We evaluate the complexity of Colombian climate from extreme behavior of gauge temperature and precipitation, using the the novel Tsallis' non-extensive entropy principle based on physical information through the q-index. We find the spatial structure of non additive universal categories (q-index) and compare with some complex systems with the potential to have some degree of dynamical affinity. Our results evidence the great dynamical variability of regional climate expressed in the large range of values of $q$-index, and the high degree of non-extensitivity for both temperature and precipitation.

This study focusses on identifying a set of representative future climate projections for the Upper Indus Basin (UIB). Although a large number of GCM’s predictor sets are nowadays available in the CMIP5 archive, the issue of their reliability for specific regions must still be confronted. This situation makes it imperative to sort out the most appropriate, single or small-ensemble set of GCMs for the assessment of climate change impacts in a region. Here a set of different approaches is adopted and applied for a step-wise shortlist and selection of appropriate climate models for the UIB under two RCPs: RCP 4.5 and RCP 8.5, based on, a) range of projected mean changes, b) range of projected extreme changes, and c) skill in reproducing the past climate. Furthermore, because of higher uncertainties in climate projection for high mountainous regions like the UIB, a wider range of future GCM climate projections is considered by using all possible future extreme scenarios (wet-warm, wet-cold, dry-warm, dry-cold). Based on this two-fold procedure, a limited number of climate models is pre-selected, out of which the final selection is done by assigning ranks to the weighted score for each of the mentioned selection criteria. The dynamically downscaled climate projections from the Coordinated Regional Downscaling Experiment (CORDEX) available for the top-ranked GCMs are further statistically downscaled (bias-corrected) over the UIB. The downscaled projections up to year 2100 indicate temperature increases ranging between 2.3 °C and 9.0 °C and precipitation changes that range, from a slight annual increase of 2.2% under the drier scenarios, to as high as 15.9% for the wet scenarios. Moreover, for all scenarios, the future precipitation will be more extreme, as the probability of wet days will decrease, while, at the same time, the precipitation intensities will increase. The spatial distribution of the downscaled predictors across the UIB also shows similar patterns for all scenarios, with a distinct precipitation decrease over the south-eastern parts of the basin, but an increase in the northeastern parts. These two features are particularly intense for the “Dry-Warm” and the “Median” scenarios over the late 21st century.

Building more energy efficient and sustainable urban areas that will both mitigate the effect of climate change and adapt for the future climate, requires the development new tools and methods that can help urban planners, architect and communities achieve this goal. In the current study, we designed a workflow that links different methodologies developed separately, to derive the energy consumption of a university school campus for the future. Three different scenarios for typical future years (2039, 2069, 2099) were run as well as a renovation scenario (Minergie-P). We analyse the impact of climate change on the heating and cooling demand of the buildings and determined the relevance of the accounting of the local climate in this particular context. The results from the simulations showed that in the future there will a constant decrease in the heating demand while for the cooling demand there will be a significant increase. It was further demonstrated that when the local climate was taken into account there was an even higher rise in the cooling demand but also that the proposed renovations were not sufficient to design resilient buildings. We then discuss the implication of this work on the simulation of building energy consumption at the neighbourhood scale and the impact of future local climate on energy system design. We finally give a few perspective regarding improved urban design and possible pathways for the future urban areas.

Land surface albedo determines the splitting of downwelling solar radiation into components which are either reflected back to the atmosphere or absorbed by the surface. Land surface albedo is an important variable for the climate community and therefore was defined by the Global Climate Observing System (GCOS) as an Essential Climate Variable (ECV). Within the scope of the Satellite Application Facility for Land Surface Analysis (LSA SAF) of EUMETSAT, a near-real time (NRT) daily albedo product was developed in the last decade from observations provided by the SEVIRI instrument on board the geostationary satellites of the Meteosat Second Generation (MSG) series. In this study we present a new collection of albedo satellite products based on the same satellite data. The MSG Ten-day ALbedo (MTAL) product incorporates MSG observations over 31 days with a frequency of NRT production of 10 days. The MTAL collection is more dedicated to climate analysis studies compared to the daily albedo that was initially designed for the weather prediction community. For this reason, a homogeneous reprocessing of MTAL was done in 2018 to generate a Climate Data Record (CDR). The resulting product is called MTAL-R and has been made available to the community in addition to the NRT version of the MTAL product which has been available for several years. The retrieval algorithm behind the MTAL products comprises three distinct modules: one for atmospheric correction, one for daily inversion of a semi-empirical model of the bidirectional reflectance distribution function, and one for monthly composition that also determines surface albedo values. In this study the MTAL-R CDR is compared to ground surface measurements and concomitant albedo products collected by sensors on-board polar-orbiting satellites (SPOT-VGT and MODIS). We show that MTAL-R meets the quality requirements if MODIS or SPOT-VGT are considered as reference. This work leads to 14 years of production of geostationary land surface albedo products with a guaranteed continuity in the LSA SAF for the future years with the forthcoming third generation of European geostationary satellites.

This study examines the feasibility of using event-related potentials (ERPs) obtained from electroencephalographic (EEG) recordings as biomarkers for long-term memory item classification. Previous studies have identified old/new effects in memory paradigms associated with explicit long-term memory and familiarity. Recent advancements in convolutional neural networks (CNNs) have enabled the classification of ERP trials under different conditions and identification of features related to neural processes at the single-trial level. We employed this approach to compare three CNN models with distinct architectures using experimental data. Participants (N = 25) performed an association memory task while recording ERPs that were used for training and validation of the CNN models. The EEGNET-based model achieved the most reliable performance in terms of precision, recall, and specificity compared with the shallow and deep convolutional approaches. The classification accuracy of this model reached 70% for known items and 62% for unknown items. Good overall accuracy requires a trade-off between recall and specificity and depends on the architecture of the model and the dataset size. These results suggest the possibility of integrating ERP and CNN into online learning tools and identifying the underlying processes related to long-term memorization.

Recent research has highlighted associations between sleep and microbial taxa and pathways. However, the causal effect of these associations remains unknown. To investigate this, we performed a two-sample bidirectional Mendelian randomization (MR) analysis using summary statistics of genome-wide association studies (GWAS) from 412 gut microbiome traits (N = 7,738) and GWAS studies from seven sleep-associated traits (N = 345,552 to 386577). We employed multiple MR methods to assess causality, with Inverse Variance Weighted (IVW) as the primary method. We further applied Cochran’s Q statistical analysis, MR-Egger intercept, and MR-PRESSO for heterogeneity and pleiotropy assessment, alongside a Bonferroni correction ((P

Electroencephalography (EEG) enabled earbuds represent a promising frontier in evaluating brain activity beyond traditional laboratory settings. However, these devices need more comprehensive characterization before widespread health related usage. A toolbox was developed to facilitate and expand the assessment of ear-EEG devices. The first component of this toolbox is a desktop application (“EaR-P Lab”) that integrates EEG validation paradigms. This application is designed to be used with EEG amplifiers compatible with the Lab Streaming Layer (LSL) protocol. The second element of the toolbox introduces an adaptation of the phantom testing concept, to the domain of ear-EEG by using 3D ear scans of the tested individuals, allowing controlled assessment of ear-EEG devices. The EEG paradigms were validated for scalp acquisitions and applied on ear-EEG measurements, under wet ear electrode conditions. The ear-EEG phantom was successful in measuring useful metrics in EEG system characterization, highlighting performance differences within the electrodes on the tested earpieces. This knowledge was factored in to select an optimal electrode reference which resulted in increased response power on the auditory steady-state response (ASSR). Through this work, an ear-EEG evaluation toolkit is made available with the intention to enable future and systematic assessment of novel ear-EEG devices from the hardware to the neural signals.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

Plants respond to drought by major reprogramming of gene expression enabling the plant to survive this threatening environmental condition. One major upstream signal inducing this multifaceted process is the phytohormone abscisic acid (ABA). In this report, we investigate the drought response in barley plants (Hordeum vulgare, cv. Morex) at both epigenome and transcriptome levels. Leaves of barley plants after 10 days of drought treatment, when soil water content was decreased by about 40%, were compared to well-watered controls. Due to the drought treatment, chlorophyll content and photosystem II-efficiency were decreased by about 10% and some known drought-related genes were already induced. Global ChIPseq analyses were used to identify genes where histones 3 associated with promoter or gene body were modified with euchromatic K4 trimethylation or K9 acetylation during drought. Using stringent exclusion criteria, 129 genes loaded with H3K4me3 and 2008 genes loaded with H3K9ac in response to drought were identified, indicating that H3K9 acetylation reacts to drought more sensitive than H3K4 trimethylation. Comparison with differentially expressed genes enabled to identify those genes, which are loaded with the euchromatic marks and are induced in response to the drought treatment. The results show that a major part of these genes is involved in ABA-signaling and related pathways. Intriguingly, two members of the protein phosphatase 2C family (PP2Cs), which are involved in the central regulatory machinery of ABA signaling, were also identified by this approach.

The durability of ecological concrete in a marine environment was studied. Specimens of a six-year-old submerged ecological concrete from a breakwater located in the East Mediterranean sea were analyzed for their biological carbonate deposition cover, chloride effective diffusion, carbonation, and mineralogy. About 57% of the surface was found to be covered by biogenic-deposited carbonates. The effective chloride diffusion coefficient and the carbonation rate were found to be reduced proportionally to the biogenic-carbonate cover. Most of the aluminates were found in non-crystalline minerals. No evidence of a sulfate attack was found.

In northern Thailand, the problem of small particulate matter happens every year, with the pri-mary source being agricultural weed burning and wildfire. The tourism industry is strongly impacted and has been the spotlight for the past few years. Thus, the study aims to investigate the effect of small particulate matter on tourism and related SMEs in Chiang Mai, Thailand. The data was collected from 286 entrepreneurs in the tourism and related SMEs sectors. The data was analyzed using data mining and association rule techniques. The study revealed that small particulate matter has a considerable impact on customer factors, especially the number of customers has decreased. Operational factors and prod-uct/service factors are also affected by the dust in the form of adjustments to keep the business running and the protection of the health of employees and customers. Certainly, financial factors are affected by the small particulate matter situation, both lower revenues and higher costs.

