probe, IIXEK, which can visualize a complex of target proteins interacting with photoaffinity-labeled IIAEK by fluorescent substances. Photoaffinity labeling and MS analysis with IIXEK for the rat small intestinal mucosa and intestinal lipid raft fractions of Caco-2 cells, we identified intestinal alkaline phosphatase (IAP) as a specific molecule interacting with IIAEK and discovered IIAEK common binding amino acid sequence, GFYLFVEGGR. Transfection of IAP siRNA counteracted the decrease in ABCA1 mRNA levels in Caco-2 cells. IIAEK significantly increased IAP mRNA and protein levels, and significantly decreased ABCA1 mRNA and protein levels in Caco-2 cells. In conclusion, we found that IIAEK targets IAP to improve cholesterol metabolism via a novel signaling pathway with a specific activation of IAP and down-regulation of intestinal ABCA1.

This paper presents the super-twisting algorithm (STA) direct power control (DPC) scheme for the control of active and reactive powers of grid-connected DFIG. Simulations of 5 KW DFIG has been presented to validate the effectiveness and robustness of the proposed approach in the presence of uncertainties with respect to vector control (VC). The proposed controller schemes with fixed gains are effective in reducing the ripple of active and reactive powers, effectively suppress sliding-mode chattering and the effects of parametric uncertainties not affecting system performance.

Nigeria is the most populous country in the African continent. The aim of this study was to analyze risk factors for COVID-19 prevalence and deaths in all 6 geopolitical regions and 37 states in Nigeria. We analyzed the data retrieved from various sources, including Nigeria CDC, Nigeria National Bureau of Statistics, Unicef-Nigeria multiple indicator cluster survey and the Institute of Health Metrics and Evaluation, University of Washington. We examined 4 clinical risk factors (prevalence of TB, HIV, smoking and BCG vaccination coverage) and 5 sociodemographic factors (age ≥65, population density, literacy rate, unemployment and GDP per capita). Multivariate modeling was conducted using generalized linear model. Our analysis showed that the incidence of confirmed COVID-19 cases differed widely across the 37 states, from 0.09 per 100,000 in Kogi to 83.7 in Lagos. However, more than 70% of confirmed cases were concentrated in just 7 states: Lagos, Abuja, Oyo, Kano, Edo, Rivers and Delta. Case mortality rate (CMR) per million population also varied considerably, with Lagos, Abuja and Edo having CMR above 9. On bivariate analysis, higher CMR correlated positively with GDP and to a lesser extent with TB and population density. On multivariate analysis, which is more definitive, states with higher HIV prevalence and BCG coverage had lower CMR, while high GDP states had a greater CMR. This study indicates that COVID-19 has disproportionately affected certain states in Nigeria. Population susceptibility factors include higher economic development but not literacy or unemployment. Death rates were mildly lower in states with higher HIV prevalence and BCG vaccination coverage.

The Coronavirus Disease 2019 (COVID-19) pandemic has resulted in a significant surge of critically ill patients and an unprecedented demand on intensive care services. The rapidly evolving understanding of pathogenesis, limited disease specific evidence and demand-resource imbalances have posed significant challenges for intensive care clinicians. COVID-19 is a complex multisystem inflammatory vasculopathy with a significant mortality implication for those admitted to intensive care. Institutional strategic preparation and meticulous intensive care support are essential to maximising outcomes during the pandemic. The significant mortality variation observed between institutions and internationally, despite a single aetiology and uniform presentation, highlights the potential influence of management strategies on outcome. Given that optimal organ support and adjunctive therapies for COVID-19 have not yet been well defined by trial-based outcomes, strategies are predicated on existing literature and experiential learning. This review outlines the relevant pathophysiology and management strategies for critically ill patients with COVID-19, and shares some of the collective learning accumulated in a high volume Severe Respiratory Failure centre in London.

Water-soluble and cytocompatible polymers were investigated to enhance a transporting efficiency of biomolecules into cells in vitro. The polymers composed of 2-methacryloyloxyethyl phosphorylcholine (MPC) unit, a hydrophobic monomer unit, and a cationic monomer unit bearing an amino group were synthesized for complexation with model biomolecules, siRNA. The cationic MPC polymer was shown to interact with both siRNA and the cell membrane and was successively transported siRNA into cells. When introducing 20 − 50 mol% hydrophobic units into the cationic MPC polymer, transport of siRNA into cells. The MPC units (10 − 20 mol%) in the cationic MPC polymer were able to impart cytocompatibility, while maintaining interaction with siRNA and the cell membrane. The level of gene suppression of the siRNA/MPC polymer complex was evaluated in vitro and it was as the same level as that of a conventional siRNA transfection reagent, whereas its cytotoxicity was significantly lower. We concluded that these cytocompatible MPC polymers may be promising complexation reagent for introducing biomolecules into cells, with the potential to contribute to future fields of biotechnology, such as in vitro evaluation of gene functionality, and the production of engineered cells with biological functions.

Inflammation plays a key role in the development and progression of type-2 diabetes (T2D), a disease characterised by peripheral insulin resistance and systemic glucolipotoxicity. Visceral adipose tissue (AT) is the main source of inflammation early in disease course. Macrophages are innate immune cells that populate all peripheral tissues, including AT. Dysregulated AT macrophage (ATM) responses to microenvironmental changes are at the root of aberrant inflammation and development of insulin resistance, locally and systemically. The inflammatory activation of macrophages is regulated at multiple levels: cell surface receptor stimulation, intracellular signalling, transcriptionally and metabolically. This review will cover the main mechanisms involved in AT inflammation and insulin resistance in T2D. First, we will describe the physiological and pathological changes in AT that lead to inflammation and insu- lin resistance. We will next focus on the transcriptional and metabolic mechanisms described that lead to the activation of ATMs. We will discuss more novel metabolic mechanisms that influence macrophage polarisation in other disease or tissues contexts that may be relevant to future work in insulin resistance and T2D.

Currently, there is no effective antiviral therapy recommended for the new coronavirus disease 2019 pneumonia (COVID-19). The purpose of this pilot study was to evaluate the safety of Ozonized Saline Solution (O₃SS) used as a complementary therapy in adult patients COVID-19. Twenty-five adult patients who were hospitalized with mild to severe COVID-19 symptoms, who met the inclusion criteria and were being treated from April 18^rd to April 26th, 2020, at the Viamed Virgen De La Paloma Hospital, Madrid, Spain were included in this study. Patients were allocated to receive standard care (SC) that included 200-400 mg hydroxychloroquine twice daily for 5-7 days plus Tocilizumab 400 mg twice daily for 5 days, low molecular weight heparin (LMWH) and 40 mg-60 mg metil-prednisone plus O₃SS, 200 mL, 3-5 µg/mL daily for 10 days. No control group was included, data were compared to clinical trials in this subject. Primary outcomes of treatment with O₃SS were an improvement of clinical symptoms and a reduction in mortality. Secondary end points evaluated included participant clinical status, laboratory examinations, and duration of viral shedding. None of the patients treated with SC + O₃SS died. Improvements in symptoms such as dyspnea, weakness, and reduction in body temperature were observed and corresponded with an improvement of laboratory finding including D-dimer, fibrinogen, LDH, and CRP. No side effects from the O₃SS treatment were observed. Conclusions: COVID-19 patients with mild to severe symptoms who received intravenous O₃SS as a complementary therapy demonstrated no side effects. This preliminary data will be served as base for a future study of the efficacy of this therapy.

Background: The information on the difference in clinical characteristics between severe and non-severe cases is limited in some countries including Iran. The objective of this case series is to compare the clinical characteristics, radiologic features, and laboratory findings between COVID-19 severe cases who received the intensive care unit (ICU) care with non-severe cases who did not receive ICU care. Methods: In this retrospective cohort study, 186 laboratory-confirmed patients with COVID-19 diagnosed from 1 March 2020 to 30 March 2020 were investigated. Results: This study population included 186 hospitalized patients with confirmed COVID-19. The median age was 47 years, and 88 (47.31%) were female. Of these patients, 48 were admitted and transferred to ICU. Of 186 patients, 44.62% had medical comorbidities including hypertension and diabetes. The most common clinical manifestation were shortness of breath 86.56%, myalgia 74.19%, and headache. Higher neutrophil counts, CRP, and LDH as well as the lower levels of lymphocytes were the most important laboratory finding among COVID-19 patients. As of April 15, 2020, 33 were still hospitalized. A total of 116 patients (62.70 %) had been discharged, and 36 patients (19.94 %) had died. Of the 48 patients admitted to the ICU, 33.33% have died. Conclusion: In the present study, shortness of breath was the most common clinical symptom, and the mortality rate in patients admitted to the ICU was about 33%, indicating that about one-third of patients with severe illness who admitted to the ICU section died.

Coronavirus disease 2019 (COVID-19) fatal outcomes have been associated with multiple cardiovascular risk factors. In new epidemic areas, such as Latin America, there is a lack of studies about this. Here, we evaluated those factors in a retrospective cohort of patients in a national reference hospital of Lima, Peru. Design. A retrospective cohort observational study was done. For this study, information was obtained from clinical records of the hospital for the cases that were laboratory-diagnosed and related, during March 6^th and April 30^th, 2020. rRT-PCR was used for the detection of the RNA of SARS-CoV-2 following the protocol Charité, Berlin, Germany, from nasopharyngeal swabs at the National Institute of Health. Calculation of the odds ratio (OR) with the respective 95% confidence interval (95% CI) was done, also logistic regression for adjusted OR (multivariate) was done. Values of p < 0.05 were considered significant for all analyses. Results. One hundred six hospitalized patients were evaluated. The mean age of patients was 61.58 years (SD 16.81). Cardiovascular risk factors among them were hypertension (46.2%), diabetes (28.3%), and obesity (28.3%), among others. Fifty-six patients died (52.8%). Mortality associated factors at the multivariate analysis were arterial hypertension (OR=1.343, 95% 1.089-1.667), myocardial injury (OR=1.303, 95% 1.031-1.642), and mechanical ventilation (OR 1.262, 95% 1.034-1.665), as associated factors. Conclusion. As observed in other regions of the world, cardiovascular risk factors represent a significant and independent threat to be considered in patients with COVID-19. Further studies and interventions in Peru and Latin America are expected.

