In this work we present a versatile, rapid, and low-cost manufacturing technique to develop bioceramic scaffolds that could enhance bone tissue regeneration via microwave preparation using a commercial microwave oven. The scaffolds were prepared combining hydroxyapatite and water glass (sodium trisilicate solution), foamed by using a microwaves oven and then characterized by means of SEM-EDS, mechanical properties, infrared spectroscopy (ATR-FTIR), density and stability test in water. Furthermore, in vitro tests were performed to verify the affinity of osteoclast cells versus the so prepared scaffold. The morphology of the samples showed interconnected pores suitable for promoting tissue regeneration and vascularization while specific mechanical properties were preserved. The physicochemical characterization and the in vitro tests presented promising results for bone regenerative applications.

The increased cultivation of Cannabis sativa L. in North America, represented by high Δ9-tetrahydrocannabinol-containing (high-THC) cannabis genotypes and low THC-containing hemp genotypes, has been impacted by an increasing number of plant pathogens. These include fungi which destroy roots, stems and leaves, in some cases causing a build-up of populations and mycotoxins in the inflorescences that can negatively impact quality. Viroids and viruses have also increased in prevalence and severity and can reduce plant growth and product quality. Rapid diagnosis of the occurrence and spread of these pathogens is critical. Techniques in the area of molecular diagnostics have been applied to study these pathogens in both cannabis and hemp. These include polymerase chain reaction (PCR)-based technologies, including RT-PCR, multiplex RT-PCR, RT-qPCR, and ddPCR, as well as whole genome sequencing (NGS) and bioinformatics. In this study, examples of how these technologies have enhanced the rapidity and sensitivity of pathogen diagnosis on cannabis and hemp will be illustrated. These molecular tools have also enabled studies on the diversity and origins of specific pathogens, specifically viruses and viroids, and these will be illustrated. Comparative studies on the genomics and metabolomics of healthy and diseased plants are urgently needed to provide insight into their impact on quality and composition of cannabis and hemp-derived products. Management of these pathogens will require monitoring of their spread and survival using the appropriate technologies to allow accurate detection, followed by appropriate implementation of disease control measures.

Abstract: This article explores the intricate relationship between environmental degradation, specifically air pollution, and economic growth in the Sultanate of Oman spanning the period from 1990 to 2022. We employ cointegration and vector error correction models to uncover both short- and long-term dynamics in the association between air pollution and economic growth. Fur-thermore, Granger causality analysis is utilized to investigate the causal links between these crucial variables. This data encompasses factors related to environmental quality and various control variables. The empirical results unveil a sustained long-term cointegration connection between the variables. Additionally, our findings highlight a statistically significant positive impact of economic growth and energy consumption on CO2 emissions. Furthermore, the short-term analysis reveals an annual adjustment of approximately 14.1% in N2O emissions dis-equilibrium. The Granger causality study indicates unidirectional causal relationships involving N2O emissions, economic growth, and CO2 emissions. The implications of these findings for Oman's policy landscape are substantial. To effectively reduce greenhouse gas emissions, it is imperative for Oman to establish robust climate change policies. Additionally, the government can play a pivotal role in encouraging and endorsing the use of renewable energy sources, such as green hydrogen, as a promising alternative to traditional oil and gas resources.

(Background) Phytotoxicity refers to the capacity of chemical substances or environmental factors to have a negative impact on plants. This is a crucial issue in both the context of crop cultivation and environmental protection. (Material and Methods) The research results were based on a 3-year field experiment conducted at the experimental station in Jadwisin (52°28′ N, 21°02′ E) on loamy soil. The experiment was set up using a randomized sub-block design in a split-split-plot arrangement, with three replications. The first-order factor consisted of potato cultivars, while the second-order factors were weed control methods: 1) Control – without protection; 2) mechanical weed control, extensive mechanical treatments to close rows; 3) Sencor 70 WG – pre-emergence (PRE) of potatoes; 4) Sencor 70 WG + Titus 25 WG + Trend 90 EC – PRE of potatoes; 5) Sencor 70 WG – post-emergence (POST) of potatoes; 6) Sencor 70 WG + Titus 25 WG + Trend 90 EC – POST of potatoes; 7) Sencor 70 WG + Fusilade Forte 150 EC – POST of potatoes; 8) Sencor 70 WG + Apyros 75 WG + Atpolan 80 SC – POST of potatoes. The phytotoxic effects of herbicides on potato plants and weeds were assessed every 7 days, starting from the date when the first signs of damage appeared, until they stabilized or disappeared. (Results:) Phytotoxic damage to potato and weed plants were caused by the chemical weed control methods used. The response of potato plants to herbicides was significantly related to the genetic traits of the cultivars and meteorological conditions in the years of research. (Conclusion:) Phytotoxicity is an important aspect in both agriculture and environmental protection. Research on its mechanisms and impact will enable the development of effective plant protection strategies and the preservation of ecosystem balance.

The ribosome is a macromolecular complex composed of RNA and proteins that interact through an integrated and interconnected network to preserve its ancient core activities. In this review, we emphasize the pivotal role played by RNA-binding proteins as a driving force in the evolution of the current form of the ribosome, underscoring their importance in ensuring accurate protein synthesis. This category of proteins includes both ribosomal proteins and ribosome biogenesis factors. Impairment of their RNA-binding activity can also lead to ribosomopathies, a group of disorders characterized by defects in ribosome biogenesis that are detrimental to protein synthesis and cellular homeostasis. A comprehensive understanding of these intricate processes is essential for elucidating the mechanisms underlying the resulting diseases and advancing potential therapeutic interventions.

Ornamental kale (Brassica oleracea var. acephala) is an attractive ornamental plant with a range of leaf colors and shapes. Breeding new varieties of ornamental kale has proven challenging due to its lengthy breeding cycle and the limited availability of genetic markers. Microspore culture is an effective approach to generate new materials and genetic maps are a prerequisite for quantitative trait loci analysis, MAS, fine gene mapping, and genome sequence assembly. In this study, a F1DH ornamental kale population comprising 300 DH lines was constructed using microspore culture. A high-density genetic map was developed by conducting whole-genome sequencing on 150 individuals from the F1DH population. The genetic map contained 1,696 bin-markers with 982,642 single-nucleotide polymorphisms (SNPs) spanning a total distance of 775.81 cM on all nine chromosomes with an average distance between markers of 0.46 cM. The ornamental kale genetic map contained substantially more SNP markers compared with published genetic maps for other B. oleracea crops. The F1DH progenies provide an excellent resource for germplasm innovation and breeding new varieties of ornamental kale. The high-density genetic map provides crucial insights for gene mapping and unraveling the molecular mechanisms behind important agronomic traits in ornamental kale.

The large quantity of information retrieved from communities, public data repositories, web pages, or data mining can be sparsed and poorly classified. This work shows how to employ unsupervised classification algorithms such as K-means proper to classify user reviews into their closest category, forming a balanced data set. Moreover, we found that the text vectorization technique significantly impacts the clustering formation, comparing TF-IDF and Word2Vec. The value for mapping a cluster with movie genre was 81.34% ± 20.48 of the cases when the TF-IDF was applied, whereas Word2Vec only yielded a 53.51% ± 24.1. In addition, we highlight the impact of the removal of stop-words. Thus, we detected that pre-compiled lists are not the best method to remove stop-words before clustering because there is much ambiguity, centroids are poorly separated, and only 57% of clusters could match a movie genre. Thus, our proposed approach achieved a 94% of accuracy. After analyzing the classifiers’ results, we appreciated a similar effect when divided by the stop-words method removal. Statistically significant changes were observed, especially in precision metric and Jaccard scores in both classifiers, using custom-generated stop lists rather than pre-compiled ones. Reclassifying sparse data is strongly recommended as using custom-generated stop lists.

Enteric viruses are the major cause of gastroenteritis and enteric hepatitis worldwide, but in some areas like Saudi Arabia little data is known about their presence in water sources. The available information from clinical samples is not enough to figure their actual prevalence. The aim of this study was to gather information for the first time in Saudi Arabia on the presence of Norovirus (NoV) genogroup GI and GII, hepatitis A virus (HAV) and hepatitis E virus (HEV) in water. For this purpose, thirteen monthly samples were collected in lake Wadi Hanifa and surrounding wells from December 2014 to November 2015. Viruses were detected and quantified by Real-time RT-qPCR. Despite HEV findings were anecdotic, our results highlight interesting behaviors of the other viruses. There was a higher prevalence of noroviruses in Wadi Hanifa samples than in well water samples (46.43% vs12.5% of NoV GI; 66.67% vs8.33% of NoV GII). On the contrary, similar levels of HAV positivity were observed (40.48% in surface water vs 43.06% in well water). Also, a strong influence of flooding events on HAV and NoV GI occurrence was observed in both surface and well water samples, being NoV GII apparently not affected.

Background: Influenza vaccine is a tool for preventing infection and reducing exacerbations in patients with asthma and chronic obstructive pulmonary disease (COPD). Purpose of this study is to investigate dynamics of CRP and serum cytokines (IL-2, IL-6, IL-10, IL-17) in patients with asthma and COPD, as well as to perform a correlation analysis with the clinical parameters of the disease manifestation. Methods: The study included 34 patients with asthma, 20 patients with COPD vaccinated against influenza during a period of remission from 2 to 4 weeks, both groups being under a basic maintenance therapy, and 26 healthy individuals vaccinated with the trivalent polymer-subunit vaccine Grippol® Plus, containing 5 µg of influenza virus strains and 500 µg of azoximer bromide. Results: Observing patients with asthma and COPD, during a year after the vaccination, has revealed a significant reduction in exacerbations frequency (p < 0.05) and duration (p < 0.05) of the bronchial obstructive syndrome (BF). Before the vaccination the IL-6 level in patients with asthma had a direct moderate correlation with duration of exacerbations of the underlying disease (p < 0.05), along with the number of systemic corticosteroids courses during exacerbations (p < 0.05). In 12 months after the vaccination, while assessing cytokine profile of all study groups, a significant reduction in the level of IL-6 was observed, compared to the baseline values (p< 0.05). Conclusion: Conducted analysis of immunological, clinical, and functional parameters of patients with asthma and COPD has proven for influenza vaccine to be effective in BF patients.

Although the effect of thermal modification (TM) on teak wood color is well documented, a few studies were carried out in closed system processes, as well as it remains unclear the effect of different processes on the same material. This work aimed to verify the effect of closed and open system processes of TM on the color of fast-growing teak wood. Thermally modified wood was evaluated in a closed system at 160 °C (CS160) and in an open system at 185 °C and 210 °C (OS185 and OS210). We measured the moisture content (initial and final) of wood, and the corrected mass loss (CML). The chemical analyses encompassed the contents of alpha-cellulose, hemicelluloses, lignin, and extractives (total, in acetone and dichloromethane). Wood color was measured before and after TM according to the CIEL*a*b* color space. It was possible to achieve the same color using different processes of thermal modification (CS160 and OS210). TM reduced wood lightness (L*), red-green chromaticity coordinate (a*), and yellow-blue chromaticity coordinate (b*). L* and a* had the bigger and lower variations, respectively. The color of thermally modified wood was significantly changed, even at the mildest condition tested (OS185, 0.33% CML).

In this study, we considered the structural stability, electronic properties, and phonon dispersion of the cubic (c-ZrO₂), tetragonal (t-ZrO₂), and monoclinic (m-ZrO₂) phases of ZrO₂. We found that the monoclinic phase of zirconium dioxide is the most stable among the three phases in terms of total energy, lowest enthalpy, highest entropy, and other thermodynamic properties. The smallest negative modes were found for m-ZrO₂. Our analysis of the electronic properties showed that during the m–t phase transformation of ZrO₂, the Fermi level first shifts by 0.125 eV toward higher energies and then decreases by 0.08 eV in the t–c cross-section. The band gaps for c-ZrO₂, t-ZrO₂, and m-ZrO₂ are 5.140 eV, 5.898 eV, and 5.288 eV, respectively. Calculations based on the analysis of the influence of doping 3.23, 6.67, 10.35, and 16.15 mol. %Y₂O₃ onto the m-ZrO₂ structure showed that the enthalpy of m-YSZ decreases linearly, which accompanies further stabilization of monoclinic ZrO₂ and an increase in its defectiveness. A doping-induced and concentration-dependent phase transition in ZrO₂ under the influence of Y₂O₃ was discovered, due to which the position of the Fermi level changes and the energy gap decreases. It has been established that, not only for pure systems but including those doped with Y₂O₃, the main contribution to the formation of the conduction band is made by the p-states of electrons. The t-ZrO₂ (101) and t-YSZ (101) surface models were selected as optimal surfaces for water adsorption based on a comparison of their surface energies. An analysis of the mechanism of water adsorption on the surface of t-ZrO₂ (101) and t-YSZ (101) showed that H₂O on unstabilized t-ZrO₂ (101) is adsorbed dissociatively with an energy of -1.22 eV, as well as by the method of molecular chemisorption with an energy of - 0.69 eV and the formation of a hydrogen bond with a bond length of 1.01 Å. In the case of t-YSZ (101), water is molecularly adsorbed onto the surface with an energy of -1.84 eV. Dissociative adsorption of water occurs at an energy of -1.23 eV, near the yttrium atom. The results show that ab initio approaches are able to describe the mechanism of doping-induced phase transitions in (ZrO₂+Y₂O₃)-like systems, based on which it can be assumed that DFT calculations can also flawlessly evaluate other physical and chemical properties of YSZ, which have not yet been studied quantum chemical research. The obtained results complement the database of research works carried out in the field of the application of biocompatible zirconium dioxide crystals and ceramics in green energy generation and can be used in designing humidity-to-electricity converters and creating solid oxide fuel cells based on ZrO₂.