The combination of statistical learning technologies with large databases of psychophysiological data has appropriately generated enthusiastic interest in future clinical applicability. It is argued here that this enthusiasm should be tempered with the understanding that significant obstacles must be overcome before the systematic introduction of psychophysiological measures into neuropsychiatric practice becomes possible. The nonspecificity of psychophysiological measures complicates their use in diagnosis. Low test-retest reliability complicates use in longitudinal assessment, and quantitative psychophysiological measures can normalize in response to placebo intervention. Ten cautionary observations are introduced and, in some instances, possible directions for remediation are suggested.

Abstract Background The number of immune-related endocrine dysfunctions (irEDs) has concurrently increased with the widespread use of immunotherapy in clinical practice and further expansion of the approved indications for immune checkpoint inhibitor (ICI) combinations using different modalities of anti-cancer treatment. Method A retrospective analysis was conducted on consecutive patients >18 years of age with advanced solid malignancies who had received at least one dose of anti-programmed cell death protein 1 (anti-PD-1) and/or anti-CTLA4 antibodies between January 2014 and December 2019 at a Hong Kong university hospital. Patients were reviewed for up to two months after the last administration of an ICI. The types, onset times and grades of irEDs, including hypothyroidism, hyperthyroidism, adrenal insufficiency and immune-related diabetes mellitus, were recorded. Factors associated with irEDs were identified using multivariate analysis. Result A total of 953 patients (male: 603, 64.0%; median age: 62.0 years) received ICIs during the study period. Of these, 580 patients (60.9%) used ICI-alone, 132 (13.9%) used dual-ICI, 187 (19.6%) used an ICI combined with chemotherapy (chemo+ICI), and 54 (5.70%) used immunotherapy with a targeted agent (targeted+ICI). A significantly higher proportion of patients using targeted+ICI had irEDs and hypothyroidism; in contrast, a higher proportion of patients using dual-ICI had adrenal insufficiency. There was no significant difference in the incidence of irED between the younger (<65 years) and older (>65 years) patients. Using logistic regression, only treatment type was significantly associated with irEDs. Notably, older patients had a higher risk of having immune-related diabetes mellitus. Conclusions This large, real-world cohort demonstrates that combining ICI with targeted therapy has a higher risk of overall irED and hypothyroidism. Immunotherapy is safe and well-tolerated regardless of age, but close monitoring of fasting glucose is needed in older populations.

With a highly efficient optical absorption capability, bismuth selenide (Bi2Se3) nanomaterial can be used as an outstanding photothermal agent for anti-tumor treatment and shows promise in the field of nanotechnology-based biomedicine. However, little research has been done on the relevant mechanism underlying the photothermal killing effect of Bi2Se3 nanomaterial. Herein, the photothermal effects of Bi2Se3 nanoparticles on A549 cells were explored with emphasis put on autophagy. Firstly, we characterized the structure and physicochemical property of the synthesized Bi2Se3 and confirmed their excellent photothermal conversion efficiency (35.72%), photostability, biocompatibility and ability of photothermal killing on A549 cells. Enhanced autophagy was detected in Bi2Se3-exposed cells under an 808 nm laser. Consistently, an elevated expression ratio of LC3-II to LC3-I, a marker of autophagy occurrence, was induced in Bi2Se3-exposed cells upon NIR irradiation. Meanwhile, the expression of cleaved-PARP was increased in the irradiated cells dependently on the exposure concentrations of Bi2Se3 nanoparticles. Pharmacological inhibition of autophagy by 3-methyladenine (3-MA) further strengthened the photothermal killing effect of Bi2Se3. Meanwhile, stress-related signaling pathways including p38 and SAPK/JNK were activated coupled with the attenuated PI3K/Akt signaling. Our study figures out that autophagy and the activation of stress-related signaling pathways were involved in the photothermal killing of cancerous cells by Bi2Se3, which provides a more understanding of photothermal nanomaterials.

Apathy is a fundamental neuropsychiatric symptom of Korsakoff’s syndrome (KS) and has also been reported in patients with alcohol use disorder with no (AUD) or less severe cognitive disorders (ALC). However, research on the nature of apathy is limited in these groups. Aim of this study was to examine the multidimensional nature of apathy in patients with KS, ALC and AUD. Moreover, we examined differences between apathy ratings by patients and their professional caregivers, and related apathy to everyday functioning and overall cognition. Twenty-four patients with KS, 24 patients with ALC and 21 patients with AUD participated in this study. Apathy was measured using the Apathy Motivation Index (AMI), which distinguishes behavioral, emotional and social apathy. Both patients and professional caregivers reported social apathy as most prominent symptom, compared to behavioral and emotional apathy. Apathy ratings did not differ across the three patient groups. Discrepancies between patient and caregiver ratings were observed in patients with KS and ALC, with more severe apathy reported by caregivers. Caregiver-reported behavioral and social, but not emotional, apathy was related to everyday functioning. These results show that apathy is present in a substantial proportion of patients with alcohol addiction with or without cognitive impairments.

Emotional dysfunction, including flat affect and emotional perception deficits, is a specific symptom of schizophrenia disorder. We used a modified multimodal odd-ball paradigm with fearful facial expressions accompanied by congruent and non-congruent sounds to investigate the impairment of emotional perception and reaction to other people's emotions. We analyzed subjective assessments and ERP data for emotionally charging congruent and non-congruent stimuli in patients with schizophrenia and healthy peers. The results showed the deficit of multimodal perception of fearful stimuli in patients with schizophrenia compared to healthy controls. The amplitude of N50 was significantly higher in subjects of the control group for non-congruent stimuli than congruent and did not differ in patients with schizophrenia. The dynamics of P100 and N200 components confirmed the impaired sensory gating in patients with schizophrenia. The lower amplitude of P3a could be associated with deficits in verbal memory and attention, less emotional arousal, or incorrect interpretation of emotional valence as specific features of patients. The difficulties in identifying the incoherence of facial and audial components of emotional expression could be significant in understanding the psychopathology of schizophrenia.

Daphne wolongensis described on the basis of a few known individuals was investigated in the wild, in Baoxing Valey, Sechuan. Its status of valid species was verified morphologically and genetically. Three newly found populations were compared to the closely related species Daphne retusa, D. tangutica, D. longilobata, D. acutiloba, D. sureil, to clones available in cultivation and selected cultivars. The high bootstrap values indicate a good level of genetic differentiation between each of the studied species. The hypothesis whether D. wolongensis is a hybridogenous species was rejected, it is a well-defined independent species. Based on morphological and genetic data, it seems likely that another species, D. limprichtii can be a mountain form of D. tangutica. Variability of populations in Wolong gives a good opportunity to select genotypes with a higher or better performance of combination of traits. From 51samples collected in Wolong it was possible to select the top ten different types as genetic resources for breeding. Daphne wolongensis, in the visited sites of Wolong area, occupies less than 1 km2. Together with isolated finds, the number of found individuals is less than 500 and the area is not larger than 10 km2, thus it falls to the IUCN category of “Critically Endangered” plants.

Introduction: Osteoarthritis (OA) and age-related degeneration (ARD) are stimulants for the development of the fabella in the knee joint. This meta-analysis updates previous studies and reviews on the prevalence of the fabella in OA or ARD knee joints. In addition, it provides a quantitative estimation of the fabellar prevalence in knees having OA and ARD. Methodology: Twenty studies comprising of data from 11,056 knee joints were included in the analysis, consisting of 6,819 Knees of OA subjects (including those with age more than 40 years) and 4,237 knees of non-OA subjects (including less than 40years) knees, respectively. 2,434 knees had fabellae present in OA subjects (including more than 40years), and 844 fabellae were present in non-OA subjects (including less than 40years). The Odds and Risk Ratios were calculated. Sensitivity analysis and cumulative analysis were conducted to assess the robustness of the findings. Results: Prevalence of fabella was found to be higher in OA knees, where the Risk Ratio of developing fabella was 2.50 (2.07-3.01). Compared with this, the Risk Ratio for the incidence of fabella in OA with ARD knee was 1.84 (1.66-2.03). The bilateral occurrence of fabella was more common than unilateral. The risk of developing fabella in individuals aged less than forty-year was 63% less than individuals aged more than forty years. Conclusion: OA and ARD would increase the prevalence of fabella by 84%, thus acting as stimulants and risk factors for ossified fabella.

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

The present study was conducted to evaluate the effects of dietary supplementation of tea polyphenol （TP） on serum hormone, serum enzyme activity, antioxidant-related and immune-related gene expression of laying hens under heat stress. A total of 288 Chinese yellow chicken (186 days old) were randomly distributed among two treatments, each of which included 6 replicates of 24 hens. Dietary treatments were that the basal diet was supplemented with 200 mg / kg tea polyphenol. The study lasted for 7 weeks, including 1 week of adaptation and 6 weeks of the formal test. The content of high-density lipoprotein cholesterol (HDL-C) and total protein (TP) in serum significantly decreased by dietary supplementation with tea polyphenol. Dietary tea polyphenol supplementation improved serum superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) enzyme activity and decreased serum malondialdehyde (MDA) content in treatments compared to the control. However, supplementation of tea polyphenol did not affect the activity of serum catalase (CAT). The results indicated that long-term feeding of tea polyphenols help to increase the amount of hormones (FSH, E2) associated with reproduction in laying hens and thus improve egg production. It also improved the immune function of laying hens in high temperature environments. Adding tea polyphenols to the diet can significantly increase the serum IgG, IgM content of the laying hens and can upregulate the IgA content. Dietary supplementation of tea polyphenols in the laying hens significantly increased the expression of antioxidant enzyme-related genes (SOD, CAT and GPX1) in the liver. Moreover, the addition of tea polyphenols significantly increased the expression of immune-related genes (Interferon-γ (INF-γ), Interleukin 2 (IL-2) and Interleukin 4 (IL-4)) in the spleen. It is concluded that addition of tea polyphenols has a positive effect on antioxidant activity and immune function of laying hens.

