Social network analysis is extensively employed for the examination of relationships and networks among actors across diverse disciplines and thematic research domains. Nevertheless, the utilization of this approach in agriculture and natural resources, particularly pertaining to watershed management, has been relatively limited. The objective of this study is to conduct an analysis of the social interaction and networks of Cidanau Watershed Management (CWM) stakeholders and measure the nodes of units as individuals or organizations in relation to the role and influence of each other through a quantitative approach. The results of the data analysis show that Fkdc has a high degree of centrality and centrality betweenness. This shows that Fkdc has a strong influence and controls CWM network interaction. Conversely, Hs (households) have a low degree of centrality, and centrality betweenness values have a low influence and role in actors’ networks. According to the closeness centrality parameter, it is observed that both Households (Hs) and Universities (Univ) have exhibited the shortest geodesic distance in relation to other stakeholders within the network, thus indicating their highest level of closeness. It means that households and universities had interdependency and were controlled by others. The lowest centrality of Fkdc means that Fkdc has independence of influence and high control access over others. There are four CWM network clusters based on total link strength. Fkdc demonstrates outstanding leadership qualities, enjoys a strong reputation, and possesses a high degree of popularity within the network. Furthermore, Fkdc serves as a positive central node that effectively brings together the interests of all actors, fostering a collective commitment towards shared goals and mutual rewards. In the CWM case, Fkdc is a sustainable watershed organization that acts as a central network body and plays a fundamental role as an intermediary between networks and interactions. Ultimately, with regards to the viewpoint of CWM, the decentralization of watersheds aimed to facilitate wider public engagement by establishing Fkdc as a central network entity and assuming a crucial role as a medium for the dissemination of information, exchange of ideas, and the exertion of influence among its members.

Background: United Nations Sustainable Development Goals state that by 2030, the Global maternal mortality rate (MMR) should be lower than 70 per 100,000 live births. MMR is still one of Africa's leading causes of death among women. This research aims to study regional trends in maternal mortality in Africa. Methods: We extracted data for Maternal mortality rates per 100,000 births from the World Bank database from 1990-2015. Joinpoint regression was used to study the trends and estimate the annual percent change (APC). Results: Maternal mortality has decreased in Africa over the study period by an average APC of -2.6%. All regions showed significant downward trends, with the sharpest decreases in East Africa. Only the North African region is close to the United Nations' sustainable development goals for Maternal mortality. The remaining sub-Saharan African regions are still far from achieving the goals. Conclusions: maternal mortality has decreased in Africa, especially in East Africa. The only region closed to the United Nations target is North Africa. The remaining sub-Saharan African regions are still far from achieving the goals. These results could be used for the development of Regional Policies.

Boreal forests are one of the largest stores of carbon on Earth, and two-thirds of them are located in Siberia. Despite the fact that these forests have a significant influence on the global climate, they continue to remain understudied. Chernevaya taiga is a unique example of a highly productive Siberian boreal ecosystem. This type of forest is characterized by a series of unique ecological traits, the most notable of which are the gigantism of the perennial herbaceous plants and bushes, complete lack of moss cover on soil surface, and the type of soil it grows on, notable for its particularly high rate of decomposition of vegetative remains and low humic acid content. Abundant rainfall actively washes out nutrients from the top layers of the soil, but its fertility level remains very high. In fact, based on the existing data, it is twice as high as that of fertilized agricultural lands. In some ways the conditions within this type of forest closely resemble those observed in tropical rainforests. Microbiota associated with soil and plants represent an integral part of an interconnected system and contribute significantly to productive processes in soils. Its impacts on the environment require further study, since it could lead to discoveries that will help improve soil fertility without harming the natural environment.

The safety of people is an important phenomenon nowadays. This importance arises due to the crowded places including subway station, universities, colleges, airport, shopping mall and square, and city squares. Therefore, the development of an effective system based on physical characteristics of crowd layout is of significant demand. In this paper, we proposed a novel automated and intelligent systems for crowd event analysis based on a set of physical elements. For this purpose, we take into account optical flow and spatial-time gradient, contour features, and Gaussian processes. Our method combine these characteristics into a unique model to deal with the challenging problem of crowd event analysis. For evaluating our proposed method, we consider a benchmark dataset and a number of different performance metrics. These analysis demonstrate the robustness and effectiveness of our proposed method.

Poverty alleviation is a hallmark of post-revolution Chinese policymaking. Since 1978, the Communist Party of China (CPC) has implemented successive waves of poverty alleviation policies whose effects have become the focus of an ever-increasing body of academic literature. This paper reviews this diverse but limited literature that evaluates the impact of the CPC’s poverty reduction programs through four major channels, namely fiscal investment programs, social safety nets, rural governance on the village-, county- and provincial level, and the relocation of rural populations from destitute regions. This paper aims to synthesize results and evaluate whether and how the abovementioned poverty alleviation programs have had distinct positive or negative impacts on regional development outcomes. Furthermore, I highlight contradictions in empirical findings to motivate the discussion about contextual importance when designing and implementing future poverty alleviation programs. Finally, I suggest that an exhaustive and critical appraisal of the empirical strategies used in this literature would further the development and application of more accurate and informative methodologies.