Novel coronavirus disease (COVID-19) has affected nearly 7 million individuals and claimed more than 0.4 million lives to date. There are several reports of gender differences related to infection and death due to COVID-19. This raises important questions such as “Whether there are differences based on gender in risk and severity of infection or mortality rate?” and “What are the biological explanation and mechanisms underlying these differences?” Emerging evidence has proposed sex-based immunological, genetic, and hormonal differences to explain this ambiguity. Besides biological differences, women have also faced social inequities and economic hardships due to this pandemic. Several recent studies have shown that independent of age males are at higher risk for severity and mortality in COVID-19 patients. Although susceptibility to SARS-CoV-2 was found to be similar across both genders in several disease cohorts, a disproportionate death ratio in men can be partly explained by the higher burden of pre-existing diseases and occupational exposures among men. From an immunological point of view, females can engage a more active immune response, which may protect them and counter infectious diseases as compared to men. This attribute of better immune responses towards pathogens is thought to be due to high estrogen levels in females. Here we review the current knowledge about sex differences in susceptibility, the severity of infection and mortality, host immune responses, and the role of sex hormones in COVID-19 disease.

COVID-19 pandemic that started in China has spread within 3 months to the entire globe. We tested the hypothesis that the vaccination against tuberculosis by BCG correlates with a better outcome for COVID-19 patients. Our analysis covers 55 countries complying with predetermined thresholds on the population size and number of deaths per million (DPM). We found a strong negative correlation between the years of BCG administration and the DPM along with the progress of the pandemic, corroborated by permutation tests. The results from multivariable regression tests with 23 economic, demographic, health-related, and pandemic restriction quantitative properties, substantiate the dominant contribution of BCG years to the COVID-19 outcomes. The analysis of countries according to an age-group partition reveals that the strongest correlation is attributed to the coverage in BCG vaccination of the young population (0-24 years). Furthermore, a strong correlation and statistical significance are associated with the degree of BCG coverage for the most recent 15 years, but no association was observed in these years for other broadly used vaccination protocols for measles and rubella. We propose that BCG immunization coverage, especially among the most recently vaccinated contributes to attenuation of the spread and severity of the COVID-19 pandemic.

In the 21st century, three highly pathogenic betacoronaviruses have emerged, with an alarming rate of human morbidity and case fatality. Genomic information has been widely used to understand the pathogenesis, animal origin and mode of transmission of betacoronaviruses in the aftermath of the 2002-03 severe acute respiratory syndrome (SARS) and 2012 Middle East respiratory syndrome (MERS) outbreaks. Furthermore, genome sequencing and bioinformatic analysis have had an unprecedented relevance in the battle against the 2019-20 coronavirus disease 2019 (COVID-19) pandemic, the newest and most devastating outbreak caused by a coronavirus in the history of mankind, allowing the follow up of disease spread and transmission dynamics in near real time. Here, we review how genomic information has been used to tackle outbreaks caused by emerging, highly pathogenic, betacoronavirus strains, emphasizing on SARS-CoV, MERS-CoV and SARS-CoV-2.

As the first initiative of its kind in Algeria, here is presented a solar-powered mobile “Ultraviolet Germicidal Irradiation” disinfection unit (UVGI) based on a special germicidal ultraviolet-C (UVC) radiator. The system was designed to disinfect several objects such as: medical tools, reusable masks, face-shields, gloves, phones, laptops, keys, money and many other portable devices that need to be disinfected/sterilized. It offers the advantage of complete autonomy through the built-in photovoltaic (PV) system that includes a solar panel, a gel battery, a charge controller and a power inverter. The system provides an extra 220V-50Hz outlet with 375VA maximum power to be used when energy is needed. The system is easily scalable to generate higher ultraviolet dosages by adding more UVC lamps. The chemical-free germicidal UVC sanitizing method employed by this device effectively disactivates a very wide range of microorganisms (microbes, bacteria and fungi and viruses including the actual SARS-CoV-2 that causes COVID-19 respiratory disease) and it has several advantages in comparison to chemical-based sanitizing methods. The total cost to make this open source device is below 1000 € and is easily customizable and scalable. This device is an open source, secure and fast equipment for objects and surface disinfection. The device will be fully automated by adding PIR sensors or remote control after further funding will be received.

Abstract. The COVID-19 has turned in to a global human tragedy and economic devastation. Governments have implemented lockdown measures, blocked international travel, and enforced other public containment measures to mitigate the virus morbidity and mortality. As of today, no drug has the power to fight the infection and bring normalcy to the utter chaos. This leaves us with only one choice namely an effective and safe vaccine that shall be manufactured as soon as possible and available to all countries and populations affected by the pandemic at an affordable price. There has been an unprecedented fast track path taken in R&D by the World community for developing an effective and safe vaccine. Platform technology has been exploited to develop candidate vaccines in a matter of days to weeks and as of now, 108 such vaccines are available. Six of these vaccines have entered clinical trials. As clinical trials are ‘rate-limiting’ and ‘time-consuming’, many innovative methods are in practice for a fast track. These include parallel phase I-II trials and obtaining efficacy data from phase IIb trials. Human ‘challenge experiments’ to confirm efficacy in humans is under serious consideration. The availability of the COVID-19 vaccine has become a race against time in the middle of death and devastation. There is an atmosphere of tremendous hype around the COVID-19 vaccine and developers are using every moment to make claims, which remain unverified. However, concerns are raised about a rush to deploy a COVID-19 vaccine. Applying ‘Quick fix’ and ‘short cuts’ can lead to errors with disastrous consequences.

Background: The purpose of this study was to examine the prevalence and effects of current smoking on adverse outcomes among hospitalized COVID-19 patients. Methods: We performed a systematic review of the literature (PubMed) for studies published until April 25. Studies were included into the analysis if they satisfied all of the following criteria: 1. To present hospitalized patients with COVID-19. 2. To classify patients into less and more severe disease, irrespective of the severity definition (defined as “adverse ourtcome”). 3. To present data on the smoking status, separately for each severity classification. We identified 18 (from a total of 1398) relevant studies. Pooled current smoking prevalence was compared with the gender-adjusted, population-based expected prevalence by calculating Prevalence Odds Ratio (POR). The association between current, compared to non-current and former, smoking and adverse outcome was examined by calculating Odds Ratio (OR). All analyses were performed using random-effects meta-analysis. Results: Among 6515 patients, 440 of whom were current smokers, the pooled prevalence of current smoking was 6.8% (95%CI: 4.8-9.1%) and the POR was 0.21 (95%CI: 0.16-0.26, P < 0.001). In Chinese studies only, the POR was 0.22 (95%CI: 0.17-0.27, P < 0.001). Current smokers were more likely to have an adverse outcome compared to non-current smokers (OR: 1.53, 95%CI: 1.06-2.20, P = 0.022). However, they were less likely to have an adverse outcome compared to former smokers (OR: 0.42, 95%CI: 0.27-0.74, P = 0.003). Conclusion: An unexpectedly low prevalence of current smoking was observed among hospitalized patients with COVID-19. Hospitalized current smokers had higher odds compared to non-current smokers but lower odds compared to former smokers for an adverse outcome. The possibility that nicotine may have a protective effect in COVID-19 which may be masked by smoking-related toxicity and by the abrupt cessation of nicotine intake when smokers are hospitalized should be explored.

Objective: On March 11, 2020 the WHO declared that COVID-19 is pandemic. Among the risk factors for many infectious diseases, a role of the ABO blood group system is reported in the literature. We argue whether it is necessary to investigate the relationship between ABO blood groups and susceptibility to SARS-CoV-2 infection and if we should consider some blood groups as potential risk factors for COVID-19. Results: Based on the scientific evidence reported in this letter, we believe that further studies are needed to investigate how the ABO polymorphism influences the host susceptibility, individual response and clinical risk for SARS-CoV-2 infection.

Importance: The COVID-19 pandemic is currently accelerating. Patients with locally advanced non-small cell lung cancer (LA-NSCLC) may require treatment in locations where resources are limited and the prevalence of infection is high. Patients with LA-NSCLC frequently present with comorbidities that increase the risk for severe morbidity and mortality from COVID-19. These risks may be further increased by treatments for LA-NSCLC. Observation: We present expert thoracic oncology multidisciplinary (radiation oncology, medical oncology, surgical oncology) consensus of alternative strategies for the treatment of LA-NSCLC during a pandemic. The overarching goals of these approaches are to reduce the number of visits to a healthcare facility, reduce the risk of SARS-CoV-2 exposure, and attenuate the immunocompromising effects of lung cancer therapies. Patients with resectable disease can be treated with definitive non-operative management if surgical resources are limited or the risks of perioperative care are high. Non-operative options include chemotherapy, chemoimmunotherapy, and radiation therapy with sequential schedules. The order of treatments may be based on patient factors and clinical resources. Whenever radiation therapy is delivered without concurrent chemotherapy, hypofractionated schedules are appropriate. For patients who are confirmed to have COVID-19, usually cancer therapies may be withheld until symptoms have resolved with negative viral test results. Conclusions and Relevance: The risk of severe treatment-related morbidity and mortality is significantly elevated for patients undergoing treatment for LA-NSCLC during the COVID-19 pandemic. Adapting alternative treatment strategies as quickly as possible may save lives and should be implemented through communication with the multidisciplinary cancer team.