EZH2 overexpression is associated with tumor proliferation, metastasis, and poor prognosis. Targeting and inhibiting EZH2 may be an effective therapeutic strategy for head and neck squamous cell carcinoma (HNSCC). We previously analyzed EZH2 mRNA expression in a well-characterized dataset of 230 (110 original and 120 validation cohorts) human head and neck cancer samples. This study aimed to investigate the effects of inhibiting EZH2, either via RNA interference or via pharmacotherapy, on HNSCC growth. EZH2 upregulation was significantly correlated with recurrence (P < 0.001) and the methylation index of tumor suppressor genes (P < 0.05). DNMT3A was significantly upregulated upon EZH2 upregulation (P = 0.043). Univariate analysis revealed that EZH2 upregulation was associated with poor disease-free survival (log-rank test, P < 0.001). In multivariate analysis, EZH2 upregulation was evaluated as a significant independent prognostic factor of disease-free survival (hazard ratio: 2.085, 95% confidence interval: 1.390–3.127; P < 0.001). Cells treated with RNA interference and DZNep, an EZH2 inhibitor, showed the most dramatic changes in expression, accompanied with a reduction in the growth and survival of FaDu cells. These findings suggest that EZH2 upregulation is correlated with tumor aggressiveness and adverse patient outcomes in HNSCC. Evaluation of EZH2 expression might help predict the prognosis of HNSCC patients.

Recent evidence suggests the existence of shared neural resources for rhythm processing in language and music. Such overlaps could be the basis of the facilitating effect of regular musical rhythm on spoken word processing previously reported for typical children and adults, as well as adults with Parkinson’s disease and children with developmental language disorders. The present study builds upon these previous findings by examining whether musical rhythmic priming also influences visual word processing, and the extent to which such cross-modal priming effect of rhythm is related to individual differences in musical aptitude and reading skills. EEG was recorded while participants listened to a rhythmic tone prime, followed by a visual target word with a stress pattern that either matched or mismatched the rhythmic structure of the auditory prime. Participants were also administered standardized assessments of musical aptitude and reading achievement. ERPs elicited by target words with a mismatching stress pattern showed an increased fronto-central negativity. Additionally, the size of the negative effect correlated with individual differences in musical rhythm aptitude and reading comprehension skills. Results support the existence of shared neurocognitive resources for linguistic and musical rhythm processing, and have important implications for the use of rhythm-based activities for reading interventions.

Choroidal neovascularization (CNV) is a key pathological feature of several of the leading causes of vision loss including neovascular age-related macular degeneration. Here we show that a calreticulin anti-angiogenic domain (CAD)-like peptide 27, CAD27, inhibited in vitro angiogenic activities, including tube formation and migration of endothelial cells, and suppressed vascular sprouting from rat aortic ring explants. In rat model of laser-induced CNV, we demonstrate that intravitreal injection of CAD27 significantly attenuated the formation of CNV lesions as measured via fundus fluorescein angiography and choroid flat-mounts (19.5% and 22.4% reductions at 10μg and 20μg of CAD27 injected, respectively). Similarly, the reduction of CNV lesions was observed in the groups of rats that had received topical applications of CAD27 (choroid flat-mounts: 17.9% and 32.5% reductions at 10μg/mL and 20μg/mL of CAD27 installed, respectively). Retinal function was unaffected, as measured using electroretinography in both groups received interareal injection or topical applications of CAD27 at least for 9 days. These findings show that CAD27 can be used as a potential therapeutic alternative for targeting CNV in the diseases such as neovascular age-related macular degeneration.

Garment sector has crucial working field in Turkey.It has also very high risky occupational health conditions and safety.The objective of this study is to define level of job level, work-related stress’ symptoms, social support and coping mechanisms of garment workers and to determine any related factors.This study is descriptive and cross-sectional. The study population comprised garment workers in the 16-65 age range. The data was collected by Assessment Form, The Brief Stress Coping Profile and Brief Job Stress Questionnaire. The level of work-related stress was statistically higher among the workers who had chronic disease, low economic, education status and poor quality of sleep. Psychological and physical physiological reactions to stress were found higher among women workers and those with chronic disease.It also was seen that job stress scores had a meaningful relationship with “emotional expression involving others” (r =.20) and “Avoidance and suppression” coping profile (r =.16; p <.01).Psychological symptom scores were found to have a low level of meaningful relationship with “Seeking help for solution” (r =-.08), “changing point of view” (r=.13) and “emotional expression involving others” coping profiles (r=.21). Work-related stress causes many health and behavioral problems. Work related reasons and coping profiles have powerful effects on stress.

Age-related diseases (ARDs) are the leading cause of death worldwide, and contribute to 90% of mortality in developed countries. Interestingly, the mortality rates of individual ARDs increase exponentially with age. Processes described by the exponential growth function typically involve a branching chain reaction or, more generally, a positive feedback loop. Here I propose that each ARD is mediated by one or several positive feedback loops (vicious cycles). I then identify critical vicious cycles in five major ARDs: atherosclerosis, hypertension, diabetes, Alzheimer’s and Parkinson’s. I also propose that the progression of ARDs can be halted by selectively interrupting the vicious cycles and suggest the most promising targets. An evolutionary perspective is also offered.

Unquestionably the rapidly changing climate and, therefore, alterations in the associated bioclimate, constitute an alarming reality with implications in daily practice and natural capital management. In this research the present and projected bioclimate evolution over the phytogeographical regions of Greece is displayed. For this purpose, ultrahigh-resolution computation results on the spatial distribution of the Emberger index’s Q2 classes of bioclimatic characterisation are analysed and illustrated for the first time. The assessments are performed over the reference period (1970–2000) and two future time frames (2021–2040; 2041–2060) under the RCP4.5 and RCP8.5 emission scenarios. By 2060 and under the extreme RCP8.5, intense xerothermic trends are demonstrated owing to the resulting significant spatial evolution mainly of the Arid-Hot, Semi-Arid-Very Hot, Semi-Arid-Hot and Semi-Arid-Temperate Q2 classes, respectively, over the phytogeographical regions of Kiklades (up to 29% occupation), Kriti and Karpathos (up to 30%), West Aegean Islands (up to 26%), North East (up to 56%)–North Central (up to 31%). The RCP8.5 long-term period exhibits the strongest impacts over approximately the right half of the Greek territory the bioclimate of which appears as more dry-thermal in the future.

In Korea, laver (Gim) is the leading traded marine product and an important food source, accounting for 82.0% of the world’s exports. Laver exports reached $100 million in 2010 and steadily increased to $600 million in 2020. An increase in laver exports improves the income of laver farmers and promotes the growth of fisheries. However, marine algae are vulnerable to climate change. In this study, we aimed to predict changes in laver production due to climate change using environmental variables, including water temperature, rainfall, and sunlight duration. The results showed that water temperature considerably affected laver production; when water temperature increased by 1 °C, production decreased by 13.78% (t) in the same month. By contrast, when sunlight duration and rainfall increased by 1 h and 1 mm, respectively, 1 month before harvesting laver, production increased by 0.32% (t-1) and 0.13% (t-1), respectively. Using four scenarios based on climate change published by the Intergovernmental Panel on Climate Change in a modeling exercise, we found that laver production in 2100 in Wando in Korea may decline by 73.3% owing to water temperature changes (based on 2020 production), threatening food security. Accordingly, short-, mid-, and long-term countermeasures are needed for sustainable laver aquaculture. Appropriate water temperature (21–22 °C) during seeding is necessary to control environmental variables, based on scientific data and activation of land-based seeding methods. Moreover, mid- and long-term countermeasures should include development of high-temperature resistant laver seeds, identification of suitable new laver aquaculture grounds, and research on seeds that can adapt to climate change.

Sweden has long been hailed as a role model in climate policy. But the new right-wing government supported by a far-right populist party is undertaking a paradigm shift in Swedish climate policy and governance. This paper critically analyses this paradigm shift and its impacts on legitimacy, accountability and justice. These are democratic norms important in the analysis of a just transition to climate neutrality. Severe democratic deficits of the policy process and the policies proposed and adopted are identified, suggesting ‘nasty politics’ characterised by populist, divisive, and contentious rhetoric that entrenches polarization and us/them narratives. Climate scientists and the climate justice movement are discriminated in the policy process, the latter also being accused of terrorism and seen as a threat to democracy by the government. The deficits are partly explained by the neo-corporatist political system of Sweden and the dominance of the (neo)liberal discourse of ecological modernization in Swedish environmental policy, but primarily with the ongoing process of autocratization driven by anti-democratic far-right populist parties throughout Europe. The anti-democratic climate policy reforms in Sweden are foreboding an unwelcome development in the EU given the boost of far-right populist parties in the upcoming elections to the European Parliament in June 2024.

The concept of policy entrepreneurs has gained increasing attention in studies of climate policy and governance since it foregrounds the role of agency in understanding policy change. However, agency of policy entrepreneurs in the policy process is largely political and conceals the power that shapes how public problems and policies are framed and defined. Thus, policy entrepreneurs should be confronted with the challenge of generating legitimacy, accountability and justice of their actions and the implementation of their targeted policy change. Drawing on political-philosophical theories of liberal and deliberative democracy this paper outlines a conceptual framework for critical analytical as well as normative research on strategies and impacts of policy entrepreneurs. Empirical research on the strategies and impacts of policy entrepreneurs in recent policymaking on climate policy and governance in the EU and Sweden identifies several democratic deficits. In all, the paper brings ideology and politics into research on policy entrepreneurs. It is suggested that not only the strategies used, but also the ideologies of actors that use them, is the causal mechanism that links the policy entrepreneurs to the outcomes, and thus if their advocacy will facilitate or hamper a just transition to climate neutrality and sustainability.

Sweden has long been hailed as a role model in climate policy. But the new right-wing government supported by a far-right populist party is undertaking a paradigm shift in Swedish climate policy and governance. This paper critically analyses this paradigm shift from perspectives of legitimacy, accountability and justice. These are democratic norms important in the analysis of a just transition to climate neutrality. Severe democratic deficits of the policy process and the policies proposed and adopted are identified. The deficits are explained by the neo-corporatist political system of Sweden, the dominance of the (neo)liberal discourse of ecological modernization in Swedish environmental policy, and an ongoing process of autocratization driven by anti-democratic far-right populist parties throughout Europe. The paper ends by suggesting how climate policy and governance can be democratized and re-politicized, that also give room for climate justice advocates to take part in policy processes.

