Crataegus Oxyacantha is used in the treatment of cardiovascular diseases. In related to your biosafety, only in vitro and in vivo genotoxicity of the fruit and the leaf is described, however, the teratogenic potential is unknown. The aim this study was evaluating the transplacental genotoxicity effect of aqueous and hydroalcoholic extract of leaves C. oxyacantha in a rat model and the quantification of malondialdehyde (MDA) in liver. Three different doses of the aqueous and hydroalcoholic extracts of the C. oxyacantha leaf were administered orally (500, 1000 and 2000 mg/kg) to Wistar rats during 5 days through the pregnancy term (16-21 days), sampling in rats were every 24 h during the last 6 days of gestation and only one sample was taken in neonates at birth. A sample of the mother's and neonate's liver was taken for the determination of MDA. The results show that, at the hepatic level, the evaluated doses of extracts C. oxyacantha in pregnant rats and their pups did not show cytotoxicity. However, the aqueous and hydroalcoholic extract generated cytotoxic and genotoxic damage in the short term. On the other hand, only the aqueous extract showed a teratogenic effect. Based on these results, the aqueous and hydroalcoholic extracts of the C. oxyacantha leaf should not be administered during pregnancy.

A land cover map of two arctic catchments, nearby the Abisko Scientific Research Station, was obtained from a classification of a Sentinel-2 satellite image and a ground survey performed in July 2022. The two contiguous catchments, Miellajokka and Stordalen, are covered by various ecotypes, from boreal forest to alpine tundra and peatland. The Random Forest algorithm correctly identified 83% of polygon pixels reserved for testing. The developed workflow relied solely on open source software and acquired ground observations. Space organization was directed by the altitude as shown by the intersection of the land cover with the topography. Comparison between this new land cover map and previous ones based on data acquired between 2008 and 2011 demonstrates some trends of vegetation cover evolution in response to climate change in the considered area. The potential applications in terms of permafrost modeling (hiperborea.omp.eu) are finally discussed.

Observational studies have linked vitamin D insufficiency to pediatric type 2 diabetes (T2D) , but evidence from vitamin D supplementation trials is sparse. Given the rising prevalence of pediatric T2D in all ethnicities, determining a protective role of vitamin D has significant public health importance. We tested whether serum 25-hydroxyvitamin D (25OHD) levels are causally linked to youth-onset T2D risk using Mendelian randomization (MR). We selected 54 single nucleotide polymorphisms (SNPs) associated with 25OHD in a European genome-wide association study (GWAS) on 443,734 individuals and obtained their effects on pediatric T2D from the multi-ethnic PRODIGY GWAS (3,006 cases/6,061 controls). We applied inverse variance weighted (IVW) MR, and a series of MR methods to control for pleiotropy. We undertook sensitivity analyses in ethnic sub-cohorts of PRODIGY, and using SNPs in core vitamin D genes or ancestry-informed 25OHD SNPs. Multivariable MR accounted for mediating effects of body mass index. We found that a standard deviation increase in 25OHD in the logarithmic scale did not affect youth-onset T2D risk (IVW MR odds ratio (OR) = 1.04, 95% CI=0.96-1.13, P=0.35) in the multi-ethnic analysis, and sensitivity, ancestry-specific and multivariable MR analyses showed consistent results. Our study had limited power to detect small/moderate effects of 25OHD (OR of pediatric T2D < 1.39 to 2.1). In conclusion, 25OHD levels are unlikely to have large effects on risk of youth-onset T2D across different ethnicities.

In spite of its incidence on pistachio trees, the chemical ecology of Labidostomis lusitanica (Germar) (Coleoptera: Chrysomelidae) has been neglected so far. In this work we provide the first evidence of a biologically active male-specific compound that may be promoting field aggregation. Headspace collections by solid-phase microextraction from feral males and females reported the presence of 2-isobutyl-3-methoxypyrazine exclusively on males. Electroantennographic recordings revealed that males and females responded in a dose-dependent manner to increasing stimuli of 2-isobutyl-3-methoxypyrazine, with females overall displaying a higher response than males. In dual-choice tests, both males and females showed a significant preference for the compound in comparison to a pure air stimulus. In the light of these results, the possible role of 2-isobutyl-3-methoxypyrazine as an aggregation cue in L. lusitanica is discussed.

Aim: Exposure to polycyclic aromatic hydrocarbons (PAHs) has been in the past associated with adverse effects on human health among which belong also respiratory diseases. Our study is focused on the evaluation of PAH exposure by measuring the concentrations of their monohydroxylated metabolites (OH-PAHs) in urine and comparing their concentrations with the incidence of respiratory diseases in 2-year-old children from two locations of the Czech Republic – a control locality Ceske Budejovice and a previously highly contaminated mining district Most. Methods: The total number of 248 participants were sampled for urine samples that were analysed for the presence of 11 OH-PAHs using liquid-liquid extraction with ethyl acetate and clean-up employing dispersive solid phase extraction with a sorbent Z-Sep. Separation, identification and quantification of the target compounds was achieved by ultra-high performance liquid chromatography coupled to tandem mass spectrometry. The incidence of respiratory diseases was evaluated according to the questionnaires provided by the paediatricians. Results and discussion: The concentrations of measured OH-PAHs were higher in the urine samples collected from 2-year-old children living in Most compared to 2-year-old children from Ceske Budejovice. The same trend was observed also when the urine samples were analysed when these children were studied as newborns in our previous study. From all of the monitored respiratory diseases, only influenza due to unidentified influenza virus showed a difference between tested locations where the 2-year-old children living in Most were more frequently diagnosed with this disease. Conclusion: Even though the air pollution and lifestyle in both cities is very similar, we have observed higher incidence of respiratory diseases as well as higher concentration of OH-PAHs in urine of the 2-year-old children from Most. Therefore, we hypothesize that the population living in this previously highly contaminated location (in 1970s and 1980s) can carry some long-term health burden.

A human case of dengue virus 2 was detected from a febrile patient living in the Sare yoba, Kolda region (Southern Senegal). Phylogenetic analysis based on the partial sequence of the NS5 gene reveals that the virus belongs to the DENV2 Sylvatic genotype and is closely related to a strain (JF260983/ 98.98% identity) detected in Spain from a tourist who travelled to Guinee Bissau (bordering Kolda region) in 2009. This highlights a potential recent underreported circulation of sylvatic Dengue in the southern part of Senegal and calls for re-enforced integrated surveillance among humans, non-human primates and arboreal mosquitoes throughout a one-health approach.

The detection of waste plastics in the marine and terrestrial environment using satellite Earth Observation data offers the possibility of large-scale mapping, and reducing on-the-ground manual investigation. In addition, costs are kept to a minimum by utilizing free-to-access Copernicus data. A Machine Learning based classifier was developed to run on Sentinel-1 and -2 data. In support of the training and validation, a dataset was created with terrestrial and aquatic cases by manually digitizing varying landcover classes alongside plastics under the sub-categories of greenhouses, plastic, tyres and waste sites. The trained classifier, including an Artificial Neural Network and post-processing decision tree, was verified using five locations encompassing these different forms of plastic. Although exact matchups are challenging to digitize, the performance has generated high accuracy statistics, and the resulting land cover classifications have been used to map the occurrence of plastic waste in aquatic and terrestrial environments.

Minigastrin (MG) analogs for therapy of CCK2R-expressing malignancies are limited by low stability in vivo or excessive accumulation in non-target organs. By modifying the C-terminal receptor-binding sequence, metabolization could be prevented and tumor targeting significantly improved. In this work, N-terminal changes of the peptide length were evaluated. Based on the amino acid sequence of DOTA-MGS5 (DOTA-DGlu-Ala-Tyr-Gly-Trp-(N-Me)Nle-Asp-1Nal-NH₂), two new MG analogs were synthesized, by either introduction of a penta-DGlu moiety or depletion of the four N-terminal amino acids and introduction of a non-charged hydrophilic linker. Two CCK2R-expressing cell lines were used to demonstrate receptor interaction. Stability of the ¹⁷⁷Lu-labeled peptide analogs was evaluated in human serum up to 24 h after incubation and in BALB/c mice up to 30 min after injection. The biodistribution profile and tumor targeting potential was evaluated in xenografted BALB/c nude mice. For both new MG analogs, the combination of strong receptor-specific cell interaction, high stability and enhanced tumor targeting could be demonstrated. Shortening of the peptide sequence lowered the absorption in the dose-limiting organs, whereas elongation increased uptake in renal tissue.

Primary systemic treatment (PST) downsizes the tumor and improves pathological response. The aim of this study is to analyze the feasibility and tolerance of primary concurrent radio-chemotherapy (PCRT) in breast cancer patients. Patients with localized TN/HER2+ tumors were enrolled in this prospective study. Radiation is delivered concomitantly during the first 3 weeks of chemotherapy, and it is based on a 15 fractions scheme (40.5Gy/2.7Gy per fraction to whole breast and nodal levels I-IV. Chemotherapy is based on Pertuzumab-Trastuzumab-Paclitaxel followed by anthracyclines in HER2+ and CBDCA-Paclitaxel followed by anthracyclines in TN breast cancers patients. 58 patients were enrolled, 25 patients (43%) were TN and 33 patients HER2+ (57%). With a median follow-up of 24.2 months, 56 patients completed PCRT and surgery. A total of 35 patients (87.5%) achieved &gt;90% loss of invasive carcinoma cell in the surgical specimen. The 70.8% and the 53.1% of patients with TN and HER-2+ subtype respectively achieved complete pathological response (pCR). This is the first study of concurrent neoadjuvant treatment in breast cancer in which three strategies are applied simultaneously: fractionation of RT in 15 sessions, adjustment of CT to tumor phenotype and local planning by PET. The pCR rates are encouraging.

G‐quadruplexes (G4) are structures formed at the ends of the telomere, these are rich in guanines and were stabilized by molecules that bind to specific sites. TMPyP4 and Thymoquinone (TQ) are small molecules that bind to the G4, they have drawn attention because of their role as telomerase inhibitors. The aim of this study was to evaluate the effects of telomerase inhibitors on cellular proliferation, senescence, and death. Two cell lines LC‐HK2 (NSCLC) and RPE‐1 were treated with TMPyP4 (5μM) and TQ (10μM). Both inhibitors were effective in decreasing telomerase activity. TMPyP4 increased the percentage of cells with membrane damage associated with cell death and decreased the frequency of cells in the S‐phase. TMPyP4 changed the cell adhesion ability and modified the pattern of focal adhesion. TQ acted in a dose‐dependent manner, increasing the frequency of senescent cells, and inducing cell cycle arrest in the G1. In conclusion, the effects of both drugs on LC-HK2 and RPE-1 cell lines were different although both are telomerase inhibitors, because TMPyP4 decreased proteins of cell adhesion and TQ induces a decrease in cell viability.

Matrix metalloproteinases (MMPs) are critical enzymes involved in a variety of cellular processes. MMPs are well known for their ability to degrade the extracellular matrix (ECM) and their extracellular role in cell migration. Recently, more research has been conducted on investigating novel subcellular localizations of MMPs and their intracellular roles at the respective locations. In this review article, we focus on the subcellular localization and novel intracellular roles of two MMPs closely related: membrane-type-1 matrix metalloproteinase (MT1-MMP) and matrix metalloproteinase-2 (MMP-2). Although MT1-MMP is commonly known to localize on the cell surface, the protease also localizes to the cytoplasm, caveolae, Golgi, cytoskeleton, centrosome, and nucleus. At these subcellular locations, MT1-MMP functions in cell migration, macrophage metabolism, invadopodia development, spindle formation and genes expression, respectively. Similar to MT1-MMP, MMP-2 localizes to the caveolae, mitochondria, cytoskeleton, nucleus and nucleolus, and functions in calcium regulation, contractile dysfunction, genes expression and ribosomal RNA transcription. Our particular interest lies in the role MMP-2 and MT1-MMP serve within the nucleus, as it may provide critical insights into cancer epigenetics and tumor migration and invasion. We suggest that targeting nuclear MT1-MMP or MMP-2 to reduce or halt cell proliferation and migration may lead to the development of new therapies in cancer and other diseases.

Crop-type mapping is an important intermediate step for cost-effective crop management at the field level, as an overview of all fields with a particular crop type can be used for monitoring or yield forecasting, for instance. Our study used a data set with 2400 fields and corresponding satellite observations from the federal state of Bavaria, Germany. The study classified corn, winter wheat, winter barley, sugar beet, potato, and winter rapeseed as the main crops grown in Upper Bavaria. We additionally experimented with a rejection class "Other", which summarised further crop types. Corresponding Sentinel-2 data included the normalised difference vegetation index (NDVI) and raw bands from 2016 to 2018 for each selected field. The influence of raw bands compared to NDVI was analysed and the classification algorithms, i.e. support vector machine (SVM) and random forest (RF), were compared. The study showed that the use of an index should be critically questioned and that raw bands provided a wider spectral bandwidth, which significantly improved the mapping of crop types. The results underline the use of RF with raw bands and achieved overall accuracies (OA) of up to 92%. We also predicted crop types in an unknown year with significantly different weather conditions and several months before the end of the growing season. Thus, the influence of climate anomalies and the accuracy depending on the time of prediction were assessed. The crop types of a test site and year without labels could be determined with an OA of up to 86%. The results demonstrate the usefulness of the proof-of-concept and its readiness for use in real applications.

The KRAS mutant population has been undruggable for 40 years. G12C inhibitors and immunotherapy are the beginning of success. It is necessary to summarize the successful experience of the existing treatment model and explore the direction of the next treatment. In this review, we discuss the latest developments in targeted therapy and immunotherapy for KRAS-mutation NSCLC, aiming to provide direction or enlightenment for future treatment strategies.

Diabetes and chronic kidney disease (CKD) are a major public health burden in low-and-middle-income countries. This study aimed to explore factors associated with CKD in patients with type 2 diabetes (T2D) in Bangladesh. A cross-sectional study was conducted among 315 adults with T2D presenting at the outpatient department of Bangladesh Institute of Health Sciences (BIHS) hospital between July 2013 to December 2013. CKD was diagnosed based on estimated Glomerular Filtration Rate using the ‘Modification of Diet in Renal Disease’ equations and presence of albuminuria estimated by the albumin-to-creatinine ratio. Multivariate logistic regression analysis was used to determine the factors associated with CKD. The overall prevalence of CKD among patients with T2D was 21.3%. In the unadjusted model Factors associated with CKD were: aged 40-49 years (OR: 5.7, 95% CI: 1.3-25.4), age 50-59 years (7.0, 1.6-39), age ≥60 years (7.6, 1.7-34); being female (2.2, 1.2-3.8), hypertensive (1.9, 1.1-3.5) and household income between 128.2-256.4 US$ (2.9, 1.0-8.2) compared with income ≤128.2$. However, after adjustment of other covariates, only duration of hypertension and household income (128.2-256.4 US$) remained statistically significant. There is a need to implement policies and programs for early detection and management of hypertension and CKD in T2D patients in Bangladesh.