COVID-19 disease outbreak was started in the December, 2019 in the Wuhan city of China which is also known as the largest transportation hub of China. During the spring festival of China the situation become epidemic. Soon, the virus is imported to many regions including the low income countries. Till now, 234073 infected reported cases of the COVID-19 in the world with the total of 9840 deaths (March 20, 2020). The common symptoms of the COVID-19 are the cough, high fever, sore throat, fatigue and breathlessness. The disease is found to be mild in most of the people, some of cases reported to the pneumonia also with multi organ dysfunction and acute ARDS (acute respiratory distress syndrome). It is found that the incubation period for the infection is 2-14 days which is usually 4 days in maximum of cases. India has reported 283 cases of COVID-19 infections till now with 4 deaths. India is still at stage 2 on local transmission as per WHO report 60. WHO reported 60 clearly stated that there is no community transmission occurred in India yet which can be prevented by the avoiding mass gathering and proper screening of the people. Govt. of India has taken many initiatives to minimize the spread of COVID-19 infection in the country. The infection rate of the COVID-19 in India remains low related to population size of the country. It is because of fast government action to quarantine the suspected people and shut down all its borders. There is a great slowdown in the global economy due to COVID-19 attack which is likely to costs around $1 trillion. The spread of COVID-19 infection can be reduced by minimizing the H-H transmissions. Still there is need of Anti-n-CoV drug development which can replace the supporting therapies for the treatment of infection.

A novel strategy is presented for reliable diagnosis and progression prediction of diseases with special attention to COVID-19 pandemy. A plan is presented for how the model can be implemented worldwide in healthcare and how novel treatments and targets can be detected. The idea is based on poikilosis, pervasive heterogeneity and variation at all levels, systems and mechanisms. Poikilosis in diseases can be taken account in pathogenicity model, which is based on distribution of three independent condition measures – extent, modulation and severity. Pathogenicity model is a population or cohort-based description of disease components. Evidence-based thresholds can be applied to the pathogenicity model and used for diagnosis as well as for early detection of patients in risk of developing the most severe forms of the disease. Analysis of patients with differential course of disease can help in detecting biomarkers of diagnostic and prognostic significance. A practical and feasible plan is presented how the concepts can be implemented in practice. Collaboration of many actors, including the World Health Organization and national health authorities, will be essential for success.

The global pandemic of COVID-19 accounts for more than 14,000 deaths worldwide. However, little is known about the host genetics interaction with infection and COVID-19 progression. To better understand the role of host genetics, we review the current literature, aggregate readily available genetic resources, and provide some updated analysis relevant to COVID-19 and associated phenotypes. Using the unrelated individuals in UK Biobank (total n = 337,579 across 5 populations), we aggregate human leukocyte antigen and ABO blood type frequencies. We find significant and consistent risk reduction of blood group O reported in Zhao et al. and encourage broad sharing of ABO blood type frequencies that are readily accessible across COVID-19 with mild, moderate, and severe/critical symptoms for robust inferences at https://tinyurl.com/abo-covid19. In addition, we generate polygenic risk scores (PRSs) weights for 29 blood measurements, including clinically relevant haematological measurements for COVID-19, such as lymphocyte count and percentage. Focusing on the 8 most COVID-19 clinically relevant blood measurements, we performed PRS-PheWAS analysis across 44 disease antigen measurements (n = 6,643 unrelated individuals in White British group), infectious diseases and acute respiratory infections (n = 20,928 cases and 349,000 controls across 3 population groups) and deaths (n = 1,846 cases and 368,082 controls), recorded in hospital inpatient record and death registry data, respectively, in UK Biobank, and find host genetic PRS associations with disease risk. Taken together, we anticipate these resources (https://github.com/rivas-lab/covid19) will aid in improving our understanding of host genetic risk factors playing a role in SARS-CoV-2 infection and COVID-19 disease severity.

Introduction: An epidemic of Coronavirus Disease 2019 (COVID-19) begun in December 2019 in China, causing a Public Health Emergency of International Concern. Among raised questions, clinical, laboratory, and imaging features have been partially characterized in some observational studies. No systematic reviews have been published on this matter. Methods: We performed a systematic literature review with meta-analysis, using three databases to assess clinical, laboratory, imaging features, and outcomes of COVID-19 confirmed cases. Observational studies, and also case reports, were included and analyzed separately. We performed a random-effects model meta-analysis to calculate the pooled prevalence and 95% confidence interval (95%CI). Results: 660 articles were retrieved (1/1/2020-2/23/2020). After screening by abstract/title, 27 articles were selected for full-text assessment. Of them, 19 were finally included for qualitative and quantitative analyses. Additionally, 39 case report articles were included and analyzed separately. For 656 patients, fever (88.7%, 95%CI 84.5-92.9%), cough (57.6%, 40.8-74.4%) and dyspnea (45.6%, 10.9-80.4%) were the most prevalent manifestations. Among the patients, 20.3% (95%CI 10.0-30.6%) required intensive care unit (ICU), with 32.8% presenting acute respiratory distress syndrome (ARDS) (95%CI 13.7-51.8), 6.2% (95%CI 3.1-9.3) with shock and 13.9% (95%CI 6.2-21.5%) of hospitalized patients with fatal outcomes (case fatality rate, CFR).Conclusion: COVID-19 brings a huge burden to healthcare facilities, especially in patients with comorbidities. ICU was required for approximately 20% of polymorbid, COVID-19 infected patients and this group was associated with a CFR of over 13%. As this virus spreads globally, countries need to urgently prepare human resources, infrastructure, and facilities to treat severe COVID-19.

Background Critical patients with novel coronavirus pneumonia ( COVID-19) have worse outcome and high mortality. However, the histopathology of critical patient with COVID-19 remains undisclosed. Methods We performed the whole lung biopsy, and described the pathological changes of critical COVID-19 patient done with transplant by HE staining, immunohistochemistry and special staining observed under the microscopy. Findings The whole lungs displayed diffuse congestive appearance and partly haemorrhagic necrosis on gross examination. The haemorrhagic necrosis was prominently present in outer edge of the right lower lung. The cut surfaces of the lung displayed severe congestive and haemorrhagic changes. The main pathological changes showed massive pulmonary interstitial fibrosis, and partly hyaline degeneration, variable degrees of hemorrhagic pulmonary infarction. Small vessels hyperplasia, vessel wall thickening, lumen stenosis, occlusion and microthrombosis formation. Focal monocytes, lymphocytes and plasma cells infiltrating into pulmonary interstitium. Bronchiolitis and alveolitis with proliferation, atrophy, desquamation and squamous metaplasia of epithelial cells. Atrophy, vacuolar degeneration, proliferation, desquamation and squamous metaplasia in alveolar epithelial cells. Alveolar cavity congestion was prominent, and contained mucus, edema fluid, desquamated epithelial cells, and inflammatory cells. We also found several multinucleate giant cells and intracytoplasmic viral inclusion bodies. Special stains including Masson stain, sirius red staining, reticular fibers staining indicated massive pulmonary interstitial fibrosis. Immunohistochemistry showed positive for immunity cells including CD3, CD4, CD8, CD20, CD79a, CD5, CD38 and CD68. Interpretation We demonstrate the pathological findings of critical patient with COVID-19, which might provide a deep insight of the pathogenesis and severity of this disease.

Background: In 80% of patients, COVID-19 presents as mild disease^1,2. 20% of cases develop severe (13%) or critical (6%) illness. More severe forms of COVID-19 present as clinical severe acute respiratory syndrome, but include a T-predominant lymphopenia³, high circulating levels of proinflammatory cytokines and chemokines, accumulation of neutrophils and macrophages in lungs, and immune dysregulation including immunosuppression⁴. Methods: All major SARS-CoV-2 proteins were characterized using an amino acid residue variation analysis method. Results predict that most SARS-CoV-2 proteins are evolutionary constrained, with the exception of the spike (S) protein extended outer surface. Results were interpreted based on known SARS-like coronavirus virology and pathophysiology, with a focus on medical countermeasure development implications. Findings: Non-neutralizing antibodies to variable S domains may enable an alternative infection pathway via Fc receptor-mediated uptake. This may be a gating event for the immune response dysregulation observed in more severe COVID-19 disease. Prior studies involving vaccine candidates for FCoV^5,6 SARS-CoV-1^7-10 and Middle East Respiratory Syndrome coronavirus (MERS-CoV) ¹¹ demonstrate vaccination-induced antibody-dependent enhancement of disease (ADE), including infection of phagocytic antigen presenting cells (APC). T effector cells are believed to play an important role in controlling coronavirus infection; pan-T depletion is present in severe COVID-19 disease³ and may be accelerated by APC infection. Sequence and structural conservation of S motifs suggests that SARS and MERS vaccine ADE risks may foreshadow SARS-CoV-2 S-based vaccine risks. Autophagy inhibitors may reduce APC infection and T-cell depletion^{12 13}. Amino acid residue variation analysis identifies multiple constrained domains suitable as T cell vaccine targets. Evolutionary constraints on proven antiviral drug targets present in SARS-CoV-1 and SARS-CoV-2 may reduce risk of developing antiviral drug escape mutants. Interpretation: Safety testing of COVID-19 S protein-based B cell vaccines in animal models is strongly encouraged prior to clinical trials to reduce risk of ADE upon virus exposure.