The objective of this research was to study the dynamics of moisture and nutrition at the root zone and to quantify the variables linked to efficient water management in avocado orchards of mid and high-lands of Michoacán, México, in typical Andisols of low fertility with (A)C(w2) and C(w2) climates, respectively. Using the FDR (Frequency Domain Reflectometry) technology, the dynamics of soil moisture and salinity were recorded daily at four depths: 0-15, 15-30, 30-45, and 45-60 cm. The soil moisture balance model was used to determine actual evapotranspiration (ETr), crop coefficient (Kc), and water use efficiency (WUE). Results indicated that ETr is 66-73% of the total water at 0-30 cm depth; the fertilizer absorption is limited to 0-30 cm, being negligible at deeper layers. The water use efficiency is 4.4 to 5.6 kg of fruit m-3 of applied water, and the ratio of the water use index (ETr/irrigation sheet applied, ISA) is 0.65-0.70; while the annual avocado Kc is 0.72 in Cutzato and 0.78 in Tiamba. We concluded that avocado has a low water requirement, it does not cause leaching of nutrients and/or water, the absorption of water and nutrients mostly occurs at 30 cm depth, and from a hydrological point of view, the crop is environmentally friendly.

The study explores the value of indigenous knowledge in mitigating and adapting to the effects of climate change in rural communities of Uganda. It provides an overview of how rural farmers use traditional and indigenous knowledge to predict weather changes to inform their adaptation and mitigation plans. The study intended to investigate how climate change effects were managed by the rural communities of Bakiga using indigenous knowledge and practices. Specifically, it sought to establish how local farmers’ innovations and practices were used to mitigate the effects of climate change and enhance food security. A case study research design with triangulation of data sources was employed. The study was conducted in Rukiga District, southwestern Uganda, where rural farmers were interviewed to explore their practices for reducing the effects of climate change to enhance food security. Thematic data analysis was used to get participants’ experiences and views regarding indigenous knowledge and effects of climate change mitigation. The findings indicate that rural farmers have indigenous practices of mitigating the effects climate change and contributing to the Sustainable Development Goals (SDGs).

The brief paper utilises Zimbabwe as a case study to discuss the effects of El Nino in Southern Africa. It offers potential adaptation and mitigation measures for farmers to prepare for the forecasted El Nino-influenced rainy season 2023/24 and the future. To reduce climate and weather hazards connected with El Nino, the brief report suggests anticipatory action methods be applied in southern Africa, using Zimbabwe as a case study. To protect farmers' livelihoods and enhance drought readiness for the forthcoming agricultural seasons, the paper suggests a degree of strategic, tactical, and operational decision-making that the agriculture industry should adhere to. It emphasised the significance of providing farmers with knowledge and advice regarding drought and heat stress, including cultivating crop varieties and livestock and sufficient fire safety precautions. The brief paper calls to advocate for anticipatory action to avert El Nino in Southern Africa.

This study contextualises the background of Japan’s “carbon neutrality and net-zero” (CNN) policy announced in October 2020, thereby identifying important changes in the country’s climate policy between 1990 and 2020. Using four research questions, four main findings were extracted from a narrative technique-based analysis of Japan’s policy documents related to CNN. The following are the findings: [i] the framing of climate change as a “climate crisis” by influential Japanese climate stakeholders was a key motivation for Japan to formally announce its CNN policy in October 2020, [ii] pressure from the international community and the political leadership of the Yoshihide Suga administration are essential factors that led the Japanese government to change its stance and announced this policy, [iii] Japan unintentionally delayed announcement of the policy until 2020 due to the concern among Japanese climate stakeholders about the problem of fairness in Kyoto Protocol’s emission reduction targets, and [iv] this delay was also due to Keidanren’s (or business sector) consistent opposition to the introduction of regulatory schemes. These results emerge for the first time in a study of Japan’s CNN politics, particularly in terms of the broader context of climate politics. Finally, we offer a possible explanation for Suga’s deliberate announcement of the CNN policy. This opens up space for future research to complement our study by providing important indicators on the trajectory of this important policy.

The prefabricated houses supply in Chile was analyzed from web platforms, public market, social media, and Internal Revenue Service, using indicators according to regulatory compliance, complexity, and sustainability attributes, which are essential in advancing to industrialization, and climate change adaptability. The 80% is concentrated in construction, and manufacturing companies, 83% of them are legally registered,with the capacity of meeting technical requirements. To delve deeper into this, 54% has low level, 35% medium level, and 11% high level. The sustainability was measured in 5 levels: 2.7% (1), 37,5% (2), 58,6% (3), 1,1% (4) and 0% (5), which is the highest one. This attribute was determined as the weakest one. The proposed evaluation, based on indicators by attribute, is objective and relevant to consideration since there is still a lack of capacity to supply the housing deficit, and there is not attributes associated to security in habitability to address the climate change, and environment threats, with a lack of action by the state to promote this productive sector, therefore focusing more in provide products, than taking responsibility of the site, not advancing to become a real state agency, which could be improved if management, and regulation were incorporated.

Based on the daily observation data of 2254 meteorological stations in China from 1961 to 2021 after homogenization and correction, the extreme value analysis method that combines relative threshold and absolute threshold was used to identify extreme climate events in the mainland of China, namely extreme high temperature, extreme low temperature, extreme drought, extreme precipitation and extreme typhoon events. The frequency and linear variation trends of individual extreme events in the past 60 years were investigated. On this basis, the multi extreme events composite risk grade index (MXCI) was constructed, which can objectively reflect the comprehensive characteristics of multi extreme climate events in different regions. The results show that the high value areas of MXCI were mainly located in Southeast China and Southwest China. The MXCI presented a decreasing trend in most of the western and southeastern regions of China, while an increasing trend from Southwest China to the south of Northeast China, due to the frequent occurrence of extreme high temperature, extreme drought and other extreme events in these regions.

This essay review explores the concept of climate-smart forestry as an approach to mitigating and adapting to climate change. It highlights the need for a holistic approach to forestry that considers regional differences and synergies between ecosystem services. The essay discusses various management strategies at different scales, including species selection, mixed species cultivation, and the promotion of the bioeconomy. It also examines the trade-offs and synergies between different forest uses and the effects of forest management on ecosystem services. Furthermore, the review addresses major abiotic and biotic damage risks to forests, such as wildfires, windstorms, and bark beetle attacks, and proposes risk management strategies. Lastly, the review delves into the management of peatland forests, discussing the role of drainage, the impact of ditch network maintenance, and the challenges of peat ash fertilization. Overall, the review provides valuable insights into climate-smart forestry and its potential to contribute to climate change mitigation and adaptation.

Students are often portrayed as future leaders. Their participation in climate change mitigation would improve when they access climate information and gain a high level of climate change awareness. This study was initiated to assess the Congolese students’ awareness of climate change by focusing on their sources of information on climate change, knowledge about the causes and impacts of climate change and activities that can raise awareness on climate change. Using a convenience sampling technique, we collected data through individual interviews conducted among 1,278 students from 13 universities across the Democratic Republic of Congo (DRC). The interview results showed that all students irrespective of their disciplines were concerned about climate change, a phenomenon strongly driven by human activities, such as deforestation (78%), urbanisation (30%), agriculture activities (30%) and transport services (26%). The students’ perceptions of climate change impacts included increase in temperature (82%), decrease in the number of rainy days (66%), proliferation of pests (60%) and increase in the number of malaria patients (39%). The primary sources of information that significantly affected students’ awareness of climate change included environment-related university courses and television broadcasts. The awareness-raising and mitigation actions related to climate change recommended by the students included educating people about good waste management (56%), planting trees (65%) and using the taxes paid by mining companies for the restoration of degraded ecosystems. The students believed that in DRC, all layers of the society (educational institutions, civil society organisations, community members and businesses) are important in building resilience to climate change. This study can guide teachers to focus their educational efforts on shaping pro-environmental behaviour in students.

There is a growing consensus that to effectively adapt to climate change, cities need user-friendly tools and reliable high-resolution biophysical and socio-economic data for analysis, mapping, modeling, and visualization. This study examines availability of various types of information used in climate adaptation plans of 40 municipalities with population less than 300,000 people in the United and in France, probing into the choice and usage of relevant information by small municipalities. We argue that non-climatic spatial data, such as population demographic and socio-economic patterns, urban infrastructure, and environmental data must be integrated with climate tools and datasets to inform effective vulnerability assessment and equitable climate adaptation planning goals. Climate adaptation plans frequently fail to address the existing structural inequalities and environmental injustices in urban infrastructure and land use. Adaptation methodological approaches should be reassessed in the context of much needed societal transformation. Lessons learned from our studies offer valuable insights for potential development of the national and state-level climate adaptation information services for cities.

The Impact Chain framework for risk assessment has proven to be a robust and effective It is very useful to set up the conceptual framework associated to a given risk and allows accommodating naturally the different components that shape that However, the operationalization of the impact chain may not be straightforward, in particular due to the inherent uncertainties associated to the selected indicators and the assigned In this paper, we introduce an extension to the Impact Chain framework that allows to consider uncertainties in the different components of the risk In the framework of the UNCHAIN project, a web-based tool has been developed to ease the task of implementing that The tool has been applied to a case study on the loss of tourist attractiveness due to heat stress conditions on the Balearic island, Spain, to illustrate how uncertainties in different components of the impact chain can affect the robustness of the final risk Also, the tool provides an estimate of the sensitivity of the final risk to each component, which can be used to guide risk mitigation Finally, a proposal for the validation of the risk assessment is presented.