Abstract: Commercialization of extra virgin olive oil (EVOO) requires a best before date recom-mended at up to 24 months after bottling, stored under specific conditions. Thus, it is expected that the product retains its chemical properties and preserves its ‘extra virgin’ category. However, in-adequate storage conditions could alter the properties of EVOO. In this study, Arbequina EVOO was exposed to five storage conditions for up to one year to study the effects on the quality of the oil and the compounds responsible for flavor. Every 15 or 30 days, samples from each storage condition were analyzed determining physicochemical parameters, the profiles of phenols, volatile compounds, α-tocopherol and antioxidant capacity. Principal component analysis was utilized to better elucidate the relationships between composition of EVOOs and the storage conditions. EVOOs stored at -23 and 23 °C in darkness and 23 °C with light, differed from the oils stored at 30 and 40 °C in darkness. The former were associated with higher quantity of non-oxidized phenolic compounds and the latter with higher elenolic acid, oxidized oleuropein and ligstroside derivatives, which also increased with storage time. E-2-Nonenal (detected at trace levels in fresh oil) was selected as a marker of the degradation of Arbequina EVOO quality over time, with significant linear regressions identified for the storage conditions at 30 and 40 °C. Therefore, early oxidation in EVOO could be monitored by measuring E2-Nonenal levels.

Bone marrow derived adult human mesenchymal stem cells (hMSCs) possess therapeutic qualities that enable them to enhance wound repair. However, the mechanisms by which this occurs remains poorly understood. Basic mechanisms may include the directed migration of delivered cells to target sites and/or the production and release of soluble factors that act at a distance. Allogeneic and even xenogeneic cells may effectively participate in wound repair. Labeled hMSCs were delivered to full-thickness skin wounds that were created in immunologically competent mice. The delivery occurred on day 3 post-wounding using two different carriers; one which released cells and one which retained cells. The fates of the delivered cells were tracked for up to 25 days. During this period, released cells migrated as a tight cohort deep into the wound to reach the subdermal vascular plexus. Simultaneously, enhanced formation of granulation tissue was evident. This migration of hMSCs was not essential in that enhanced granulation tissue formation and wound contraction occurred when cells were retained in the carrier matrix. This provided further evidence for the release of therapeutic factors by hMSCs to sites of injury.

Abstract: An efficient and environmentally Pumice as a new catalyst for designing of 3,4- dihydropyrimidin-2(1H) ones / thiones via one-pot multi component condensation of aromatic aldehydes, urea/ thiourea and ethyl acetoacetate or acetyl acetone in excellent yields (96-99 %). The advantages using of this new catalyst is very cheap, available, non-toxic, stable under thermal conditions, easy work-up, improved yields, the product of reaction is very pure without using chromatographic methods and solvent free conditions.

Type-2 diabetes mellitus (T2DM) have been strongly associated with single nucleotide polymorphisms (SNPs) in the TCF7L2 gene. This study investigated the association between rs12255372, rs7903146 and T2DM in a Ghanaian population. A case-control study design was used for this study. A total of 106 T2DM patients and 110 control participants were selected. Basic data collected included body mass index, blood pressure and socio-demographics. Fasting blood samples were collected and used for serum lipid analysis, HbA1c, plasma glucose estimation and DNA extraction. Common and allele-specific primers were designed for genotyping using the Modified Tetra-Primer Amplification assay. Associations were evaluated using logistic regression models. The rs7903146 risk variant was significantly associated with 2.16 vs 4.06 increased odds for T2DM in patients <60 years vs ≥60 years. Both rs7903146 and rs12255372 are significantly associated with increased odds of T2DM in women, overweight/obese; T2DM negative family history (T2DM-NFH) and low-HDL-C. In a multivariate model, rs7903146 but not rs12255372 was significantly associated with 2.18, 5.01 and 2.25 increased odds of T2DM, under the codominant, recessive and additive model, respectively (p<0.05). The association between rs7903146 and rs12255372 with T2DM is more highly associated in a subgroup- women and those with T2DM-NFH, yet have cardiometabolic risk.

Wheat is one of the global strategic crops and ranks third in terms of cereals production. Wheat crop is exposed to many fungal infections during the cultivation stages, some of which have the ability to secrete numbers of toxic secondary metabolites that threaten the quality of grains, consumer health, producer economics and global trade exchange. Fifty-four random samples were collected from wheat which originated from different countries. The samples included 14 of soft wheat to study the extent of their contamination with Deoxynivalenol (DON) and T-2 toxin by auto-ELISA technology and r-biopharm Microtiter plate. All samples were contaminated with DON toxin except one sample, and the contamination average ranged between 40.7 and 1018.8 µg kg-1. The highest contamination rates were in Lithuanian and the lowest in Indian wheat. Meanwhile the highest average level of T-2 toxin contamination was in Lithuanian wheat grains with a rate of 377.4µg kg-1 and the lowest in Polish wheat with an average of 115.3µg kg-1. GC-MS/MS and multiple reaction monitoring mode (MRM), was used to detect 15 triazole derivatives in collected samples, which may be used to combat fungal diseases on wheat during the growing season. Only 9 derivatives were found; Simeconazole, Penconazole, Hexaconazole, Cyproconazole, Diniconazole, Tebuconazole, Metconazole, Fenbuconazole and Difenoconazole. These derivatives varied according to the origin of wheat samples as well as their its concentration whereas, another 6 derivatives were not detected in all samples. A direct inverse relationship was found between the DON concentration in the samples and the residues of Simeconazole, Penconazole, Diniconazole, Tebuconazole, Metconazole, Fenbuconazole and Difenoconazole and the T-2 toxin showed the same relationship except for Tebuconazole. The safe and rational use of some triazole derivatives may be a new approach and a promising strategy not only to reduce plant diseases and their problems, but also to get rid of some mycotoxins as contaminates.

Tissue resident memory T cells (TRM) were first described in 2009. While initially the major focus was on CD8 TRM, there has been recently an increased interest in defining the phenotype and the role of CD4 TRM in diseases. Circulating CD4 T cells seed tissue CD4 TRM, but there also appears to be an equilibrium between CD4 TRM and blood CD4 T cells. CD4 TRM are more mobile than CD8 TRM, usually localized deeper within the dermis/lamina propria and yet may exhibit synergy with CD8 TRM in disease control. This has been demonstrated in herpes simplex infections in mice. In human recurrent herpes infections, both CD4 and CD8 TRM persisting between lesions may control asymptomatic shedding through interferon gamma secretion, although this has been more clearly shown for CD8 T cells. The exact role of the CD4/CD8 TRM axis in the trigeminal ganglia and/or cornea in controlling recurrent herpetic keratitis is unknown. In HIV, CD4 TRM have now been shown to be a major target for productive and latent infection in cervix. In HSV and HIV co-infections, CD4 TRM persisting in the dermis support HIV replication. Further understanding of the role of CD4 TRM and their induction by vaccines may help control sexual transmission by both viruses.

Although RNA modifications were discovered decades ago, the identification of enzymes that write, read, and erase RNA modifications enabled their functional study and spawned the field of epitranscriptomics. Coupling that knowledge to new methods has enabled the precise pinpointing of epitranscriptomic modifications across the transcriptome plus the elucidation of their functional consequences. PCIF1 (Phosphorylated CTD Interacting Factor 1) was shown to add N6, 2’-O-dimethyladenosine (m⁶Am) marks at the first nucleotide after the 5’ N7-methylguanosine (m⁷G) cap. In this review, we discuss the epitranscriptomic regulation of mRNA in general, and focus on m⁷G cap-adjacent m⁶Am in particular. m⁶Am positions can now be distinguished from N6-methyladenosine (m⁶A) using new techniques leveraging PCIF1-knockout cells. Although m⁶Am modification sites can be detected precisely, conflicting data have been published regarding how cap-adjacent m⁶Am marks affect their host mRNA. Discrepancies in the data mean that the effects of cap-adjacent m⁶Am on mRNA stability, decapping, and translation continue to be debated. Finally, while PCIF1 is predominantly nuclear, a subset of results suggest a possible cytoplasmic role as well. Taken together, these contradictory results which employed different methodologies and cell lines means that further experiments are required to determine the ultimate biological function(s) of m⁷G cap-adjacent m⁶Am.

Hepatic encephalopathy (HE) is a form of brain dysfunction that is specifically caused by liver insufficiency and/or portal-systemic shunt. The exact nature of HE is debated, so that conflicting uses of the term HE may cause inconsistencies in its detection and, in turn, issues with its management. This review highlights the meaning of the term HE on the basis of both its historical origins and current consensus. It also provides criteria for the diagnosis of the condition, on the basis of its phenotypes and the risk factors for its occurrence. The procedure for differential diagnosis from other conditions which result in similar phenotypes is considered, together with precipitants and confounders. Finally, the current multidimensional approach for the correct clinical recording of HE episodes is discussed.

It is common knowledge that increasing CO₂ concentration plays a major role in enhancement of the greenhouse effect and contributes to global warming. The purpose of this study is to complement the conventional and established theory that increased CO₂ concentration due to human emissions causes an increase of temperature, by considering the reverse causality. Since increased temperature causes an increase in CO₂ concentration, the relationship of atmospheric CO₂ and temperature may qualify as belonging to the category of “hen-or-egg” problems, where it is not always clear which of two interrelated events is the cause and which the effect. We examine the relationship of global temperature and atmospheric carbon dioxide concentration at the monthly time step, covering the time interval 1980–2019, in which reliable instrumental measurements are available. While both causality directions exist, the results of our study support the hypothesis that the dominant direction is T → CO₂. Changes in CO₂ follow changes in T by about six months on a monthly scale, or about one year on an annual scale. We attempt to interpret this mechanism by involving biochemical reactions, as at higher temperatures soil respiration, and hence CO₂ emission, are increasing.

For more than ten years, Central Chile faces drought conditions, which impact crop production and quality, increasing food security risk. Under this scenario, implementing management practices that allow increasing water use efficiency is urgent. The study was carried out in kiwifruit trees, located in the O’Higgins region, Chile; for season 2018-2019 and 2019-2020. We evaluate nine vegetation indices in the VNIR and SWIR regions derived from Sentinel-2 (A/B) satellites to know how much variability in the canopy water status could explain. Over the study's site were installed sensors that continuously measure the leaf's turgor pressure (Yara Water-Sensor). A strong correlation between turgor pressure and vegetation indices was obtained with the Spearman's rho coefficient ($\rho$). However, the NIR range's indices were influenced by the vegetative development of the crop rather than its water status. Red-edge showed better performance as the vegetative growth did not affect it. It is necessary to expand the study to consider higher variability in kiwifruit's water conditions and incorporate the sensitivity of different wavelengths.

IIAEK (Ile-Ile-Ala-Glu-Lys, lactostatin) is a novel pentapeptide from bovine milk β-lactoglobulin which lowers cholesterol levels. However, the molecular mechanisms underlying the suppression of intestinal cholesterol absorption by IIAEK are unknown. Therefore, we evaluated the effects of IIAEK on intestinal cholesterol metabolism in Caco-2 cells in a human intestinal model. We found that IIAEK significantly reduced the expression of intestinal cholesterol metabolism-associated genes, particularly that of the ATP-binding cassette transporter A1 (ABCA1) protein. Subsequently, we chemically synthesized a novel molecular probe, IIXEK, which can visualize a complex of target proteins interacting with photoaffinity-labeled IIAEK by fluorescent substances. Photoaffinity labeling and MS analysis with IIXEK for the rat small intestinal mucosa and intestinal lipid raft fractions of Caco-2 cells, we identified intestinal alkaline phosphatase (IAP) as a specific molecule interacting with IIAEK and discovered IIAEK common binding amino acid sequence, GFYLFVEGGR. Transfection of IAP siRNA counteracted the decrease in ABCA1 mRNA levels in Caco-2 cells. IIAEK significantly increased IAP mRNA and protein levels, and significantly decreased ABCA1 mRNA and protein levels in Caco-2 cells. In conclusion, we found that IIAEK targets IAP to improve cholesterol metabolism via a novel signaling pathway with a specific activation of IAP and down-regulation of intestinal ABCA1.

This paper presents the super-twisting algorithm (STA) direct power control (DPC) scheme for the control of active and reactive powers of grid-connected DFIG. Simulations of 5 KW DFIG has been presented to validate the effectiveness and robustness of the proposed approach in the presence of uncertainties with respect to vector control (VC). The proposed controller schemes with fixed gains are effective in reducing the ripple of active and reactive powers, effectively suppress sliding-mode chattering and the effects of parametric uncertainties not affecting system performance.

Water-soluble and cytocompatible polymers were investigated to enhance a transporting efficiency of biomolecules into cells in vitro. The polymers composed of 2-methacryloyloxyethyl phosphorylcholine (MPC) unit, a hydrophobic monomer unit, and a cationic monomer unit bearing an amino group were synthesized for complexation with model biomolecules, siRNA. The cationic MPC polymer was shown to interact with both siRNA and the cell membrane and was successively transported siRNA into cells. When introducing 20 − 50 mol% hydrophobic units into the cationic MPC polymer, transport of siRNA into cells. The MPC units (10 − 20 mol%) in the cationic MPC polymer were able to impart cytocompatibility, while maintaining interaction with siRNA and the cell membrane. The level of gene suppression of the siRNA/MPC polymer complex was evaluated in vitro and it was as the same level as that of a conventional siRNA transfection reagent, whereas its cytotoxicity was significantly lower. We concluded that these cytocompatible MPC polymers may be promising complexation reagent for introducing biomolecules into cells, with the potential to contribute to future fields of biotechnology, such as in vitro evaluation of gene functionality, and the production of engineered cells with biological functions.

Inflammation plays a key role in the development and progression of type-2 diabetes (T2D), a disease characterised by peripheral insulin resistance and systemic glucolipotoxicity. Visceral adipose tissue (AT) is the main source of inflammation early in disease course. Macrophages are innate immune cells that populate all peripheral tissues, including AT. Dysregulated AT macrophage (ATM) responses to microenvironmental changes are at the root of aberrant inflammation and development of insulin resistance, locally and systemically. The inflammatory activation of macrophages is regulated at multiple levels: cell surface receptor stimulation, intracellular signalling, transcriptionally and metabolically. This review will cover the main mechanisms involved in AT inflammation and insulin resistance in T2D. First, we will describe the physiological and pathological changes in AT that lead to inflammation and insu- lin resistance. We will next focus on the transcriptional and metabolic mechanisms described that lead to the activation of ATMs. We will discuss more novel metabolic mechanisms that influence macrophage polarisation in other disease or tissues contexts that may be relevant to future work in insulin resistance and T2D.