It is proposed that both human creativity and human consciousness are (unintended) consequences of the human brain’s extraordinary energy efficiency. The topics of creativity and consciousness are treated separately, though have a common sub-structure. It is argued that creativity arises from a synergy between two cognitive modes of the human brain (which broadly coincide with Kahneman’s Systems 1 and 2). In the first, available energy is spread across a relatively large network of neurons. As such, the amount of energy per active neuron is so small that the operation of such neurons is susceptible to thermal (ultimately quantum decoherent) noise. In the second, available energy is focussed on a small enough subset of neurons to guarantee a deterministic operation. An illustration of how this synergy can lead to creativity with implications for computing in silicon are discussed. Starting with a discussion of the concept of free will, the notion of consciousness is defined in terms of an awareness of what are perceived to be nearby counterfactual worlds in state space. It is argued that such awareness arises from an interplay between our memories on the one hand, and quantum physical mechanisms (where, unlike in classical physics, nearby counterfactual worlds play an indispensable dynamical role) in the ion channels of neural networks. As with the brain’s susceptibility to noise, it is argued that in situations where quantum physics plays a role in the brain, it does so for reasons of energy efficiency. As an illustration of this definition of consciousness, a novel proposal is outlined as to why quantum entanglement appears so counter-intuitive.

In this review, we discuss the insulin resistance (IR) and its development in the insulin target tissues that leads to diabetes. Also, we highlight the use of induced pluripotent stem cells (iPSCs) to understand the mechanisms underlying the development of IR. IR is associated with several metabolic disorders, including type 2 diabetes (T2D). The development of IR in insulin target tissues involves genetic and acquired factors. Persons at genetic risk for T2D tend to develop IR several years before glucose intolerance. Although there are currently several mouse models for both IR and T2D that had provided a lot of information about the disease, these models cannot recapitulate all the aspects of this complex disease as seen in each individual. Patient-specific iPSCs can overcome the hurdles faced with the classical mouse models for studying IR. iPSC technology can generate cells genetically identical to IR individuals, which can help in distinguishing between genetic and acquired defects in insulin sensitivity. Combining the technologies of the genome editing and iPSCs may provide important information about the inherited factors underlying the development of different forms of IR. Further studies are required to fill the gaps in understanding the pathogenesis of IR and diabetes.

A pattern of NK cell heterogeneity in each individual determines proliferative and functional responses of NK cells to activating stimuli. Obtaining the progeny of a single cell by cloning original population is one of the ways to study the NK cell heterogeneity. In this work, we used single cell sorting into a plate and stimulation by IL-2 and gene-modified K562 feeder cells expressing membrane-bound IL-21 (K562-mbIL21) that led to generation of phenotypically confirmed and functionally active NK cell clones. We applied two models of clone cultivation, which differently affected their phenotype, lifespan and functional activity. The first model, which included weekly restimulation of clones with K562-mbIL21 and IL-2, resulted in the generation of relatively short-lived (5-7 weeks) clones of highly activated NK cells. HLA-DR expression in the expanded NK cells correlated strongly with IFN-γ production. The second model, in which NK cells were restimulated mainly with IL-2 alone, produced long-lived clones (8-14 weeks) that expanded up to 10⁷ cells with lower ability to produce IFN-γ. Our method is applicable for studying variability in phenotype, proliferative and functional activity of the certain NK cell progeny in response to the stimulation, which may help in selecting NK cells best suited for clinical use.

The peripheral lymphatic system plays a crucial role in the recovery mechanisms after many pathological changes, such as infection, trauma, vascular, or metabolic diseases. The lymphatic clearance of different tissues from waste products, viruses, bacteria and toxic proteins significantly contributes to the correspondent recovery processes. However, understanding of the meningeal lymphatics functions is a challenging problem. The exploration of mechanisms of lymphatic communication with brain fluids as well as the role of the lymphatic system in the brain drainage, clearance and recovery are still in its infancy. Here we review novel concepts on the anatomy and physiology of the lymphatics in the brain, which warrant a substantial revision of our knowledge about the role of lymphatics in the rehabilitation of the brain functions after neural pathologies. We discuss a new vision on how to recruit the meningeal lymphatics by the opening of blood-brain barrier as a trigger mechanism of activation of the meningeal lymphatic drainage. This leads to innovative strategies in neurorehabilitation therapy.

Production of energy is a main task of cancer cells metabolism, since costs of duplicating are enormous. Although energy is derived in cells by dismantling carbon to carbon bonds of any macronutrient, cancer nutritional needs for energetic purposes have been studied primarily as dependent on glycolysis. Since the end of the last century, awareness of dependence of cancer metabolism on amino acids not only for protein syntheses but also for matching energy needs has grown. The roles of specific amino acids, like glutamine, glycine and serine have been explored in different experimental conditions and reviewed. Moreover, there are epidemiological evidences that some amino acids used as supplement for therapeutic reasons (the branched chain ones) may reduce incidence of liver cancer, and some molecular mechanism has been proposed as functional to their protective action. On the contrary, metabolic signature of some pathology connected with increased risk of cancer, like prolonged hyperinsulinemia in insulin resistant patients, is signed by plasma elevated levels of the same branched chain amino acids, posing puzzling questions to clinicians. Most recently, peculiar formulations of amino acids, deeply different if compared to amino acids compositions normally present in foods, have shown the power to master epigenetics slowing growth or driving cancer cells to apoptotic death, while being even beneficial for normal cells and for animals health and life span. In this review, we will analyze and try to disentangle some of the many knots dealing with complexities of amino acids biology and linked to cancer metabolism.

Herpes simplex virus (HSV) infections can be treated with direct acting antivirals like acyclovir and foscarnet, but long-term use can lead to drug resistance, which motivates research into broadly-acting antivirals that can provide a greater genetic barrier to resistance. Photodynamic inactivation (PDI) employs a photosensitizer, light, and oxygen to create a local burst of reactive oxygen species that inactivate microorganisms. The botanical plant extract Orthoquin^TM is a powerful photosensitizer with antimicrobial properties. Here we report that Orthoquin also has antiviral properties. Photoactivated Orthoquin inhibited herpes simplex virus type 1 (HSV-1) and herpes simplex virus type 2 (HSV-2) infection of target cells in a dose-dependent manner, across a broad range of sub-cytotoxic concentrations. HSV inactivation required direct contact between Orthoquin and the inoculum, whereas pre-treatment of target cells had no effect. Orthoquin did not cause appreciable damage to viral capsids or pre-mature release of viral genomes as measured by qPCR for the HSV-1 genome. By contrast, immunoblotting for HSV-1 antigens in purified virion preparations suggested that higher doses of Orthoquin had a physical impact on certain HSV-1 proteins that altered protein mobility or antigen detection. Orthoquin PDI also inhibited the non-enveloped adenovirus (AdV) in a dose-dependent manner, whereas Orthoquin-mediated inhibition of the enveloped vesicular stomatitis virus (VSV) was light-independent. Together, these findings suggest that broad antiviral effects of Orthoquin-mediated PDI may stem from damage to viral attachment proteins.

An efficient, eco-compatible and very cheap method for the construction of triazoles via eliminative azide–olefin cycloaddition (EAOC) reaction has been developed by a catalytic system IL/FeCl3, offering an highly regioselective approach to structurally diverse 1,5-disubstituted 1,2,3-triazoles in up to 95% yield. This strategy features the reuse of catalytic system through simple operations. Mechanistic studies indicated that an asynchronous concerted dipolar cycloaddition-elimination process might be involved.

Metformin use in pregnancy is increasing worldwide as randomised controlled trial (RCT) evidence is emerging demonstrating its safety and efficacy. The Metformin in Gestational Diabetes (MiG) RCT changed practice in many countries demonstrating that metformin had similar pregnancy outcomes to insulin therapy with less maternal weight gain and a high degree of patient acceptability. A multicentre RCT is currently assessing the addition of metformin to insulin in pregnant women with type 2 diabetes. RCT evidence is also available for the use of metformin for women with Polycystic Ovarian Syndrome and for non-diabetic women with obesity. No evidence of an increase in congenital malformations or miscarriages has been observed even when metformin is started before pregnancy and continued to term. Body composition and metabolic outcomes at two, seven and nine years have now been reported for the offspring of mothers treated in the MiG study. In this review, we will briefly discuss the action of metformin and then consider the evidence from the key clinical trials.

Though melatonin is known to improve ultraviolet B (UVB)-induced oxidative damage and inflammatory conditions via blockade of nuclear factor (NF)-κB, interleukin (IL)-6, there is no report on anti-wrinkle effect of melatonin to date. Hence in the present study, anti-wrinkle mechanism of melatonin was elucidated in UVB treated HaCaT keratinocytes and hairless mice. Herein melatonin protected against a radical initiator tert-Butyl hydroperoxide (t-BOOH) induced reactive oxygen species (ROS) production, matrix metalloprotease 1 (MMP-1) and cytotoxicity in HaCaT keratinocytes. Also, melatonin suppressed the expression of sonic hedgehog (SHH) and GLI for hedgehog signaling, p-NF-kB, cyclooxygenase (COX-2), p-ERK for inflammatory responses in UVB treated HaCaT keratinocytes. Furthermore, melatonin protected skin from wrinkle formation, transdermal water loss in hairless mice irradiated by UVB for 8 weeks. Notably, melatonin prevented against epidermal thickness and dermal collagen degradation in UVB irradiated hairless mice by Hematoxylin & Eosin and Masson’s trichrome staining. Taken together, these findings suggest that melatonin reduces wrinkle formation via inhibition of ROS/SHH and inflammatory proteins such as NF-kB/COX-2/ERK/MMP1.