Spatial planning holds a key role in preventing or mitigating the impacts of climate change on both cities and rural areas, taking a forward-thinking and holistic approach to urban and regional development. As such, spatial planning deals with challenges occurring at different scales and across sectors. The international literature points out the need for horizontal and vertical cooperation to tackle climate change impacts. While there is abundant knowledge regarding the challenges related to climate change at different spatial levels, procedural integration into planning frameworks and practice is currently under-researched. This paper presents a novel theoretical framework that integrates various steps towards a holistic, integrative and adaptive climate proofing process. An iterative process was used for conceptual development, based on literature review followed by external feedback meetings and two workshops with the core team of planning experts responsible for exchange across federal states. By specifically addressing the challenges relating to cross-regional and cross-sectoral planning, this novel framework attempts to (i) facilitate a hierarchy of measures, (ii) maximise co-benefits for various adaptation purposes and climate change mitigation and (iii) foster the long-term institutionalisation of integrative processes across sectors, planning areas and policy levels.

Climate change has a inevitable impacts on tree radial growth, particularly at mountain timeberlines. To understand climate effects on conifer radial growth in the central Hengduan Mountains and potential impacts of future climate change on conifer forest, we studied growth responses to climate variables in Abies georgei, the major tree species of conifer forest in Hengduan Mountains. We collected tree ring samples from four sites near the timberlines and analyzed the relationship between principle components (PC#1) of four chronologies and climatic variables by using response function analysis (RFA), redundancy analysis (RDA) and moving interval analysis (MIA). A. georgei growth was affected by both temperature (positive effects) and precipitation (negative effects). Specifically, the radial growth of A. georgei was significantly and positively correlated with current July and previous November temperature (detected by both RFA and RDA), while precipitation of current June and September inhibited tree growth (detected by RDA). More rapid warming in recent 20 years (1990–2010) clearly enhanced growth responses to July and November temperature, whereas the relationship was weaken for June and September precipitation according to MIA. Under the climate trend of the study area, if the increasing temperature could offset the negative effects of excessive precipitation, A. georgei radial growth would likely benefit from warming, the dynamics of conifer forest should also consider indirect impacts of climate change.

This research aimed at examining how social enterprises mitigate climate change in Ghana, examining their strategies, impacts on the environment that affect climate change, and barriers. The research adopted a cross-sectional survey design, descriptive and involved 185 social enterprises. Questionnaires were administered online and data was analyzed using descriptive statistics and regression analysis. The findings revealed that the most used strategies include the development of new funding structures and advocacy for sustainable farming. It also highlights numerous environmental concerns such as the judicious use of hazardous materials and pollution. Nevertheless, results from regression analysis showed that the relationship between the number of social entrepreneurship activities and the impact on the environment is relatively low and the role of other factors may be more significant. Some of the main barriers that were found include competition from large organizations, cultural perspectives towards climate change, policy instability and lack of adequate technical education. Accordingly, the recommendations proposed are developing specialized funding programs for climate-focused social enterprises; climate change education and awareness campaigns; and capacity building to upgrade technical competencies in clean technologies and climate resilience design.

In this study the impact of climate change on drought conditions in Serbia is investigated trough the multifractal analysis of standardized precipitation evapotranspiration index (SPEI). The SPEI time series for accumulation time scale of 1, 3, 6 and 12 months were calculated using the high resolution meteorological gridded dataset E-OBS with a resolution of 0.10 in regular latitude/longitude coordinates and time span from 1961 to 2020. The multifractal analysis was performed for two standard climatic periods (1961−1990 and 1991−2020) using multifractal detrended fluctuation analysis method (MFDFA) which is suitable for nonstationary temporal series. In each of 1278 grid cells that cover Serbian territory we analyzed 4 SPEI time series for two 30 years periods (which totals 10224 MFDFA runs) and calculated multifractal spectrum parameters that describe persistence, degree of multifractality and the influence of small/large fluctuations. We found that all the analyzed SPEI series show multifractal properties with the dominance of small fluctuations. The short and medium drought conditions described by SPEI-1, SPEI-3 and SPEI-6 are persistent (the position of maximum of multifractal spectrum is in the range 0.5&lt;α0&lt;1), stronger persistence is found at higher accumulation time scales, while SPEI-12 time series are antipersistent (0&lt;α0-1&lt;0.5). The degree of multifractality (width of multifractal spectrum W) increases from SPEI-1 to SPEI-6 and decreases for SPEI-12. For all series multifractal spectrum is right skewed (skew parameter r&gt;0) indicating that small SPEI temporal fluctuations contribute more to multifractality than large fluctuations. In the second period SPEI-1 SPEI-3 and SPEI-6 series become more persistent with weaker multifractality, indicating that short and medium drought conditions (which are related to soil moisture and crop stress) become easier to predict, while SPEI-12 changed toward random regime and stronger multifractality in eastern and central part of country, indicating that long term drought conditions (related to streamflow, reservoir levels, and groundwater levels) become more difficult for modeling and prediction.

This paper explores the imminent threat posed by climate change to the unique platypus species. It delves into the ecological repercussions of global temperature rise and altered climate patterns on platypus habitats. The study emphasises the multifaceted impacts, including changes in aquatic habitat quality, food sources, and breeding rituals. Climate-induced shifts in phytoplankton spring blooms and anthropogenic pressures further endanger the platypus's habitat. The article stresses the importance of understanding these effects for both species conservation and anticipating broader ecological and socio-economic consequences. Mitigating climate change impacts requires a multidimensional approach, involving habitat manipulation and restoration strategies.

Carbon (C) is one of the most abundant elements. It is part of all living organisms and is found in all states of matter (solid, liquid, gas, and plasma). It can take the form of one of the hardest and transparent materials (diamond) or it can be flexible and dark ( graphite), with many carbonaceous materials at both extremes. In gaseous form, C is a component of several greenhouse gas emitted during the combustion of fossil fuels. Carbon movement between the atmosphere, land (biosphere and lithosphere), and ocean (hydrosphere) can alter total amounts in each pool. Human activities accelerate C movement into the atmosphere, causing increases in climate change. This shift from terrestrial and oceanic C pools to the atmosphere cause an increase in the intensity and duration of droughts, hurricanes, snowstorms, and other natural phenomenon. Although society hears about C emissions there is a lack of understanding of its importance and the need to decrease C in the atmospheric pool to avoid exacerbating climate change. Forests and biochar are two biological methods to retain C in the terrestrial pool for long time and at very low cost. This review details where C comes from, its relationship with forests, and biochar and their roles in increasing carbon sequestration to limit the impacts of climate change and continue having future sustainable forests and ecosystems services that we enjoy today.

Puerto Rico is a neotropical island located in the Caribbean. Like other neotropical regions, Puerto Rico streams discharges can vary with the seasons, atmospheric events, and human activities. The Lapa River is part of the Puerto Rico Heritage Rivers Program. This program identifies and manages the protection of hydrographic systems that maintain their natural conditions. The necessity of increasing the knowledge of the natural processes of the Lapa River and providing valuable information for the development of a future management plan for the ecosystem, the following objectives were established in this research: (1) to describe the temporal variations in water discharges in the Lapa River and (2) to describe the impact of atmospheric events on the water discharges at the Lapa River. This study concluded that the highest annual discharge averages recorded from 1989 to 2021 in the Lapa River occurred in 2011 and 2017. 2011, the annual mean discharge was 31.20 (ft3/s); in 2017, the average was 40.44 (ft3/s). In terms of atmospheric events, this study concludes that, during the evaluated period, the highest discharge event occurred after the impact of hurricanes Irma and Maria, with an average discharge of 164.40 ft3/s in October and 182.60 ft3/s in September. This event set a precedent in the river Lapa’s discharges, impacting the river basin’s flora, fauna, and morphology from its headwaters downstream.

Climate changes caused by anthropogenic actions can directly and indirectly affect living beings, including parasites and their hosts. Changes such as water temperature, pH, distribution of nutrients in the aquatic environment are some examples that can interfere with the fish community, whether in open water or in production systems. In this review, we will show how climate change can affect the adaptation of hosts and parasites in the aquatic environment and how these parasites can be used for environmental monitoring.

The study aims to investigate the impacts of climate change on butterfly populations Thimphu district of Bhutan. Butterflies are indicators of environmental factors and can act as an early warning of impending changes in local flora and fauna. The study will involve citizen science with participants using iNaturalist and Seek applications to capture butterfly data in various habitat areas in the Thimphu district. The data collected will be analyzed using Statistics Kit for Social Sciences (SPSS), Nvivo, and Geographical Information System (GIS) programs. The results of the research will be disseminated through awareness campaigns to increase public understanding of the value of butterfly protection in the conservation of healthy environments. The study's findings will be used to develop conservation initiatives to maintain biodiversity and assess the impacts of climate change.

Bluecat is a recently proposed methodology to upgrade a deterministic model (D-model) into stochastic (S-model), based on the hypothesis that the information contained in a time series of observations and the concurrent predictions by the D-model is sufficient to support this upgrade. Prominent characteristics of the methodology are its simplicity and transparency, which allow easy use in practical applications, without sophisticated computational means. Here we utilize the Bluecat methodology and expand it in order to be combined with climatic model outputs, which often require extrapolation out of the range of values covered by observations. We apply the expanded methodology to the precipitation and temperature processes in a large area, namely the entire territory of Italy. The results showcase the appropriateness of the method for hydroclimatic studies, as regards the assessment of the performance of the climatic projections, as well as their stochastic conversion with simultaneous bias correction and uncertainty quantification.

Turmeric is highly tolerant to several climatic changes and can grow under high temperatures and moderate drought conditions. This herb is very much dependant on optimum rainfall, optimum heat with less chilling or freezing conditions. These conditions if are more than normal would tend to reduce the yields of the crops and also effect the productivity. To reduce such drastic yield losses certain conventional plant breeding methods were employed but were very less effective compared to plant biotechnology. To reduce these loses by stresses, extensive and effective molecular biology methods were employed which identifies the genes that are stress responsive along with certain methods like gene transfer, genetic engineering was also known to be effective. All these methods are quite helpful in mitigating the yield losses and promoting healthy growth in the plants. The maintenance of rhizome size, curcumin content, essential oils etc. is very much necessary for the turmeric crop because of its role, especially in the medical field. Therefore, the yield losses are reduced to a maximum extent so that development of smart turmeric is easy and crop designing is possible only with the advanced techniques involved in agriculture biotechnology.