It is proposed that both human creativity and human consciousness are (unintended) consequences of the human brain’s extraordinary energy efficiency. The topics of creativity and consciousness are treated separately, though have a common sub-structure. It is argued that creativity arises from a synergy between two cognitive modes of the human brain (which broadly coincide with Kahneman’s Systems 1 and 2). In the first, available energy is spread across a relatively large network of neurons. As such, the amount of energy per active neuron is so small that the operation of such neurons is susceptible to thermal (ultimately quantum decoherent) noise. In the second, available energy is focussed on a small enough subset of neurons to guarantee a deterministic operation. An illustration of how this synergy can lead to creativity with implications for computing in silicon are discussed. Starting with a discussion of the concept of free will, the notion of consciousness is defined in terms of an awareness of what are perceived to be nearby counterfactual worlds in state space. It is argued that such awareness arises from an interplay between our memories on the one hand, and quantum physical mechanisms (where, unlike in classical physics, nearby counterfactual worlds play an indispensable dynamical role) in the ion channels of neural networks. As with the brain’s susceptibility to noise, it is argued that in situations where quantum physics plays a role in the brain, it does so for reasons of energy efficiency. As an illustration of this definition of consciousness, a novel proposal is outlined as to why quantum entanglement appears so counter-intuitive.

In this review, we discuss the insulin resistance (IR) and its development in the insulin target tissues that leads to diabetes. Also, we highlight the use of induced pluripotent stem cells (iPSCs) to understand the mechanisms underlying the development of IR. IR is associated with several metabolic disorders, including type 2 diabetes (T2D). The development of IR in insulin target tissues involves genetic and acquired factors. Persons at genetic risk for T2D tend to develop IR several years before glucose intolerance. Although there are currently several mouse models for both IR and T2D that had provided a lot of information about the disease, these models cannot recapitulate all the aspects of this complex disease as seen in each individual. Patient-specific iPSCs can overcome the hurdles faced with the classical mouse models for studying IR. iPSC technology can generate cells genetically identical to IR individuals, which can help in distinguishing between genetic and acquired defects in insulin sensitivity. Combining the technologies of the genome editing and iPSCs may provide important information about the inherited factors underlying the development of different forms of IR. Further studies are required to fill the gaps in understanding the pathogenesis of IR and diabetes.

In Portugal, cork oak (Quercus suber L.) stands cover 737 Mha, being the most predominant species of the montado agroforestry system, contributing for the economic, social and environmental development of the country. Cork oak decline is a known problem since the late years of the 19th century that has recently worsen. The causes of oak decline seem to be a result of slow and cumulative processes, although the role of each environmental factor is not yet established. The availability of Sentinel-2 high spatial and temporal resolution dense time series enables gradual processes monitoring. These processes can be monitored using spectral vegetation indices (VI) once their temporal dynamics are expected to be related with green biomass and photosynthetic efficiency. The Normalized Difference Vegetation Index (NDVI) is sensitive to structural canopy changes, however it tends to saturate at moderate-to-dense canopies. Modified VI have been proposed to incorporate the reflectance in the red-edge spectral region, which is highly sensitive to chlorophyll content while largely unaffected by structural properties. In this research, in-situ data on the location and vitality status of cork oak trees are used to assess the correlation between chlorophyll indices (CI) and NDVI time series trends and cork oak vitality at the tree level. Preliminary results seem to be promising since differences between healthy and unhealthy (diseased/dead) trees were observed.

A pattern of NK cell heterogeneity in each individual determines proliferative and functional responses of NK cells to activating stimuli. Obtaining the progeny of a single cell by cloning original population is one of the ways to study the NK cell heterogeneity. In this work, we used single cell sorting into a plate and stimulation by IL-2 and gene-modified K562 feeder cells expressing membrane-bound IL-21 (K562-mbIL21) that led to generation of phenotypically confirmed and functionally active NK cell clones. We applied two models of clone cultivation, which differently affected their phenotype, lifespan and functional activity. The first model, which included weekly restimulation of clones with K562-mbIL21 and IL-2, resulted in the generation of relatively short-lived (5-7 weeks) clones of highly activated NK cells. HLA-DR expression in the expanded NK cells correlated strongly with IFN-γ production. The second model, in which NK cells were restimulated mainly with IL-2 alone, produced long-lived clones (8-14 weeks) that expanded up to 10⁷ cells with lower ability to produce IFN-γ. Our method is applicable for studying variability in phenotype, proliferative and functional activity of the certain NK cell progeny in response to the stimulation, which may help in selecting NK cells best suited for clinical use.

The peripheral lymphatic system plays a crucial role in the recovery mechanisms after many pathological changes, such as infection, trauma, vascular, or metabolic diseases. The lymphatic clearance of different tissues from waste products, viruses, bacteria and toxic proteins significantly contributes to the correspondent recovery processes. However, understanding of the meningeal lymphatics functions is a challenging problem. The exploration of mechanisms of lymphatic communication with brain fluids as well as the role of the lymphatic system in the brain drainage, clearance and recovery are still in its infancy. Here we review novel concepts on the anatomy and physiology of the lymphatics in the brain, which warrant a substantial revision of our knowledge about the role of lymphatics in the rehabilitation of the brain functions after neural pathologies. We discuss a new vision on how to recruit the meningeal lymphatics by the opening of blood-brain barrier as a trigger mechanism of activation of the meningeal lymphatic drainage. This leads to innovative strategies in neurorehabilitation therapy.

Production of energy is a main task of cancer cells metabolism, since costs of duplicating are enormous. Although energy is derived in cells by dismantling carbon to carbon bonds of any macronutrient, cancer nutritional needs for energetic purposes have been studied primarily as dependent on glycolysis. Since the end of the last century, awareness of dependence of cancer metabolism on amino acids not only for protein syntheses but also for matching energy needs has grown. The roles of specific amino acids, like glutamine, glycine and serine have been explored in different experimental conditions and reviewed. Moreover, there are epidemiological evidences that some amino acids used as supplement for therapeutic reasons (the branched chain ones) may reduce incidence of liver cancer, and some molecular mechanism has been proposed as functional to their protective action. On the contrary, metabolic signature of some pathology connected with increased risk of cancer, like prolonged hyperinsulinemia in insulin resistant patients, is signed by plasma elevated levels of the same branched chain amino acids, posing puzzling questions to clinicians. Most recently, peculiar formulations of amino acids, deeply different if compared to amino acids compositions normally present in foods, have shown the power to master epigenetics slowing growth or driving cancer cells to apoptotic death, while being even beneficial for normal cells and for animals health and life span. In this review, we will analyze and try to disentangle some of the many knots dealing with complexities of amino acids biology and linked to cancer metabolism.

To circumvent the thermodynamic limitation of the synthesis of oxazolidinones starting from 2-aminoethanols and CO2 and realize incorporation CO2 under atmospheric pressure, a protic ionic liquid-facilitated three-component reaction of propargyl alcohols, CO2 and 2-aminoethanols was developed to produce 2-oxazolidinones along with equal amount of α-hydroxyl ketones. The ionic liquid structure, reaction temperature and reaction time were in detail investigated. And 15 mol% [TBDH][TFE] (1,5,7-triazabicylo[4.4.0]dec-5-ene trifluoroethanol) was found to be able to synergistically activate the substrate and CO2, thus catalyzing this cascade reaction under atmospheric CO2 pressure. By employing this task-specific ionic liquid as sustainable catalyst, 2-aminoethanols with different substituents were successfully transformed to 2-oxazolidinones with moderate to excellent yield after 12 h at 80 oC. This three-component reaction running under atmospheric pressure proves to be a clever detour to avoid the thermodynamic issue in the synthesis of 2-oxazolidinones starting from 2-aminoethanols and CO2.

The snow melt from the High Atlas is a critical water resource in Morocco. In spite of its importance, monitoring the spatio-temporal evolution of key snow cover properties like the snow water equivalent remains challenging due to the lack of in situ measurements at high elevation. Since 2015, the Sentinel-2 mission provides high spatial resolution images with a 5 day revisit time, which offers new opportunities to characterize snow cover distribution in mountain regions. Here we present a new data assimilation scheme to estimate the state of the snowpack without in situ data. The model was forced using MERRA-2 data and a particle filter was developed to dynamically reduce the biases in temperature and precipitation using Sentinel-2 observations of the snow cover area. The assimilation scheme was implemented using SnowModel, a distributed energy-balance snowpack model and tested in a pilot catchment in the High Atlas. The study period covers 2015-2016 snow season which corresponds to the first operational year of Sentinel-2A, therefore the full revisit capacity was not yet achieved. Yet, we show that the data assimilation led to a better agreement with independent observations of the snow height at an automatic weather station and the snow cover extent from MODIS. The performance of the data assimilation scheme should benefit from the continuous improvements in MERRA-2 reanalyses and the full revisit capacity of Sentinel-2.

Herpes simplex virus (HSV) infections can be treated with direct acting antivirals like acyclovir and foscarnet, but long-term use can lead to drug resistance, which motivates research into broadly-acting antivirals that can provide a greater genetic barrier to resistance. Photodynamic inactivation (PDI) employs a photosensitizer, light, and oxygen to create a local burst of reactive oxygen species that inactivate microorganisms. The botanical plant extract Orthoquin^TM is a powerful photosensitizer with antimicrobial properties. Here we report that Orthoquin also has antiviral properties. Photoactivated Orthoquin inhibited herpes simplex virus type 1 (HSV-1) and herpes simplex virus type 2 (HSV-2) infection of target cells in a dose-dependent manner, across a broad range of sub-cytotoxic concentrations. HSV inactivation required direct contact between Orthoquin and the inoculum, whereas pre-treatment of target cells had no effect. Orthoquin did not cause appreciable damage to viral capsids or pre-mature release of viral genomes as measured by qPCR for the HSV-1 genome. By contrast, immunoblotting for HSV-1 antigens in purified virion preparations suggested that higher doses of Orthoquin had a physical impact on certain HSV-1 proteins that altered protein mobility or antigen detection. Orthoquin PDI also inhibited the non-enveloped adenovirus (AdV) in a dose-dependent manner, whereas Orthoquin-mediated inhibition of the enveloped vesicular stomatitis virus (VSV) was light-independent. Together, these findings suggest that broad antiviral effects of Orthoquin-mediated PDI may stem from damage to viral attachment proteins.

An efficient, eco-compatible and very cheap method for the construction of triazoles via eliminative azide–olefin cycloaddition (EAOC) reaction has been developed by a catalytic system IL/FeCl3, offering an highly regioselective approach to structurally diverse 1,5-disubstituted 1,2,3-triazoles in up to 95% yield. This strategy features the reuse of catalytic system through simple operations. Mechanistic studies indicated that an asynchronous concerted dipolar cycloaddition-elimination process might be involved.

The combination of freeze-dried aronia, red ginseng, ultraviolet-irradiated shiitake mushroom and natokinase (AGM; 3.4: 4.1: 2.4: 0.1) was examined to evaluate its effects on insulin resistance, insulin secretion and gut microbiome in a non-obese type 2 diabetic animal model. Pancreatectomized (Px) rats were provided high fat diets supplemented with either of 1) 0.5 g AGM (AGM-L), 2) 1 g AGM (AGM-H), 3) 1 g dextrin (control), or 4) 1g dextrin with 120 mg metformin (positive-control) per kg body weight for 12 weeks. AGM (1 g) contained 6.22 mg cyanidin-3-galactose, 2.5 mg ginsenoside Rg3 and 0.6 mg β-glucan. Px rats had decreased bone mineral density in the lumbar spine and femur and lean body mass in the hip and leg compared to the normal-control and AGM-L and AGM-H prevented the decrease. Visceral fat mass was lower in the control group than the normal-control group and its decrease was smaller by AGM-L and AGM-H. HOMA-IR was lower in descending order of the control, positive-control, AGM-L, AGM-H and normal-control groups. Glucose tolerance was deteriorated in the control group and it was improved by AGM-L and AGM-H more than in the positive-control group. Glucose tolerance is associated with insulin resistance and insulin secretion. Insulin tolerance indicated insulin resistance was highly impaired in diabetic rats, but it was improved in the ascending order of the positive-control, AGM-L and AGM-H. Insulin secretion capacity, measured by hyperglycemic clamp, was much lower in the control group than the normal-control group and it was improved in the ascending order of the positive-control, AGM-L and AGM-H. Diabetes modulated the composition of gut microbiome and AMG prevented the modulation of gut microbiome. In conclusion, AGM improved glucose metabolism by potentiating insulin secretion and reducing insulin resistance in insulin deficient type 2 diabetic rats. The improvement of diabetic status alleviated body composition changes and prevented changes of gut microbiome composition.

Metformin use in pregnancy is increasing worldwide as randomised controlled trial (RCT) evidence is emerging demonstrating its safety and efficacy. The Metformin in Gestational Diabetes (MiG) RCT changed practice in many countries demonstrating that metformin had similar pregnancy outcomes to insulin therapy with less maternal weight gain and a high degree of patient acceptability. A multicentre RCT is currently assessing the addition of metformin to insulin in pregnant women with type 2 diabetes. RCT evidence is also available for the use of metformin for women with Polycystic Ovarian Syndrome and for non-diabetic women with obesity. No evidence of an increase in congenital malformations or miscarriages has been observed even when metformin is started before pregnancy and continued to term. Body composition and metabolic outcomes at two, seven and nine years have now been reported for the offspring of mothers treated in the MiG study. In this review, we will briefly discuss the action of metformin and then consider the evidence from the key clinical trials.

Though melatonin is known to improve ultraviolet B (UVB)-induced oxidative damage and inflammatory conditions via blockade of nuclear factor (NF)-κB, interleukin (IL)-6, there is no report on anti-wrinkle effect of melatonin to date. Hence in the present study, anti-wrinkle mechanism of melatonin was elucidated in UVB treated HaCaT keratinocytes and hairless mice. Herein melatonin protected against a radical initiator tert-Butyl hydroperoxide (t-BOOH) induced reactive oxygen species (ROS) production, matrix metalloprotease 1 (MMP-1) and cytotoxicity in HaCaT keratinocytes. Also, melatonin suppressed the expression of sonic hedgehog (SHH) and GLI for hedgehog signaling, p-NF-kB, cyclooxygenase (COX-2), p-ERK for inflammatory responses in UVB treated HaCaT keratinocytes. Furthermore, melatonin protected skin from wrinkle formation, transdermal water loss in hairless mice irradiated by UVB for 8 weeks. Notably, melatonin prevented against epidermal thickness and dermal collagen degradation in UVB irradiated hairless mice by Hematoxylin & Eosin and Masson’s trichrome staining. Taken together, these findings suggest that melatonin reduces wrinkle formation via inhibition of ROS/SHH and inflammatory proteins such as NF-kB/COX-2/ERK/MMP1.