PDMS samples may be used in various microfluidic applications by hydrophilizing their surfaces. This study examines the effects of air plasma jet (APJ) and dielectric barrier discharge (DBD) plasma on the surface hydrophilicity of polydimethylsiloxane. In order to increase the hydrophilicity of PDMS sample surfaces, two plasma sources including APJ and DBD were compared. Both DBD and APJ setups were measured for voltage and current, and their respective power was calculated and compared based on their characteristics. It is important to note that the electrical specifications of APJ and DBD were identical, and the source power rates for APJ and DBD plasma were 306W and 300W respectively. UV-vis spectroscopy was used to characterize the plasma, and an electrical characterization of the plasma's power supply was carried out. The effects of parameters such as the distance from the nozzle tip, the duration of the process, and the source voltage on the hydrophilicity of the surfaces during the treatment by APJ were also examined, and samples were then examined for a period of time to determine whether surface hydrophilicity was preserved. On the PDMS surface, a contact angle of about 5.1° was observed using short-term plasma treatments of 10 seconds. In the same conditions, the effect of DBD treatment was superior to that of APJ treatment.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The availability of multiple sequenced genomes from a single species made it possible to explore intra- and inter-specific genomic comparisons at higher resolution and build clade-specific pangenomes of several crops. The pan-genomes of crops constructed from various cultivars/accessions, landraces, and wild ancestral species represent a compendium of genes and structural variations and allow researchers to search for the novel genes and alleles that were inadvertently lost in domesticated crops during the historical process of crop domestication or in the process of extensive plant breeding. Fortunately, many valuable genes and alleles associated with desirable traits like disease resistance, abiotic stress tolerance, plant architecture, and nutrition qualities exist in landraces, ancestral species, and crop wild relatives. The novels genes from the wild ancestors and landraces can be introduced back to high-yielding varieties of modern crops by implementing classical plant breeding, genomic selection, and transgenic/gene editing approaches. Thus, pan-genomic represents a great leap in plant research and offers new avenues for targeted breeding for mitigating the impact of global climate change. Here we summarize the tools used for pangenome assembly and annotations, web-portals hosting plant pangenomes. Furthermore, we highlight a few discoveries made in crops using the pan-genomic approach and its future potential.

The outbreak of the COVID-19 pandemic has raised concerns about potential environmental factors that could influence the spread and severity of the SARS-CoV-2 virus. Atmospheric pollution, particularly particulate matter (PM), has been suggested as a contributing factor to viral infections and respiratory complications. This two-year observational study aimed to investigate the relation between air pollution and the spread of COVID-19, focusing on PM2.5. Unlike previous studies limited to specific cities or countries, inevitable to use temporal data. Our research analyzed data from various states across the United States, considering both spatial and temporal correlation. The analysis considered the number and geographic distribution of COVID-19 cases along with daily PM2.5 exposure levels, accounting for monthly average PM2.5 exposure, from March 2020 to December 2021. The observed conflicting results of the temporal and spatial correlation present challenges for researchers in understanding the true nature of the relationship between PM2.5 air pollution and COVID-19 cases. The correlation between various factors, such as population density, PM2.5, temperature, and wind speed, and COVID-19 refers to an association or statistical relationship, not causation. Moreover, the intricate interplay of these variables makes it difficult to establish a clear cause-and-effect relationship.

An increase in Spodoptera species was reported in Bt soybean fields expressing Cry1Ac insecticidal proteins in Brazil, requiring additional management with chemical insecticides. Here, we evaluated the dose effects of flubendiamide and thiodicarb on Spodoptera cosmioides (Walker, 1858), Spodoptera eridania (Stoll, 1782), Spodoptera albula (Walker, 1857) and Spodoptera frugiperda (J. E. Smith, 1797) (Lepidoptera: Noctuidae) that survived on MON 87751 × MON 87708 × MON 87701 × MON 89788, expressing Cry1A.105, Cry2Ab2 and Cry1Ac; MON 87701 × MON 89788 soybean, expressing Cry1Ac; and non-Bt soybean. On unsprayed Cry1A.105/Cry2Ab2/Cry1Ac soybean, only S. frugiperda showed ~60% mortality after 10 d, whereas S. cosmioides, S. eridania and S. albula showed >81% mortality. Surviving larvae of all species on this Bt soybean showed &gt;80% mortality when exposed to the field label dose of flubendiamide (70 mL/ha) or thiodicarb (400 g/ha) or at 50% of these doses. In contrast, all four species had <25% and <19% mortality on Cry1Ac and non-Bt soybean, respectively. Surviving S. cosmioides, S. eridania and S. albula on these soybean types presented >83% mortality post-exposure to both dose levels of flubendiamide and thiodicarb. Some S. frugiperda larvae surviving on Cry1Ac and non-Bt soybean sprayed with a 50% dose of either insecticide developed into adults. However, L1 larvae developing on Cry1Ac soybean leaves sprayed with flubendiamide and L2 larvae on this soybean sprayed with thiodicarb had a prolonged immature stage, and females lower fecundity, which are likely to impact its population growth on soybean.

Building on the carbon reduction targets agreed in the Paris Agreements, many nations have renewed their efforts toward achieving carbon neutrality by the year 2050. In line with this ambitious goal, nations are seeking to understand the appropriate combination of technologies which will enable the required reductions in such a way that they are appealing to investors. Around the globe, solar and wind power lead in terms of renewable energy deployment, while carbon capture and storage (CCS) is scaling up toward making a significant contribution to deep carbon cuts. Using Japan as a case study nation, this research proposes a linear optimization modeling approach to identify the potential contributions of renewables and CCS toward maximizing carbon reduction and identifying their economic merits over time. Results identify that the combination of these three technologies could enable a carbon dioxide emission reduction of between 55 and 67 percent in the energy sector by 2050 depending on resilience levels and CCS deployment regimes. Further reductions are likely to emerge with increased carbon pricing over time. The findings provide insights for energy system design, energy policy making and investment in carbon reducing technologies which underpin significant carbon reductions, while identifying potential regional social co-benefits.

Intra-abdominal pressure (IAP) elevation during capnoperitoneum can cause adverse cardiovascular and respiratory effects. This study aimed to determine if a sequentially increased IAP affects cardiovascular and respiratory variables in anesthetized dogs and evaluate the effects of constant rate infusion of dexmedetomidine (Dex) on cardiovascular and respiratory variables with increased IAP. Five dogs were anesthetized, instrumented, and the Veress needle was equipped to adjust the IAP using a carbonic anhydrase insufflator. Stabilization was conducted for 1 h, and physiological variables were measured in IAPs of 0, 5, 10, 15, and 20 mmHg and after desufflation. After the washout period, the dogs underwent similar procedures along with constant rate infusion of dexmedetomidine. Cardiovascular effects of increased IAP up to 20 mmHg were not significant in healthy beagle dogs and those administered with dexmedetomidine. In the control group, the arterial pressure slightly increased, but not statistically significant, at an IAP of 20 mmHg compared with that at baseline (mean arterial blood pressure, p = 0.399; systolic arterial blood pressure, p = 0.293; diastolic arterial blood pressure, p = 0.141). When comparing the control and dexmedetomidine groups, overall significant effects of dexmedetomidine were noted on heart rate, cardiac output, and systemic vascular resistance during the experiment. Respiratory effects were not affected by abdominal insufflation when compared between different IAPs and between the two groups. Overall, an increased IAP of until 20 mmHg did not significantly affect cardiovascular and respiratory variables in both control and dexmedetomidine groups. This study suggests that dexmedetomidine infusion administration is applicable in laparoscopic procedures in healthy dogs.

The perceived poor performance of publicly traded companies on their sustainability commitments and the quality of sustainability reporting has prompted stakeholders to consider the economic, environmental, and social impacts of corporate activities. Economic activities have led to various threats in the form of climate change, pollution, greenhouse gas emissions, natural disasters, and other issues that have negatively impacted the environment and stakeholders. Companies are expected to report to stakeholders on their sustainability performance, but reality proves that present reporting falls below stakeholders’ expectations mainly due to its still voluntary nature. The present study aims to provide a literature review of the relationship between sustainability reporting and the role of companies governance, especially observing if climate change requirements and energy-needed changes are being accounted. Results highlight mixed evidence for the influence of board governance attributes, providing interesting insights for research advancement. The study has practical implications for businesses, regulators, governments, and other stakeholders in their policy deliberations and investment decisions. Further empirical studies are recommended to re-examine sustainability reporting using the variables identified as important factors and gaps in this study and other board characteristics to improve the generalizability of the results.

We have developed additive logistic models for the occurrence of lightning, large (≥ 2 cm), and very large (≥ 5 cm) hail to investigate the evolution of these hazards in the past, in the future, and for forecasting applications. The models, trained with lightning observations, hail reports, and predictors from atmospheric reanalysis, assign an hourly probability to any location and time on a 0.25° × 0.25° × 1-hourly grid as a function of reanalysis-derived predictor parameters, selected following an ingredients- based approach. The resulting hail models outperform the Significant Hail Parameter and the simulated climatological spatial distributions and annual cycles of lightning and hail are consistent with observations from storm report databases, radar, and lightning detection data. As a corollary result, CAPE released above the -10°C isotherm was found to be a more universally skilful predictor for large hail than CAPE. In the period 1950–2021, the models applied to the ERA5 reanalysis indicate significant increases of lightning and hail across most of Europe, primarily due to rising low-level moisture. The strongest modelled hail increases occur in northern Italy with increasing rapidity after 2010. Here, very large hail has become 3 times more likely than it was in the 1950s. Across North America trends are comparatively small, apart from isolated significant increases in the direct lee of the Rocky Mountains and across the Canadian Plains. In the southern Plains, a period of enhanced storm activity occurred in the 1980s and 1990s.

Nanoporous films of Eu-doped organosilicate glass (OSG) have been synthesized using sol-gel technology and spin-coating, employing evaporation-induced self-assembly (EISA), on silicon wafers. The Eu doping is achieved by dissolution of Eu(NO3)3·6H2O in the precursor solution. The deposited films are characterized by using Fourier transform infrared (FTIR) spectroscopy, ellipsometric porosimetry (EP), X-ray photoelectron spectroscopy (XPS) and photoluminescence spectroscopy. It is observed that Eu doping makes the films more hydrophilic and reduces the pore size and open porosity. The reduction Eu3+ → Eu2+ occurs in the pores of OSG films, which is confirmed by depth profiling XPS. However, Eu3+ still presents on the film’s top surface. Presence of Eu3+ and Eu2+ gives characteristic luminescence emission in the range of 600‒630 nm (Eu3+) and 290‒400 nm (Eu2+). The Eu2+/Eu3+ concentrations ratio depends on CH3 groups concentration in the films. Moreover, concentration of Eu2+ ions in the pores can be reduced by exposure in inductively coupled (ICP) oxygen plasma. The observed shift of the luminescence spectra towards the UV region, in comparison to previously reported Eu-doped organosilicate films, can be attributed to the energy transfer occurring between the host material and Eu2+ ions.

In the light of current justified international concerns about pollution caused by both greenhouse gases and by current agricultural practices, as well as the management of livestock manure, zeolite rocks with a prevalent zeolite content (a mineral endowed with peculiar chemical-physical properties), are widely used worldwide. They have a high extraction potential and represent an effective and scientifically proven means of pollution control. Moreover, based on the results of countless laboratory and field experiments, zeolitites (in particular Italian chabazite) rich in potassium (K) but low in sodium (Na) and with high drainage and water retention properties, have an effective potential for environmental protection, reduction of fertilizers and irrigation water, and increase of agronomic production. In agriculture and horticulture, in particular, the permanent correction of agricultural soils and growing media with appropriate amounts of zeolitites makes it possible to reduce the input of synthetic fertilizers and water as well, in order to substantially increase yields in quantity and quality. However, there are few scientific articles describing the use of zeolite in agriculture and its benefits for farmers. This review is aimed at gaining a better insight into the application of zeolitites in agriculture, particularly in difficult climatic situations, and to provide more information on how these minerals can ensure both the reduction of the use of fertilizers and the increase of plant protection. In addition, details and explanations are provided on the term 'zeolitite' used in order to ensure higher quality agricultural products.

Persistent Organic Pollutants (POP) such as dichlorodimethyltrichloroethane (DDT) are present and ubiquitous in the environment due to their resilient nature. DDT is a prevalent endocrine disruptor still found in detectable amounts in organisms and the environment even after its use was banned in the 1970s. Studies show that exposure to DDT can cause adverse health effects in humans and animals, impairing fertility and increasing the risk of developing cancer. The aim of this work is to provide a comprehensive overview of the available literature on the effect of DDT and its metabolites on female reproductive tract, leading to infertility and cancer. Medline and Google Scholar were systematically searched to detect all relevant animal and human studies published in the last 20 years (January 2003 to February 2023) in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-analyses (PRISMA) statement. In total, 38 studies were included for qualitative synthesis. This systematic search and review indicated that exposure to DDT is associated with female reproductive health decline and that DDT acts as a sufficient carcinogen instigating reproductive cancers.

Papain-like lysosomal cysteine proteases include 11 human cysteine cathepsins which act as endopeptidases and/or exopeptidases. They are involved in numerous physiological and pathological processes. Among them, only cathepsins B, H, C, and X/Z exhibit exopeptidase activity. Their activities are tightly regulated in various ways to prevent potentially hazardous effects on the cell. In this review, we focus on the structural and functional aspects of these four cysteine cathepsins and their role in neurodegeneration and cancer. Neurodegenerative disorders of aging share an endolysosomal dysfunction and accumulation and spread of oligomeric forms of neurotoxic proteins. The accumulation of various protein aggregates activates the microglia, thus inducing the activation and release of cysteine cathepsins and proinflammatory cytokines, leading to neurodegeneration. In cancer, cysteine cathepsins participate in tumor progression and metastasis. Tumor–stromal crosstalk leads to activation of the stroma and overexpression and secretion of proteolytic enzymes, triggering extracellular matrix degradation and the release of soluble factors. Activated stromal cells (i.e., macrophages, fibroblasts, mast cells) secrete additional growth factors, cytokines, and chemokines that are responsible for the regulation of processes leading to tumor progression and metastasis. Therefore, a better understanding of the role of cysteine cathepsins in neurodegeneration and cancer could lead to novel targeted therapeutic approaches.

Among all Brazilian economic sectors, the livestock sector stands out due to its large production and high export volume. However, beef production is associated to significant environmental impacts, such as deforestation and greenhouse gas (GHG) emission. The Paris Agreement was settled to avoid that global mean temperature rise up to 1.5 – 2º C by 2100. In 2020, Brazil committed in its nationally determined contribution (NDC) to reduce its GHG emission by 43% until 2030. This study aims to identify the association of beef production and beef cattle emissions, as well as assess predictive GHG emission scenarios for 2030 and value these emissions. To translate the environmental impacts of beef production into economic impacts, and thus amplify the discussion, we valued GHG emissions using the social cost of carbon (SCC). The results showed that the business as usual (BAU) GHG emission derived from beef production would range between 0.423 and 0.634 GtCO₂e in 2030, whereas the maximum emission estimated to meet the NDC should be 0.257 GtCO₂e. The SCC revealed the opportunity to reduce between US $18.8 and $42.6 billion in the cost of BAU emissions from beef production in 2030 if the NDC is met. Lastly, assessing a scenario where climate targets and beef exports are prioritized, between 2-10 kg of beef per capita would be available in the domestic market in 2030. Our results reveal the need and urgency of changes in livestock production to emit less GHG per kg of beef produced, and the avoided monetary cost of reducing emissions.