The latest IPCC report forcefully states that immediate, decisive, and large-scale actions are needed to avert climate catastrophe. This essay presumes that democratic governments are best and most desirably positioned to take these actions. Yet in the countries most pivotal to global climate, significant voting blocs are uninterested in environmental issues. The essay urges adding bottom-up dialog between environmental and anti-environmental voters, to current and future top-down technocratic “solutions.” To make this combination result in a unified pro-environment electorate, we must understand: religious objections to environmentalism; the capital-vs.-knowledge strife that slows polluting corporations’ green transitions; and the psychological mechanisms that can make inter-group dialog fruitful.

With the rising trends in elderly populations around the world, there is a growing interest in understanding how climate sensitivity is related to their thermal perception. Therefore, we analyzed the associations between mortality in the elderly due to cardiovascular (CVD) and respiratory diseases (RD) and meteorological variables, for three cities in the State of São Paulo, Brazil: Campos do Jordão, Ribeirão Preto and Santos, from 1996 to 2017. We applied the Autoregressive Model Integrated with Moving Average (ARIMA) and the Principal Component Analysis (PCA) in order to evaluate statistical associations. Results showed CVD as a major cause of mortality, particularly in the cold period, when a high mortality rate is also observed due to RD. The mortality rate was higher in Campos do Jordão and lower in Santos (and intermediate values in Ribeirão Preto). Campos do Jordão results indicate an increased probability of mortality from CVD and RD due to lower temperatures. In Ribeirão Preto, the lower relative humidity may be related to the increase in CVD and RD deaths. This study emphasizes that, even among subtropical climates, there are significant differences. Therefore, this can assist decision makers in the implementation of mitigating and adaptive measures.

The world witnessed one of the largest lockdowns in the history of mankind ever, spread over months in an attempt to contain the contact spreading of the novel coronavirus induced COVID-19. As billions around the world stood witness to the staggered lockdown measures, a storm brewed up in the urns of the rather hot Bay of Bengal (BoB) in the Indian Ocean realm. When Thailand proposed the name “Amphan” (pronounced as “Um-pun” meaning ‘the sky’), way back in 2004, little did they realize that it was the christening of the 1st super cyclone (Category-5 hurricane) of the century in this region and the strongest on the globe this year. At the peak, Amphan clocked wind speeds of 168 mph (Joint Typhoon Warning Center) with the pressure drop to 925 h.Pa. What started as a depression in the southeast BoB at 00 UTC on 16th May 2020 developed into a Super Cyclone in less than 48 hours and finally made landfall in the evening hours of 20th May 2020 through the Sundarbans between West Bengal and Bangladesh. Did the impact of the COVID-19 induced lockdown drive an otherwise typical pre-monsoon tropical depression into a super cyclone?

Data from Earth Observation (EO) satellites are increasingly used to monitor the environment, understand variability and change, inform evaluations of climate model forecasts and manage natural resources. Policy makers are progressively relying on the information derived from these datasets to make decisions on mitigating and adapting to climate change. These decisions should be evidence based, which requires confidence in derived products as well as the reference measurements used to calibrate, validate or inform product development. In support of the European Union’s Earth Observation Programmes Copernicus Climate Change Service, the Quality Assurance for Essential Climate Variables (QA4ECV) project fulfilled a gap in the delivery of climate quality satellite derived datasets by prototyping a robust, generic system for the implementation and evaluation of Quality Assurance (QA) measures for satellite-derived ECV climate data record products. The project demonstrated the QA system on six new long-term, climate quality ECV data records for surface Albedo, Leaf Area Index, FAPAR, NO₂, HCHO and CO. Provision of standardized QA information provides data users with evidence-based confidence in the products and enables judgement on the fitness-for-purpose of various ECV data products their specific applications.

Background: Cancer therapies predispose survivors to a high symptom burden. This study utilized mobile health (mHealth) technology to assess the feasibility of collecting daily symptoms from adult survivors of childhood cancer and evaluate symptom fluctuation and associations with future health-related quality-of-life (HRQOL). Methods: A prospective study using an mHealth platform to distribute a 20-item cancer-related symptom survey (5 consecutive days each month) and an HRQOL survey (the day after symptom survey) over 3 consecutive months to participants from the Childhood Cancer Survivor Study. PROMIS-29 Profile and Neuro-QOL assessed HRQOL. Daily symptom burden was calculated by summing the severity (mild, moderate, or severe) of 20 symptoms. Univariate linear mixed-effects models analyzed total, person-to-person, day-to-day, and month-to-month variability for the burden of 20 individual symptoms. Multivariable linear regression analyzed the association between daily symptom burden in the first month and HRQOL in the third month, adjusting covariates. Results: Out of the 60 survivors invited, 41 participated in this study (68% enrollment rate); 83% reported their symptoms ≥3 times and 95% reported HRQOL, both in each week across 3 months. Variability of daily symptom burden differed from person-to-person (74%), day-to-day (18%), and month-to-month (8%). Higher first-month symptom burden was associated with poorer HRQOL related to anxiety (regression coefficient: 6.56; 95%CI: 4.10-9.02), depression (6.32; 95%CI: 3.18-9.47), fatigue (7.93; 95%CI: 5.11-10.80), sleep (6.07; 95%CI: 3.43-8.70), pain (5.16; 95%CI: 2.11-8.22), and cognitive function (-6.89; 95%CI: -10.00 to -3.79) in the third month. Conclusion: Daily assessment reveals fluctuations in symptomology, and higher symptom burden was associated with poorer HRQOL in the future. Utilizing mHealth technology for daily symptom assessment improves our understanding of symptom dynamics and sources of variability.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

OCTA is an imaging modality used in the assessment of the retinal vasculature. It operates on the principle of coherence tomography used in standard OCT with the addition of delineating the retinal vascular. This provides a modern non-invasive retinal vascular imaging method compared to conventional dye-based imaging. High quality depth resolution of the superficial and deep capillary networks is possible on OCTA whereas this was not possible prior. OCTA may be limited by image quality degradation from factors such as motion artefact or media opacities, and therefore may not be the investigation of choice for all patient groups. There are multiple potential clinical applications for OCTA in retinal and choroidal vascular disease. Ongoing research is necessary to substantiate the more widespread use of OCTA due to its significant cost burden compared to current modalities.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

Wildfires have short- and long-term impacts on the geoenvironment, including the changes to biogeochemical and mechanical properties of soils, landfill stability, surface- and groundwater, air pollution, and vegetation. Climate change has increased the extent and severity of wildfires across the world. Simultaneously, anthropogenic activities—through the expansion of urban areas into wildlands, abandonment of rural practices, and accidental or intentional fire-inception activities—are also responsible for a majority of fires. This paper provides an overall review and critical appraisal of existing knowledge about processes induced by wildfires and their impact on the geoenvironment. Burning of vegetation leads to loss of root reinforcement and changes in soil hydromechanical properties. Also, depending on the fire temperature, soil can be rendered hydrophobic or hydrophilic and compromise soil nutrition levels, hinder revegetation, and, in turn, increase post-fire erosion and debris flow susceptibility of hillslopes. In addition to direct hazards, wildfires pollute air and soil with smoke and fire suppression agents releasing toxic, persistent, and relatively mobile contaminants into the geoenvironment. Nevertheless, the mitigation of wildfires’ geoenvironmental impacts does not fit within the scope of this paper. In the end, in no exhaustive way, some areas of future need for research are highlighted.

In order to better understand the extent to which global climate variability is linked to the frequency and intensity of heat waves and overall changes in temperature throughout the United States (US), correlations between long-term monthly mean, minimum, and maximum temperatures measured at sites throughout the contiguous US and low-frequency variability of multiple climate indices (CIs) are analyzed over the period 1948 to 2018 using correlation analysis. The Pearson’s correlation coefficient is used to assess correlation strength, while Leave-One-Out Cross-Validation and a bootstrapping technique (p-value) are used to address potential serial and spurious correlation and assess the significance of each correlation. Three parameters defined the sliding windows over which surface temperature and CI values were averaged: window size, lag time between the temperature and CI windows, and the beginning month of the temperature window. A 60-month sliding window size and 0 lag time resulted in the strongest correlations overall; beginning months were optimized on an individual site basis. Strong (r &gt;= 0.60) and significant (p-value &lt;= 0.05) correlations were identified. The Western Hemisphere Warm Pool (WHWP) and El Niño/Southern Oscillation (ENSO) exhibited the strongest links to temperatures in the western US, tropical Atlantic sea surface temperatures to temperatures in the central US, the WHWP to temperatures throughout much of the eastern US, and atmospheric patterns over the northern Atlantic to temperatures in the Northeast and Southeast. The final results were compared to results from previous studies focused on precipitation and coastal sea levels. Regional consistency was found regarding links between the northern Atlantic and overall weather and coastal sea levels in the Northeast and Southeast as well as on weather in the upper Midwest. Though the MJO and WHWP revealed dominant links with precipitation and temperature, respectively, throughout the West, ENSO revealed consistent links to sea levels and surface temperatures along the West Coast. These results help focus future research regarding specific mechanisms of climate variability that appear the exhibit strong links to US regional weather and sea level variability and prediction.

Estimating the economic risks of climate shocks and climate stressors on spatially heterogeneous cities over time remain highly challenging. The purpose of this paper is to present a practical methodology to assess the economic risks of climate change in developing cities to inform spatially sensitive municipal climate response strategies. Building on a capital-based framework (CBF), spatially disaggregated baseline and future scenario scores for economic wealth and its exposure to climate change are developed for six different classes of capital and across 77 major suburbs in Cape Town, South Africa. Capital-at-risk was calculated by combining relative exposure and capital scores across different scenarios and with population impacted plotted against the major suburbs and the city’s 8 main planning districts. The economic risk assessment presented here provides a generic approach to assist investment planning and the implementation of adaptation options through an enhanced understanding of relative levels of capital endowment vis-à-vis relative levels of exposure to climate-related hazards over time. An informed climate response strategy in spatially heterogeneous cities need to include spatially sensitive estimates on capital-at-risk and populations disproportionally impacted by climate exposure over time. The economic risk assessment approach presented here helps in advancing to such a goal.