Shiga toxin (Stx) produced by Escherichia coli is the main pathogenic factor of diarrhea-associated hemolytic uremic syndrome (HUS), which is characterized by obstruction of renal microvasculature by platelet-fibrin thrombi. It is well known that the oxidative imbalance generated by Stx induces platelet activation, contributing to thrombus formation. Moreover, activated platelets release soluble CD40 ligand (sCD40L) which in turn contributes to oxidative imbalance, triggering the release of reactive oxidative species (ROS) on various cellular types. The aim of this work was to determine if the interaction between the oxidative response and platelet-derived sCD40L participates in the pathogenic mechanism during HUS. Activated human glomerular endothelial cells (HGEC) by Stx2 induced platelets to adhere to them. Although platelet adhesion did not contribute to endothelial damage, high levels of sCD40L were released to the medium. The release of sCD40L by activated platelets was inhibited by antioxidant treatment. Furthermore, we found increased levels of sCD40L in plasma from HUS patients, which were also able to trigger the respiratory burst in monocytes, in a sCD40L-dependent manner. Thus, we concluded that platelet-derived sCD40L and the oxidative response are reciprocally stimulated during Stx2-associated HUS. This process may contribute to the evolution of glomerular occlusion and the microangiopathic lesions.

Distribution systems can form islands when faults occur. Each island represents a subsection with variable boundaries subject to the location of a fault(s) in the system. A subsection with variable boundaries is referred to as island in this paper. For operation in autonomous mode, it is imperative to detect the island configurations and stabilize these subsections. This paper presents a novel scheme for the detection of islanding boundaries and stabilizing the system during autonomous operation. In the first stage, a boundary detection method is proposed to detect the configuration of the island. In the second stage a dynamic voltage sensitivity factor (DVSF) is proposed to assess the dynamic performance of the system. In the third stage, a wide area load shedding program is adopted based on DVSF to shed the load in weak busbars and stabilize the system. The proposed scheme is validated and tested on a generic 18-bus system using a combination of EMTDC/PSCAD and MATLAB softwares.

β-Lactams are pharmacologically important compounds because of their various biological uses, including antibiotic and so on. β-Lactams were synthesized from benzylidene-inden derivatives and acetoxyacetyl chloride. The inhibitory effect of these compounds was also examined for human carbonic anhydrase I and II (hCA I, and II) and acetylcholinesterase (AChE). The results reveal that β-lactams are inhibitors of hCA I, II and AChE. The K_i values of β-lactams (2a-k) were 0.44-6.29 nM against hCA I, 0.93-8.34 nM against hCA II, and 0.25-1.13 nM against AChE. Our findings indicate that β-lactams (2a-k) inhibit both CA isoenzymes and AChE at low nanomolar concentrations.

Severe acute respiratory syndrome coronavirus 2 (SARS-Cov-2/2019-nCoV) infection is an emerging pandemic. The virus binds to angiotensin converting enzyme 2 (ACE2) and TMPRSS2 which are abundantly expressed on various human cells including lung epithelial cells and intestinal cells and the virus can infect these cells. Currently no specific treatments or vaccines are available for this disease. A per oral live attenuated vaccine can be beneficial in SARS-Cov-2 infection because the attenuated virus initially infects the gut, stimulates the mucosa associated immune system sparing the respiratory system during the initial immune response. The live virus can also spread in the community boosting herd immunity.

Traditional photodynamic therapy (PDT), a clinical cancer therapeutic approach using light in killing cancer cells, is often limited by insufficient light penetration, inefficient photosensitizer energy transfer, and inadequate oxygen in hypoxic tumors. Employing X-ray to activate photosensitizer in PDT can potentially overcome these limitations. Here, we compared protocols to synthesize a novel nano-photosensitizer composed of a europium-doped yttrium oxide core with a silica shell (Y₂O₃:Eu@SiO₂) which can be utilized in such therapeutic method, i.e., X-ray activated PDT (XPDT). Transmission electron microscopy (TEM) and dihydroethidium (DHE) were utilized to evaluate the effects of various synthesis conditions on the characteristics of Y₂O₃:Eu@SiO₂ and their ability to generate reactive oxygen species (ROS). The in vivo tumor suppression effects of the Y₂O₃:Eu@SiO₂ were assessed by ¹⁸F-fluorothymidine position emission tomography (¹⁸F-FLT PET) in human ovarian cancer xenografts using radiation sensitive CAOV3 and radiation resistant SKOV3 cell lines. Our data revealed a positive correlation between nanoparticle condensation time and core size as well as a negative correlation between urea concentrations and core size. Addition of cetyltrimethylammonium bromide (CTAB) during core synthesis enhanced particle dispersion. Two silica coating conditions showed the greatest efficiency in the enhancement of ROS generation. Furthermore, our in vivo study revealed suppression of tumor growth by Y₂O₃:Eu@SiO₂ administration when compared to non-treated control. Silica shell provides flexibility to conjugate moieties that specifically target to cancers. This nano-photosensitizer demonstrates the significant promise for overcoming limitations of conventional PDT and combating various cancers in clinical applications.

Evidence-based medicine (EBM) is in crisis, in part due to bad methods, which are understood as misuse of statistics that is considered correct in itself. This article exposes two related common misconceptions in statistics, the effect size (ES) based on correlation (CBES) and a misconception of contingency tables (MCT). CBES is a fallacy based on misunderstanding of correlation and ES and confusion with 2 × 2 tables, which makes no distinction between gross crosstabs (GCTs) and contingency tables (CTs). This leads to misapplication of Pearson’s Phi, designed for CTs, to GCTs and confusion of the resulting gross Pearson Phi, or mean-square effect half-size, with the implied Pearson mean square contingency coefficient. Generalizing this binary fallacy to continuous data and the correlation in general (Pearson’s r) resulted in flawed equations directly expressing ES in terms of the correlation coefficient, which is impossible without including covariance, so these equations and the whole CBES concept are fundamentally wrong. MCT is a series of related misconceptions due to confusion with 2 × 2 tables and misapplication of related statistics. The misconceptions are threatening because most of the findings from contingency tables, including CBES-based meta-analyses, can be misleading. Problems arising from these fallacies are discussed and the necessary changes to the corpus of statistics are proposed resolving the problem of correlation and ES in paired binary data. Since exposing these fallacies casts doubt on the reliability of the statistical foundations of EBM in general, we urgently need to revise them.

Cornea severe inflammation produces opacity or even perforation, scarring, and angiogenesis, resulting in blindness. The cornea can be used to study the effect of new anti-angiogenic chemopreventive agents. We researched the anti-angiogenic effect of two extracts, Methanol (Met) and Hexane (Hex), from the seed of Cucurbita argyrosperma, in the inflamed corneas. The corneas of Wistar rats were alkali-injured and treated intragastrically for seven successive days. Clinical manifestation as opacity score, corneal neovascularization (CNV) area, re-epithelialization percentage, and histological evaluation were performed. Inflammatory (COX-2, NF-κB, and IL-1β), and angiogenic (VEGF-A, VEGFR1, VEGFR2) markers were assessed by immunohistochemistry. Cox-2, Il-1β, and Vegf-a mRNA levels were also determined. After treatments, we observed slim corneal thickness with lower opacity scores and low cell infiltration compared to untreated rats. Treatment also accelerated wound healing and decreased CNV area. The staining of inflammatory and angiogenic factors was significantly decreased. These effects are related to a down-expression of Cox-2, Il-1β, and Vegf. These results suggest that intake of C. argyrosperma seed can be used to attenuate the angiogenesis secondary to inflammation in corneal chemical damage.

Human coronaviruses cause both upper and lower respiratory tract infections in humans. In 2012 a sixth human coronavirus (hCoV) was isolated from a patient presenting with severe respiratory illness. The 60-year-old man died as a result of renal and respiratory failure after admission to a hospital in Jeddah, Saudi Arabia. The aetiological agent was eventually identified as a coronavirus and designated Middle East respiratory syndrome coronavirus (MERS-CoV). MERS-CoV has now been reported in more than 27 countries across the Middle East, Europe, North Africa and Asia. As of July 2017, 2040 MERS-CoV laboratory confirmed cases, resulting in 712 deaths, were reported globally, with a majority of these cases from the Arabian Peninsula. This review summarises the current understanding of MERS-CoV, with special reference to the (i) genome structure, (ii) clinical features, (iii) diagnosis of infection and (iv) treatment and vaccine development.

Metabolic dysfunction-associated steatotic liver disease (MASLD) is a serious health problem, and recent evidence indicates that gut microbiota plays a key role in its development. It is known that 2-oleoyl glycerol (2-OG) produced by the gut microbiota is associated with hepatic fibrosis, but it is not known whether this metabolite is involved in the development of hepatic steatosis. The aim of this study was to evaluate how a high-fat sucrose diet (HFS) increases 2-OG production through gut microbiota dysbiosis and to identify whether this metabolite modifies hepatic lipogenesis and mitochondrial activity for the development of hepatic steatosis as well as whether a combination of functional foods can reverse this process. Wistar rats were fed HFS diet for 7 mo. At the end of the study, body composition, biochemical parameters, gut microbiota, protein abundance of lipogenic and antioxidant enzymes, measurement of liver 2-OG, and mitochondrial function were assessed in rats and we studied the effect of HFS with functional foods. In humans with MASLD, we analyzed gut microbiota and serum 2-OG. Consumption of HFS diet in Wistar rats caused oxidative stress, hepatic steatosis and gut microbiota dysbiosis, decreasing α-diversity and increased Blautia producta abundance, which increased 2-OG. This metabolite increased de novo lipogenesis through ChREBP and SREBP-1. 2-OG significantly increased mitochondrial dysfunction. Addition of functional foods to the diet modified the gut microbiota, reducing B. producta and 2-OG levels, leading to a decrease in body weight gain, body fat mass, serum glucose, insulin, cholesterol, triglycerides, fatty liver formation, and increased mitochondrial function. In order to use 2-OG as biomarker, this metabolite was measured in healthy subjects or with MASLD and it was observed that subjects with hepatic steatosis II and III had significantly higher 2-OG than healthy subjects, suggesting that the abundance of this circulating metabolite could be a predictor marker of hepatic steatosis.

Appropriate animal models of human diseases are a cornerstone in the advancement of science and medicine. To create animal models of neuropsychiatric and neurobehavioral diseases such as ASD necessitates the development of sufficient neurobehavioral measuring tools to translate human behavior to expected measurable behavioral features in animals. Indeed, at least in rodents, adequate neurobehavioral and neurological tests have been developed. Since ASD is characterized by a number of specific behavioral trends with significant severity, animal models of autistic-like behavior have to demonstrate the specific characteristic features, namely impaired social interactions, and communication, restricted, repetitive behavioral patterns with association to several additional impairments such as somatosensory, motor and memory impairments. Thus, an appropriate model must show behavioral impairment of a minimal number of neurobehavioral characteristics using an adequate number of behavioral tests. The proper animal models enable the study of ASD like-behavior from the etiologic, pathogenetic and therapeutic aspects. From the etiologic aspects, models have been developed by the use of immunogenic substances like polyinosinic-polycytidylic acid (PolyIC), Lipopolysaccharide (LPS) and propionic acid or other well-documented immunogens or pathogens, like mycobacterium tuberculosis. Another approach is the use of chemicals like valproic acid, Polychlorinated biphenyls (PCBs), organophosphate pesticides - chlorpyrifos (CPF) and others. These substances were administered either prenatally, generally after the period of major organogenesis, or, especially in rodents, during the early postnatal life. In addition, using modern genetic manipulation methods, genetic models have been created of almost all human genetic diseases that are manifested by autistic like behavior (i.e. fragile X, Rett syndrome, SHANK gene mutation Neuroligin genes and others). Ideally, we should not only evaluate the different behavioral modes affected by the ASD-like behavior but also assess the severity of the behavioral deviations by an appropriate scoring system, as applied to humans.

The increasing concern regarding climate change continues to motivate research in the Arctic. Within the delicate cycle of the cryosphere, leads are an important kinematic feature that regulate heat balances in the Arctic. Therefore, it is necessary to quantify the genesis of leads over time to identify when and where changes are occurring. The use of a principal component analysis (PCA) is one such tool that is used to identify the characteristics of seasonal ice variability. The PCA not only identifies “normal” or “dominant” conditions or features, but also extract anomalous spatial features from an archive of long-term sequence of images.