Development of agriculture in Russia and Belarus is based on the practical implementation of "smart" systems in agriculture based on the use of modern wireless, intelligent technologies and Internet of Things. This review presents research articles (mainly, in Russian) published in the period of 2013 – 2022 on the use of cloud technologies and Internet of Things for the development of agriculture in Russia and Belarus. An analysis of the use of cloud technologies and Internet of Things in the modern world is given on the basis of research articles and reviews published in English in the period of 2017 – 2022. The main directions of digitalization of modern agriculture are listed. The uses of cloud technologies and Internet of Things in agriculture are described along with promising directions for further research and applications.

The quality and safety of fermented milk products, which make up a sizeable portion of human nutrition, are greatly influenced by both the milk itself and the starting cultures employed to ferment it. Lactic acid bacteria (LAB) create a variety of metabolites throughout the fermentation process, altering the organoleptic properties of the substrates. The final product’s nutritional value and digestibility are enhanced by fermentation of the raw materials, which also adds vitamins, vital amino acids, and fatty acids. The quality and safety of fermented milk products, which make up a sizeable portion of human nutrition, are greatly influenced by both the milk itself and the starting cultures employed to ferment it. The inhibition of the growth of pathogenic microbes, which lowers the likelihood of the emergence of foodborne diseases, is another crucial function of LAB. A variety of pathogenic bacteria are frequently present in raw (unpasteurized) milk, and other raw materials; these pathogenic bacteria should be removed during the fermentation process. As a result, a variety of LAB metabolites, such as hydrogen peroxide, organic acids, and bacteriocins, function as bio preservative agents, enhancing food safety and lengthening the shelf life of the finished products.

Diverse development models, including waterfall development, iterative development, and agile development, have been put forth and implemented across real-world contexts. When engaging in discussions on project management, the examination and exploration of development models assume paramount importance and are integral. This paper embarks upon an investigation and scrutiny of these development models, culminating in the proposition of "Quasi" Development Models: Quasi-Waterfall and Quasi-Agile.

Angiotensin II (Ang II) plays a role in several inflammatory diseases and is capable of inducing the release of inflammatory mediators in several cell types. The objective was to investigate the potential of Ang II to induce mRNA expression of inflammatory mediators by cultured primary human periodontal cells. A synergistic effect of a co-treatment with Ang II and IL1β on mRNA expression of inflammatory mediators was also explored. Primary cultures of human fibroblast-like cells isolated from gingival and periodontal ligament tissues from 3 subjects were established using explant techniques. Immunophenotyping of STRO-1, Ang II type 1 receptor (AT1R) and Ang II type 2 receptor (AT2R) was performed by flow cytometry analysis. Cell cultures were challenged with Ang II (1M) for 3, 6 and 24h with or without a co-treatment with IL1β (0.1ng/mL) for 24h. mRNA expression of inflammatory mediators was performed by real time quantitative polymerase chain reaction (RT-qPCR). We present, for the first time, a precise quantification for AT1R and AT2R on human gingival and periodontal fibroblast-like cell types; the percentage of positive immunostaining compared to the total population of cells varied from 3.35% through 5.29% for AT1R and 2.97% through 4.57% for AT2R. Ang II slightly upregulated mRNA expression of IL6 and CCL2/MCP1 in gingival cells and IL8 and PTGS2/COX2 in periodontal ligament cells. IL1β induced upregulation of IL8, IL6 CCL2/MCP1, PTGS2/COX2 and IL1β mRNA in both cell types. Co-treatment with Ang II and IL1β did not show a synergistic effect under these experimental conditions. Ang II shows a low potential to induce mRNA upregulation of inflammatory mediators in cultured primary human gingival and periodontal ligament cells, most likely due to the low percentage of Ang II receptors in such cells, and no synergistic effect with the co-treatment with IL1β.

Inhibition of quorum sensing (QS)-dependent biofilm formation and virulence is extensively investigated as a novel approach to combat bacterial pathogens by impeding their ability to cause antibiotic-tolerant diseases. Such strategies are considered a promising alternative to conventional antibacterial therapy since interrupting the central cell-to-cell communication system imposes less selective pressure on the target pathogen. In this study, novel hybrid compounds composed of anthranilic acids substituted with halogens at different positions of the phenyl ring, and 4-(2-aminoethyl/4-aminobuthyl)amino-7-chloroquinoline linked via 1,3,4-oxadiazole were synthesized using standard procedures. Their anti-QS activities were evaluated using Chromobacterium violaceum ATCC31532 (anti-biofilm and bactericidal activities) and Pseudomonas aeruginosa PAO1 (anti-biofilm/-virulence activities). The results showed that compounds 15–19 and 23 inhibited the production of violacein, the QS-inducible pigment, in C. violaceum to a similar extent as the model QS inhibitor - quercetin (83.5–90%). Compound 15 exhibited the strongest effect on P. aeruginosa in the anti-biofilm screening, reducing its ability to form biofilm by almost 50%, while compounds 16 and 19 were able to reduce the biofilm formation by approximately 30%. However, compound 23 did not demonstrate significant anti-biofilm activity and only inhibited pyocyanin production in P. aeruginosa. In conclusion, this study suggests that 1,3,4-oxadiazoles 15, 16, and 19 are the most promising compounds for future research as novel QS inhibitors against Gram-negative bacteria equipped with different QS signaling pathways.

This study investigated the mechanical properties and fatigue behavior of FH36 steel plate rolled in different directions. By adopting a sequential rolling process in the rolling direction (RD) and transverse direction (TD), the differences in properties between RD and TD were eliminated, resulting in nearly identical tensile properties. The steel plate exhibited a yield strength of approximately 420 MPa, a tensile strength of approximately 506 MPa, and an elongation of approximately 25%. Fatigue tests conducted at room temperature and -60℃ showed a fatigue limit of the maximum stress of 488 MPa at room temperature and 500 MPa at -60℃, indicating improved low-temperature fatigue performance. The fracture surfaces displayed distinct characteristics, such as oblique shearing fractures for high-cycle fatigue and cup-cone shape fractures for low-cycle fatigue. The fatigue source zone were both on the surface of the specimens. As the maximum stress increased, the area of the crack propagation zone for high-cycle fatigue decreased, while the area of the final fracture zone, the number of dimples and the proportion of the LAGBs increased.

The present work was performed to evaluate the levels of phytochemical constituents and the antioxidant and antibacterial properties of marine red seaweed (Kappaphycus alvarezii) and seagrass (Cymodocea serrulata). Quantitative phytochemical analysis, antioxidant activity and antimicrobial activity against 5 potential pathogenic bacteria was investigated. In both cases were found presence of flavonoids, tannins, phenolic compounds, glycosides, steroids, carbohydrates and ashes. Alkaloids were only found in K. alvarezii, buy not in C. serrulata. The antimicrobial properties of both K. alvarezii and C. serrulata chloroform extracts were found to be antagonis-tically effective against the gram-positive bacterium Bacillus subtilis and the gram-negative bacterium Vibrio parahaemolyticus, Vibrio alginolyticus, Vibrio harveyi and Klebsiella pneu-moniae. GC‒MS analysis revealed the presence of 94 bioactive compounds in K. alvarezii and 104 C. serrulata, including phenol, decane, dodecane, hexadecane, vanillin, heptadecane, diphenyla-mine, benzophenone, octadecanoic acid, dotriaconate, benzene, phytol, butanoic acid, and 2-hydroxyl-ethyl ether, which played a vital role in antioxidant and antibacterial activities. Thus, in view of the results, both K. alvarezii and C. serrulata could be considered as sources of ingre-dients with appreciable nutritional and medicinal value.

The biological synthesis of nanoparticles has been emerging as an environmentally benign and eco-friendly method owing to its cost-effectiveness and high efficiency. Recently, the biological synthesis of semiconductor and metal-doped semiconductor nanoparticles with enhanced photocatalytic degradation efficiency and anticancer and antibacterial properties have gained tremendous attention. In pursuit of this purpose, for the first time, we biosynthesized zinc oxide (ZnO) and silver/ZnO nanocomposites (NCs) as semiconductor and metal-doped semiconductor nanoparticles, respectively, using the cell-free filtrate (CFF) of Lysinibacillus sphaericus bacterium. The biosynthesized ZnO and Ag/ZnO were characterized by various techniques such as ultraviolet-visible spectroscopy, X-ray diffraction, Fourier-transform Infrared spectroscopy, Field-emission scanning electron microscopy, transmission electron microscopy, and photoluminescence spectroscopy. The photocatalytic degradation potential of these semiconductor/metal-semiconductor nanoparticles was evaluated against the degradation of azo dye methylene blue (MB) under simulated solar irradiation. Ag/ZnO showed 90.7 ± 0.91% photocatalytic degradation of MB, compared to 50.7 ± 0.53% by ZnO in 120 min. The cytotoxicity of ZnO and Ag/ZnO on human cervical HeLa cancer cells was determined using an MTT assay. Both nanomaterials exhibited cytotoxicity in a concentration-dependent and time-dependent manner on HeLa cells. The antibacterial activity was also determined against Gram-negative (Escherichia coli) and Gram-positive (Staphylococcus aureus). Compared to ZnO, Ag/ZnO NPs showed higher antibacterial activity. Hence, the biosynthesis of semiconductor nanoparticles could be a promising strategy for developing hybrid metal/semiconductor nanomaterials for different biomedical and environmental applications.

In this paper, a distinction is first made between environmental, sustainable and green chemistry; the last two are then examined in relation to the more general problem of the environmental education. A brief historical digression on the STS (Science, Technology and Society) movement tries to dissect the reasons why chemistry is seen by the general public as a problem, not as a decisive resource for the realization of the ecological transition. Although sustainable and green chemistry can be decisive in overcoming the insularity of chemical disciplines in the high school, it fails to effectively embed itself in educational practices. Specific operational goals, supporting a real scientifical and technological literacy in sustainable and green chemistry, can help chemical educators. They are provided at the end of an examination of the founding axes of sustainable and green chemistry, according to the criteria of scientific and technological literacy.

Grain shape and chalkiness are important appearance quality traits of rice, which also affect the yield and milling quality. In this study, 190 F2 families derived from the cross between Hua 5178S and Hua 611 were sequenced to construct a genetic linkage map. Combined with F2 and F2:3 generations grain shape and chalkiness phenotype, a total of 15 QTL were detected. There are 8 grain shape QTL distributed on chromosomes 2, 5, 6, 8, and 10; 7 chalkiness QTL distributed on chromosomes 2, 3, and 6. A QTL cluster affecting multiple chalkiness traits was found on chromosome 6, qWBR6.1, qWCR6 and qCR6 were selected for genetic effect verification. It was found that qWBR6.1, qWCR6 and qCR6 explained 13% and 24%, and 29% of the phenotypic variations respectively, and qWCR6 and qCR6 were co-mapped. This study laid a foundation for further cloning of rice appearance quality genes.

Bacterial Extracellular Vesicles (BEVs) generated from the bacteria has high feasibility of intracellular interactions with other cells, can be used as a cargo to deliver any therapeutic substances like monoclonal antibodies, proteins, plasmids, siRNA and small molecules for the treatment of neurodegenerative diseases (NDs). BEVs have a high ability for delivering therapeutic molecules across the blood-brain barrier to treat Alzheimer's Disease (AD) via various mechanisms. In this review, we have sum up in-depth research details of the role and advancement of BEVs in NDs, AD and its Therapeutics. Moreover, details about offensive and defensive functions of BEVs in ND pathogenesis and examine the critical BEV networks in the microbiome-gut-brain axis and their role in neurodegenerative disorders. Additionally determining the roles of BEVs in the neuroimmune system and their interaction with neurodegenerative disorders and exploring the risk factors of BEVs in the autophagy-lysosomal pathway and their possible effects on neurodegenerative disorders are summarised in detail. In conclusion, this review seeks to contribute to a better understanding of the potential function of BEVs in NDs and to identify new therapeutic intervention strategies.

In the depths of inquiry, where thoughts unfurl like tendrils of smoke, this qualitative study ventures into the enigmatic realms of diaspora, migration, and the elusive brain drain within the tapestry of the Philippines. It is a journey guided by a sturdy theoretical framework, traversing the multifaceted dimensions of society, culture, and psyche. Here, the lens expands beyond the confines of economics, delving into the essence of these phenomena, seeking profound insights that dance beneath the surface. Through meticulous analysis of empirical data, hidden truths emerge, illuminating the intricate dynamics of diaspora, the intricate patterns of migration, and the intricate threads that shape migration decisions. Moreover, it peers into the intricate tapestry of impacts that diaspora and migration have on both sending and receiving societies, casting a beam of understanding upon their social, economic, and cultural implications. The study, in its wisdom, extends its reach to offer valuable policy recommendations, serving as a compass for stakeholders and decision-makers. It emphasizes the pivotal importance of harnessing the vast potential held within diaspora, fostering social integration, and bridging the gaps in knowledge that lie in wait. In its entirety, this research harmonizes with the existing body of knowledge, blending seamlessly with the symphony of understanding, and ignites the path towards evidence-based strategies that pave the way for sustainable development and the well-being of societies near and far.

With the introduction of more and more monoclonal antibodies selectively targeting various mediators of the immune-system, together with Janus-Kinase (JAK)-inhibitors with variable affinities towards different JAK subtypes, the available therapeutic options for the treatment of inflammatory bowel diseases (IBD) have undergone an acceleration in the last five years. On the other hand, the prevalence of IBD patients over 65-years of age is steadily increasing and, with this, there is a large population of patients that presents more comorbidities, polypharmacy, and, more frequently, frailty compared to younger patients, exposing them to potentially major risks for adverse events deriving from newer therapies, e.g. infections, cardiovascular risks, and malignancies. Unfortunately, pivotal trials for the commercialization of new therapies rarely include older IBD patients and those with serious comorbidities are virtually excluded. In the present review, we focus on existing literature from pivotal trials and real-world studies, analyzing data on efficacy/effectiveness and safety of newer therapies in older IBD patients with special emphasis on comorbidities and frailty, two distinct but intercorrelated aspects of the older population since age by itself seems to be of minor importance.