Shiga toxin (Stx) produced by Escherichia coli is the main pathogenic factor of diarrhea-associated hemolytic uremic syndrome (HUS), which is characterized by obstruction of renal microvasculature by platelet-fibrin thrombi. It is well known that the oxidative imbalance generated by Stx induces platelet activation, contributing to thrombus formation. Moreover, activated platelets release soluble CD40 ligand (sCD40L) which in turn contributes to oxidative imbalance, triggering the release of reactive oxidative species (ROS) on various cellular types. The aim of this work was to determine if the interaction between the oxidative response and platelet-derived sCD40L participates in the pathogenic mechanism during HUS. Activated human glomerular endothelial cells (HGEC) by Stx2 induced platelets to adhere to them. Although platelet adhesion did not contribute to endothelial damage, high levels of sCD40L were released to the medium. The release of sCD40L by activated platelets was inhibited by antioxidant treatment. Furthermore, we found increased levels of sCD40L in plasma from HUS patients, which were also able to trigger the respiratory burst in monocytes, in a sCD40L-dependent manner. Thus, we concluded that platelet-derived sCD40L and the oxidative response are reciprocally stimulated during Stx2-associated HUS. This process may contribute to the evolution of glomerular occlusion and the microangiopathic lesions.

Distribution systems can form islands when faults occur. Each island represents a subsection with variable boundaries subject to the location of a fault(s) in the system. A subsection with variable boundaries is referred to as island in this paper. For operation in autonomous mode, it is imperative to detect the island configurations and stabilize these subsections. This paper presents a novel scheme for the detection of islanding boundaries and stabilizing the system during autonomous operation. In the first stage, a boundary detection method is proposed to detect the configuration of the island. In the second stage a dynamic voltage sensitivity factor (DVSF) is proposed to assess the dynamic performance of the system. In the third stage, a wide area load shedding program is adopted based on DVSF to shed the load in weak busbars and stabilize the system. The proposed scheme is validated and tested on a generic 18-bus system using a combination of EMTDC/PSCAD and MATLAB softwares.

Traditional photodynamic therapy (PDT), a clinical cancer therapeutic approach using light in killing cancer cells, is often limited by insufficient light penetration, inefficient photosensitizer energy transfer, and inadequate oxygen in hypoxic tumors. Employing X-ray to activate photosensitizer in PDT can potentially overcome these limitations. Here, we compared protocols to synthesize a novel nano-photosensitizer composed of a europium-doped yttrium oxide core with a silica shell (Y₂O₃:Eu@SiO₂) which can be utilized in such therapeutic method, i.e., X-ray activated PDT (XPDT). Transmission electron microscopy (TEM) and dihydroethidium (DHE) were utilized to evaluate the effects of various synthesis conditions on the characteristics of Y₂O₃:Eu@SiO₂ and their ability to generate reactive oxygen species (ROS). The in vivo tumor suppression effects of the Y₂O₃:Eu@SiO₂ were assessed by ¹⁸F-fluorothymidine position emission tomography (¹⁸F-FLT PET) in human ovarian cancer xenografts using radiation sensitive CAOV3 and radiation resistant SKOV3 cell lines. Our data revealed a positive correlation between nanoparticle condensation time and core size as well as a negative correlation between urea concentrations and core size. Addition of cetyltrimethylammonium bromide (CTAB) during core synthesis enhanced particle dispersion. Two silica coating conditions showed the greatest efficiency in the enhancement of ROS generation. Furthermore, our in vivo study revealed suppression of tumor growth by Y₂O₃:Eu@SiO₂ administration when compared to non-treated control. Silica shell provides flexibility to conjugate moieties that specifically target to cancers. This nano-photosensitizer demonstrates the significant promise for overcoming limitations of conventional PDT and combating various cancers in clinical applications.

(1) Background: The COVID-19 pandemic had a devastating impact on the world, causing widespread illness and death. It is essential to focus on prevention strategies to limit the spread of the disease. Despite the advent of vaccines, maintaining a vigilant approach to prevention remains paramount. While vaccines are essential, they do not guarantee absolute immunity, and their protective effect may diminish over time; (2) Methods: We reviewed effective strategies to prevent COVID-19 transmission. We focused on me-ta-analyses (MA), literature reviews (LR) and the health care context. Various prevention measures and interventions were reviewed. Both es-tablished practices and unresolved issues were considered; (3) Results: Standard precautions (SP) as the cornerstone of infection control, with hand hygiene and mask use as key components. Debate about the relative importance of droplet versus aerosol transmission led to differences in recommendations between agencies at the onset of the pandemic. We have clarified the role of personal protective equipment (PPE), including eye protection. The effectiveness of masks in pre-venting transmission is reviewed. The use of surgical masks is recommended to prevent droplet transmission, while eye protection is recommended in combination with masks. Although data show some risk reduction, the clear superiority of N95/FFP2 over surgical masks remains unproven. In terms of room occupancy, ventilation is critical in reducing the risk of transmission in poorly ventilated environments. The use of negative pressure isolation rooms (NPIRs) is being investigated. The presence of viral RNA on surfaces does not necessarily indicate infectivity, and the risk of transmission by surface contact is low if surfaces are properly maintained and hand hygiene is practised regularly. Testing for SARS-CoV-2 in asymptomatic persons in healthcare settings may help prevent transmission; (4) Conclusions: Prevention of SARS-CoV-2 transmission requires a multifaceted approach, including reducing particle emissions from infected persons by wearing masks, eliminating aerosols by ventilation, ensuring physical separation, and protecting exposed persons with masks and eye protection.

Evidence-based medicine (EBM) is in crisis, in part due to bad methods, which are understood as misuse of statistics that is considered correct in itself. This article exposes two related common misconceptions in statistics, the effect size (ES) based on correlation (CBES) and a misconception of contingency tables (MCT). CBES is a fallacy based on misunderstanding of correlation and ES and confusion with 2 × 2 tables, which makes no distinction between gross crosstabs (GCTs) and contingency tables (CTs). This leads to misapplication of Pearson’s Phi, designed for CTs, to GCTs and confusion of the resulting gross Pearson Phi, or mean-square effect half-size, with the implied Pearson mean square contingency coefficient. Generalizing this binary fallacy to continuous data and the correlation in general (Pearson’s r) resulted in flawed equations directly expressing ES in terms of the correlation coefficient, which is impossible without including covariance, so these equations and the whole CBES concept are fundamentally wrong. MCT is a series of related misconceptions due to confusion with 2 × 2 tables and misapplication of related statistics. The misconceptions are threatening because most of the findings from contingency tables, including CBES-based meta-analyses, can be misleading. Problems arising from these fallacies are discussed and the necessary changes to the corpus of statistics are proposed resolving the problem of correlation and ES in paired binary data. Since exposing these fallacies casts doubt on the reliability of the statistical foundations of EBM in general, we urgently need to revise them.

Cornea severe inflammation produces opacity or even perforation, scarring, and angiogenesis, resulting in blindness. The cornea can be used to study the effect of new anti-angiogenic chemopreventive agents. We researched the anti-angiogenic effect of two extracts, Methanol (Met) and Hexane (Hex), from the seed of Cucurbita argyrosperma, in the inflamed corneas. The corneas of Wistar rats were alkali-injured and treated intragastrically for seven successive days. Clinical manifestation as opacity score, corneal neovascularization (CNV) area, re-epithelialization percentage, and histological evaluation were performed. Inflammatory (COX-2, NF-κB, and IL-1β), and angiogenic (VEGF-A, VEGFR1, VEGFR2) markers were assessed by immunohistochemistry. Cox-2, Il-1β, and Vegf-a mRNA levels were also determined. After treatments, we observed slim corneal thickness with lower opacity scores and low cell infiltration compared to untreated rats. Treatment also accelerated wound healing and decreased CNV area. The staining of inflammatory and angiogenic factors was significantly decreased. These effects are related to a down-expression of Cox-2, Il-1β, and Vegf. These results suggest that intake of C. argyrosperma seed can be used to attenuate the angiogenesis secondary to inflammation in corneal chemical damage.

Appropriate animal models of human diseases are a cornerstone in the advancement of science and medicine. To create animal models of neuropsychiatric and neurobehavioral diseases such as ASD necessitates the development of sufficient neurobehavioral measuring tools to translate human behavior to expected measurable behavioral features in animals. Indeed, at least in rodents, adequate neurobehavioral and neurological tests have been developed. Since ASD is characterized by a number of specific behavioral trends with significant severity, animal models of autistic-like behavior have to demonstrate the specific characteristic features, namely impaired social interactions, and communication, restricted, repetitive behavioral patterns with association to several additional impairments such as somatosensory, motor and memory impairments. Thus, an appropriate model must show behavioral impairment of a minimal number of neurobehavioral characteristics using an adequate number of behavioral tests. The proper animal models enable the study of ASD like-behavior from the etiologic, pathogenetic and therapeutic aspects. From the etiologic aspects, models have been developed by the use of immunogenic substances like polyinosinic-polycytidylic acid (PolyIC), Lipopolysaccharide (LPS) and propionic acid or other well-documented immunogens or pathogens, like mycobacterium tuberculosis. Another approach is the use of chemicals like valproic acid, Polychlorinated biphenyls (PCBs), organophosphate pesticides - chlorpyrifos (CPF) and others. These substances were administered either prenatally, generally after the period of major organogenesis, or, especially in rodents, during the early postnatal life. In addition, using modern genetic manipulation methods, genetic models have been created of almost all human genetic diseases that are manifested by autistic like behavior (i.e. fragile X, Rett syndrome, SHANK gene mutation Neuroligin genes and others). Ideally, we should not only evaluate the different behavioral modes affected by the ASD-like behavior but also assess the severity of the behavioral deviations by an appropriate scoring system, as applied to humans.