This study describes the synthesis and characterization of mixed hydrotalcite–organosilica membrane for gas separation. Hydrotalcite exhibits the capability to adsorb carbon dioxide at elevated temperatures. High surface area and favorable coating properties are essential to harness its potential for practical applications. Stable alcohol-based dispersions are needed for thin film applications of mixed membranes containing hydrotalcite. Currently, producing such dispersions without the need for delamination and dispersion agents is a challenging task. This work introduces for the first time a manufacturing approach to overcoming the drawbacks mentioned above. It includes a synthesis of hydrotalcite nanoparticles, followed by agent-free delamination of their layers and final dispersion into alcohol without dispersion agents. Further, the hydrotalcite-derived sorption agent is dispersed in a matrix based on organo-silica gels derived from 1,2-bis(triethoxysilyl)ethane (BTESE). The analytical results indicate that the interconnection between hydrotalcite and BTESE-derived gel occurs via forming a strong hydrogen bonding system between the interlayer species (OH groups, CO32-) of hydrotalcite and oxygen and silanol active gel centers. These findings lay the foundation for applications involving incorporating hydrotalcite-like compounds into silica matrices, ultimately enabling the development of materials with exceptional mass transfer properties. In part 2 of this study, gas separation performance of the organo-silica and the hydrotalcite-like materials and their combined form will be investigated

In late December 2019 a novel RNA beta-coronavirus was recognized as the causative agent of previously pneumonia cases of unknown origin. The virus was successively named Severe Acute Respiratory Syndrome CoronaVirus 2 (SARS-CoV-2) as well as the respiratory illness that it causes Coronavirus disease 19 (COVID-19) (1, 2). The global spread of SARS-CoV-2 and the thousands of deaths caused by COVID-19 led the World Health Organization (WHO) to declare a pandemic on 11 March 2020. To date, the world has paid a high toll in this pandemic in terms of human lives lost, economic repercussions and increased poverty. Indeed, even if most patients with COVID-19 are asymptomatic or experience mild self-limiting disease, 14% of them progress to severe disease and 5% to critical illness with complications, such as interstitial pneumonia, respiratory failure with acute respiratory distress syndrome (ARDS) and multiple organ dysfunction syndromes (MODS) (3). It is accepted that SARS-CoV-2 primarily affects the respiratory system, although other organs are also involved (4). The virus enters host cells by attaching its Spike like surface projections to the angiotensin-converting enzyme-2 (ACE2) receptor which is mainly expressed on alveolar epithelial cells and in nearly all human organs in varying degrees. Thus, although the central target of SARS-CoV-2 infection is the lung, the wide distribution of ACE2 receptors in other organs may lead to cardiovascular, gastrointestinal, kidney, liver, central nervous system and ocular damages that have to be closely monitored during the disease (5, 6). The virus then activates the innate and adaptive immune system resulting in a large number of cytokines release, known as “cytokine storm”, that is directly correlated with tissue injury and unfavourable prognosis of severe lung disease (7). In particular, interleukin (IL)-6 seems to plays an important role in driving this cytokine release so that its increased levels have been recognized as a hallmark inflammatory signature in sera of COVID-19 patients (8). IL-6 is a polyfunctional cytokine with both anti-inflammatory and pro-inflammatory properties which exerts its several functions through two main signal transduction pathways (9). In the classical signal transduction pathway, IL-6 binds to IL-6-trans membrane receptor (IL-6R) to form a complex that, then, binds to the trans membrane glycoprotein gp130, inducing its homo-dimerization and initiating intracellular signal transduction. This kind of signaling is limited to cells (hepatocytes, macrophages, neutrophils, T cells, etc.) that express IL-6R on their cell surface (10). Nevertheless, cells do not express IL- 6R, as stromal and epithelial cells, are able to still respond to IL-6 because the soluble form of the receptor (sIL-6R) binds to IL-6 in circle and then anchors to membrane gp130 receptor, initiating the trans-signaling pathway. For this reason, sIL-6R is able to increase the function of IL-6 and is considered the agonist form of its receptor. When the level of IL-6 increases, its effects are widely expressed because gp130 molecules are ubiquitous and, therefore, also present in cells without IL-6R in the membrane form. On the contrary, a soluble form of the glycoprotein 130 (sgp130) can complex with sIL-6R to prevent the sIL-6R from binding to the membrane-bound gp130. In this case sgp130 is able to decrease the function of IL-6 and is considered the antagonist form of IL-6 receptor system (11). Based on the central role of IL-6 in the inflammatory pathology of COVID-19 and the consistent association between elevated levels of the cytokine and severe disease outcomes found in the first phase of infection, we sought to analysis IL-6 and its soluble receptor complex behavior during the different waves of COVID-19 pandemic, in order to evaluate the possible differences which occur among them and to hypothesize if they might be used as prognostic markers of disease severity.

Formaldehyde (HCHO), an indoor volatile organic compound, is seriously harmful to human health. Therefore, green and effective decomposition of HCHO is essential. TiO₂ has been employed for the degradation of HCHO via photocatalytic generation of reactive oxygen species (ROS) (O^2-, ·OH), yet the low specific surface area of crystalline TiO₂ depressed the catalytic performance. Herein, we prepared TiO₂ aerogels with high specific surface area and high porosity by sol-gel method, and added PVA to introduce flexible molecular chains for pore size regulation. The photocatalytic performance test verifies that the pore size of TiO₂ aerogel is one of the important factors for HCHO decomposition. Notably, through the establishment of theoretical model and calculation, we validated that the efficiency of HCHO decomposition is related to the oxygen pressure in the pores of TiO₂ aerogel, and the oxygen pressure is inversely proportional to the pore size. Accordingly, the optimal pore size of TiO₂ aerogel for the photocatalytic HCHO decomposition is 2 nm~10 nm. This study provides a theoretical idea for TiO₂ aerogels in the decomposition reaction of HCHO, which is expected to inspire more breakthroughs in the study of TiO₂ aerogels for green chemistry.

We produced a recombinant eel luteinizing hormone (rec-eel LH) analog with high potency in Chinese hamster ovary DG44 (CHO DG44) cells. The eel LH mutant (LH-M), which had a linker comprising the equine chorionic gonadotropin (eCG) β-subunit carboxyl-terminal peptide (CTP) region (amino acids 115 to149), was inserted between the β-subunit and α-subunit of wild-type tethered eel LH (LH-wt). Monoclonal cells transfected with the eel LH-wt and eel LH-M plasmids were isolated from five and nine clones of CHO DG44 cells, respectively. The secreted quantities abruptly increased on day 3, with peak levels of 5,000–7,500 ng/mL on day 9. The molecular weight of eel LH-wt was 32–36 kDa while that of eel LH-M increased to approximately 38–44 kDa, indicating the detection of two bands. Treatment with peptide N-glycanase F decreased the molecular weight by approximately 8 kDa. The oligosaccharides at the eCG β-subunit O-linked glycosylation sites were appropriately modified post-translation. The EC50 value and maximal responsiveness of eel LH-M increased by approximately 2.90- and 1.29-fold, respectively, indicating that the mutant exhibited more potent biological activity than eel LH-wt. Phosphorylated extracellular regulated kinase (pERK1/2) activation resulted in a sharp peak 5 min after agonist treatment, with a rapid decrease thereafter. These results indicate that the new rec-eel LH analog which contains the eCG β-subunit CTP linker comprising O-linked glycosylation sites, had more potent activity than the wild-type in vitro. Taken together, this new eel LH analog can be produced in large quantities using a stable CHO DG44 cell system.

In this research, the primary goal was to investigate the relationship between strategic planning and organizational performance in Iraq's manufacturing context. The study's primary data sources were 360 manager respondents. The structured questionnaire was used to collect primary data from manufacturing firms located throughout Iraq. To analyze the result, the researcher used descriptive statistics, correlation, and multiple regression analysis. SPSS version 16 software was used to conduct data analysis. The result reveals that the process of strategic planning has a beneficial effect on financial performance. Environmental scanning has a statistically significant positive effect on a company's non-financial performance. Management participation and planning formality positively and statistically significantly affect a business's non-financial performance at the 10 percent level. The domain of strategy and technique has not impacted the company's non-financial performance.

This study aimed to produce single-chain recombinant eel follicle-stimulating hormone (rec-eel FSH) analogs with high activity in Chinese hamster ovary DG44 (CHO DG44) cells. We recently reported that an O-linked glycosylated carboxyl-terminal peptide (CTP) of the equine chorionic gonadotropin (eCG) β-subunit plays contributes on high activity and time-dependent secretion in mammalian cells. We constructed a mutant (FSH-M) in which a linker including the eCG β-subunit CTP region (amino acids 115 to149) was inserted between the β-subunit and α-subunit of wild-type single chain eel FSH (FSH-wt). Plasmids containing eel FSH-wt and eel FSH-M were transfected into CHO DG44 cells. Single cells expressing each protein were isolated from 10 and 7 clones, respectively. Secretion increased gradually during the cultivation period and peaked at 4,000–5,000 ng/mL on day 9. The molecular weight of eel FSH-wt was 34–40 kDa, while that of eel FSH-M increased substantially, with two bands at 39–46 kDa. Treatment with PNGase F to remove the N glycosylation sites decreased the molecular weight remarkably to approximately 8 kDa. The EC50 value and maximal responsiveness of eel FSH-M were approximately 1.23- and 1.06-fold higher than those of eel FSH-wt, indicating that the mutant showed slightly higher biological activity. Phosphorylated extracellular regulated kinase (pERK1/2) activation exhibited a sharp peak at 5 min, followed by a rapid decline. These findings indicate that the new rec-eel FSH molecule with the eCG β-subunit CTP linker showed potent activity and could be produced in massive quantities using the stable CHO DG44 cell system.

A two-year experiment was conducted with a local maize hybrid under full irrigation (F), deficit irrigation (D) and rainfed conditions (R) to estimate maize evapotranspiration in Bosnia and Herzegovina. Three approaches (Allen & Pereira (A&P), SIMDualKc (SD), and Vegetation Index (VI)) were used to estimate the actual crop coefficient (Kc act), actual basal crop coefficient (Kcb act), and actual crop evapotranspiration (ETc act) were applied with the dual crop coefficient method and remote sensing (RS) data. While Kcb act from all approaches matched FAO56 tabulated values, SD showed differences, in comparison to A&P, of up to 0.24 in D and R conditions, especially in initial and mid-season stages. VI demonstrated very good performance in all treatments. In F, the obtained Kc act for all approaches during the initial and end stages were higher than the tabulated values, ranging from 0.71-0.87 for Kc ini act and from 0.80-1.06 for Kc end act, while the mid-season period showed very good agreement with the literature. Maize crop evapotranspiration range is 769-813 mm, 480-752 mm, and 332-618 mm for F, D and R, respectively. The results confirmed the suitability of both approaches (SD and VI) to estimate maize crop evapotranspiration under F, with the VI approach demonstrating an advantage in calculating Kcb act, Kc act, and ETc act values under water stress conditions. The 67.6% increase in grain yields with irrigation emphasizes the need to transition from rainfed to irrigation-dependent agriculture, even for drought-resistant crops like maize.

: Climate change necessitates urgent actions to mitigate carbon dioxide (CO2) emissions from fossil fuel-based energy generation. Among various strategies, the deployment of carbon capture and storage (CCS) solutions are critical for reducing emissions from point sources such as power plants and heavy industries. In this context, cryogenic carbon capture (CCC) via desublimation has emerged as a promising technology. While CCC offers high separation efficiency, minimal downstream compression work, and integration potential with existing industrial processes, challenges such as low operating temperatures and equipment costs persist. Ongoing research aims to address these hurdles in order to optimize the desublimation processes for widespread implementation. This review consolidates diverse literature works, providing insights into the strengths and limitations of CCC technology, including the latest pilot plant scale demonstrations. The transformative potential of CCC is first assessed on a theoretical basis, such as thermodynamic aspects and mass transfer phenomena. Then, recent advancements in the proposed process configurations are critically assessed and compared through key performance indicators. Furthermore, future research directions for this technology are clearly highlighted.

Despite Low Power Wide Area Networks’ ability to offer an extended range, it might still encounter challenges with coverage blind spots in the network. This article proposes an innovative energy-efficient nature-inspired relay selection algorithm for LoRa-based LPWAN networks, serving as a solution for challenges related to poor signal range in areas with limited coverage. A behavior swarm-inspired approach has been utilized to select the relays’ localization in the network, providing network energy efficiency and radio signal extension. These relays help bridge communication gaps, significantly reducing the impact of coverage blind spots by forwarding signals from devices with poor direct connectivity with the gateway. The proposed algorithm considers critical factors for the LoRa standard, such as the Spreading Factor or device energy budget analysis. The simulation experiments validate the proposed scheme’s effectiveness in terms of energy efficiency under diverse multi-gateway topology scenarios involving thousands of devices. Specifically, it has been verified that the proposed approach outperforms the reference method in preventing the battery depletion of relays, which is vital for battery-powered IoT devices. Furthermore, for some large-scale problems, the proposed heuristic method achieves over twice the speed of the exact method with a negligible accuracy loss of less than 2%.

Gastric inflammation-related disorders are commonly observed digestive system illnesses char-acterized by the activation of proinflammatory cytokines, particularly tumor necrosis factor-α (TNF-α). This results in the induction of cyclooxygenase-2 (COX-2)/prostaglandin E2 (PEG2) and matrix metallopeptidase-9 (MMP-9). These factors contribute to the pathogenesis of gastric in-flammation disorders. We examined the preventive effects of Lonicera japonica Thunb. ethanol ex-tract (Lj-EtOH) on gastric inflammation induced by TNF-α in normal GES-1 cells. The GES-1 cell line was used to establish a model that simulated the overexpression of COX-2/PGE2 and MMP-9 proteins induced by TNF-α, to examine the anti-inflammatory properties of Lj extracts. The re-sults indicated that Lj-EtOH exhibits significant inhibitory effects on COX-2/PEG2 and MMP-9 ac-tivity, attenuates cell migration, and provides protection against TNF-α-induced gastric inflam-mation. The protective effects of Lj-EtOH are associated with the modulation of COX-2/PEG2 and MMP-9 through activation of TNFR–ERK 1/2 signaling pathways as well as the involvement of c-Fos and nuclear factor kappa B (NF-κB) signaling pathways. Based on our findings, Lj-EtOH ex-hibits a preventive effect on human gastric epithelial cells. Consequently, it may represent a novel treatment for the management of gastric inflammation.

Hepatocellular carcinoma (HCC) is a heterogeneous malignancy with complex carcinogenesis. Although there has been significant progress in the treatment of HCC over the past decades, drug resistance to chemotherapy remains a major obstacle in its successful management. In this study we were able to reduce chemoresistance in cisplatin-resistant HepG2 cells by either silencing the expression of transglutaminase type 2 (TG2) using siRNA or by pre-treatment of cells with the TG2 enzyme inhibitor cystamine. Further analysis revealed that, whereas the full-length TG2 isoform (TG2-L) was almost completely cytoplasmic in its distribution, the majority of the short TG2 isoform (TG2-S) was membrane-associated in both parental and chemoresistant HepG2 cells. Following induction of cisplatin toxicity in non-chemoresistant parental cells, TG2-S together with cisplatin quickly relocated to the cytosolic fraction. Conversely, no cytosolic relocalisation of TG2-S or nuclear accumulation cisplatin was observed following identical treatment of chemoresistant cells, where TG2-S remained predominantly membrane-associated. This suggests that deficient subcellular relocalisation of TG2-S from membranous structures into the cytoplasm may limit the apoptic response to cisplatin toxicity in chemoresistant cells. Structural analysis of TG2 revealed the presence of binding motifs for interaction of TG-S with the membrane scaffold protein LC3/LC3 homologue that could contribute to a novel mechanism of chemotherapeutic resistance in HepG2 cells.