Abstract: Background: Adolescents frequently self-report pain, according to epidemiological research. The knee is one of the sites where the pain is most common. One of the main factors contributing to the number of years people spend disabled and having substantial personal, societal, and economic burdens globally is musculoskeletal disorders. Insidious, slowly building onset that neither the adolescent nor the parent is aware of [5]. Patellofemoral Pain (PFP) is a clinical knee pain commonly affecting adolescents. In the present study, the authors aimed to estimate the frequency of knee pain in Saudi adolescents. Methods: This cross-sectional survey carried out from June to November 2022 included 676 adolescents, ages 10 to 18. The data are presented as frequencies and percentages for categorical variables. Analysis of variance (ANOVA) was used to compare means between groups, while the chi-square test was used for the comparison of categorical variables. Statistical significance was set at p < 0.05. Results: Adolescents were invited to take part in the study; 57.5% were female and 42.5% were male, and 68.8% were aged between 15 and 18. The prevalence of knee pain was considerably high among females (26%), while it was 19.2% among males. Moreover, age was a significant predictor for knee pain, and BMI was as well. We also found a significant difference between BMI classification and stiffness of the knee (p = 0.008). There is a difference between adolescents who do physical activities in leisure and difficulty bending (p = 0.03). Conclusion: Our study noted a high rate of knee pain among adolescents, so we need to raise awareness about risk factors. Adolescent knee pain can be prevented with conservative methods and some minor lifestyle/activity modifications.

Delve into the ebb and flow of human ingenuity as the researcher traces the evolution of writing from papyrus to pixels. Discover how humble instruments like quill pens and typewriters have propelled human into the digital frontier, forever reshaping the art of expression in the modern age. This article examines the evolution of writing tools from traditional pen and paper to digital writing in the modern age. It explores the development of writing materials such as papyrus, parchment, and paper, as well as the invention of writing tools including quill pens, fountain pens, and typewriters. The rise of digital writing tools, including word processing software and smartphones, is also discussed, along with their benefits such as increased efficiency and productivity, enhanced collaboration and sharing capabilities, and greater accessibility and flexibility. However, the article also highlights the challenges of writing in the digital age, including the impact of digital distractions on writing focus and quality, the issue of online plagiarism and copyright infringement, and the potential loss of traditional writing skills. The article concludes with recommendations for educators, school administrators, students, and researchers to strike a balance between digital and traditional writing practices, to embrace digital writing tools while preserving traditional writing skills, and to understand the importance of the evolution of writing. The theoretical frameworks of Social Construction of Technology (SCOT) Theory, Media Ecology Theory, and Activity Theory are also discussed in relation to the evolution of writing tools. Overall, this article provides valuable insights into the history, benefits, and challenges of writing in the digital age, as well as suggestions for navigating the future of writing and its tools.

The identification and quantitative determination of wool and fine animal fibers are of great interest in the textile field because of significant price differences between them and common adulterations in raw and processed textiles. Since animal fibers have remarkable similarities in their chemical and physical characteristics, specific identification methods have been studied and proposed following advances in analytical technologies. The identification methods of wool and fine animal fibers are reviewed in this paper and the results of relevant studies are listed and summarized, starting from classical microscopy methods which are still used today not only in Small to Medium Enterprises but also in large industries, research studies and quality control laboratories. Particular attention has been paid to image analysis, Nir spectroscopy and proteomics which constitute the most promising technologies of quality control in the manufacturing and trading of luxury textiles and can find application in forensic science and archeology.

In the current socio-economic context, pension systems have become a crucial topic in the agenda of governments and international bodies. In this paper, an empirical study regarding the economic and social sustainability of pension systems in Central and Eastern European Countries was performed. The goal of the research is to establish the sustainability of pension systems with econometric modeling techniques on three dimensions as the research hypotheses are revealed: first, by strengthening the financial soundness of pension systems; second, consolidating the economic environment of pension systems; third, increasing the degree of social security systems with a direct effect of reducing poverty. The results led to relevant insights emphasizing the need for more inclusive economic, financial, and social reforms. From a policy perspective, these findings could be a starting point for the enhancement of the financial adequacy and economic and social sustainability of pension systems in Central and Eastern European Countries. The econometric techniques in this study highlight those modern pensions systems that need to be addressed in a more complex and empirical context that must encompass the main technical aspects. The conclusions suggest that in the future it needs judicial, economic, and social adjustments for the enhancement of the financial soundness of the pension systems.

The positive impact of nature on human health has been explored by researchers. Although studies have indicated that olfaction and odors have an impact on both memory and health, re-search on the odor perception in relation to perceived health is scarce. A recent study found that the naturenatural scent from stem cuttings and potted plants of a specific rose-scented geranium Pelargonium graveolens, ‘Dr. Westerlund,’Westerlund’ had positive effects on stress-related mental disorders. reduction. Essential oils from many Pelargonium species, in particular ‘Dr. Westerlund’, are known to have phytochemical properties and pharmacological activities. No study has, so far, explored and identified the chemical com-pounds and the sensory perception of these compounds in stem cuttings and the potted ´Dr. Westerlund´ plantplants. Such knowledge would be an important contribution forto an increased understanding of the effects of plants’ chemical odor properties on human well-being and link this to the expressed perceived scents. Resulting sensory profiles of P.This study aimed to identify the sensory profile and suggest responsible chemical compounds of Pelargonium graveolens ´Dr. Westerlund´ as a potted plant and as stem cuttings were reported, as well as´. The sensory and chemical analysis results revealed sensory profiles of Pelargonium graveolens ´Dr. Westerlund´s, and suggestions for the chemical compounds that are attributed to the sensory profiles. Further studies are recommended to investigate the odor experience of scented pelargonium species in relation to various levels ofcorrelation between volatile com-pounds and possible stress hormones. reduction in humans.

In the last two decades many detailed full transcriptomic studies on complex biological samples have been published and included in large gene expression repositories. These studies primarily provide bulk expression signal for each sample, including multiple cell-types mixed within the global signal. The cellular heterogeneity in these mixtures does not allow the activity of specific genes in specific cell types to be identified. Therefore, inferring relative cellular composition is a very powerful tool to achieve a more accurate molecular profiling of complex biological samples. In recent decades, computational techniques have been developed to solve this problem by applying cell deconvolution methods, designed to decompose cell mixtures into their cellular components and calculate the relative proportions of these elements. Some of them, only calculate the cell proportions (supervised methods), while other deconvolution algorithms can also identify the gene signatures specific for each cell type (unsupervised methods). In these work, five deconvolution methods (CIBERSORT, FARDEEP, DECONICA, LINSEED and ABIS) were implemented and used to analyze blood and immune cells, and also cancer cells, in complex mixture samples (using three bulk expression datasets). Our study provides three analytical tools (corrplots, cell-signature plots and bar-mixture plots) that allow a thorough comparative analysis of the cell mixture data. The work indicates that CIBERSORT is a robust method optimized for the identification of immune cell-types, but not as efficient in the identification of cancer cells. We also observed that LINSEED is a very powerful unsupervised method that provides precise and specific gene signatures for each of the five main immune cell-types analyzed: neutrophils and monocytes (in the myeloid lineage), B-cells, NK cells and T-cells (in the lymphoid lineage).

Angiotensin II (Ang II) plays a role in several inflammatory diseases and is capable of inducing the release of inflammatory mediators in several cell types. The objective was to investigate the potential of Ang II to induce mRNA expression of inflammatory mediators by cultured primary human periodontal cells. A synergistic effect of a co-treatment with Ang II and IL1β on mRNA expression of inflammatory mediators was also explored. Primary cultures of human fibroblast-like cells isolated from gingival and periodontal ligament tissues from 3 subjects were established using explant techniques. Immunophenotyping of STRO-1, AT1 and AT2 receptors was performed by flow cytometry analysis. Cell cultures were challenged with Ang II (1M) for 3, 6 and 24h with or without a co-treatment with IL1β (0.1ng/mL) for 24h. mRNA expression of inflammatory mediators was performed by real time quantitative polymerase chain reaction (RT-qPCR). We present, for the first time, a precise quantification for AT1 and AT2 receptors on human gingival and periodontal fibroblast-like cell types; the percentage of positive immunostaining compared to the total population of cells varied from 3.35% through 5.29% for AT1 and 2.97% through 4.57% for AT2. Ang II slightly upregulated mRNA expression of IL6 and CCL2/MCP1 in gingival cells and IL8 and PTGS2/COX2 in periodontal ligament cells. IL1β induced upregulation of IL8, IL6 CCL2/MCP1, PTGS2/COX2 and IL1β mRNA in both cell types. Co-treatment with Ang II and IL1β did not show a synergistic effect under these experimental conditions. Ang II shows a low potential to induce mRNA upregulation of inflammatory mediators in cultured primary human gingival and periodontal ligament cells, most likely due to the low percentage of Ang II receptors in such cells, and no synergistic effect with the co-treatment with IL1β.

Background: This literature review investigates qualitative and quantitative uses of indocyanine green (ICG) in surgical treatment, as this novel technique has become increasingly popular in ORs (operating rooms) worldwide due to its many advantages. Method: An extensive literature review was performed by searching for relevant terms in 5 international databases (www.pubmed.gov, www.sciencedirect.com, www.scopus.com, www.Oxfordjournals.com, www.reaxys.com). The results of this search were summarized into the main advantages of employing ICG in colorectal surgery as follows: a) intraoperative fluorescence angiography capability; b) fluorescence-guided identification of lymph node involvement in colorectal cancer and the sentinel lymph node method; c) positive fluorescence flagging of a liver tumour as small as "only" 200 tumour cells; d) facilitation of fistula diagnosis; and e) tumour tattooing. Moreover, in addition to qualitative intraoperative ICG use, this technique can be combined with quantitative methods and parameters, such as maximum intensity, relative maximum intensity, and different inflow parameters (time-to-peak, slope, and t1/2max). The conclusion of this article is that fluorescence surgery with ICG aided by near-infrared (NIR) light is a relatively recent technology, an advantage of which is improving the specific anatomic and functional information provided, thus allowing more comprehensive and safer tumour removal as well as preservation of important structures.

The article presents the results of the γ-ray and fast neutrons impact on various rice species, in order to obtain mutant forms resistant to salinity (NaCl) and drought factors (sorbite). They are going to be used as initial forms in synthetic selection when creating varieties, adapted to the stressful conditions of, both, soil and climate in the Kazakhstan Aral Sea. The average lethal doses (LD50) of γ-rays and fast neutrons, as well as, the average NaCl and sorbite lethal concentrations were established. A distinct dependence on the effect of ionizing radiation and stress factors on the number of induced resistant mutant forms has been related to the initial rice variety. The largest number of mutant forms was obtained from the local variety Syr Suluy, followed by Leader and Aikerim varieties. Out of all varieties, only 1% of the initially irradiated by γ-rays seeds survived, while after fast neutron irradiation – 4,3%. M1 mutant plants significantly differ from the initial forms in terms of morphological features – plant height, panicle length, and grain size. They are tolerant to lodging, and have short and highly sterile panicles, indicating that they are mutants.

Background: Hepatic erythrophagocytosis is augmented in NASH and amplifies inflammation and fibrosis. Although various pro-phagocytic signals have been identified on erythrocytes of NASH patients, the role of bound thrombospondin-1 (TSP-1), which acts as an “eat-me” signal, arginase-1, which regulates the levels of nitric oxide in erythrocytes, and phosphatidylethano-lamine (PE) which can amplify erythrophagocytosis and hepatic inflammation have not been explored. Hence, we sought to investigate the levels of arginase-1 and TSP-1 in erythrocyte lysate and PE in erythrocyte membranes of NASH patients. Methods: Twenty-four patients and 14 healthy controls participated in our study. The levels of TSP-1 and arginase were quantified by ELISA in erythrocyte lysates, and the levels of PE in erythrocyte membranes by thin layer chro-matography. Results: Erythrocytes of NAFLD patients exhibit lower levels of arginase-1 and TSP-1 (p<0.01). Erythrocyte-bound TSP-1 levels correlated with the levels of erythrocyte surface CD47. Phosphatidylethanolamine was increased in erythrocytes of NASH patients and was accompanied by increased release, indicating exposure. Conclusion: Our results imply reduced TSP-1 binding by erythrocytes which could allow free TSP-1 molecules to act on macrophages, enhancing erythrophagocytosis. Increased PE which could amplify inflammation after efferocytosis, while downregulation of arginase-1 could lead to defective efferocytosis.

Breast and Cervical cancer are significant causes of morbidity and mortality among women worldwide. Usually, conventional therapies and early detection has shown success in metastasis and relapse rates and improved overall survival of the patients. The elimination of the efficacy of chemotherapies and target therapies because cancer stem cells create resistance against chemotherapy, metastasis, and relapse. Studies reveal that cancer stem cell markers are important for improving efficiencies of targeted therapies. Our study aims to analyze the stem cell markers and target the most significant stem cell marker by phytochemicals and their derivates. Through the analysis, it was observed that CXCR4 and SOX-2, mir-1, mir-125, and mir-429 may have a crucial role in stemness of breast and cervical cancer respectively, while BPMD & MD simulations revealed Di-valinoyl curcumin as a potential compound for CXCR4 targeting.

Solid oxide cells are capable of efficiently converting various chemical energy carriers to electricity and vice versa. The urgent challenge nowadays is the faster degradation rate compared with other fuel cell/electrolyzer technologies. To understand the degradation mechanisms, simulation of a solid oxide cell is helpful. Since most previous research developed models using commercial software, such as COMSOL and ANSYS Fluent, a gap for knowledge transfer is being gradually formed between academia and industry due to licensing issues. This paper introduces a multiphysics model, developed by a computational code, openFuelCell2. The code is implemented with an open-source library, OpenFOAM. It accounts for momentum transfer, mass transfer, electrochemical reactions and metal interconnect oxidation. The model can precisely predict I-V curves under different temperatures, fuel humidity and operation modes. Comparison between OpenFOAM and COMSOL simulations shows good agreement. The metal interconnect oxidation is modelled, which can predict the thickness of the oxide scale under different protective coatings. Simulations are conducted by assuming an ultra-thin film resistance on the rib surface. It is revealed that coatings fabricated by atmospheric plasma spraying can efficiently prevent metal interconnect oxidation, with a contribution of only 0.53 \% to the total degradation rate.