The outcomes of the 2015 Paris Agreement triggered a number of climate impact assessments, such as for floods and droughts, to focus on future time frames corresponding to the years of reaching specific levels of global warming. Yet, the links between the timing of the warming levels and the corresponding greenhouse gas concentration pathways to reach them, remain poorly understood. To address this gap, we compare projected changes of annual mean, extreme high and extreme low river discharges in Europe at 1.5°C and 2°C under scenarios RCP8.5 and RCP4.5 from an ensemble of Regional Climate Model (RCM) simulations. The statistical significance of the difference between the two scenarios for both warming levels is then evaluated. Results show that in the majority of Europe (>95% of the surface area for the annual mean discharge, >98% for high and low extremes), the changes projected in the two pathways are statistically indistinguishable. These results suggest that in studies of changes at specific warming levels the projections of the two pathways can be merged into a single ensemble without major loss of information. With regard to the uncertainty of the unified ensemble, findings show that the projected changes of annual mean, extreme high and extreme low river discharge are statistically significant in large portions of Europe.

Both climate change and anthropogenic activities contribute to the deterioration of terrestrial water resources and ecosystems worldwide. Central Asian endorheic basins are among the most affected regions through both climate and human impacts. Here, we used a digital elevation model, digitized bathymetry maps and Landsat images to estimate the areal water cover extent and volumetric storage changes in small terminal lakes in Burabay National Nature Park (BNNP), located in Northern Central Asia (CA), for the period of 1986 to 2016. Based on the analysis of long-term climatic data from meteorological stations, short-term hydrometeorological network observations, gridded climate datasets (CRU) and global atmospheric reanalysis (ERA Interim), we have evaluated the impacts of historical climatic conditions on the water balance of BNNP lake catchments. We also discuss the future based on regional climate model projections. We attribute the overall decline of BNNP lakes to long-term deficit of water balance with lake evaporation loss exceeding precipitation inputs. Direct anthropogenic water abstraction has a minor importance in water balance. However, the changes in watersheds caused by the expansion of human settlements and roads disrupting water drainage may play a more significant role in lake water storage decline. More precise water resources assessment at the local scale will be facilitated by further development of freely available higher spatial resolution remote sensing products. In addition, the results of this work can be used for the development of lake/reservoir evaporation models driven by remote sensing and atmospheric reanalysis data without the direct use of ground observations.

With the development of the energy sector based on renewable primary sources, structural changes are emerging for the entire national energy system. Initially, it was estimated that energy generation based on fossil fuels would decrease until its disappearance. However, the evolution of CO2 capture capacity leads to a possible coexistence for a certain period with the renewable energy sector. The paper develops this concept of coexistence of the two systems, with the positioning of green hydrogen not only within the renewable energy sector but also as a transformation vector for carbon dioxide captured in the form of synthetic fuels such as CH4 and CH3OH. The paper also analyzes the economic aspects related to price differences for energy produced in the two sectors, as well as their interconnection. The technical aspect, as well as the economic one, for storage through various other solutions besides hydrogen, has been highlighted. The development of the renewable energy sector and its demarcation from the fossil fuel energy sector, even with the transcendent vector represented by green hydrogen, leads to the deepening of dispersion aspects between the electricity sector and the thermal energy sector, a less mentioned aspect in current works but of great importance.

California has experienced a surge in wildfires, prompting research into contributing factors, including weather and climate conditions. This study investigates the complex, multiscale interactions between large-scale climate patterns, such as the Boreal Summer Intraseasonal Oscillation (BSISO), El Niño Southern Oscillation (ENSO), and the Pacific Decadal Oscillation (PDO), and their influence on moisture and temperature fluctuations, and wildfire dynamics in California. The combined impacts of PDO and BSISO on intraseasonal fire weather changes, the interplay between Fire Weather Index (FWI), relative humidity, vapor pressure deficit (VPD), and temperature in assessing wildfire risks, and geographical variations in the relationship between FWI and climatic factors within California are examined. The study employs a multi-pronged approach, analyzing wildfire frequency and burned areas alongside climate patterns and atmospheric conditions. Findings reveal significant variability in wildfire activity across different climate conditions, with heightened risks during specific BSISO phases, La-Niña, and cool PDO. The influence of BSISO varies depending on its interaction with PDO. Temperature, relative humidity, and VPD show strong predictive significance for wildfire risks, with significant relationships between FWI and temperature in elevated regions (correlation, r &gt; 0.7, p ≤ 0.05) and FWI and relative humidity along the Sierra Nevada Mountains (r ≤ -0.7, p ≤ 0.05).

Climate change is a big challenge for agriculture since it affects crop productivity and yield. The increase of droughts, salinity, and soil degradation are some of the main consequences of climate change. The use of microorganisms has emerged as an alternative to mitigate them. Among these microorganisms, dark septate endophytes (DSEs) have garnered more attention in recent years. Various studies show that their association with plants helps reduce the harmful effects of abiotic stresses and increases nutrient availability, allowing plants to thrive under adverse conditions. This work reviews the effect of DSEs and the subjacent mechanisms that will help plants develop a higher tolerance to climate change.

Bettelmatt cheese, a cherished Italian culinary gem hailing from the picturesque Val d'Ossola region, is deeply intertwined with its natural environment. This article explores the intricate relationship between the organoleptic attributes of Bettelmatt cheese and the challenges posed by climate change. The sensory qualities of this cheese, including its flavor profile, texture, and aroma, are profoundly influenced by the alpine pastures where the cows graze, the unique terroir, and the traditional production methods. However, as climate change continues to impact ecosystems and weather patterns, it raises questions about the resilience and adaptability of this traditional cheese. In addition to these challenges, the article would like to explore the complexities of regulation and protection of this cheese, crucial for food and gastronomic sciences.

Background:. Knowledge and positive perception of climate change are crucial for public participation in activities that contain climate change. Limited studies, particularly in South Africa have reported on the knowledge and perceptions of climate change by university students. Study Aim: This study aimed to assess the level of knowledge and perceptions of climate change by the science students at the University of South Africa (UNISA). Methods: This was a quantitative cross sectional survey, undertaken among science students using questionnaire emailed to 500 students in the School of Science through Unisa email system. Bivariate logistic regression was used to test the association between socio-demographics, level of knowledge and perceptions of climate change. Results: A total of 420 students participated in the study. They were predominantly male (70.3%), mostly younger than 35 years of age. Most of the respondents were in the 2nd (34.7%) and 3rd (33.8%) year of study. Majority of respondents (97.9%) knew and perceived (93.6%) that climate change was happening. Overall, 93.8% of respondents had an excellent knowledge and basic concepts of climate change. Conclusion: The majority of students were knowledgeable and had positive perceptions about the basic concepts of climate change. However, the year of study was not significantly associated with positive perceptions of climate change. There is need to include climate change modules in South African university curriculum.

Both globally and in Hungary, agriculture is one of the industries that is most vulnerable to weather and climate extremes. Intense temperature rises, spatial and temporal variations in precipitation, and significant changes in extreme climatological and weather parameters have contributed to changes in the conditions of cropland, crop losses, and impacts on crop quality in recent years. This paper depicts the transformation of the domestic agricultural sector due to the extreme drought shock of 2022, as well exploring the adaptation strategies applied. The research is based on official agro-climate database and crop data, and the temperature, precipitation, and radiation during the growing season are all examined. The agro-meteorological properties in Hungary had to be investigated for the entire year and all four of its seasons, with indicator analysis projected onto the ever-increasing and dormant seasons. Long-term climate analysis is necessary to understand the historic drought of 2022 and the success of future adaptation and mitigation techniques. The results can help smallholders effectively reduce the adverse impacts of drought conditions, thereby increasing their adaptation to similar shocks.

The intricate relationship between physical and social environments within organizations plays a pivotal role in shaping sustainable innovation endeavors. This paper presents a comprehensive analysis of two key dynamics that have garnered substantial scholarly attention for promoting sustainable innovation: the physical environment and the organizational climate. To elucidate the intricate interplay between these dynamics, we propose a novel three-dimensional framework that guides the modeling of the intricate processes through which the physical environment and innovation climate synergistically influence innovation outcomes. Building on this framework, we delve into an in-depth literature review concerning physical environments that exert a significant impact on innovation. Through this review, we identify and elaborate on four pivotal elements of the physical environment: communality, personalization, comfort, and healthiness. Leveraging insights gleaned from this review, we outline two promising avenues for future research in the realm of the physical environment's interaction with the innovation climate. Furthermore, we underscore the critical importance of adopting an interdisciplinary approach that seamlessly integrates insights from both the physical and social domains to comprehensively understand the sustainable innovation landscape.

This study examines the projected impact of climate change on the Density Altitude (DA) at Chinese airports during the summer by the end of the 21st century. Findings indicate that climate change is expected to significantly increase the DA at all Chinese airports, with an estimated rise between 300 and 800 feet. The analysis suggests temperature increases will universally contribute to a rise in DA. Pressure changes, however, are more variable. Most airports are predicted to see an increase in pressure, which could offset some temperature effects on the DA. Airports in eastern China are expected to see a decrease in pressure, amplifying the effects on DA and creating operational challenges.

Understanding how climatic variables impact the reference evapotranspiration (ET0) is essential for water resource management, especially considering potential fluctuations due to climate change. Therefore, we used the Sobol method to analyze the spatiotemporal variations of Penman-Monteith ETo sensitivity to the climatic variables: downward solar radiation, relative humidity, maximum and minimum air temperature, and wind speed. The Sobol’s indices variances were estimated by Monte Carlo integration, setting the sample limits to 2.5 and 97.5 percentiles of the daily data of 33 automatic weather stations located in the state of Mato Grosso, Brazil. The results of the Sobol analysis indicate considerable spatiotemporal variations in the sensitivity of ETo to climatic variables and their interactions. The dominant climatic variable responsible for ET0 fluctuations in Mato Grosso is incident solar radiation, which has a more significant impact in humid environments, as observed in the areas of the Amazon biome in the state. Air relative humidity and wind speed have higher sensitivity indices during the dry season in the areas of the Cerrado biome (Savanna) in Mato Grosso. Our findings show that changes in solar radiation, relative humidity, and wind speed cannot be ignored when analyzing changes in reference evapotranspiration.