During the last two decades several cases of venous thrombosis (VTE) after a prolonged period at a computer has been described, denominated “eThrombosis”. Video gaming on a computer has become very popular and can be a social activity where several players are gathered to play against each other or in a virtual environment for several days (“LAN (i.e., Local Area Network) parties”) where the participants are sedentary and consuming calorie-rich food items. The aim of this study was to investigate a potential coagulation activation during a 42 hour LAN party. Nine male gamers volunteered for the LAN party. Citrated blood was sampled before and every 6 hours, and plasma was analyzed for thrombin generation, and Thrombin-antithrombin-complexes (TAT), prothrombin Fragment 1+2 (F1+2), and D-dimer. Thrombin generation increased slightly but not significantly during the LAN party, whereas the coagulation activation markers were unchanged. These results do not indicate that the coagulation system is activated significantly during 42 h gaming with minimal physical activity. Although an increased activity cannot be excluded, it does not directly indicate a risk of VTE in general. It may be specific and particularly susceptible in-dividuals who are prone to thrombosis and, therefore, are at risk of developing e-thrombosis.

Nucleoside analogs are commonly used drugs for the treatment of cancer and viral infections. Nucleoside deoxyribosyltransferase (NDT) is one of the key enzymes required for the biosynthesis of deoxynucleotides. The feasibility of biochemical transformation processes is usually greatly dependent on the cost of biocatalysts. Therefore, immobilizing and reusing biocatalysts is an approach to be considered to bring biotransformations closer to industrial feasibility, since it not only allows enzymes to be reused but can also improve their stability under several reaction conditions. In this work, histidine tags have been successfully fused to a Nucleoside deoxyribosyltransferase from Lactobacillus reuteri (LrDNT), which has been produced in a bench-scale reactor using a facile araBAD promoter-based protein expression system in an industrial microorganism, the E. coli BL21(DE3) strain. The overexpressed LrNDT was bound to a nickel-chelating agarose affinity chromatography medium via a one-step purification and immobilization process with a 99% yield, retaining about 97% of its initial activity. The optimal conditions for the immobilized LrNDT maintain high enzyme activity within the range of 20-45°C and pH 6.0-7.5. Finally, the immobilized enzyme reactor (IMER) of LrNDT was applied for the continuous-flow biosynthesis of 2'-deoxyadenosine and retained 90% of its activity after 16 hours, providing a theoretical basis for the industrial production of nucleoside analogs.

The late diagnosis of Type 2 Diabetes Mellitus can occur due to lack of access to the primary health care system and the non-manifestation of symptoms. Faced with this problem, this work presents the creation of a mobile application, called DiabetesCheck, for predicting the risk of Type 2 Diabetes Mellitus. A mathematical model is used, which classifies the risk of Type 2 Diabetes Mellitus for a group of patients with intervention and for a comparative group, using Fuzzy Classification and Decision Trees. The proposed application allows the health professional to monitor patients through the history stored in a database, allowing a representation of the evolution of patients and indication of medications. Therefore, this proposal aims to carry out the diagnosis in the initial phase of the disease and help in the prescription of more effective treatments and in the proposition of public policy strategies in epidemiology and screening.

Nanocomposites of TiO₂ Degussa P25 nanoparticles/activated carbon (TiO₂/AC ) were prepared at various mass ratios of (4:1), (3:2), (2:3), and (1:4) by a facile process. The effects of TiO₂/AC mass ratios on the structural, morphological, and photocatalytic properties were systematically studied in comparison with bare TiO₂ and bare AC. TiO₂ nanoparticles exhibited dominant anatase and minor rutile phases, and a crystallite size of approximately 21 nm; while AC had XRD peaks of graphite and carbon, and a crystallite size of 49 nm. The composites exhibited tight decoration of TiO₂ nanoparticles on micron-/submicron AC particles, and uniform TiO₂/AC composites were obtained as evidenced by the uniform distribution of Ti, O, and C in an EDS mapping. Moreover, Raman spectra show the typical vibration modes of anatase TiO₂ (e.g., E_1g⁽¹⁾, B_1g⁽¹⁾, E_g⁽³⁾) and carbon materials with D and G bands. The TiO₂/AC with (4:1), (3:2), and (2:3) possessed higher reaction rate constants (k) in photocatalytic degradation of methylene blue (MB) than that of either TiO₂ or AC. Among the investigated materials, TiO₂/AC = 4:1 achieved the highest photocatalytic activity with a high k of 55.2×10^-3 min^-1 and an MB removal efficiency of 96.6% after 30 min treatment under UV-Vis irradiation (120 mW/cm²). The enhanced photocatalytic activity for TiO₂/AC is due to the synergistic effect of the high adsorption capability of AC and the high photocatalytic activity of TiO₂. Furthermore, TiO₂/AC promotes the separation of photoexcited electron/hole (e^-/h⁺) pairs to reduce their recombination rate and thus enhance photocatalytic activity. The optimal TiO₂/AC composite in this study can be used for treating industrial or household wastewater with organic pollutants.

This report provides a comprehensive overview of occupational asthma and respiratory hypersensitivity, focusing on some chemicals used in the workplace Includes numerous case studies and research papers related to occupational exposure methacrylates, such as HEMA-HPMA, and respiratory hypersensitivity are discussed And the relationship is explored The book also examines asthma pathophysiology, emerging drug delivery systems used to treat asthma, and the potential of nanoparticles , dendrimers and micellar systems have to improve pulmonary drug delivery in detail The worldwide prevalence of asthma is highlighted, with higher rates in high-GDP countries. The book highlights the need to improve asthma diagnosis, treatment and biomarkers, particularly in rural and low-income countries where the disease is often underdiagnosed and inadequately treated, and discusses the role of inflammation in asthma, in particular secondary inflammation characterized by specific cytokines and inflammation cells In addition, the paper explores various drug delivery methods, such as parenteral and parenteral drugs, pressurized inhalers (pMDIs), dry powder inhalers ( DPIs), nebulizers, nanoparticles, liposomes, micellar systems, microparticles , dendrimers, and gene therapy . These systems aim to increase pulmonary delivery of drugs and improve clinical outcomes. The potential of dendrimer bilirubin-based nanoparticles and micellar systems in the treatment of asthma and lung inflammatory diseases, including asthma, has been discussed in summary, this paper provides an overview of occupational asthma and respiratory hypersensitivity, and this discussion highlights the association between methacrylate exposure and respiratory hypersensitivity.

To accurately and non-destructively monitor the growth of spring wheat in the Hetao Irrigation Area, UAV remote sensing was employed during various fertility stages. Digital image indices from diverse fertilization treatments were calculated and compared with physiological indices to identify the most sensitive digital image indices corresponding to these indices. The study underscored the critical importance of the flowering stage in the growth of spring wheat, thus highlighting the necessity of focusing on this stage. This finding reiterated that the flowering stage was pivotal for spring wheat development in the Hetao Irrigation Area. Several digital image indices, such as GLA, R, G, INT, g, GRVI, MGRVI, RGBVI, EXG, and GRRI, exhibited a high frequency of significant correlations with physiological indices during the four primary reproductive stages of wheat. Consequently, these sensitive digital image indices during the flowering stage can more effectively characterize the physiological indices of spring wheat.

Background: The aim was to diagnose Candida in the oral cavity of subjects with type 2 diabetes mellitus (T2DM) using a genotyping technique and to compare the results with those from con-ventional diagnosis by Papanicolau (Pap) staining. Methods: Palatal mucosa smears were per-formed in 18 dental care patients diagnosed with T2DM and grade I, II, and III prosthetic stomatitis who met the inclusion criteria; 18 healthy control subjects were also included in the study. He-moglobin A1c (HbA1c) levels were determined from total blood. Using exfoliative cytology, the Pap staining technique was used to diagnose candidiasis. Exfoliative cytology was also used for molecular diagnosis; DNA was obtained for Candida genotyping and RNA was used for gene ex-pression studies. Results: Clinical patterns indicated that all subjects were positive for Candida; however, Pap analysis revealed only three positive subjects, whereas end-point polymerase chain reaction (PCR) analysis revealed fifteen subjects with some type of Candida. The most common Candida species found were Candida guilliermondii (38.8%), Candida krusei (33.3%), Candida tropicalis, and Candida lusitaniae (22.2%). Interestingly, the coexpression of different species of Candida was found in various patients. In all patients, HbA1c levels were increased. Gene expression analysis showed a significant decrease (p ≤ 0.05) in TLR2 expression in positive subjects, whereas TLR4 expression did not differ significantly among patients. Conclusions: The end-point PCR technique showed better sensitivity for diagnosis of Candida when compared with diagnosis by Pap staining. T2DM subjects showed an increased presence of C. guilliermondii that was correlated with decreased TLR2 expression

Nowadays, it is highly desired to develop highly active and humidity resistive ozone decomposition catalyst to eliminate the ozone contaminant, one of the primary pollutants in air. In this work, a series of Cu2S hollow structured materials are rapidly synthesized using different structured Cu2O templates. The Cu2S from porous Cu2O shows the highest ozone catalytic decomposition efficiency of >95% to 400 ppm ozone with a weight hourly space velocity of 480,000 cm3g-1h-1 in dry air. Importantly, the conversion still keeps >85% in a high relative humidity of 90%. The mechanism is explored by diffusive reflectance infrared spectroscopy which shows the decomposition intermediate of O22-, and the X-ray photoelectron spectroscopy reveals the dual active site of both Cu and S. All these results show the effective decomposition of ozone by Cu2S especially in harsh environments, promising for active ozone elimination.

As humans age, aberrancies in several signaling pathways occur. In the aging population, some patients display abnormal bone morphogenetic protein (BMP) signaling. This can lead to osteoporosis (OP), a debilitating bone disorder caused by an imbalance between osteoblasts and osteoclasts. In 2002, the Food and Drug Administration (FDA) approved usage of recombinant human BMP-2 (rhBMP-2) during spinal fusion surgery as it is crucial for bone formation. However, complications have been reported with rhBMP-2 and primary osteoblasts isolated from OP patients are unresponsive to BMP-2. While patient samples are available, previous medical history may alter results. Therefore, C57BL/6 mice, an aging model that displays aberrant BMP-signaling, can be utilized to investigate OP and aging. We show that BMP receptor type Ia (BMPRIa) is upregulated in the bone marrow stromal cells (BMSCs) of 15-month mice similar to previous data. We show that a conjugation between BMP-2 and Quantum Dots (QDot®s) effectively binds to BMPRIa and can investigate BMP-2 activity. After incubating BMSCs with methyl-β-cyclodextrin (MβCD), BMP-signaling is restored in 15-month mice as shown by western blotting and the von Kossa assay. MβCD may be used to rescue BMPRIa and the BMP-signaling pathway can be utilized by future therapeutics to treat OP.

Background. Type 2 diabetes mellitus (T2DM) is becoming a major global health concern, especially in poorer nations. The high prevalence of obesity and the ensuing diabetes is attributed to rapid economic progress, physical inactivity, consumption of high-calorie foods, and changing lifestyles. Objectives. We investigated the role of pro-inflammatory chemokines; CCL1, 2, 4 and 5 with varying levels of obesity in T2DM in the Asir region of Saudi Arabia. Materials and methods. 170 confirmed T2DM patients and a normal control group were enrolled. The demographic data, serum levels CCL-1, 2, 4 and 5 and the biochemical indices were assessed in patients and control groups by standard procedures. Results. T2DM patients were divided into four groups: A (normal body weight), B (Overweight), C (obese), and D (highly obese). n controls. We observed that male and female control patients had similar mean serum concentrations of pro-inflammatory chemokines CCL 1, 2, 4, and 5. Chemokines CCL1, CCL2, and CCL4 in the serum of Type 2 Diabetes Mellitus patients with normal or overweight body weights were significantly higher than the control group, regardless of gender. In T2DM individuals with obesity and severe obesity, the rise was most significant. There was a progressive rise in the concentrations of CCL1, 2, and 4 in T2DM) patients with increasing BMI. Serum CCL5 levels increased significantly in all T2DM patient groups. The increase in CCL5 was more predominant in normal-weight people as compared to overweight and obese T2DM patients. Conclusions. Male and female control patients had similar serum levels of pro-inflammatory chemokines CCL 1, 2, 4, and 5. The progressive rise in blood concentrations of three Pro-inflammatory chemokines; CCL1, 2, and 4 in T2DM patients with increasing BMI supports the idea that dyslipidemia and obesity contribute to chronic inflammation and insulin resistance. Serum CCL5 levels increased significantly in all T2DM patient groups. The selective and more pronounced increase of CCL5 in the T2DM group with normal BMI as compared to patients with varying degrees of obesity, was rather surprising. Further research is needed to determine if CCL5 under-expression in overweight and obese T2DM patients is due to some unexplained counterbalancing processes.

Cognitive reserve is the adaptability of cognitive processes in the face of brain aging and pathology. This study aimed to validate the Arabic version of the Cognitive Reserve Index Questionnaire (CRIq) in a healthy Lebanese sample. CRIq assesses cognitive reserve through three domains: education, working activity, and leisure time. Statistical measures, including descriptive and regression analysis along with structural equation modeling, were utilized to investigate the convergent and discriminant validity of CRIq, incorporating fluid intelligence (Gf) and measures of cognitive function, long-term memory encoding and retrieval (Glr), and processing speed (Gs). Results from 174 participants revealed that the activities assessed by CRIq-Arabic were comparable to the original CRIq study, with slight cultural differences. The internal consistency of CRIq-Arabic was good (Cronbach's α = 0.88), indicating reliability. Convergent validity was confirmed, with moderate to high loadings on the cognitive reserve latent construct. Discriminant validity was supported as correlations between cognitive reserve variables and non-target constructs (Gf, Glr, Gs) were less than 1. The findings provide an initial psychometric validation of the CRIq-Arabic. Further research in clinical samples is needed to enhance its utility in neuropsychological practice.

Type 2 diabetes mellitus (T2DM) is a common metabolic disease characterised by insulin resistance and elevated blood glucose levels, affecting millions of people worldwide. T2DM patients with dyslipidaemia have an increased risk of cardiovascular disease (CVD). A complex interplay of risk factors such as hyperglycaemia, dyslipidaemia, hypertension, obesity, inflammation and oxidative stress favour the development of atherosclerosis, a central mechanism in the pathogenesis of cardiovascular disease. Dyslipidaemia, a hallmark of T2DM, is characterised by elevated triglycerides, decreased high-density lipoprotein (HDL) cholesterol and the presence of small, dense low-density lipoprotein (LDL) particles, all of which promote atherosclerosis. In this article, we have attempted to present various treatment strategies that include pharmacological interventions such as statins, ezetimibe, PCSK9 inhibitors, fibrates and omega-3 fatty acids. We have also tried to highlight the pivotal role of lifestyle modifications, including physical activity and dietary changes, in improving lipid profiles and overall cardiovascular health in T2DM patients. We have also tried to present the latest clinical guidelines for the management of dyslipidaemia in T2DM patients. In conclusion, the treatment of dyslipidaemia in T2DM patients is of great importance as it lowers lipid particle levels, slows the progression of atherosclerosis and ultimately reduces susceptibility to cardiovascular disease.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

D-Glucaric acid is an important bio-based building block of polymers and is a high value-added chemical that can be used in a variety of applications. In the present study, the Udh target genes from Pseudomonas putida and Pseudomonas syringae were used together to construct the expression vector pETDuet-2×Udh. The transformants of BL21(DE3) with vector pETDuet-2×Udh was applied to produce glucaric acid from glucuronic acid. After optimization of induction conditions, the highest Udh expression were achieved when 0.4 mmol L-1 isopropyl-β-d–thiogalactoside (IPTG) was added to cell cultures at an OD600 value of 0.6 followed by culture at 26℃ for 6 hours. The production of glucaric acid substantially reached 5.24 ± 0.015 g L-1 in fed-batch cultures in a 30 L tank. In the present study, a new system for glucaric acid production was established, which was more economic and friendly to environment.