Voids in face-centered cubic (fcc) metals are commonly assumed to form by the aggregation of vacancies; however, the mechanisms of vacancy clustering and diffusion are not fully understood. In this study, we use computational modeling to provide a detailed insight into the structures and formation energies of primary vacancy clusters, mechanisms and barriers for their migration in bulk copper, and how these properties are affected at simple grain boundaries. The calculations were carried out using Embedded Atom Method (EAM) potentials and Density Functional Theory (DFT) and employed the Site-Occupation Disorder code (SOD), the Activation Relaxation Technique nouveau (ARTn) and the Knowledge Led Master Code (KLMC). We investigate stable structures and migration paths and barriers for clusters of up to six vacancies. Migration of vacancy clusters occurs via hops of individual constituent vacancies with di-vacancies having a significantly smaller migration barrier than mono-vacancies and other clusters. This barrier is further reduced when di-vacancies interact with grain boundaries. This interaction leads to the formation of self-interstitial atoms and introduces significant changes into the boundary structure. Tetra-, penta-, and hexa-vacancy clusters exhibit increasingly complex migration paths and higher barriers than smaller clusters. Finally, the direct comparison with the DFT results shows that EAM can accurately describe the vacancy-induced relaxation effects in the Cu bulk and in grain boundaries. Significant discrepancies between the two methods were found in structures with a higher number of low-coordinated atoms, such as penta-vacancies and di-vacancy absortion by grain boundary. These results will be useful for modeling the mechanisms of diffusion of complex defect structures and provide further insights into the structural evolution of metal films under thermal and mechanical stress.

The exceptional Jordan algebra is the algebra of $3 \times 3$ Hermitian matrices with octonionic entries. It is the only one from Jordan’s algebraic formulation of quantum mechanics which is not equivalent to the conventional formulation of quantum theory. It has often been suggested that this exceptional algebra could explain physical phenomena not currently explained by the conventional approach, such as values of the fundamental constants of the standard model of particle physics, and their relation to gravitation. We show that this is indeed the case; and this also unravels the connection between general relativity and the weak force. The exceptional Jordan algebra also predicts a new U(1) gravitational interaction which modifies general relativity, and which provides a theoretical basis for understanding the Modified Newtonian Dynamics (MOND).

The effects of 0.4wt.% Sc addition on a typical Al-Si10-Mg alloy were systematically investigated in the present research. Samples with and without Sc produced refined dendritic arranged microstructures with sensitivity to the aging treatment after solidification, particularly in the case of the alloy without Sc. After being exposed to 300°C for 90 minutes, the dendritic spacing nearly doubled in the Al-10wt.%Si-0.45wt.%Mg samples. The rapidly solidified microstructures were constituted by the -Al dendritic phase surrounded by eutectic phases/intermetallics such as Si, Mg2Si and Al3Sc (in the case of the alloy containing Sc). 255°C and 300°C were deemed most appropriate temperatures for aging treatments, with four exposure times of up to 120 minutes tested for each alloy. The heat treatments allowed the Vickers hardness profiles to be plotted and compared. Moreover, in order to detect both Sc- and Mg- precipitates after aging, specific samples have been prepared for either SEM or TEM analyses. At first, the results pointed to a strong precipitate-related hardening effect formed as a result of the Sc addition to the alloy. All samples containing Sc showed a higher hardness value when compared to their respective treated samples without Sc. Secondly, when comparing the Al-10Si-Mg-Sc alloy samples among themselves after being treated at different conditions, high temperatures and excessive treatment times can become detrimental to the hardness. This was due to the growth of larger Sc-bearing precipitates of approximately 1 µm in size under such conditions, having less pronounced hardening effect. The best condition (255°C for 60 min) for as centrifuged samples in Cu-mold produced very fine dispersion of Mg- and Sc- intermetallics (~200 nm in size) with a peak hardness of 110 HV.

Ultraviolet (UV) radiation has both harmful and beneficial effects on human health. It can cause skin damage and cancer, but also provides the primary source of vitamin D. Additionally, UV radiation affects energy metabolism in mice with metabolic diseases and has protective effects on hypertension and cardiovascular diseases.Metabolic Syndrome is a collection of metabolic dysfunctions such as dyslipidemia, hypertension, hyperglycemia, abdominal/central obesity, and insulin resistance. Chronic UVR exposure suppressed obesity and type 2 diabetes in high-fat diet-fed mice, while vitamin D supplementation did not replicate these effects. On the other hand, topical application of nitric oxide (NO) donors replicated UV effects on mice, and NO scavengers prevented the positive impact of UV. UVR may prevent the development of obesity and metabolic syndrome through mechanisms that depend on UVR-induced NO, not vitamin D. Exposure to sunshine has a protective impact on blood pressure and cardiovascular disease. Although lower vitamin D concentration is linked to increased hypertension and the incidence of CVD, oral vitamin D supplementation does not decrease blood pressure or the risk of CVD, indicating that vitamin D may not mediate the beneficial effects of sun exposure. Instead, NO plays a crucial role as an endogenous vasodilator, produced by the vascular endothelium. Solar UVA may release nitrogen oxides from skin storage into the bloodstream, lowering blood pressure and cardiovascular mortality.In conclusion, UVR exposure could be a promising non-pharmacological intervention for metabolic syndrome, hypertension, and CVD prevention, and NO may play a crucial role in mediating these effects. Further research is needed to explore the precise mechanisms and identify the optimal doses and exposure times of UVR.

The G2 gas cloud motion data and the scarcity of observations on the event horizon-scale distances have challenged the comprehensiveness of the central supermassive black hole model. In addition, the Planck Legacy 2018 release has preferred a positively curved early Universe with a confidence level higher than 99%. This study investigates the impact of the background curvature and its evolution over the conformal time on the formation and morphological evolution of central compact objects and the consequent effect on their host galaxies. The formation of a galaxy from the collapse of a supermassive gas cloud in the early Universe is modeled based on interaction field equations as a 4D relativistic cloud-world that flows and spins through a 4D conformal bulk of a primordial positive curvature considering the preference of the Planck release. Owing to the curved background, this scenario of galaxy formation reveals that the core of the galaxy undergoes a forced vortex formation with a central event horizon leading to opposite vortices (traversable wormholes) that spatially shrink while evolving in the conformal time. It indicates that the galaxy and its core are formed in the same process whereas the surrounding gas clouds form the spiral arms due to the frame-dragging induced by the fast-rotating core. It demonstrates that the accretion flow onto the central supermassive compact object only occurs at the central event horizon of the two opposite vortices while their other ends eject the relativistic jets. This can elucidate the relativistic jet formation and explain the G2 gas cloud motion if its orbit is around one of the vortices but at a distance from the central event horizon. The gravitational potential of the early curved bulk could contribute to galaxy formation while the present spatial flatness deprives the potential of bulk which could lead to galaxy quenching. The formation of a galaxy and its core simultaneously could explain the growth of the supermassive compact galaxy core to a mass of ~10⁹ M_⊙ at just 6% of the current Universe age.

The by-products of the juice and cider industry in forms of pomace and peels are rich sources of pectin which further can be used in the food, cosmetic and non-food industries. The aim of the research was to use by-products from fruits and berries grown in Latvia: Rhubarb (Rheum rhabarbarum); Apples (Malus domestica); Plums (Prunus domestica); Red Currants (Ribes rubrum); Black Currants (Ribes nigrum); Gooseberries (Ribes uva-crispa); Sour Cherries (Prunus cerasus); Pumpkins (Cuccurbita spp.) for pectin extraction. Citric acid (0.1 N) was used for the hot water extraction. The yield of pectin (PY = 4.47 – 17.8 % DM) and physicochemical parameters of obtained pectin were determined: methoxy degree (ME = 4.27 – 8.13 %), esterification degree (DE = 45.16 % – 64.06 %), anhydrouronic acid content (AUA = 38.23.% - 84.74 %); moisture content (5.2 – 7.4 %), ash content (1.42 - 2.88 g 100 g-1), total phenolic content (TPC = 2.076 – 4.668 GAE, mg L-1) and antiradical scavening activity (DPPH Method (0.56 – 37.29 %)). Pectin analysis was performed by FT-IR and the rheological properties of pectin gels were determined.

The addition of prebiotics is one of the most important ways to improve the techno-functional properties of bread. In this study, the effects of resistant starch, polydextrose, and inulin on the wheat flour, dough, and bread properties were investigated. In farinography results, resistant starch significantly increased the development time (2:18) with a boosting effect, but polydextrose (1:48) and inulin (1:36) weakened the dough (P &lt;0.05). Inulin, polydextrose, and resistant starch had the most effect on reducing water absorption (40, 43.2, and 48.9) respectively (P &lt;0.05). According to extensography data, inulin had the best result in baking compared to other polysaccharides. In terms of baked breads, samples containing resistant starch had high moisture that could be due to starch gelatinization and moisture-retaining, which delays the staling process of bread. Inulin, polydextrose, and resistant starch prebiotic ingredients affected dough rheological properties and bread quality, and organoleptic characteristics, however, resistant starch was the best.

Antimicrobial resistance is on the rise, and there aren't enough new treatments to combat it. This might send the modern world back to the pre-antibiotic age. The molecular hybrids of pyrazolo[3,4-b]pyridine and triazole have been designed, synthesized, and analyzed for their drug-like molecule nature and in vitro analyses for their inhibition potentials against S. Aureus and K. Pneumoniae. The compounds CY-R2-25 and CY-R2-28 have been identified as the high potential molecules in this series based on in vitro experiments. CY-R2-25 has zone of inhibition values of 15 0.82 and 14 0.7, whilst CY-R2-28 has the zone of inhibition values of 18 0.95 and 16 0.82 against S. Aureus and K. Pneumoniae, respectively. MIC and MIB values for CY-R2-25 and CY-R2-28 against S. Aureus and K. Pneumoniae are 0.25 and 0.5, respectively.

Contamination with Arsenic, a toxic metalloid, is increasing in the marine environment. Additionally, global warming can alter metalloids toxicity. Polychaetes are key species in marine environments. By mobilizing sediments, they play vital roles in nutrient and element (including contaminants) cycles. Most studies with marine invertebrates focused on the effects of metalloids on either adults or larvae. Here we bring information on the effects of temperature increase and arsenic contamination on the polychaete Hediste diversicolor in different growth stages and water temperatures. Feeding activity and biochemical responses – neurotransmission, indicators of cell damage, antioxidant and biotransformation enzymes and metabolic capacity - were evaluated. Temperature rise combined with As imposed alterations on feeding activity and biochemical endpoints at different growth stages. Small organisms have their antioxidant enzymes increased, avoiding lipid damage. However, larger organisms are the most affected class due to inhibition of superoxide dismutase, which resulted in protein damage. Oxidative damage was observed on smaller and larger organisms exposed to As and 21 °C, demonstrating higher sensibility to the combination of temperature rise and As. The observed alterations may have ecological consequences, affecting the cycle of nutrients, sediment oxygenation and the food chain that depend on the bioturbation of this polychaete.

Hilbert arithmetic in a wide sense, including Hilbert arithmetic in a narrow sense consisting by two dual and anti-isometric Peano arithmetics, on the one hand, and the qubit Hilbert space (originating for the standard separable complex Hilbert space of quantum mechanics), on the other hand, allows for an arithmetic version of Gentzen’s cut elimination and quantum measurement to be described uniformy as two processes occurring accordingly in those two branches. A philosophical reflection also justifying that unity by quantum neo-Pythagoreanism links it to the opposition of propositional logic, to which Gentzen’s cut rule refers immediately, on the one hand, and the linguistic and mathematical theory of metaphor therefore sharing the same structure borrowed from Hilbert arithmetic in a wide sense. An example by hermeneutical circle modeled as a dual pair of a syllogism (accomplishable also by a Turing machine) and a relevant metaphor (being a formal and logical mistake and thus fundamentally inaccessible to any Turing machine) visualizes human understanding corresponding also to Gentzen’s cut elimination and the Gödel dichotomy about the relation of arithmetic to set theory: either incompleteness or contradiction. The metaphor as the complementing “half” of any understanding of hermeneutical circle is what allows for that Gödel-like incompleteness to be overcome in human thought.

Oral immunization with the choleric toxin (CT) elicits a high level of protection against its enterotoxin activities and can control cholera in endemic settings. However, the complete B-cell epitope map of the CT responsible for protection remains to be clarified. Here, we have mapped the B-cell linear epitopes of the three chains of the CT protein (CTP) prepared by Spot synthesis. The immunoreactivity of sera from mice immunized with an oral, inactivated vaccine (Schankol†™) was measured against membrane-bound peptides for mapping. Results: Eighteen IgG epitopes were identified; eight in the CTA, three in the CTB, and seven in the protein P. Three epitopes, TQTGFVRHDDGYVST (aa 66-77, Vc/TxA-3), KNGAIFQVE VPGSQN (aa 64-78, Vc/TxB-11), and LNDEHK (aa 90-95, Vc/TxP-16), were chosen to synthesize a multiple antigen peptide that was used to coat ELISA plates to screen immunized mouse sera as a test for an in vitro diagnostics for cholera. Conclusion: Vaccination with inactive CT-generated antibodies against multiple linear epitopes and the selected epitopes can be used to construct immunological reagents for rapid serological diagnosis of cholera with high sensitivity and specificity.

Various factors, such as uncertainty of component parameters and uncertainty of sensor meas-urement values, contribute to the difficulty of fault detection in the landing gear retrac-tion/extension hydraulic system. In this paper, we introduce linear fractional transformation technology and uncertainty analysis theory for the construction of the diagnostic bond graph of the landing gear retraction/extension hydraulic system. In this way, interval analytical redundancy relations and fault signature matrix can be derived. Using the fault signature matrix, existing faults of the system can be preliminarily detected and isolated. Additionally, interval analytical re-dundancy relations can be used to detect system faults in detail, and cases analysis can be carried out to determine if the actuator is externally or internally leaky, and if the landing gear selector valve is reversing stuck. Compared to the traditional analytical redundancy relations, this method takes into account the negative factors of uncertainty; and compared to the traditional absolute diagnostic threshold, the interval diagnostic threshold is more accurate and sensitive.