This study describes the synthesis and characterization of mixed hydrotalcite–organosilica membrane for gas separation. Hydrotalcite exhibits the capability to adsorb carbon dioxide at elevated temperatures. High surface area and favorable coating properties are essential to harness its potential for practical applications. Stable alcohol-based dispersions are needed for thin film applications of mixed membranes containing hydrotalcite. Currently, producing such dispersions without the need for delamination and dispersion agents is a challenging task. This work introduces for the first time a manufacturing approach to overcoming the drawbacks mentioned above. It includes a synthesis of hydrotalcite nanoparticles, followed by agent-free delamination of their layers and final dispersion into alcohol without dispersion agents. Further, the hydrotalcite-derived sorption agent is dispersed in a matrix based on organo-silica gels derived from 1,2-bis(triethoxysilyl)ethane (BTESE). The analytical results indicate that the interconnection between hydrotalcite and BTESE-derived gel occurs via forming a strong hydrogen bonding system between the interlayer species (OH groups, CO32-) of hydrotalcite and oxygen and silanol active gel centers. These findings lay the foundation for applications involving incorporating hydrotalcite-like compounds into silica matrices, ultimately enabling the development of materials with exceptional mass transfer properties. In part 2 of this study, gas separation performance of the organo-silica and the hydrotalcite-like materials and their combined form will be investigated

In late December 2019 a novel RNA beta-coronavirus was recognized as the causative agent of previously pneumonia cases of unknown origin. The virus was successively named Severe Acute Respiratory Syndrome CoronaVirus 2 (SARS-CoV-2) as well as the respiratory illness that it causes Coronavirus disease 19 (COVID-19) (1, 2). The global spread of SARS-CoV-2 and the thousands of deaths caused by COVID-19 led the World Health Organization (WHO) to declare a pandemic on 11 March 2020. To date, the world has paid a high toll in this pandemic in terms of human lives lost, economic repercussions and increased poverty. Indeed, even if most patients with COVID-19 are asymptomatic or experience mild self-limiting disease, 14% of them progress to severe disease and 5% to critical illness with complications, such as interstitial pneumonia, respiratory failure with acute respiratory distress syndrome (ARDS) and multiple organ dysfunction syndromes (MODS) (3). It is accepted that SARS-CoV-2 primarily affects the respiratory system, although other organs are also involved (4). The virus enters host cells by attaching its Spike like surface projections to the angiotensin-converting enzyme-2 (ACE2) receptor which is mainly expressed on alveolar epithelial cells and in nearly all human organs in varying degrees. Thus, although the central target of SARS-CoV-2 infection is the lung, the wide distribution of ACE2 receptors in other organs may lead to cardiovascular, gastrointestinal, kidney, liver, central nervous system and ocular damages that have to be closely monitored during the disease (5, 6). The virus then activates the innate and adaptive immune system resulting in a large number of cytokines release, known as “cytokine storm”, that is directly correlated with tissue injury and unfavourable prognosis of severe lung disease (7). In particular, interleukin (IL)-6 seems to plays an important role in driving this cytokine release so that its increased levels have been recognized as a hallmark inflammatory signature in sera of COVID-19 patients (8). IL-6 is a polyfunctional cytokine with both anti-inflammatory and pro-inflammatory properties which exerts its several functions through two main signal transduction pathways (9). In the classical signal transduction pathway, IL-6 binds to IL-6-trans membrane receptor (IL-6R) to form a complex that, then, binds to the trans membrane glycoprotein gp130, inducing its homo-dimerization and initiating intracellular signal transduction. This kind of signaling is limited to cells (hepatocytes, macrophages, neutrophils, T cells, etc.) that express IL-6R on their cell surface (10). Nevertheless, cells do not express IL- 6R, as stromal and epithelial cells, are able to still respond to IL-6 because the soluble form of the receptor (sIL-6R) binds to IL-6 in circle and then anchors to membrane gp130 receptor, initiating the trans-signaling pathway. For this reason, sIL-6R is able to increase the function of IL-6 and is considered the agonist form of its receptor. When the level of IL-6 increases, its effects are widely expressed because gp130 molecules are ubiquitous and, therefore, also present in cells without IL-6R in the membrane form. On the contrary, a soluble form of the glycoprotein 130 (sgp130) can complex with sIL-6R to prevent the sIL-6R from binding to the membrane-bound gp130. In this case sgp130 is able to decrease the function of IL-6 and is considered the antagonist form of IL-6 receptor system (11). Based on the central role of IL-6 in the inflammatory pathology of COVID-19 and the consistent association between elevated levels of the cytokine and severe disease outcomes found in the first phase of infection, we sought to analysis IL-6 and its soluble receptor complex behavior during the different waves of COVID-19 pandemic, in order to evaluate the possible differences which occur among them and to hypothesize if they might be used as prognostic markers of disease severity.

Formaldehyde (HCHO), an indoor volatile organic compound, is seriously harmful to human health. Therefore, green and effective decomposition of HCHO is essential. TiO₂ has been employed for the degradation of HCHO via photocatalytic generation of reactive oxygen species (ROS) (O^2-, ·OH), yet the low specific surface area of crystalline TiO₂ depressed the catalytic performance. Herein, we prepared TiO₂ aerogels with high specific surface area and high porosity by sol-gel method, and added PVA to introduce flexible molecular chains for pore size regulation. The photocatalytic performance test verifies that the pore size of TiO₂ aerogel is one of the important factors for HCHO decomposition. Notably, through the establishment of theoretical model and calculation, we validated that the efficiency of HCHO decomposition is related to the oxygen pressure in the pores of TiO₂ aerogel, and the oxygen pressure is inversely proportional to the pore size. Accordingly, the optimal pore size of TiO₂ aerogel for the photocatalytic HCHO decomposition is 2 nm~10 nm. This study provides a theoretical idea for TiO₂ aerogels in the decomposition reaction of HCHO, which is expected to inspire more breakthroughs in the study of TiO₂ aerogels for green chemistry.

We produced a recombinant eel luteinizing hormone (rec-eel LH) analog with high potency in Chinese hamster ovary DG44 (CHO DG44) cells. The eel LH mutant (LH-M), which had a linker comprising the equine chorionic gonadotropin (eCG) β-subunit carboxyl-terminal peptide (CTP) region (amino acids 115 to149), was inserted between the β-subunit and α-subunit of wild-type tethered eel LH (LH-wt). Monoclonal cells transfected with the eel LH-wt and eel LH-M plasmids were isolated from five and nine clones of CHO DG44 cells, respectively. The secreted quantities abruptly increased on day 3, with peak levels of 5,000–7,500 ng/mL on day 9. The molecular weight of eel LH-wt was 32–36 kDa while that of eel LH-M increased to approximately 38–44 kDa, indicating the detection of two bands. Treatment with peptide N-glycanase F decreased the molecular weight by approximately 8 kDa. The oligosaccharides at the eCG β-subunit O-linked glycosylation sites were appropriately modified post-translation. The EC50 value and maximal responsiveness of eel LH-M increased by approximately 2.90- and 1.29-fold, respectively, indicating that the mutant exhibited more potent biological activity than eel LH-wt. Phosphorylated extracellular regulated kinase (pERK1/2) activation resulted in a sharp peak 5 min after agonist treatment, with a rapid decrease thereafter. These results indicate that the new rec-eel LH analog which contains the eCG β-subunit CTP linker comprising O-linked glycosylation sites, had more potent activity than the wild-type in vitro. Taken together, this new eel LH analog can be produced in large quantities using a stable CHO DG44 cell system.

In this research, the primary goal was to investigate the relationship between strategic planning and organizational performance in Iraq's manufacturing context. The study's primary data sources were 360 manager respondents. The structured questionnaire was used to collect primary data from manufacturing firms located throughout Iraq. To analyze the result, the researcher used descriptive statistics, correlation, and multiple regression analysis. SPSS version 16 software was used to conduct data analysis. The result reveals that the process of strategic planning has a beneficial effect on financial performance. Environmental scanning has a statistically significant positive effect on a company's non-financial performance. Management participation and planning formality positively and statistically significantly affect a business's non-financial performance at the 10 percent level. The domain of strategy and technique has not impacted the company's non-financial performance.

This study aimed to produce single-chain recombinant eel follicle-stimulating hormone (rec-eel FSH) analogs with high activity in Chinese hamster ovary DG44 (CHO DG44) cells. We recently reported that an O-linked glycosylated carboxyl-terminal peptide (CTP) of the equine chorionic gonadotropin (eCG) β-subunit plays contributes on high activity and time-dependent secretion in mammalian cells. We constructed a mutant (FSH-M) in which a linker including the eCG β-subunit CTP region (amino acids 115 to149) was inserted between the β-subunit and α-subunit of wild-type single chain eel FSH (FSH-wt). Plasmids containing eel FSH-wt and eel FSH-M were transfected into CHO DG44 cells. Single cells expressing each protein were isolated from 10 and 7 clones, respectively. Secretion increased gradually during the cultivation period and peaked at 4,000–5,000 ng/mL on day 9. The molecular weight of eel FSH-wt was 34–40 kDa, while that of eel FSH-M increased substantially, with two bands at 39–46 kDa. Treatment with PNGase F to remove the N glycosylation sites decreased the molecular weight remarkably to approximately 8 kDa. The EC50 value and maximal responsiveness of eel FSH-M were approximately 1.23- and 1.06-fold higher than those of eel FSH-wt, indicating that the mutant showed slightly higher biological activity. Phosphorylated extracellular regulated kinase (pERK1/2) activation exhibited a sharp peak at 5 min, followed by a rapid decline. These findings indicate that the new rec-eel FSH molecule with the eCG β-subunit CTP linker showed potent activity and could be produced in massive quantities using the stable CHO DG44 cell system.