One of the hallmarks of microgravity-induced effects in several cellular models is represented by the alteration of oxidative balance with the consequent accumulation of Reactive Oxygen Species (ROS). It is well known that male germ cells are sensitive to oxidative stress and to changes of gravitational force even if published data on germ cell models are scarce. To gain more insights into the mechanisms of male germ cell response to altered gravity, a 3D cell culture model has been established from TCam-2 cells, a seminoma-derived cell line considered the only human cell line available to study in vitro mitotically active human male germ cells. TCam-2 cell spheroids were cultured for 24 hours under unitary gravity (Ctr) or simulated microgravity (s-microgravity) conditions, these last ones were obtained using the Random Positioning Machine (RPM). A significant increase in intracellular ROS and mitochondria superoxide anion levels has been observed after RPM exposure. In line with these results a trend of protein and lipid oxidation increase, and increased pCAMKII expression levels were observed after RPM exposure. The ultrastructural analysis by Transmission Electron Microscopy revealed that RPM-exposed mitochondria appeared enlarged and, even if seldom, disrupted. Notably, even the expression of the main enzymes involved in the redox homeostasis appears modulated by RPM exposure in a compensatory way, being GPX1, NCF1, and CYBB downregulated, whereas NOX4 and HMOX1 upregulated. Interestingly, HMOX1 is involved in the heme catabolism of mitochondria cytochromes, and therefore the positive modulation of this marker can be associated to the observed mitochondria alteration. All together, these data demonstrate TCam-2 spheroid sensitivity to acute SM exposure and indicate the capability of these cells to trigger compensatory mechanisms that allow to overcome the exposure to altered gravitational force.

Systemic sclerosis (SSc) is a multisystem connective tissue disease characterized by pathological processes involving autoimmunity, vasculopathy, and resultant extensive skin and organ fibrosis. Recent studies have demonstrated activation and aberrant wound healing responses in the epithelial layer of the skin in this disease, implicating the epithelial keratinocytes as a source of pro-fibrotic and inflammatory mediators. In this paper we investigated the role of Immunoglobulin G (IgG) autoantibodies directed against epithelial cells, as potential initiators and propagators of pathological keratocyte activation and the ensuing SSc fibrotic cascade. A keratinocyte cell-based ELISA is used to evaluation binding of SSc IgG. SSc skin biopsies were stained by immunofluorescence for the presence of IgG in the keratinocyte layer. Moreover, IgG purified from SSc sera is evaluated for the potential to activate keratinocytes in tissue culture and to induce signaling in TLR2 &amp; 3 reporter cell lines. We demonstrate enhanced binding of SSc IgG to keratinocytes, and activation of these cells leading to release of IL-1α, representing a potential initiating pathway in this disease.

N'-(5-bromofuran-2-carbonyl)isonicotinohydrazide (1) was obtained as a white solid in 83% yield by 2-methyl-6-nitrobenzoic anhydride (MNBA)/4-dimethylaminopyridine (DMAP)-catalyzed reaction of 5-bromofuran-2-carboxylic acid and isoniazid in dichloromethane at room temperature. The structure of N'-(5-bromofuran-2-carbonyl)isonicotinohydrazide (1) was elucidated by 1H NMR, 13C NMR, FTIR, and the high resolution mass spectrometers. Molecular docking screening of the title compound (1) on the cyclooxygenase-2 (COX-2) protein (PDB ID: 5IKR) exhibited that compound (1) has a good binding affinity, suggesting that it is very interesting for further structure optimization and in-depth research as a potential COX-2 inhibitor.

Adipose tissue is a crucial organ in energy metabolism and thermoregulation. Adipose tissue phenotype is controlled by various signaling mechanisms under pathophysiological conditions. Type II transmembrane serine proteases (TTSPs) are a group of trypsin-like enzymes anchoring on the cell surface. These proteases act in diverse tissues to regulate physiological processes, such as food digestion, salt-water balance, iron metabolism, epithelial integrity, and auditory nerve development. More recently, several members of the TTSP family, namely, hepsin, matriptase-2, and corin, have been shown to play a role in regulating lipid metabolism, adipose tissue phenotype, and thermogenesis, via direct growth factor activation or indirect hormonal mechanisms. In mice, hepsin deficiency increases adipose browning and protects from high-fat diet-induced hyperglycemia, hyperlipidemia, and obesity. Similarly, matriptase-2 deficiency increases fat lipolysis and reduces obesity and hepatic steatosis in high-fat diet-fed mice. In contrast, corin deficiency increases white adipose weights and cell sizes, suppresses adipocyte browning and thermogenic responses, and causes cold intolerance in mice. These findings highlight an important role of TTSPs in modifying cellular phenotype and function in adipose tissue. In this review, we provide a brief description about TTSPs and discuss recent findings regarding the role of hepsin, matriptase-2, and corin in regulating adipose tissue phenotype, energy metabolism, and thermogenic responses.

Preterm delivery can be precipitated by infection, and preterm infants are at heightened risk of postnatal infection. Little is known about the ontogeny of inflammatory biomarkers in extremely preterm infants. We hypothesized that suspected prenatal infection (chorioamnionitis or spontaneous preterm labor) and clinically diagnosed postnatal infection would be associated with unique biomarker signatures, and those patterns would be influenced by the degree of prematurity. Venous blood was collected daily for the first week and weekly for up to 14 additional weeks from 142 neonates born at 22-32 weeks gestation. A custom array was utilized to measure monocyte chemoattractant protein-1 (MCP-1) and interleukin-6 (IL-6). C-reactive protein (CRP) levels were obtained from the electronic medical record. 90 infants had suspected prenatal infection and 63 were diagnosed with postnatal infection. Independent of gestational age at delivery, MCP-1 was significantly increased (P &lt; 0.001) in association with maternal preeclampsia, but MCP-1 was decreased (P&lt;0.01) and CRP was increased (P&lt;0.05) in the presence of chorioamnionitis. IL-6 and CRP were both increased in infants diagnosed with postnatal infection with peak levels observed on days 2 and 3, respectively. In conclusion, suspected prenatal and postnatal infections and non-infectious complications of pregnancy are associated with unique biomarker profiles, independent of gestational age. In those clinically diagnosed with a postnatal infection in the absence of antenatal infection concerns, IL-6 increases before CRP, emphasizing a potential role for expanded biomarker screening if antibiotics are initially avoided in infants born exclusively for maternal indications.

Erectile dysfunction (ED) is a common and feared complication of radical prostatectomy (RP) for prostate cancer. Recently, tissue engineering is being attempted for post-prostatectomy ED, with controlled interactions between cells, growth factors, and extracellular matrix (ECM) being important for nerve regeneration's structural integrity. In this study, we evaluated the effects of biomechanical ECM patch on human bone marrow-derived mesenchymal stem cells (hBMSCs) morphology and behavior in bilateral cavernous nerve injury (BCNI) rat model. The ECM patch, made of decellularized human fibroblast-derived ECM (hFDM) and a biocompatible polyvinyl alcohol (PVA) hydrogel, was tested with human bone marrow-derived mesenchymal stem cells (hBMSCs) on a bilateral cavernous nerve injury (BCNI) rat model. In vitro analysis showed that the hFDM/PVA + hBMSCs patches significantly increased neural development markers. In vivo experiments demonstrated that the rats treated with the hFDM/PVA patch had higher ICP/MAP ratio, a higher ratio of smooth muscle to collagen, increased content of nNOS, higher levels of eNOS protein expression, and a higher cGMP level compared to the BCNI group. These results indicate that the hFDM/PVA patch is effective in promoting angiogenesis, smooth muscle regeneration, and nitrergic nerve regeneration, which could contribute to improved erectile function in post-prostatectomy ED.

Beyond plasma glucose-lowering in patients with type 2 diabetes, sodium- glucose cotransporter 2 inhibitors (SGLT2i) significantly reduced the hospitalization for heart failure (HF) and retarded the progression of chronic kidney disease (CKD). Endothelial dysfunction is not only involved in the development and progression of cardiovascular disease (CVD), and is also associated with the progression of CKD. In patients with type 2 diabetes, hyperglycemia, insulin resistance, hyperinsulinemia and dyslipidemia induce the development of endothelial dysfunction. SGLT2i have shown an improvement in endothelial dysfunction, as assessed by flow-mediated vasodila-tion, in individuals at high risk for CVD. Along with an improvement of endothelial dysfunction, SGLT2i showed improvements in oxidative stress, inflammation, mitochondrial dysfunction, glucotoxicity such as advanced glycation end products signaling and nitric oxide bioavailability. The improvements in endothelial dysfunc-tion and such endothelium-derived factors may play an important role in preventing the development of coronary artery disease, coronary microvascular dysfunction and diabetic cardiomyopathy which cause HF and in retarding CKD. The suppression of the development of HF and the progression of CKD achieved by SGLT2i might have been largely induced by the improvement of vascular endothelial function by SGLT2i.

This research intended to report amine-functionalized multiwall carbon nanotubes (MWCNTs) prepared by a simple method for efficient and rapid removal of Reactive Yellow 2 (RY2) from water. EDS analysis showed that the N content increased from 0 to 2.42% and from 2.42 to 8.66% after modification by APTES and PEI, respectively. BET analysis displayed that the specific surface area, average pore size, and total pore volume were reduced from 405.22 to 176.16 m2/g, 39.67 to 6.30 nm, and 4.02 to 0.28 cm3/g, respectively. These results proved that the PEI/APTES-MWCNTs were successfully prepared. pH edge experiment indicated that pH 2 was optimal for RY2 removal. At pH 2 and 25 °C, the time required for adsorption equilibrium was 10, 15, and 180 min at initial concentrations of 50, 100, and 200 mg/L, respectively; and the maximum RY2 uptake calculated by the Langmuir model was 714.29 mg/g. Thermodynamic studies revealed that the adsorption process was spontaneous and endothermic. 0-0.1 mol/L of NaCl showed negligible effect on RY2 removal by PEI/APTES-MWCNTs. Five adsorption/desorption cycles confirmed the good reusability of PEI/APTES-MWCNTs in RY2 removal. Overall, the PEI/APTES-MWCNTs are a potential and efficient adsorbent for reactive dye wastewater treatment.

In an historic perspective on the development of the Standard Model of particle physics it is shown how mathematically driven axioms have masked the merits of a physically comprehensible structural view. It is concluded that the difference between the two approaches can be traced back to two major issues. Whereas in the Standard Model the quark is a Dirac particle with a single real dipole moment, the quark in the structural model, in confinement with other quarks, is a Dirac particle with two real dipole moments. The second issue is the view that empty space does not exist, but that space is filled with a polarisable energetic fluid. It is shown how recognition of these two issues pave a road to reconcile particle physics with gravity, in which the quark can be seen as a magnetic electron and in which the gluon, as the strong force carrier, can be seen as a massive photon.

Low back pain is a clinically highly relevant musculoskeletal burden and is associated with inflammatory as well as degenerative processes of the intervertebral disc. However, the pathophysiology and cellular pathways contributing to this devastating condition are still poorly understood. Based on previous evidence, we hypothesize that tissue renin-angiotensin system (tRAS) components, including the SARS-CoV-2 entry receptor angiotensin-converting enzyme 2 (ACE2), are present in human nucleus pulposus (NP) cells and associated with inflammatory and degenerative processes. Experiments were performed with NP cells from 4 human donors. The existence of angiotensin II, angiotensin II type 1 receptor (AGTR1), AGTR2, MAS-receptor (MasR), and ACE2 in human NP cells was validated with immunofluorescent staining and gene expression analysis. Hereafter the cell viability was assessed after adding agonists and antagonists of the target receptors as well as angiotensin II in different concentrations for up to 48 hours of exposure. A TNF-α-induced inflammatory in vitro model was employed to assess the impact of angiotensin II addition and the stimulation or inhibition of the tRAS receptors on inflammation, tissue remodeling, expression of tRAS markers, and the release of nitric oxide (NO) into the medium. Further, protein levels of IL-6, IL-8, IL-10, and intracellular as well as secreted angiotensin II were assessed after exposing the cells to the substances, and inducible nitric oxide synthase (iNOS) levels were evaluated utilizing Western Blot. The existence of tRAS receptors and angiotensin II were validated in human NP cells. Cell viability analysis revealed no cytotoxic effects of angiotensin II. The AGTR1 inhibitor Candesartan and the MAS receptors AVE0991 showed cytotoxic effects at high concentrations (100 µM). The addition of angiotensin II only showed a mild impact on gene expression markers. However, there was a significant increase in NO secreted by the cells. The gene expression ratios of pro-inflammatory/anti-inflammatory cytokines IL-6/IL--10, IL-8/IL-10, and TNF-α /IL-10 were positively correlated with the AGTR1/AGTR2 and AGTR1/MAS1 ratios, respectively. The stimulation of the AGTR2 MAS-receptor and the inhibition of the AGTR1 receptor revealed beneficial effects on the gene expression of inflammatory and tissue remodeling markers. This finding was also present at the protein level. We did not find alterations in iNOS protein concentrations after adding the drugs. The current data showed that tRAS components are expressed in human NP cells and are associated with inflammatory and degenerative processes. Further characterization of the associated pathways is warranted. The findings indicate that tRAS modulation might be a novel therapeutic approach to intervertebral disc disease.