Emerging RNA virus infections are a growing concern among domestic bird and poultry industries due to the severe impact it can have on the flock health and economic livelihoods. Avian paramyxoviruses (APMV) are pathogenic, negative sense RNA viruses that cause serious infections in the respiratory and central nervous system. APMV was detected in multiple avian species during the 2017 migration season in Ukraine, and studied using PCR, virus isolation, and sequencing. Of the 4090 wild bird samples, eleven swabs were isolated in chicken embryos and identified for APMV serotype by hemagglutinin inhibition test: APMV-1, APMV-4, APMV-6, APMV-7. At a variety of sites in Ukraine we characterized the virulence of the virus and further analyzed and predicted the potential risks of spillover to immunologically naïve populations. RNA was extracted and amplified using a multiplex-tiling primer approach to encompass full cDNA genomes. Full-length APMV-1 (n=5) and APMV-6 (n=2) genomes were sequenced on an Oxford Nanopore MinION device in Ukraine. All APMV-1 and APMV-6 fusion (F) proteins possessed a monobasic cleavage site, suggesting these APMV were likely low virulence, annually circulating strains. Utilization of this low-cost method will identify gaps in viral evolution and circulation in this understudied but important critical region for Eurasia.

The aims of the study are: a) Describe the reactogenicity of WHO-approved two mRNA (Pfizer-BioNTech, Moderna) and two non-RNA vaccines (Oxford-AstraZeneca, Sinovac) among lactating mother and baby pairs; and b) compare and contrast the reactogenicity between mRNA and non-mRNA vaccines. A cross-sectional, self-reported survey was conducted amongst 1784 lactating women who received COVID-19 vaccinations. The most common maternal adverse reaction was a local reaction at the injection site; the largest minority of respondents, 43.7% (780/1784), reported experiencing worse symptoms when receiving the second dose compared to the first dose. There were no major reported adverse effects or behavioural changes in the breastfed infants. Among the respondents who received non-mRNA COVID-19 vaccinations, a majority reported no change in lactation but those who did more commonly reported an increase in milk supply, decrease in milk supply and pain in the breast. The more commonly reported lactation changes (fluctuations in breastmilk supply and pain in the breast) for the non-mRNA vaccines were similar to that of respondents who received mRNA vaccines. Our study, with a large cohort and wide geographical and racial mix, further augments earlier reported findings that COVID-19 vaccines are safe for breastfeeding mothers and her children.

The voltage-gated potassium channel KV1.3 has been recognized as a tumor marker and represents a promising new target for the discovery of new anticancer drugs. We designed a novel structural class of KV1.3 inhibitors through structural optimization of benzamide-based hit compounds and structure-activity relationship studies. The potency, and selectivity of the new KV1.3 inhibitors were investigated using whole-cell patch- and voltage-clamp experiments. 2D and 3D cell models were used to determine antiproliferative activity. Structural optimization resulted in the most potent and selective KV1.3 inhibitor 44 in the series with an IC50 value of 470 nM in oocytes and 950 nM in Ltk cells. Kv1.3 inhibitor 4 induced significant apoptosis in Colo-357 spheroids, while 14, 37, 43, and 44 significantly inhibited Panc-1 proliferation.

In the current research work, electrical resistance tomography (ERT) was employed for crystallization process monitoring and visualization. A first-of-its-kind MATLAB-based interactive GUI application “ERT-Vis” is presented. Two case studies involving varied crystallization methods were undertaken. The experiments involving calcium carbonate reactive (precipitative) crystallization for the high conductivity solution-solute media and the cooling crystallization for sucrose crystallization representing the lower conductivity solution-solute combination were designed and performed. The software successfully provided key insights regarding the process progress in both crystallization systems. It could detect and separate the crystal agglomerations in the low as well as high conductivity solutions using visual analytics tools provided. The performance and utility of the software were studied using a software evaluation case study involving domain experts. Participant feedback indicated that ERT-Vis software helps in reconstructing images instantaneously, interactively visualizing, and evaluating the output of the crystallization process monitoring data.

About 70% of children and adolescents with cerebral palsy experience gait impairments which affect their autonomy and well-being. Robotic-assisted gait training using the Lokomat is particu-larly promising for rehabilitation as it provides a standardized environment favoring the massive repetition of the movement, in which physical demands are low on the therapist and high training loads can be achieved. As no guidelines exist regarding training protocols and Lokomat settings, the goal of this study was to review the literature on Lokomat-assisted gait therapy and possibly make training recommendations. The twelve studies reviewed reported both positive and null effects of Lokomat training on gait. Half of the studies combined Lokomat with other types of training and only five used a control intervention to assess its benefit. Overall, training was administered 1-5 times per week for 20-60 minutes, over 1-12 weeks. Although Lokomat settings were not always described, progressively decreasing body-weight support and guidance, while increasing treadmill speed appear to be prioritized. The variety of training protocols and settings used did not allow pooling of the studies to assess effects of interventions on gait parameters in children and adoles-cents with cerebral palsy. This review highlights the need for homogenization of interventions so that clear guidelines can emerge and be applied in rehabilitation centers.

Bacterial vaginosis (BV), the most common cause of vaginal discharge, is characterized by a shift in the vaginal microbiota from lactobacillus dominance to a diverse array of facultative and strict anaerobic bacteria which form a multi-species biofilm on vaginal epithelial cells. The rate of recurrence after therapy is high, often >60%. While the BV biofilm itself likely contributes to recurrent and/or refractory disease after treatment by reducing antimicrobial penetration, antimicrobial resistance in BV-associated bacteria including those, both within the biofilm and the vaginal canal, may be the result of independent, unrelated bacterial properties which are discussed in this paper. Our current recommendations for the treatment of refractory and recurrent BV are also provided.

This paper aims to raise awareness on certain interoperability issues as we intend to shape industry 5.0 in order to enable a human-centric resilient society. We advocate that the need of sharing small and specific data will become more intensive as AI-based solutions will become more pervasive. Consequently, dataspaces should be carefully designed to address this need. We advance the conversation by presenting a case study from HR demonstrating how to predict the possibility of an employee experiencing attrition. Our experimental results show that we need more than 500 samples for developing a machine learning model to be sufficiently capable to generalize the problem. Consequently, our experimental results show the feasibility of the idea. However, in small and medium sized companies this approach cannot be implemented due to the limited number of samples. At the same time, we advocate that this obstacle may be overcome if multiple companies will join a shared dataspace, thus raising interoperability issues

The Environmental interactions contributed to the processes of settlement and development of the first settlers at southern Peru 15,000 BC. The determination of this process is based on paleoclimatic studies at southern Peru and ethnoarchaeological evidence. The determination of this process is based on paleoclimatic studies of southern Peru and ethnoarchaeological evidence; establishing as a result of this analysis the hypothesis of environmental interaction and territorial occupation of the first hunter-gatherer populations until their consolidation, dominating the geographical space from Tacna. The Disruptive disaster events and their effects on climate during the Peruvian Paleolithic resulted in the origin of local societies that shaped the Tiawanaku societies of the early horizon at Southern Peru and Northern Chile.

Amyotrophic Lateral Sclerosis (ALS) is a prototypical neurodegenerative disease characterized by progressive degeneration of motor neurons to severely effect the functionality to control voluntary muscle movement. Most of the non additive genetic aberrations responsible for ALS make its molecular classification very challenging along with limited sample size, curse of dimensionality, class imbalance and noise in the data. Deep learning methods have been successful in many other related areas but have low minority class accuracy and suffer from the lack of explainailbilty when used directly with RNA expression features for ALS molecular classification. In this paper we propose a deep learning based molecular ALS classification and interpretation framework. Our framework is based on training a convolution neural network (CNN) on images obtained from converting RNA expression values into pixels based on DeepInsight similarity technique. Then we employed Shapley Additive Explanations (SHAP) to extract pixels with higher relevance to ALS classifications. These pixels were mapped back to the genes which made them up. This enabled us to classify ALS samples with high accuracy for a minority class along with identifying genes that might be playing an important role in ALS molecular classifications. Taken together with RNA expression images classified with CNN, our preliminary analysis of the genes identified by SHAP interpretation demonstrate the value of utilising Machine Learning to perform molecular classification of ALS and uncover disease-associated genes.

Cancer is a prevalent disease worldwide and treatments such as radiotherapy and chemotherapy sometimes lead to adverse events. Oral mucositis is one of the most disabling and clinical guidelines do not take into account nutritional interventions. The primary endpoint was to gather the evidence about the efficacy of nutritional interventions in the prevention and/or treatment of antineoplastic induced oral mucositis in oncological patients. It was carried out a bibliographic review in PubMed data base by combining MesH terms with boolean operators. Articles were selected based on inclusion and exclusion criteria; 50 final articles were found. Although further evidence is needed, glutamine, honey and vitamins appear to be a good therapeutic option. The rest of the compounds presented controversial or insufficient results to draw conclusions over their utilization as prevention or treatment options. Low evidence is reported about oral mucositis nutritional interventions in spite of being attainable and affordable compounds. Scarce evidence is shown in paediatric patients compared to adults. Developing higher quality studies and combinations with the compounds researched is necessary to create stronger evidence.

We report the development of in vitro propagation protocols through adventitious shoot induction pathway for a rare and medicinal Scutellaria havanensis. In vitro propagation studies using nodal explants showed MS medium supplemented with 10µM 6-Benzylaminopurine induced highest number of adventitious shoots in a time dependent manner. A ten - day incubation was optimum for shoot bud induction as longer exposures resulted in hyperhydricity of the explants and shoots induced. We also report preliminary evidence of Agrobacterium tumefaciens EHA105 - mediated gene transfer transiently expressing of green fluorescent protein in this species. Transformation studies exhibited amenability of various explant tissues, internode being the most receptive. As the plant has medicinal value, research was carried out to evaluate its potential antioxidant capacity and the efficacy of methanolic leaf extracts in curbing the viability of human colorectal cancer cell line HCT116. Comparative total polyphenol, and flavonoid content measurement of fresh and air dried leaf extract revealed that the fresh leaf extracts contain higher total polyphenol and flavonoid content. The HCT 116 cell viability assessed by colorimetric assay using a 3-(4, 5-dimethyl-thiazol-2-yl)-2, 5-diphenyltetrazolium bromide, showed a steady growth inhibition after 24 hours of incubation. Scanning Electron Microscopy of leaf surface revealed high density of glandular and non-glandular trichomes. This research provides basis for the conservation of this rare plant and future phytochemical screening and clinical research.

Potential of co-digestion mixing thickened secondary sludge (TS) from extended aeration wastewater treatment plant and locally available substrates (whey, grease and septage) has been studied using three steps. The first step was a batch test to determine biological methane potential (BMP) of different mixtures of the three co-substrates with TS. The second step has been carried out with lab-scale reactors (20 L) simulating anaerobic continuous stirred tank reactors fed by three mixtures of co-substrates determined according to previous step results. Modelling using ADM1 as a mechanistic model was applied in the third step to help understanding the co-digestion process. According to BMP step, septage used as co-substrate has a negative effect on performance and addition of 10 to 30% grease or 10% whey would lead to a higher production of biogas and with an increase of the methane content. The results from the reactor showed less evi-dence of the positive effects observed with the BMP assay. Protein and lipid fractions of particu-late biodegradable COD are important variables for digester stability and methane production as predicted by modelling. Results of simulations with ADM1 model adapted to co-digestion confirmed that this model is a powerful tool to optimize the process of biogas production.

The devastating impact of the ongoing coronavirus disease 2019 (COVID-19) on public health, caused by the Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) has made fighting of the COVID-19 pandemic is a top priority in medical research and pharmaceutical development. Surveillance of SARS-CoV-2 mutations is essential for the comprehension of SARS-CoV-2 variant diversity and their impact on virulence and pathogenicity. The SARS-CoV-2 open reading frame 10 (ORF10) protein interacts with multiple human proteins CUL2, ELOB, ELOC, MAP7D1, PPT1, RBX1, THTPA, TIMM8B, and ZYG11B expressed in the lung tissues. Mutations and co-mutations in the emerging SARS-CoV-2 ORF10 variants are expected to impact the severity of the virus and its associated consequences. In this article, We highlight 128 single mutations and 35 co-mutations in the unique SARS-CoV-2 ORF10 variants in this article. The possible predicted effects of these mutations and co-mutations on the secondary structure of ORF10 variants and host protein interactomes are presented. The findings highlight the possible effects of mutations and co-mutations on the emerging 140 ORF10 unique variants from secondary structure and intrinsic protein disorder perspectives.

Background: Patients in the postoperative period following bariatric surgery are at risk of developing eating disorders. This study aims to analyse the relation between bariatric surgery and the development and recurrence of eating disorders. Material and methods: Literature review was done on 15th November 2020. Fourteen studies that met the eligibility criteria were included for qualitative synthesis, and 7 studies for meta-analysis. Results: The prevalence of eating disorders in the postoperative period was 7.83%, based on the 7 studies in the meta-analysis. Binge eating disorder alone was 3.81%, which was the most significant factor, and addressed in 6 of these studies. Conclusion: The investigated studies have significant methodological limitations in assessing the relation between bariatric surgery and eating disorders, since they mostly present data on prevalence. PROSPERO CRD42019135614.

The development of dosimetry and studies in peptide receptor radionuclide therapy (PRRT) over these two last decades are reviewed. Differences in kidney and bone marrow toxicity reported between ⁹⁰Y, ¹⁷⁷Lu and external beam radiotherapy (EBRT) are discussed with regards to the physical properties of these beta emitter radionuclides. The impact of these properties on the response to small and large tumors is also considered. Capacities of the imaging modalities to assess the dosimetry to target tissues are evaluated. Studies published in the last two years that confirm a red marrow uptake in ¹⁷⁷Lu-DOTATATE therapy, as already observed 20 years ago in ⁸⁶Y-DOTATOC PET studies, are commented and analyzed in the light of the recent knowledges in transferrin transport mechanism. The review enlightens the importance i) of using state of the art imaging modalities, ii) of individualizing the activity to be injected with regards to the huge tissue uptake variability observed between patients, iii) of challenging the currently used but inappropriate blood based red marrow dosimetry and iv) of considering individually tandem therapy. Last, a smart individually optimized tandem therapy taking benefit of the bi-orthogonal toxicity-response pattern of ¹⁷⁷Lu-DOTATATE and of ⁹⁰Y-DOTATOC is proposed.