A two-year experiment was conducted with a local maize hybrid under full irrigation (F), deficit irrigation (D) and rainfed conditions (R) to estimate maize evapotranspiration in Bosnia and Herzegovina. Three approaches (Allen & Pereira (A&P), SIMDualKc (SD), and Vegetation Index (VI)) were used to estimate the actual crop coefficient (Kc act), actual basal crop coefficient (Kcb act), and actual crop evapotranspiration (ETc act) were applied with the dual crop coefficient method and remote sensing (RS) data. While Kcb act from all approaches matched FAO56 tabulated values, SD showed differences, in comparison to A&P, of up to 0.24 in D and R conditions, especially in initial and mid-season stages. VI demonstrated very good performance in all treatments. In F, the obtained Kc act for all approaches during the initial and end stages were higher than the tabulated values, ranging from 0.71-0.87 for Kc ini act and from 0.80-1.06 for Kc end act, while the mid-season period showed very good agreement with the literature. Maize crop evapotranspiration range is 769-813 mm, 480-752 mm, and 332-618 mm for F, D and R, respectively. The results confirmed the suitability of both approaches (SD and VI) to estimate maize crop evapotranspiration under F, with the VI approach demonstrating an advantage in calculating Kcb act, Kc act, and ETc act values under water stress conditions. The 67.6% increase in grain yields with irrigation emphasizes the need to transition from rainfed to irrigation-dependent agriculture, even for drought-resistant crops like maize.

: Climate change necessitates urgent actions to mitigate carbon dioxide (CO2) emissions from fossil fuel-based energy generation. Among various strategies, the deployment of carbon capture and storage (CCS) solutions are critical for reducing emissions from point sources such as power plants and heavy industries. In this context, cryogenic carbon capture (CCC) via desublimation has emerged as a promising technology. While CCC offers high separation efficiency, minimal downstream compression work, and integration potential with existing industrial processes, challenges such as low operating temperatures and equipment costs persist. Ongoing research aims to address these hurdles in order to optimize the desublimation processes for widespread implementation. This review consolidates diverse literature works, providing insights into the strengths and limitations of CCC technology, including the latest pilot plant scale demonstrations. The transformative potential of CCC is first assessed on a theoretical basis, such as thermodynamic aspects and mass transfer phenomena. Then, recent advancements in the proposed process configurations are critically assessed and compared through key performance indicators. Furthermore, future research directions for this technology are clearly highlighted.

Proteases represent common targets in combating infectious diseases including COVID-19. The 3-chymotrypsin-like protease (3CLpro) is a validated molecular target for COVID-19 and it is key for developing potent and selective inhibitors for inhibiting viral replication of SARS-CoV-2. In this review, we discuss structural relationships and diverse subsites of 3CLpro, shedding light on the pivotal role of dimerization and active site architecture in substrate recognition and catalysis. Our analysis of bioinformatics and other published studies unveil a proposal of a novel catalytic mechanism for the SARS-CoV-2 polyprotein cleavage by 3CLpro, centering on the triad mechanism involving His41-Cys145-Asp187 and its indispensable role in viral replication. Recognizing Asp187 as a crucial component in the catalytic process underscores its significance as a fundamental pharmacophoric element in drug design. Next, we provide an overview of both covalent and non-covalent inhibitors, elucidating advancements in drug development observed in preclinical and clinical trials. By highlighting various chemical classes and their pharmacokinetic profiles, our review aims to guide future research directions toward the development of highly selective inhibitors, underscore the significance of 3CLpro as a validated therapeutic target, and propel the progression of drug candidates through preclinical and clinical phases.

Long COVID, a name often given to the persistent symptoms following acute SARS-CoV-2 infection, poses a multifaceted challenge for health. This review explores the intrinsic relationship between comorbidities and autoimmune responses in shaping the trajectory of long COVID. Autoantibodies have emerged as significant players in COVID-19 pathophysiology, with implications for disease severity and progression. Studies show immune dysregulation persisting months after infection, marked by activated innate immune cells and high cytokine levels. The presence of autoantibodies against various autoantigens suggests their potential as comorbid factors in long COVID. Additionally, the formation of immune complexes may lead to severe disease progression, highlighting the urgency for early detection and intervention. Furthermore, long COVID is highly linked to cardiovascular complications and neurological symptoms, posing challenges in diagnosis and management. Multidisciplinary approaches, including vaccination, tailored rehabilitation, and pharmacological interventions, are used for mitigating long COVID's burden. However, numerous challenges persist, from evolving diagnostic criteria to addressing the psychosocial impact and predicting disease outcomes. Leveraging AI-based applications holds promise in enhancing patient management and improving our understanding of long COVID. As research continues to unfold, unravelling the complexities of long COVID remains paramount for effective intervention and patient care.

Despite Low Power Wide Area Networks’ ability to offer an extended range, it might still encounter challenges with coverage blind spots in the network. This article proposes an innovative energy-efficient nature-inspired relay selection algorithm for LoRa-based LPWAN networks, serving as a solution for challenges related to poor signal range in areas with limited coverage. A behavior swarm-inspired approach has been utilized to select the relays’ localization in the network, providing network energy efficiency and radio signal extension. These relays help bridge communication gaps, significantly reducing the impact of coverage blind spots by forwarding signals from devices with poor direct connectivity with the gateway. The proposed algorithm considers critical factors for the LoRa standard, such as the Spreading Factor or device energy budget analysis. The simulation experiments validate the proposed scheme’s effectiveness in terms of energy efficiency under diverse multi-gateway topology scenarios involving thousands of devices. Specifically, it has been verified that the proposed approach outperforms the reference method in preventing the battery depletion of relays, which is vital for battery-powered IoT devices. Furthermore, for some large-scale problems, the proposed heuristic method achieves over twice the speed of the exact method with a negligible accuracy loss of less than 2%.

During the last two decades several cases of venous thrombosis (VTE) after a prolonged period at a computer has been described, denominated “eThrombosis”. Video gaming on a computer has become very popular and can be a social activity where several players are gathered to play against each other or in a virtual environment for several days (“LAN (i.e., Local Area Network) parties”) where the participants are sedentary and consuming calorie-rich food items. The aim of this study was to investigate a potential coagulation activation during a 42 hour LAN party. Nine male gamers volunteered for the LAN party. Citrated blood was sampled before and every 6 hours, and plasma was analyzed for thrombin generation, and Thrombin-antithrombin-complexes (TAT), prothrombin Fragment 1+2 (F1+2), and D-dimer. Thrombin generation increased slightly but not significantly during the LAN party, whereas the coagulation activation markers were unchanged. These results do not indicate that the coagulation system is activated significantly during 42 h gaming with minimal physical activity. Although an increased activity cannot be excluded, it does not directly indicate a risk of VTE in general. It may be specific and particularly susceptible in-dividuals who are prone to thrombosis and, therefore, are at risk of developing e-thrombosis.

Background: The monocyte-phagocyte system (MPS), including monocytes/macrophages and dendritic cells (DCs), plays a key role in anti-viral immunity. We aimed to analyze the prognostic value of the MPS components on in-hospital mortality in a cohort of 58 patients (M/F ; mean ageSD years) with COVID-19 pneumonia and 22 age- and sex-matched healthy controls. Methods: We measured frequencies and absolute numbers of peripheral blood CD169+ monocytes, conventional CD1c+ and CD141+ (namely cDC2 and cDC1), and plasmacytoid CD303+ DCs by means of multi-parametric flow cytometry. A gene profile analysis of 770 immune-inflammatory related human genes and 20 SARS-CoV-2 genes was also performed. Results: Median frequencies and absolute counts of CD169-expressing monocytes were significantly higher in COVID-19 patients than in controls (p 0.04 and p 0.01, respectively). Conversely, percentages and absolute numbers of all DC subsets were markedly depleted in patients (p

Despite widespread vaccination, early treatments, and improved understanding of the disease, the effects of SARS-CoV-2 infection remain significant worldwide. Many patients still suffer from severe COVID-19, necessitating admission to intensive care units. Remdesivir is a primary treatment option among viral RNA polymerase inhibitors for hospitalized SARS-CoV-2 patients. However, there is a lack of studies examining factors influencing its effectiveness in this context. We conducted a retrospective study throughout 2022, analyzing clinical, laboratory, and sociodemographic data from 252 hospitalized COVID-19 patients treated with remdesivir. Six machine learning algorithms were compared and validated to predict factors associated with the loss of clinical benefit from remdesivir in terms of mortality and hospital stay. Data were extracted from electronic health records. The eXtreme Gradient Boost (XGB) method achieved the highest balanced accuracy for both mortality (95.45%) and hospital stay (94.24%). Factors associated with worse outcomes of remdesivir use in terms of mortality included limitation of life support treatment, need for ventilatory support (especially invasive mechanical ventilation) on day 14 after the first dose of remdesivir, lymphopenia, low levels of albumin and hemoglobin, presence of flu and/or coinfection, and cough. Factors associated with worse outcomes of remdesivir use in terms of hospital stay included the number of doses of the COVID-19 vaccine, patchy lung density, bilateral pulmonary radiological status, number of comorbidities, oxygen therapy, troponin and lactate dehydrogenase levels, and asthenia. These findings highlight the effectiveness of XGB as a strong candidate for accurately categorizing COVID-19 patients undergoing remdesivir treatment.