Fusarium culmorum is a major pathogen of grain crops. Infected plants accumulate deoxynivalenol (DON), 3-acetyl-deoxynivalenol (3-ADON), or nivalenol (NIV), which are mycotoxins of the trichothecene B group. These toxins are also produced by F. graminearum species complex. New trichothecenes structurally similar to trichothecenes B but lacking the carbonyl group on C-8, designated NX toxins, were recently discovered in atypical isolates of F. graminearum from North America. Only these isolates and a few strains of a yet to be characterized Fusarium species from South Africa are known to produce NX-2 and other NX toxins. Here we report that among 20 F. culmorum strains isolated from maize, wheat, and oat in Europe and Asia over a period of 70 years, 18 strains produced NX-2 simultaneously with 3-ADON and DON or NIV. Rice cultures of strains producing 3-ADON accumulated NX-2 in amounts corresponding to 2-8% of 3-ADON (1.2 - 36 mg/kg). A strain producing NIV accumulated NX-2 and NIV at comparable amounts (13.6 and 10.3 mg/kg, respectively). In F. graminearum, producers of NX-2 possess a special variant of cytochrome P450 monooxygenase encoded by TRI1 that is unable to oxidize C-8. In F. culmorum, producers and nonproducers of NX-2 possess identical TRI1; the reason for the production of NX-2 is unknown. Our results indicate that production of NX-2 simultaneously with trichothecenes B is a common feature of F. culmorum.

Conventional methods of crop mapping need ground truth information to train the classifier. Thanks to the frequent acquisition allowed by recent satellite missions (Sentinel 2), we can identify temporal patterns that depend on both phenology and crop management. Some of these patterns are specific to a given crop and thus can be used to map it. Thus, we can substitute ground truth information used in conventional methods with agronomic knowledge. This approach was applied to identify irrigated permanent grasslands (IPG) in the Crau area (Southern France) which play a crucial role in groundwater recharge. The grassland is managed by making three mows during the May-October period which leads to a specific temporal pattern of leaf area index (LAI). The mowing detection algorithm was designed using the temporal LAI signal derived from Sentinel 2 observations. The algorithm includes some filtering to remove noise in the signal that might lead to false mowing detection. A pixel is considered a grassland if the number of detected mows is greater than 1. A data set covering five years (2016-2020) was used. The detection mowing number was done at the pixel level and then results are aggregated at the plot level. A validation data set including 780 plots was used to assess the performances of the classification. We obtained a Kappa index ranging between 0.94-0.99 according to the year. These results were better than other supervised classification methods that include training data sets. The analysis of land-use changes shows that misclassified plots concern grasslands managed less intensively with strong intra-parcel heterogeneity due to irrigation defects or year-round grazing. Time series analysis, therefore, allows us to understand different management practices. Real land-use change in use can be observed, but long time series are needed to confirm the change and remove ambiguities with heterogeneous grasslands.

In this paper, the phases in the Mg-Ti-O system using the 1:1 formulation of MgO:TiO2 mixing synthetic brucite of Mexican origin with TiO2 microparticles of high purity and with a heat treatment at 1100°C for 1 h were studied. The raw materials and formulation by XPS and DRX techniques were characterized. The results demonstrate the presence of different oxidation states in titania and the formation of different oxides in the Mg-Ti-O system when mixed and calcined at 1100°C; additionally, the formation of vacancies in the crystal lattice during the transformation from hexagonal brucite to magnesia with a cubic structure centered on the faces is estimated. With the results, its thermal behavior is warned based on the MgO-TiO2 phase diagram.

The purpose of the current study was directed to investigate the effectiveness of docosahexaenoic acid (DHA) as a chemopreventive agent on experimentally induced hamster buccal pouch (HBP) carcinogenesis; Material and methods: 40 Syrian male hamsters, five weeks old, were divided into 4 groups of 10 animals in each as follows, GI: Topical application of liquid paraffin alone (thrice a week for 14 weeks), GII: Topical application of 7, 12 dimethyl benz[a]anthracene (DMBA) alone (0.5 % in liquid paraffin, thrice a week for 14 weeks), GIII: Topical application of DMBA (0.5 % in liquid paraffin, thrice a week for 14 weeks) + Oral administration of DHA (125 mg/kg b.w. in 1 ml distilled water by oral gavage, thrice a week for 14 weeks on alternative days of DMBA application), GIV : Oral administration of DHA alone (125 mg/kg b.w. in 1 ml distilled water by oral gavage, thrice a week for 14 weeks); Results: Gross observations and histopathological findings revealed a-GI: normal stratified squamous epithelium b- GII: well and moderately differentiated squamous cell carcinoma (SCC) c-: GIII: showed variable results ranges from hyperkeratosis, hyperkeratosis and focal hyperplasia, mild dysplasia, and well differentiated SCC with superficial invasion of tumor cells not extended to deeper areas d: GIV: normal similar to GI. Immunohistochemical results revealed that oral DHA treatment to DMBA treated hamsters restored the normal expression of bcl-2; Conclusion: DHA has the potential to be a dietary chemopreventive agent due to its capacity to improve carcinogen detoxification and to block/suppress the initiation and promotion stages of experimentally produced HBP carcinogenesis.

Calcium dihydrogen phosphate monohydrate [Ca(H2PO4)2·H2O] (a fertilizer) was successfully synthesized by the recrystallization process by using a prepared triple superphosphate (TSP) that derived from oyster shell waste as starting material. This bio-green, eco-friendly process to produce an important fertilizer can promote a sustainable society. The shell-waste-derived TSP was dissolved in distilled water and kept at 30, 50, and 80 °C. Non-soluble powder and TSP solution were obtained. The TSP solution fraction were then dried and the recrystallized products (RCP30, RCP50, and RCP80) were obtained and confirmed as Ca(H2PO4)2·H2O. Whereas the non-soluble products (NSP30, NSP50, and NSP80) were observed as calcium hydrogen phosphate dihydrate (CaHPO4·2H2O). The recrystallized yields of RCP30, RCP50, and RCP80 were found to be 51.0%, 49.6%, and 46.3%, whereas the soluble percentages were 98.72%, 99.16%, and 96.63%, respectively. RCP30 shows different morphological plate sizes, while RCP50 and RCP80 present the coagulate crystal plates. X-ray diffractograms confirm the formation of both the NSP and RCP. The infrared adsorption spectra confirmed the vibrational characteristics of HPO42‒, H2PO4‒ and H2O existed in CaHPO4·2H2O and Ca(H2PO4)2·H2O. Three thermal dehydration steps of Ca(H2PO4)2·H2O (physisorbed water, polycondensation, and re-polycondensation) were observed. Ca(H2PO4)2 and CaH2P2O7 are the thermodecomposed products from the first and second steps, whereas the final product is CaP2O6.

Type 2 diabetes (T2D) is associated with increased cardiovascular morbidity, mortality, and hospital admissions. There is variability in clinical practice. The objectives are to analyze the variability in the control of Blood Pressure (BP), HbA1c, and LDL-C in T2D patients and its influence on admissions due to cardiovascular events (CVE) Methods: We analyzed the electronic records in Primary Care Health centers in Navarra (Spain) and hospital admission for CVE. We follow 480637 people from 2012 to 2016. We calculated indicators of control of patients with T2D for each year, percentage with: HbA1c &lt; 7%; HbA1c &gt;= 9%; BP &lt;140/90 mmHg; LDL-C &lt;100 mg/dl. We used logistic and Cox regression. Results: Patients in the best control GP practices cluster are 2.5 times more likely to have HbA1c &lt;7% [OR: 2.46 (95% CI: 2.29-3.64)]. Poor HbA1c control ≥ 9% is more likely in the worst control cluster [OR: 1.73 (95% CI:1.63-1.83)]. The probability of admission for CVE increases with age, being male, low income, obesity, history of CVE, having HbA1c ≥ 9%, and belonging to a GP practice in the cluster of HbA1C ≥ 9% worst control. In contrast, it decreases in patients with HbA1c &lt;7%, BP&lt;140/90 mmHg and LDL &lt;100 mg/dl.

(1) Background: Mouse-mammary tumor virus (MMTV) might play a role in the etiology of some breast cancers in humans. The purpose of our study was to identify MMTV DNA sequences in breast tissue samples from breast cancer patients operated in our regional center from Romania. (2) Methods: We have selected 75 patients with non-metastatic breast cancer treated with curative intent and searched with PCR the MMTV-like DNA sequence in the breast cancer tissue and normal breast tissue obtained from the same patients. (3) Results: None of the examined samples was positive for MMTV-like target sequences on PCR. (4) Conclusions: We could not prove that MMTV plays a role in the etiology of breast cancer in our patient group. This finding is similar to findings of other geographically related research groups and might be due to the fact that only the Mus musculus domesticus mouse species was proven to carry infectious MMTV, but not the Mus musculus musculus species, which is specific to South-Eastern Europe and some parts of Asia.

Water reuse for irrigation is increasingly recognized as an essential and economical strategy in areas with water scarcity. A simple, low-cost, low-maintenance, and highly efficient Pond-In-Pond (PIP) treatment system can be used for wastewater reuse. PIP is a treatment technology in which two types of ponds -- anaerobic and aerobic -- are combined into a single pond and consist of a deeper inner section entirely submerged within the outer pond. Previous studies on PIPs and PIP-like systems have reinforced the potential for reuse through promising performance results with BOD removal over 80% and a reduction in land area requirements by approximately 40%. Yet, no prior efforts have been made to understand the performance mechanism of such systems. This study makes use of two, 2-D modeling tools in developing a fundamental understanding of PIP flow dynamics and the expected performance. The modeling results showed that the PIP configuration offers improved flow diversion along with reduced flow velocity. Additionally, the PIP retained approximately 17% more (p<0.05) particles than the traditional pond with most of the particles concentrated within the inner pond. Lower velocity and the higher solids retention in the PIP thus allowed for better treatment performance compared to traditional ponds. The findings from this study can be used as preliminary data for future in-depth investigations of the PIP system leading toward effective and optimal designs. This will help address the major societal concern of water scarcity with low-cost and effective wastewater treatment.

In this article, the geometry of pseudoparallel, Ricci-generalized pseudoparallel and 2-Ricci-generalized pseudoparallel invariant submanifolds of an almost $\alpha$-cosymplectic $(\kappa,\mu,\nu)$ space has been searched under the some conditions. We also give some characterizations for such submanifolds. I think that obtained new results contribute to differential geometry.

Abstract. The purpose of this review is to investigate the nature of privacy concerns in the context of Smart Local Energy Systems (SLES) to understand how SLES providers can minimize both users’ concern, and cause for concern, around privacy. We conducted a rapid realist review and thematic framework analysis against Bronfrenbrenner’s socio-ecological model to understand privacy concerns in different contexts. A common privacy concern was that sharing detailed energy use data had the potential to reveal information about home life, and to intrude upon people’s sense of autonomy, choice and control. Evidence suggests that people are willing to accept newdata sharing technologies if the benefits of doing so are clear, anticipated, and mutually beneficial. Building trust, through increasing knowledge and understanding was a mechanism for overcoming privacy concerns, but this was mediated by the organization providing the information. Non-profit organizations were more trusted to ensure appropriate safeguards to privacy were in place. One key barrier to participation with good supporting evidence was that people can resist perceived intrusions on their privacy. This could be actively resisted by refusing to install data collection technologies or passively by non-participation in adapting energy use behaviors: both of which are necessary for SLES to achieve their goals of managing energy demand and building resilience in smart grids.

The urgent need to improve performance in the construction industry has led to the adoption of many innovative technologies. 3D laser scanners are amongst the leading technologies being used to capture and process assets or construction project data for use in various applications. Due to its nascent nature, many questions are still unanswered about 3D laser scanning, which in turn contribute to the slow adaptation of the technology. Some of these include the role of 3D laser scanners in capturing and processing raw construction project data. How accurate is the 3D laser scanner or point cloud data? How does laser scanning fit with other wider emerging technologies such as Building Information Modelling (BIM)? This study adopts a proof-of-concept approach, which in addition to answering the afore-mentioned questions, illustrates the application of the technology in practice. The study finds that the quality of the data, commonly referred to as point cloud data is still a major issue as it depends on the distance between the target object and 3D laser scanner’s station. Additionally, the quality of the data is still very dependent on data file sizes and the computational power of the processing machine. Lastly, the connection between laser scanning and BIM approaches is still weak as what can be done with a point cloud data model in a BIM environment is still very limited. The aforementioned findings reinforce existing views on the use of 3D laser scanners in capturing and processing construction project data.

Aims: Angiotensin-converting enzyme 2 (ACE2) plays an important role in the entry of coronaviruses into host cells. This paper described how carnosine, a naturally occurring supplement, can be an effective drug candidate for coronavirus disease (COVID-19) on the basis of molecular docking and modeling to host ACE2 co-crystallized with COVID-19 spike protein. Methods: First, the starting point was ACE2 inhibitors and their structure-activity relationship (SAR). Next, chemical similarity (or diversity) and PubMed searches made it possible to repurpose and assess approved or experimental drugs for COVID-19. In parallel, at all stages, authors performed bioactivity scoring to assess potential repurposed inhibitors at ACE2. Finally, investigators performed molecular docking and modeling of the identified drug candidate to host ACE2 co-crystallized with COVID-19 spike protein. Results: Carnosine emerged as the best known drug candidate to match ACE2 inhibitor structure. Preliminary docking was more optimal to ACE2 than the known typical angiotensin-converting enzyme 1 (ACE1) inhibitor (enalapril) and quite comparable to known or presumed ACE2 inhibitors. Viral spike protein elements binding to ACE2 were retained in the best carnosine pose in SwissDock at 1.75 Angstroms. Out of the three main areas of attachment expected to the co-crystallized protein structure, carnosine bind with higher affinity to two compared to the known ACE2 active site. LibDock score was 92.40 for site 3, 90.88 for site 1, and inside the active site 85.49. Conclusion: Carnosine has promising inhibitory interactions with host ACE2 co-crystallized with COVID-19 spike protein and hence could offer potential mitigating effect against current COVID-19 pandemic.

The regioselectivity in non-polar [3+2] cycloaddition (32CA) reactions has been studied within the Molecular Electron Density Theory (MEDT) at the B3LYP/6-311G(d,p) level. To this end, the 32CA reactions of nine simplest three-atom-components (TACs) with 2-methylpropane were selected. The electronic structure of the reagents has been characterised through the Electron Localisation Function (ELF) and the Conceptual DFT. The energy profiles of the two regioisomeric reaction paths and ELF of the transition state structures are studied to understand the origin of the regioselectivity in these 32CA reactions. This MEDT study permits to conclude that the least electronegative ends X1 atom of these TACs controls the asynchronicity in the C-X (X = C,N,O) single bond formation, and consequently, the regioselectivity. This behaviour is a consequence of the fact that the creation of the non-bonding electron density required for the formation of the new CX single bonds has a lesser energetic cost at the least electronegative X1 atom than that at the Z3 one.