There is a need to search for new antifungals, especially for the treatment of the invasive Candida infections, caused mainly by C. albicans. These infections are steadily increasing at an alarming rate, mostly among immunocompromised patients. The newly synthesized compounds (3a-3k) were characterized by physico-chemical parameters and investigated for antimicrobial activity using the microdilution broth method to estimate minimal inhibitory concentration (MIC). Additionally, their antibiofilm activity and mode of action together with the effect on the membrane permeability in C. albicans were investigated. Biofilm biomass and its metabolic activity were quantitatively measured using crystal violet (CV) staining and tetrazolium salt (XTT) reduction assay. The cytotoxic effect on normal human lung fibroblasts and hemolytic effect were also evaluated. The results showed differential activity of the compounds against yeasts (MIC = 0.24-500 µg/mL) and bacteria (MIC = 125-1000 µg/mL). Most compounds possessed strong antifungal activity (MIC = 0.24-7.81 µg/mL). The compounds 3b, 3c, and 3e, showed no inhibitory (at 1/2 MIC) and eradication (at 8 x MIC) effect on C. albicans biofilm. Only slight decrease in the biofilm metabolic activity was observed for compound 3b. Moreover, the studied compounds increased the permeability of the membrane/cell wall of C. albicans and their mode of action may be related to action within the fungal cell wall structure and/or within the cell membrane. It is worth noting that the compounds had no cytotoxicity effect on pulmonary fibroblasts and erythrocytes at concentrations showing anticandidal activity. The present studies in vitro confirm that these derivatives appear to be a very promising group of antifungals for further preclinical studies.

UV-A (ca. 365 nm wavelength, a.k.a. 'black light') photocatalysis has been investigated to comprehensively mitigate odor and selected air pollutants in the livestock environment. This study was conducted to confirm the performance of UV-A photocatalysis on the swine farm. The objectives of this research were to (1) scale-up of the UV-A photocatalysis treatment, (2) evaluate the mitigation of odorous gases from swine slurry pit, and (3) test different UV sources, (4) evaluate the effect of suspended particulate matter (PM), and (5) conduct preliminary economic analyses. We tested UV-A photocatalysis at a mobile laboratory-scale capable of treating ~0.2 - 0.8 m3·s-1 of barn exhaust air. The targeted gaseous emissions of barn exhaust air were significantly mitigated (p < 0.05) up to 40% reduction of measured odor; 63%, 44%, 32%, 40%, 66%, and 49% reduction of dimethyl disulfide, isobutyric acid, butanoic acid, p-cresol, indole, and skatole, respectively; 40% reduction of H2S; 100% reduction of O3; and 13% reduction of N2O. The PM mitigation effect was not significant. Formaldehyde levels did not change, and a 21% generation of CO2 was observed. The percent reduction of targeted gases decreased as the airborne PM increased. Simultaneous chemical and sensory analysis confirmed that UV-A treatment changed the overall nuisance odor character of swine barn emissions into weaker manure odor with 'toothpaste and 'mint' notes. The smell of benzoic acid generated in UV-A treatment was likely one of the compounds responsible for the less-offensive overall odor character of the UV-treated emissions. Results are needed to inform the design of a farm-scale trial, where the interior barn walls can be treated with the photocatalyst, and foul air will be passively treated as it moves through the barn.

Machine learning (ML) is growing in popularity for various particle accelerator applications including anomaly detection such as faulty beam position monitor or RF fault identification, for non-invasive diagnostics, and for creating surrogate models. ML methods such as neural networks (NN) are useful because they can learn input-output relationships in large complex systems based on large data sets. Once they are trained, methods such as NNs give instant predictions of complex phenomenon, which makes their use as surrogate models especially appealing for speeding up large parameter space searches which otherwise require computationally expensive simulations. However, quickly time varying systems are challenging for ML-based approaches because the actual system dynamics quickly drifts away from the description provided by any fixed data set, degrading the predictive power of any ML method, and limits their applicability for real time feedback control of quickly time-varying accelerator components and beams. In contrast to ML methods, adaptive model-independent feedback algorithms are by design robust to un-modeled changes and disturbances in dynamic systems, but are usually local in nature and susceptible to local extrema. In this work, we propose that the combination of adaptive feedback and machine learning, adaptive machine learning (AML), is a way to combine the global feature learning power of ML methods such as deep neural networks with the robustness of model-independent control. We present an overview of several ML and adaptive control methods, their strengths and limitations, and an overview of AML approaches. A simple code for the adaptive control algorithm used here can be downloaded from: https://github.com/alexscheinker/ES_adaptive_optimization

Background: The COVID 19 pandemic and associated public health measures have disrupted the lives of people around the world. It is already evident that the direct and indirect psychological and social effects of the COVID 19 pandemic are insidious and affect the mental health of young children and adolescents now and will in the future. The aim and objectives of this knowledge-synthesis study were to identify the impact of the pandemic on children’s and adolescent’s mental health and to evaluate the effectiveness of different interventions employed during previous and the current pandemic to promote children’s and adolescent’s mental health. Methodology: We conducted the systematic review according to the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines and included experimental randomized, nonrandomized controlled trials; observational studies; and qualitative studies. Results: Of the 5,828 articles that we retrieved, 18 articles met the inclusion criteria. We thematically analyzed and put up the major findings under the thematic areas of impact of pandemic on children and adolescent’s mental health. These studies reported that pandemics cause stress, worry, helplessness, and social and risky behavioral problems among children and adolescents (e.g., substance abuse, suicide, relationship problems, academic issues, absenteeism from work). Interventions such as art-based programs, support services, and clinician-led mental health and psychosocial services effectively decrease mental health issues among children and adolescents. Conclusion: Children and adolescents are more likely to experience high rates of depression and anxiety during and after a pandemic. It is critical that future researchers explore effective mental health strategies that are tailored to the needs of children and adolescents. Explorations of effective channels regarding the development and delivery of evidence-based, age-appropriate services are vital to lessen the effects and improve long-term capacities for mental health services for children and adolescents.

Globally, anthropogenic sound and artificial light pollution have increased to alarming levels. Evidence suggests that these can disrupt critical processes that impact ecosystems and human health. However, limited focus has been given to the potential effects of sound and artificial light pollution on microbiomes. Microbial communities are the foundations of our ecosystems. They are essential for human health and provide myriad ecosystem services. Therefore, disruption to microbiomes by anthropogenic sound and artificial light could have important ecological and human health implications. In this mini-review, we provide a critical appraisal of available scientific literature on the effects of anthropogenic sound and light exposure on microorganisms and discuss the potential ecological and human health implications. Our mini-review shows that a limited number of studies have been carried out to investigate the effects of anthropogenic sound and light pollution on microbiomes. However, based on these studies, it is evident that anthropogenic sound and light pollution have the potential to significantly influence ecosystems and human health via microbial interactions. Many of the studies suffered from modest sample sizes, suboptimal experiments designs, and some of the bioinformatics approaches used are now outdated. These factors should be improved in future studies. This is an emerging and severely underexplored area of research that could have important implications for global ecosystems and public health. Finally, we also propose the photo-sonic restoration hypothesis: does restoring natural levels of light and sound help to restore microbiomes and ecosystem stability?

This paper investigates the dynamic tail dependence risk between BRICS economies and world energy market in the context of the COVID-19 financial crisis of 2020, to determine optimal investment decisions based on risk metrics. For this purpose, the study employs a combination of novel statistical techniques ranging from Markov Switching, GARCH and Vine copula. Using a dataset consisting of daily stock and world crude oil prices; we find high probability of transition between lower and higher volatility regimes. Furthermore, our results based on the C-Vine copula confirm the existence of two types of tail dependence: - symmetric tail dependence between South Africa and China; South Africa and Russia; and lower tail dependence between South Africa and India; South Africa and Brazil; South Africa and Oil. For the purpose of diversification in these markets, we formulate an asset allocation problem using C-vine copula-based returns and optimize it using Particle Swarm algorithm with a rebalancing strategy. The results show an inverse relationship between the risk contribution and asset allocation of South Africa and oil market supporting the existence of lower tail dependence between them. This suggests that when South African stocks are in distress, investors tend to shift their holdings in oil market. Similar results are found between China and oil. In the upper tail, South African asset allocation is found to have an inverse relationship with that of Brazil, Russia and India suggesting that these three markets might be good investment destinations when things are not good in South Africa and vice-versa.

OBJECTIVE: Although 3D-printed anatomic models are not new to medicine, the high costs and lengthy production times entailed have limited their application. Our goal was developing a new and less costly 3D modeling method to depict organ-tumor relations at faster printing speeds. METHODS: We have devised a method of 3D modeling using DICOM images. Coordinates are extracted at a specified interval, connecting them to create mesh-work replicas. Adjacent constructs are depicted by density variations, showing anatomic targets (ie, tumors) in contrasting color. RESULTS: An array of organ solid-tumor models were printed via Fused Deposition Modeling 3D printer at significantly less cost ($0.05/cm3) and time expenditure (1.73 min/cm3; both, p<.001). Printed models helped promote visual appreciation of organ-tumor anatomy and adjacent tissues. Our mesh-work 3D thyroidal prototype reproduced glangular size/contour and tumor location, readily approximating the surgical specimen. CONCLUSIONS: This newly devised mesh-type 3D printing method may facilitate anatomic modeling for personalized care and improve patient awareness during informed surgical consent.

Epidemiological studies have shown a strong association between high body mass index (BMI) and papillary thyroid cancer (PTC). We assessed the clinical and histopathological features of PTC in patients with a higher BMI and compared them to analogous parameters in PTC patients with a normal BMI. We retrospectively analyzed 5,021 medical records of patients admitted and surgically treated for thyroid tumors in one center between 2008 and 2018. Finally, we extracted data from 523 adult patients with PTC and stratified patients into two groups according to BMI: Group 1 with BMI < 25 kg/m² and Group 2 with BMI ≥25 kg/m². Data stratification was performed to estimate the association of overweight and obesity with clinical and histopathological features of PTC in both univariate and multivariate binary logistic regression analyses. Overall, compared to patients with a normal BMI, overweight and obese patients had a greater risk of minimal extrathyroidal extension (minimal ETE), multifocality and bilaterality of PTC (p<0.001 for all). Analysis did not show that BMI was significantly associated with more advanced tumor-node-metastasis (TNM) stage (p=0.894). Obesity and overweight were significantly associated with higher aggressiveness of PTC. When considering various management options for PTC patients, these findings regarding overweight and obesity should be taken into consideration during the decision-making process.

Rotary drilling for oil and natural gas uses drilling fluid for lubrication of the bit, to seal off unstable shale layers, and floating out rock cuttings. Drilling fluid is a water-clay chemical mixture. Produced water is a water-sand chemical mixture. Land farming is a common disposal technique of drilling fluid and produced water. In the land farming process, amendments of fluid are repeatedly applied to the soil surface. Plant growth and soil chemical properties may be altered by additions of drilling fluid, because of alkalinity, salinity, trace elements, and petroleum residue contained in waste. The objective of this study was to determine the change in soil pH, electrical conductivity (EC), total nitrogen and carbon, and extractable nutrient levels following the land application of drilling fluid and produced water. The study was a comparison of three plots with similar soil properties and conditions. The three study plots had various levels of drilling fluid and produced water applications. The data show a major difference from field-to-field for EC, Na, and Cl levels. The EC and salt levels increased with additional applications of drilling fluid and produced water. The percent total nitrogen values and plant available P levels were very low in all fields. High EC and salt values, coupled with low N and P levels, would be detrimental to plant growth and development. To successfully vegetate this land-farm site, application of N and P fertilizer would be required. This study will help to give a better understanding of practical ways to land-farm drilling fluid and produced water in a fashion that both minimizes environmental issues and is economically feasible. Salinity changes to soil were expected to be high; there are excessive amounts of sodium and chloride in spent drilling fluid and produced water.

Global economy, financial markets and technology are on the verge of moving to a new stage of development – information society. Three major world countries the US, Russia and China will play a leading role in this process. However, the specific development path will depend on many factors, including the stability of legal systems, security of computer and financial technologies, the effectiveness of legislation. The focus of this article is to assess the current condition of the economy the major countries, to identify trends and methods of stabilization of legal systems on the basis of balance of rights and obligations of the business, suggest some methods of objective evaluation of the impact factors of the total taxes, fixed costs and the legal system dynamics on financial indicators.

The rapid evolution of Next Generation Sequencing in clinical settings and the resulting challenge of variants interpretation in the light of constantly updated information, requires robust data management systems and organized approaches to variant reinterpretation. In this paper, we present iVar: a freely available and highly customizable tool provided with a user-friendly web interface. It represents a platform for the unified management of variants identified by different sequencing technologies. iVar accepts, as input, VCF files and text annotation files and elaborates them, optimizing data organization and avoiding redundancies. Updated annotations can be periodically re-uploaded and associated to variants as historicize attributes. Data can be visualized through variant-centered and sample-centered interfaces. A customizable search functionality can be exploited to periodically check if pathogenicity related data of a variant are changed over time. Patient recontacting ensuing from variant reinterpretation is made easier by iVar through the effective identification of all patients present in the database and carrying a specific variant. We tested iVar by uploading 4171 VCF files and 1463 annotation files, obtaining a database of 4166 samples and 22569 unique variants. iVar has proven to be a useful tool with good performances for collecting and managing data from medium-throughput

In a generalized topological space T_g = (Ω, T_g) (T_g-space), the g-topology T_g : P (Ω) −→ P (Ω) can be characterized in the generalized sense by specifying the generalized open, generalized closed sets (g-T_g-open, g-T_g-closed sets), generalized interior, generalized closure operators g-Intg, g-Cl_g : P (Ω) −→ P (Ω) (g-T_g-interior, g-T_g-closure operators), or generalized derived, generalized coderived operators g-Der_g, g-Cod_g : P (Ω) −→ P (Ω) (g-T_g-derived, g-T_g-coderived operators), respectively. For very many T_g-spaces, the δ^th-iterates g-Der_g^(δ), g-Cod_g^(δ) : P (Ω) −→ P (Ω) of g-Der_g, g-Cod_g : P (Ω) −→ P (Ω), respectively, defined by transfinite recursion on the class of successor ordinals are also themselves g-T_g-derived, g-T_g-coderived operators for new g-topologies in the generalized sense on Ω. Thus, the use of novel definitions of g-T_g-derived, g-T_g-coderived operators g-Der_g, g-Cod_g : P (Ω) −→ P (Ω), respectively, based on a very clever construction, together with their δ^th-iterates g-T_g-operators g-Der_g^(δ), g-Cod_g^(δ) : P (Ω) −→ P (Ω), defined by transfinite recursion on the class of successor ordinals, will give rise to novel generalized g-topologies on Ω. The present authors have been actively engaged in the study of g-T_g-operators in T_g-spaces. The study of the essential properties and the commutativity of novel definitions of g-T_g-interior and g-T_g-closure operators g-Int_g, g-Cl_g : P (Ω) −→ P (Ω), respectively, in T_g has formed the first part, and the study of the essential properties and sets of consistent, independent axioms of novel definitions of g-T_g-exterior and g-T_g-frontier operators g-Ext_g, g-Fr_g : P (Ω) −→ P (Ω), respectively, has formed the second part. In this work, which forms the last part on the theory of g-T_g-operators in T_g-spaces, the present authors propose to present novel definitions and the study of the essential properties of g-T_g-derived and g-T_g-coderived operators g-Der_g, g-Cod_g : P (Ω) −→ P (Ω), respectively, and their δ^th-iterates, and the notions of g-T_g-open and g-T_g-closed sets of ranks δ in T_g-spaces.