The Antarctica and High Arctic regions are extreme environments, with average maximum temperatures below 0 °C for most days of the year. Interestingly, fungi inhabit these regions. This review describes the history of fungal surveys near the Syowa Station and the fungal diversity in this region. In the High Arctic region, I summarized the changes in fungal communities in glacial retreat areas of Ny-Ålesund, Norway and Ellesmere Island, Canada in response to climate change. In addition, growth and enzyme secretion ability of Antarctic and Arctic fungi at sub-zero temperatures are presented. Finally, I have also provided the future directions of Antarctic and Arctic fungal research.

Changes in the dates of phenological phases of plants and insects reflect changes in climate. The aim of the study was to determine the phenological patterns and interrelationships of spring-flowering entomophilous plants (Corylus avellana L., Alnus incana Moench., Tussilago farfara L., Salix caprea L., Acer platanoides L., Taraxacum officinale L., Prunus L., Malus domestica Mill.) and the honey bee (Apis mellifera L.) in response to climate change. The research was carried out at Vokė Branch of the Institute of Agriculture, Lithuanian Research Centre for Agriculture and Forestry, using data from phenological observations during 1961–2020. The results of the studies showed that over a 60-year period, a trend towards earlier dates of all phenological events studied was observed. Significant and larger-scale changes occurred starting from the decade 1981–1990. Throughout the entire study period, with the exception of one decade, the dates of honeybee emergence on flowers correlated reliably with the dates of entomophilous plant phenophases. Due to the advance of plants phenophase dates the synchrony with honeybee emergence dates changes however, these changes had a positive effect on the foraging conditions of overwintering honeybees.

The build-up of greenhouse gases (GHGs) is causing warmness in the Earth’s atmosphere, resulting in climate change. The transport sector is one of the active members of GHG emissions and it is imperative to use sustainable transport sources to control climate change. The measure aims to encourage citizens to stop using their private vehicles as their choice of transport and instead opt for joint sustainable mobility during traveling. In this study, a quantitative research method was used and data were collected from a sample of 410 respondents through questionnaire. On the other hand, study also took a simulation-based (N=10000) sample size of private vehicle data. The data were analyzed using structural equation modelling. The results revealed that sustainable transportation, climate change technologies and electric rail vehicles reduce climate change in the ecoregions of China. We conclude that sustainable transportation policies could be formulated and implemented to reduce climate change. In response to the research results, it is recommended that, since climate change is a multi-level governance issue and the outdated pyramidal transport industry models must be shifted to a sustainable transportation system model.

The study presents an assessment of climate suitability for outdoor leisure activities in Romania using the Holliday Climate Index (HCI) for the near future (2021-2040), focusing on unfavorable and good climate conditions. The analysis employs data from an ensemble model in the context of RCP45 and RCP85 climate change scenarios. The results indicate that the number of days with low weather suitability is decreasing in almost the entire country, especially during the warm season, while during the winter and spring extended regions may be characterized by a higher number of days favorable for outdoor activities than during the current climate. An estimation of the impact of climate changes on tourism flux in Romania is further carried out, suggesting that the increasing attractivity of climate conditions may lead to an increased number of tourist overnights in the near future, more pronounced in rural destinations.

The paper provides a critical synthesis of analysis and evaluation of some case studies in the Italian national context, which allowed, through an inductive method, to assess, in terms of integration and coherence, the process of transposition of climate change adaptation contents, possibly already contained within a regional urban framework (Regional Urban Laws) or specific Regional Adaptation Strategies or Local Adaptation Plans, within the territorial and urban planning tools of metropolitan or local scale.

Climate change is the long-term shift in global weather patterns, largely caused by anthropogenic activity of greenhouse gas emissions. Global climate temperatures have unmistakably risen and naturally-occurring climate variability alone cannot account for this trend. Human activities are estimated to have caused about 1.0 °C of global warming above the pre-industrial baseline and if left unchecked, will continue to drastically damage the Earth and its inhabitants. Globally, natural disasters and subsequent economic losses have become increasingly impactful as a result of climate change. Both wildlife ecosystems and human habitats have been negatively impacted, from rising sea levels to alarming frequency of severe weather events around the world. Attempts towards alleviating the effects of global warming have often been at odds and remain divided among a multitude of strategies, reducing the overall effectiveness of these efforts. It is evident that collaborative action is required for avoiding the most severe consequences of climate change. This paper evaluates the main strategies (industrial/energy, political, economic, agricultural, atmospheric, geological, coastal, and social) towards both mitigating and adapting to climate change. As well, it provides an optimal combination of seven solutions which can be implemented simultaneously, working in tandem to limit and otherwise accommodate the harmful effects of climate change. Previous legislation and deployment techniques are also discussed as guides for future endeavors.

Climate change poses a major threat to development in most low and middle-income countries, especially the sub – Saharan Africa. Wurompo is a small farming community in the Wenchi Municipality of the Brong-Ahafo region of Ghana that depends on rain-fed agriculture activities for livelihood. In recent years, droughts, unpredictable rainfall pattern and crop failure have become common in the area. The study assessed knowledge and awareness, effects of climate change on female farmers, and their adaptation strategies. A case study in design, qualitative methods were used to collect data from 50 purposefully selected participants. Data were analyzed using themes and sub-themes generated from the research questions. Findings showed lack of adequate information and knowledge on climate change and its effects. Climate change has impacted negatively on these farmers stemming from decline in crop production and unavailability of adequate water supply in due season. Challenges to climate change adaptation are poverty, poor basic infrastructure, and modern farming practices. Farmers must be educated on climate change and its effects, with training on the necessary adaptation strategies to build their resilience. Policies that target rural farmers to adapt to climate change, and device modern agricultural techniques and practices are also necessary.

Natural disasters ravage the world's cities, valleys, and shores on a monthly basis. Having precise and efficient mechanisms for assessing infrastructure damage is essential to channel resources and minimize the loss of life. Using a dataset that includes labeled pre- and post- disaster satellite imagery, we train multiple convolutional neural networks to assess building damage on a per-building basis. In order to investigate how to best classify building damage, we present a highly interpretable deep-learning methodology that seeks to explicitly convey the most useful information required to train an accurate classification model. We also delve into which loss functions best optimize these models. Our findings include that ordinal-cross entropy loss is the most optimal loss function to use and that including the type of disaster that caused the damage in combination with a pre- and post-disaster image best predicts the level of damage caused. Our research seeks to computationally contribute to aiding in this ongoing and growing humanitarian crisis, heightened by climate change.

Not only are humans responsible for the anthropogenic causes of currently observed climate change, but we are also responsible for our responses to climate change. How we choose to respond provides important insights into our ability to collectively act in the face of threats with the unique characteristics of climate change. This communication attempts to provide an overview of some the difficulties in forging new policy directions along our coastlines in an era of climate change. It is meant as a referential framing for the research presented in this special issue. As this communication is being written, the world is gripped by a global pandemic caused by a variant of the coronavirus. There are important corollaries between the underlying characteristics of the coronavirus and the causes and effects of climate change. Seeing how the global citizenry is responding to the current epidemic provides some insight into the difficulties in fostering collective action towards climate change. As with the pandemic, the issue is not really one of understanding the problem, but rather the varying human responses to the problem. We can expect the same difficulties as we continue to confront the ever-growing problem of climate change.

This manuscript describes the construction and validation of high resolution daily gridded (0.05° × 0.05°) rainfall and maximum and minimum temperature data for Bangladesh : the Enhancing National Climate Services for Bangladesh Meteorological Department (ENACTS-BMD) dataset. The dataset was generated by merging data from weather stations, satellite products (for rainfall) and reanalysis (for temperature). ENACTS-BMD is the first high-resolution gridded surface meteorological dataset developed specifically for studies of surface climate processes in Bangladesh. Its record begins in January 1981 and is updated in real-time monthly and outputs have daily, decadal and monthly time resolution. The Climate Data Tools (CDT), developed by the International Research Institute for Climate and Society (IRI), Columbia University, is used to generate the dataset. This data processing includes the collection of weather and gridded data, quality control of stations data, downscaling of the reanalysis for temperature, bias correction of both satellite rainfall and downscaled reanalysis of temperature, and the combination of station and bias-corrected gridded data. The ENACTS-BMD dataset is available as an open-access product at BMD’s official website, allowing the enhancement of the provision of services, overcoming the challenges of data quality, availability, and access, promoting at the same time the engagement and use by stakeholders.

Background: The current coronavirus disease 2019 (COVID-19) is spreading globally at an accelerated rate. There is some previous evidence that weather may influence the incidence of COVID-19 infection. We assessed the role of meteorological factors including temperature (T) and relative humidity (RH) considering the concentrations of two air pollutants, inhalable coarse particles (PM10) and nitrogen dioxide (NO2) in the incidence of COVID-19 infections in Finland, located in arctic-subarctic climatic zone. Methods: We retrieved daily counts of COVID-19 in Finland from Jan 1 to May 31, 2020, nationwide and separately for all 21 hospital districts across the country. The meteorological and air quality data were from the monitoring stations nearest to the central district hospital. A quasi-Poisson generalized additional model (GAM) was fitted to estimate the associations between district-specific meteorological factors and the daily counts of COVID-19 during the study period. Sensitivity analyses were conducted to test the robustness of the results. Results: The incidence rate of COVID-19 gradually increased until a peak around April 6 and then decreased. There were no associations between daily temperature and incidence rate of COVID-19. Daily average RH was negatively associated with daily incidence rate of COVID-19 in two hospital districts located inland. No such association was found nationwide. The sensitivity analyses indicate the results are robust. Conclusions: Weather conditions, such as air temperature and relative humidity, may not be important factors affecting the COVID-19 incidence in the arctic and subarctic winter and spring. More evidence is needed on the associations between weather and COVID-19 during different seasons.