Nanocomposites of TiO₂ Degussa P25 nanoparticles/activated carbon (TiO₂/AC ) were prepared at various mass ratios of (4:1), (3:2), (2:3), and (1:4) by a facile process. The effects of TiO₂/AC mass ratios on the structural, morphological, and photocatalytic properties were systematically studied in comparison with bare TiO₂ and bare AC. TiO₂ nanoparticles exhibited dominant anatase and minor rutile phases, and a crystallite size of approximately 21 nm; while AC had XRD peaks of graphite and carbon, and a crystallite size of 49 nm. The composites exhibited tight decoration of TiO₂ nanoparticles on micron-/submicron AC particles, and uniform TiO₂/AC composites were obtained as evidenced by the uniform distribution of Ti, O, and C in an EDS mapping. Moreover, Raman spectra show the typical vibration modes of anatase TiO₂ (e.g., E_1g⁽¹⁾, B_1g⁽¹⁾, E_g⁽³⁾) and carbon materials with D and G bands. The TiO₂/AC with (4:1), (3:2), and (2:3) possessed higher reaction rate constants (k) in photocatalytic degradation of methylene blue (MB) than that of either TiO₂ or AC. Among the investigated materials, TiO₂/AC = 4:1 achieved the highest photocatalytic activity with a high k of 55.2×10^-3 min^-1 and an MB removal efficiency of 96.6% after 30 min treatment under UV-Vis irradiation (120 mW/cm²). The enhanced photocatalytic activity for TiO₂/AC is due to the synergistic effect of the high adsorption capability of AC and the high photocatalytic activity of TiO₂. Furthermore, TiO₂/AC promotes the separation of photoexcited electron/hole (e^-/h⁺) pairs to reduce their recombination rate and thus enhance photocatalytic activity. The optimal TiO₂/AC composite in this study can be used for treating industrial or household wastewater with organic pollutants.

This report provides a comprehensive overview of occupational asthma and respiratory hypersensitivity, focusing on some chemicals used in the workplace Includes numerous case studies and research papers related to occupational exposure methacrylates, such as HEMA-HPMA, and respiratory hypersensitivity are discussed And the relationship is explored The book also examines asthma pathophysiology, emerging drug delivery systems used to treat asthma, and the potential of nanoparticles , dendrimers and micellar systems have to improve pulmonary drug delivery in detail The worldwide prevalence of asthma is highlighted, with higher rates in high-GDP countries. The book highlights the need to improve asthma diagnosis, treatment and biomarkers, particularly in rural and low-income countries where the disease is often underdiagnosed and inadequately treated, and discusses the role of inflammation in asthma, in particular secondary inflammation characterized by specific cytokines and inflammation cells In addition, the paper explores various drug delivery methods, such as parenteral and parenteral drugs, pressurized inhalers (pMDIs), dry powder inhalers ( DPIs), nebulizers, nanoparticles, liposomes, micellar systems, microparticles , dendrimers, and gene therapy . These systems aim to increase pulmonary delivery of drugs and improve clinical outcomes. The potential of dendrimer bilirubin-based nanoparticles and micellar systems in the treatment of asthma and lung inflammatory diseases, including asthma, has been discussed in summary, this paper provides an overview of occupational asthma and respiratory hypersensitivity, and this discussion highlights the association between methacrylate exposure and respiratory hypersensitivity.

To accurately and non-destructively monitor the growth of spring wheat in the Hetao Irrigation Area, UAV remote sensing was employed during various fertility stages. Digital image indices from diverse fertilization treatments were calculated and compared with physiological indices to identify the most sensitive digital image indices corresponding to these indices. The study underscored the critical importance of the flowering stage in the growth of spring wheat, thus highlighting the necessity of focusing on this stage. This finding reiterated that the flowering stage was pivotal for spring wheat development in the Hetao Irrigation Area. Several digital image indices, such as GLA, R, G, INT, g, GRVI, MGRVI, RGBVI, EXG, and GRRI, exhibited a high frequency of significant correlations with physiological indices during the four primary reproductive stages of wheat. Consequently, these sensitive digital image indices during the flowering stage can more effectively characterize the physiological indices of spring wheat.

Type II pneumocytes are the target of SARS-CoV-2 which alters their redox homeostasis to increase reactive oxygen species (ROS). Melatonin (MT) has antioxidant proprieties and protects mitochondrial function. Here we evaluated whether the treatment with MT compensated for the redox homeostasis alteration in serum from COVID-19 patients. We determined oxidative stress (OS) markers such as carbonyls, glutathione (GSH), total antioxidant capacity (TAC), thiols, nitrites (NO2–), lipid peroxidation (LPO), and thiols groups in serum. We also studied the enzymatic activities of glutathione peroxidase (GPx), -S-transferase (GST), reductase (GR), thioredoxin reductase (TrxR), extracellular superoxide dismutase (ecSOD) and peroxidases. There was a significant increase in LPO and carbonyls (p≤0.03) and a decrease in TAC, NO2–, thiols, GSH, (p&lt;0.001) in COVID-19 patients. The activities of the ecSOD, TrxR, GPx, GST, GR and peroxidases were decreased (p≤ 0.04). The treatment with MT favored the activity of the antioxidant enzymes which contributed to increase TAC and restored the lost redox homeostasis. MT also modulated glucose homeostasis functioning as a glycolytic agent and inhibited the Warburg effect. Thus, MT restores the redox homeostasis which is altered in COVID-19 patients and can be used as adjuvant therapy in the SARS-CoV-2 infection.

Nowadays, it is highly desired to develop highly active and humidity resistive ozone decomposition catalyst to eliminate the ozone contaminant, one of the primary pollutants in air. In this work, a series of Cu2S hollow structured materials are rapidly synthesized using different structured Cu2O templates. The Cu2S from porous Cu2O shows the highest ozone catalytic decomposition efficiency of >95% to 400 ppm ozone with a weight hourly space velocity of 480,000 cm3g-1h-1 in dry air. Importantly, the conversion still keeps >85% in a high relative humidity of 90%. The mechanism is explored by diffusive reflectance infrared spectroscopy which shows the decomposition intermediate of O22-, and the X-ray photoelectron spectroscopy reveals the dual active site of both Cu and S. All these results show the effective decomposition of ozone by Cu2S especially in harsh environments, promising for active ozone elimination.

Tamm Plasmon Polariton (TPP) is a nanophotonic phenomenon that has attracted much attention due to its spatial strong field confinement, ease of mode excitation and polarization independence. TPP has applications in sensing, storage, lasing, perfect absorber, solar cell, nonlinear optics, and many others. In this work, we demonstrate a biosensing platform based on TPP resonant mode. Both theoretical analyses based on Transfer Matrix Method and experimental validation through nonspecific detection of liquids of different refractive indices and specific detection of SARS-CoV-2 nucleocapsid protein (N-protein) are presented. Results show that TPP biosensor has high sensitivity and good specificity. For N-protein detection, the sensitivity is 1.5 nm/(µg/ml) and the limit of detection can reach down to below 7 ng/ml with spectrometer of 0.01 nm resolution of wavelength shift. This work paves the way for design, optimization, fabrication, characterization, and performance analysis of TPP based biosensors

Cognitive reserve is the adaptability of cognitive processes in the face of brain aging and pathology. This study aimed to validate the Arabic version of the Cognitive Reserve Index Questionnaire (CRIq) in a healthy Lebanese sample. CRIq assesses cognitive reserve through three domains: education, working activity, and leisure time. Statistical measures, including descriptive and regression analysis along with structural equation modeling, were utilized to investigate the convergent and discriminant validity of CRIq, incorporating fluid intelligence (Gf) and measures of cognitive function, long-term memory encoding and retrieval (Glr), and processing speed (Gs). Results from 174 participants revealed that the activities assessed by CRIq-Arabic were comparable to the original CRIq study, with slight cultural differences. The internal consistency of CRIq-Arabic was good (Cronbach's α = 0.88), indicating reliability. Convergent validity was confirmed, with moderate to high loadings on the cognitive reserve latent construct. Discriminant validity was supported as correlations between cognitive reserve variables and non-target constructs (Gf, Glr, Gs) were less than 1. The findings provide an initial psychometric validation of the CRIq-Arabic. Further research in clinical samples is needed to enhance its utility in neuropsychological practice.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

D-Glucaric acid is an important bio-based building block of polymers and is a high value-added chemical that can be used in a variety of applications. In the present study, the Udh target genes from Pseudomonas putida and Pseudomonas syringae were used together to construct the expression vector pETDuet-2×Udh. The transformants of BL21(DE3) with vector pETDuet-2×Udh was applied to produce glucaric acid from glucuronic acid. After optimization of induction conditions, the highest Udh expression were achieved when 0.4 mmol L-1 isopropyl-β-d–thiogalactoside (IPTG) was added to cell cultures at an OD600 value of 0.6 followed by culture at 26℃ for 6 hours. The production of glucaric acid substantially reached 5.24 ± 0.015 g L-1 in fed-batch cultures in a 30 L tank. In the present study, a new system for glucaric acid production was established, which was more economic and friendly to environment.

The COVID-19 pandemic has raised questions about indirect impact in pregnant women on the development of their future children. Investigating the characteristics of lipid metabolism in the "mother-placenta-fetus" system can give information about the pathophysiology of COVID-19 infection during pregnancy. 234 women were included in study. Maternal plasma, cord blood, amniotic fluid lipidome were analyzed using HPLC-MS/MS. Differences in lipid profile were searched by Manna-Whitney and Kruskall-Wallis test, diagnostic model based on logistic regres-sion were bilt by AIC. Elevation levels of lysophospholipids, triglycerides, sphingomyelins, and oxidized lipids was registered in patients’ after COVID-19 maternal and cord plasma. An increase in maternal plasma sphingomyelins and oxidized lipids was observed in cases of infection during the second trimester. In amniotic fluid, compared to the control group, nine lipids are reduced, six lipids are elevated. Levels of phosphoglycerides, lysophosphoglycerides, and phosphatidylinosi-tols decreased during infection in the second and third trimesters of pregnancy. Newborn’s health diagnostic model based on maternal plasma were developed for each group and exhibit good di-agnostic value (AUC> 0.85). Maternal and cord plasma’s lipidome changes during delivery, asso-ciated with Covid-19 infection during pregnancy, are synergistic. The most significant disturbances occur with infections in the second trimester of pregnancy.