Abstract: Fanconi anemia (FA), a chromosome instability syndrome, is caused by inherited pathogenic variants in any of 22 FANC genes, that cooperate in the FA/BRCA pathway. This pathway regulates the repair of DNA interstrand crosslinks (ICLs) through homologous recombination. In FA proper repair of ICLs is impaired, and accumulation of toxic DNA double strand breaks occurs. In order to repair this type of DNA damage, FA cells activate alternative error-prone DNA repair pathways, that may lead to the formation of gross structural chromosome aberrations of which radial figures are the epitome and origin of subsequent aberrations like translocations, dicentrics and acentric fragments. The deficiency in DNA repair has pleiotropic consequences in the phenotype of patients with FA, including developmental alterations, bone marrow failure and an extreme risk to develop cancer. The mechanisms leading to the physical abnormalities during embryonic development have not been clearly elucidated, however FA has features of premature aging with chronic inflammation mediated by pro-inflammatory cytokines, that results in tissue attrition, selection of malignant clones and cancer onset. Moreover, the effect of the FA/BRCA pathway in germinal cells, evidenced by infertility in patients with FA attests of chromosomal instability and cell death also occurring in the germinal compartment.

Mechanisms for somatic chromosomal mosaicism (SCM) and chromosomal instability (CIN) are incompletely understood. During SNP-array molecular karyotyping and bioinformatic analyses of children with neurodevelopmental disorders and congenital malformations (n=612), we observed colocalizaion of regular chromosomal imbalances or copy number variations (CNV) with mosaic ones (n=47 or 7.7%). Analyzing molecular karyotyping data and pathways affected by CNV burdens, we proposed a mechanism for SCM/CIN, which had been designated as “chromohelkosis” (from the Greek chromosome ulceration/open wound). Briefly, structural chromosomal imbalances are likely to cause local instability (“wreckage”) at the breakpoints, which results either to partial/whole chromosome loss (e.g. aneuploidy) or elongation of duplicated regions. Accordingly, a function for classical/alpha satellite DNA (protection from the wreckage towards the centromere) has been hypothesized. Since SCM and CIN are ubiquitously involved in development, homeostasis and disease (e.g. prenatal development, cancer, brain diseases, aging), we have metaphorically (ironically) designate the system explaining chromohelkosis contribution to SCM/CIN as the cytogenomic “theory of everything” like the homonymous theory in physics inasmuch as it might explain numerous phenomena in chromosome biology. Recognizing possible empirical and theoretical weaknesses of this “theory”, we nevertheless believe that studies of chromohelkosis-like processes are required to understand structural variability and flexibility of the genome.

Traditional potential transformers have problems of large volume, difficulty in insulation, iron core saturation, ferroresonance overvoltage and poor transient response characteristics. The voltage sensor based on the principle of electric field coupling and differential input structure does not need to contact the measured object or ground, and can avoid the above problems. However, it requires a sufficiently high capacitance between the differential electrodes to obtain sufficient accuracy and a high voltage division ratio. The existing method of using mutual capacitance between the differential electrodes will cause many problems and fail to meet the practical needs. To solve the above problems, this paper innovatively uses multi-layer ceramic capacitor to replace the mutual capacitance and designs a new type of voltage sensor. In addition, by using single bypass small resistance grounding method to increase the input impedance of the differential signal processing circuit, error of the sensor is further reduced. The experimental results show that the sensor has excellent accuracy and great transient response characteristics. The ratio error under power frequency is within ±0.5% and the phase error is within 1. The ratio error in the range of 500 Hz∼30 kHz is within ±5% and the phase error is within 5. Moreover, it has the advantages of low cost, miniaturization, flexible shape and easy to adjust the voltage division ratio. These characteristics indicate that the sensor has good voltage measurement and sensor network potential.

The synergetic features of a three-component photoinitiating systems (A/B/C) based on the measured data and proposed mechanism of Liu et al (Polymers, 2020, 12(6), 1394) are analyzed. The co-initiators/additives B and C have dual functions of : (i) regeneration of photoinitiator A and (ii) generation of extra radicals. The synergic effects lead to higher conversion of free radical polymerization (FRP) and cationic polymerization (CP). The key factors and rate constants influencing the conversion efficacy are explored by analytic formulas. Enhancing strategies for various photopolymerization systems are summarized including one component (or monomer) and one-wavelength, two-component and one, two and three-wavelength, and three-component, one-wavelength system. The synergetic effects for higher monomer conversion can be achieved by co-initiators for extra radicals and multiple wavelengths for reduced oxygen-inhibition. Co-initiator B, however, might also reduces the CP radical produced by initiator C. The conversion rate of FRP is proportional to the square root of the light intensity (I), absorption (b) and the initiator initial concentratios (A0, B0, C0), whereas CP is proportional to the linear power of a parameter defined as P=bIA0C0, a stronger dependence than FRP. The CP conversion is governed by a steady-state value proportional to P, and a rate fucntion defining the depletion rate of [A][C], or the increasing rate of the conversion profile. The measured results of Liu et al (Polymers, 2020, 12(6), 1394) are well analyzed and matching the predicted features of our modeling. The specific systems analyzed are: benzophenone derivatives (A) ethyl 4-(dimethylamino)benzoate (B), and (4-tert-butylphenyl)iodonium hexafluorophosphate (C) under a UV (365 nm) LED irradiation; and monomers of trimethylolpropane triacrylate (TMPTA, for FRP) and (3,4- epoxycyclohexane)methyl 3,4-epoxycyclohexylcarboxylate (EPOX, for CP).

Primocane-fruiting (PF) blackberries are adaptable to different production systems. To increase yields in PF blackberries, their primocanes are typically tipped or topped in summer to encourage branch formation from axillary buds below the cut. In this study, we determined in PF ‘Prime-Ark Traveler’ whether early emerging primocanes were more productive than those that emerged later in the season and the effect of primocane bending and defoliation on flowering. The primocanes that emerged in April produced 64% more flower shoots than those that emerged after May. Also, these findings indicate the alternative primocane management practices of selecting the early emerging primocanes and bending to orient primocanes horizontally and leaf removal increase budbreak and flower shoot emergence. The present work contributes toward a better understanding of primocane emergence time and orientation-flowering relations and how they mediate crop performance in PF blackberry.

Diabetes mellitus (DM) is one of the most dangerous metabolic diseases with high rate of mortality worldwide. It is well known that insulin resistance and deficiency in insulin production from pancreatic β-cells are the main characteristic of DM. Due to the detrimental side effects of the current treatment, there is a considerable need to develop new effective antidiabetic drugs, especially alpha-glucosidase and alpha-amylase inhibitors with lesser adverse effects. These inhibitors are known to be directly involved in the delay of carbohydrate digestion, resulting in a reduction of glucose absorption rate and consequently reduce the post-prandial raise of plasma glucose, which can reduce the risk of long-term diabetes complications. Hence, natural products are well-known sources for the discovery of new scaffold for drugs discovery, including new antidiabetic drugs. The phytochemical investigation of Salvia aurita collected from Hogobach pass, Eastern Cape, South Africa (SA), yielded four known abietane diterpenes namely carnosol (1), rosmanol (2), 7-methoxyrosmanol (3), 12-methoxycarnosic acid (4) and one flavonoid named 4,7-dimethylapigenin (5). Structural characterization of these isolated compounds was conducted using 1 and 2D NMR, in comparison with reported spectroscopic data. These compounds are reported for the first time from S. aurita. The biological evaluation of the isolated compound against alpha-glucosidase exhibited strong inhibitory activities for 3 and 2 with IC50 values of 4.2 ± 0.7 and 16.4 ± 1.1 µg/mL respectively, while 4 and 1 demonstrated strong alpha-amylase inhibitory activity amongst the isolated compounds with IC50 of 16.2 ± 0.3 and 19.8 ± 1.4 µg/mL. Molecular docking analysis confirms strong inhibitory activity of 3 against alpha-glucosidase. Additionally, excellent antioxidant capacities were displayed by 2, 1 and 3 respectively as ORAC (25789.9 ± 10.5; 23961.8 ± 14.1; 23939.3 ± 2.4) µM TE/g; 1 and 2 as FRAP (3917.8 ± 2.1; 1522.3 ± 0.9) µM AAE/g; 5 and 2 as TEAC (3190.4 ± 2.8; 2055.0 ± 2.6) µM TE/g. The methanolic extract of S. aurita is a rich source of abietane diterpenes with excellent antioxidant and anti-diabetic activities that can be useful to modulate oxidative stress, and might possibly be excellent candidates for the management of diabetes. This is the first scientific report on the phytochemical isolation and biological evaluation of alpha-glucosidase and alpha-amylase inhibitory activities of Salvia aurita.

Intersectional experiences, socio-cultural meanings, ethnic traditions and morals compound stigma-related stress (Jackson et al., 2020; Schmitz 2019). Sex workers are subject to various stigmatizing forces which can lead to secrecy, isolation and lack of social and cultural support (Koken 2012). Stigmatizing forces include structural humanitarian governance and aid interventions that conflate migration and sex work with insidious constraints and coercion. This study explored how migrant female sex workers from distinctive ethnic cultures manage their identity on a day to day basis in relation to the separation of work and home life. Methods: The perspectives of female sex workers were collected via a series of in-depth semi-structured interviews. The inclusion criteria were that the women had worked in sex work for over 18months, defined their involvement in sex work as voluntary, and were over 18yrs of age. The perspectives of seven women from South Asian (Pakistani), Brazilian, and British backgrounds were analyzed using Grounded Theory (Glaser and Strauss, 1967). Ethnicity was considered to explore how the women experienced stigma, how it impacted on the management of their identity, and how the process of change occurred. Results: The women used a variety of methods to maintain work and home life boundaries, processes they used switch into a role and all experienced stigma and tried to deal with it in ways such as concealment from friends and family. Two core categories and properties emerged from the data as participants felt guilt and/or shame but only the South Asian participants spoke of this with reference to their culture and religion. Conclusion: It was not migration per se but rather the relationship of migration to culture that was key to identity management. Participants reflected that as their country was considered collectivist country with interdependent thought, that any negativity felt could not only be reflected on the individual, but also the entire family. For these reasons Pakistani sex workers were subject to more complex stigmatizing forces, shame and guilt as regards risk and exposure. Discussion focusses on the processes and management strategies used to extend social and cultural support.

This paper discusses the potential and limitations of the Normalized Difference Vegetation Index (NDVI) in environmental justice, health and inequality studies in urban areas. Very often the NDVI is correlated with socioeconomic and/or sociodemographic data to demonstrate the inequality in environmental settings that themselves influence individual health and questions of environmental justice. This paper addresses the limits of the NDVI for such applications and as well its potential, if applied properly. The overall goal is to make people of disciplines other than those that are geo-related aware of the characteristics, limits and potentials of satellite image-based information layers such as NDVI.

Results: A total of 6270 individuals were assessed (1615 severe and 4655 non-severe patients). The median age was 63 (95% CI: 49-74) and 47 (95% CI: 19-63) years in the severe and non-severe groups, respectively. Moreover, about 41% of patients had comorbidities. Severity was higher in patients with history of cerebrovascular disease: OR 4.85 (95% CI: 3.11-7.57). The odds of being in severe group increase by 4.81(95% CI: 3.43-6.74) for history of cardiovascular disease (CVD). This was 4.19 (95% CI: 2.84-6.19) for chronic lung disease and 3.18, 95% CI: 2.09-4.82 for cancer .The odds ratio of a diabetes and hypertension were 2.61 (95% CI: 2.02-3.3), and 2.37( 95% CI: 1.80-3.13) respectively.

Bacteria and archaea participate in and are influenced by processes of substance circulation and energy exchanges in natural environment. Generally, the community changes of bacteria and archaea in sediment are mainly driven by seasonality in mid-latitude regions. But in our study, water diversion to Fen river played a more important role on OTU number, diversity and community structure of bacteria and archaea in sediment than seasonal variation, which was found by 16S rRNA high-throughput sequencing technology. This phenomenon might be caused by external transferred water on the physicochemical water environment and accelerated release of positive nitrogen from sediment caused by rise of water level. Changes of carbon-nitrogen cycle and increase of electrical conductivity (EC) value induced more diversion-responders than season-responders both for bacteria and archaea. Seasonal changes have been influencing bacteria and archaea mildly throughout the whole study reach. After water diversion, the environment indicators relating to bacteria community obviously changed from nutrients to salinity while that for archaea almost disappeared. Our research showed the effects of human activities on the communities of bacteria and archaea outweigh the forcing from natural seasonal changes in mid-latitude regions and revealed the mechanism, highlighting different responses of bacteria and archaea to environmental changes.

Failaka Island is located 20 kilometers east of the Kuwait mainland. The island includes archaeological sites dating back to the Bronze, Hellenistic, Christian, and Islamic ages. To develop the island as a tourist attraction the state is pursuing a new urban plan based on the island's environmental potential. This study is the basis of the urban plan depends on environmental criteria from the view of Geoarchaeology. The study analysis the land-use and land-cover changes of Failaka Island between 1958- 2018. It provides a topographic survey of the island's coastline and a classification of its geomorphological features and a state of the art identification of its archaeological sites by using a drone to make a terrain model. The study used a medium to high-resolution image analysis of the land-use and land-cover changes: WorldView2-50cm 2010 and 2018; Landsat 8; aerial photography; Drone images and a digital elevation model (DEM), to analysis the expected sea level changes by the end of this century. This study also created a geodatabase of the island that can be adapted for future studies. The results emphasize the importance of preserving the historical and ecological features of the island while developing its infrastructure.