Drilling centers are collaborative environments dedicated to facilitate decision-making in the well construction, where multidisciplinary teams work to support operations. The oil operators usually have drilling centers with different types of ergonomic features with considerable potential of integration, creating the opportunity to an Ergonomic Workplace Analysis. This paper aims to present the analysis of infrastructure requirements of one specific company in Brazil. The method was based on a survey with employees, which, coped with a statistical analysis, enabled understanding the impact of the layout requirements. The result is an approach to design collaborative environments, standardizing and defining models for the industry.

Using graph theory, computer aided motion, static force and power flow analysis of planetary gear mechanism is realized. The motion, static force and efficiency calculations of 6HP26 automatic transmission are carried out. Based on kinematic and static force analysis model, related matrices are acquired. Hence, kinematic and static force analysis of planetary gear mechanism is achieved. The link power can be determined by the link speed and torque. Power flow diagrams of each gear are acquired. The efficiency is calculated by transmission ratio method.

Morphological features and composition of ISSR DNA fragments were studied in species of the genus Tulipa L. A comparative analysis of the data obtained was carried out and an attempt was made to clarify the species belonging of plants. Plants obtained from various sources were studied. It was found that representatives of the genus Tulipa L. from the two subgenera Tulipa and Eriostemones are well separated not only morphologically, but also by the composition of ISSR fragments. At the intra- and interspecific level, the results for morphological traits and molecular data differed. Interspecific and intraspecific differences were more clearly traced in the complex analysis of morphological features and ISSR PCR data. All samples obtained in the form of bulbs and renewed vegetatively had an identical set of ISSR fragments. Plants grown from seeds were characterized by a significant variety of molecular markers and had both species-specific and in-dividual genetic variability. It was found that the samples obtained and registered as the Tulipa urumiensis Stapf are the yellow-flowered form of the Tulipa tarda Stapf, and a sample received as the Tulipa turkestanika Regel is the Tulipa bifloriformis Vved. Thus, a comprehensive study of both the data of fragmentary DNA analysis and morphological features, provided a sufficient number of DNA samples, makes it possible to clarify the species of tulip plants, and also allows us to assess the genetic diversity of the genus Tulipa.

The Gauss model for the time evolution of the first corona pandemic wave allows to draw conclusions on the dark number of infections, the amount of heard immunization, the used maximum capacity of breathing apparati and the effectiveness of various non-pharmaceutical interventions in different countries. In Germany, Switzerland and Sweden the dark numbers are 7.4 +/- 6.1, 11.1 +/- 8.5 and 25 +/- 25, respectively. Our method of estimating dark numbers from modeling both, infection and death rates simultaneously spares these countries the laborious, time-consuming and costly medical testing for antibodies of large portions of the population. In Germany the total number of infected persons, including the dark number of infections by the first wave is estimated to be 1.06 +/- 0.60 million, corresponding to 1.28 +/- 0.72 percent of the German population. We work out direct implications from these predictions for managing the 2nd and further corona waves.

Peptidases of the papain family play a key role in protein degradation, regulated proteolysis, and the host-pathogen arms race. Although the papain family has been the subject of many studies, knowledge about its diversity, origin, and evolution in Eukaryota, Bacteria, and Archaea is limited; thus, we aimed to answer these long-standing questions. We traced the origin and expansion of the papain family through phylogenomic analysis, using sequence data from numerous prokaryotic and eukaryotic proteomes, transcriptomes, and genomes. We identified the full complement of the papain family in all prokaryotic and eukaryotic lineages. Analysis of the papain family provided strong evidence for its early diversification in the ancestor of eukaryotes. We found that the papain family has undergone complex and dynamic evolution through numerous gene duplications, which produced eight eukaryotic ancestral paralogous C1A lineages during eukaryogenesis. Different evolutionary forces operated on C1A peptidases, including gene duplication, horizontal gene transfer, and gene loss. This study challenges the current understanding of the origin and evolution of the papain family and provides valuable insights into their early diversification. The findings of this comprehensive study provide guidelines for future structural and functional studies of the papain family.

While examination malpractice has been a recognized social problem among students, the control of the phenomenon remains a challenge. In this study, we formulate a mathematical model describing the population dynamics of examination malpractice among students. Initial insight into the dynamics of the model is gained by analyzing some important mathematical features of the model such as the basic malpractice number. The malpractice-free equilibrium and endemic equilibrium points of the model are shown to be locally asymptotically stable when the basic malpractice number is less than unity. This result implies that examination malpractice can be totally eradicated among students when the basic malpractice number is less than unity. To understand the impact of controlling this social problem, we extend the model to incorporate awareness campaign and disciplinary measure as control strategies in curtailing the act. Our analysis reveals that incorporating control strategies have some influence in reducing examination malpractice among students. Further analysis indicates that considering both control strategies simultaneously yields a better result in reducing examination malpractice and examination malpractice will grow faster when control strategies are not introduced.

N-acyl hydrazone (NAH) has been remarked as a promising scaffold in drug design, given its versatility, ease of synthesis, and appealing biological activities (i.e., antimicrobial, antitumoral, analgesic, and anti-inflammatory properties). In the global context of increasing resistance of pathogenic bacteria to antibiotics, NAHs represent potential solutions for developing improved treatment alternatives. Thus, this study presents 6 new derivatives of (EZ)-N'-benzylidene-(2RS)-2-(6-chloro-9H-carbazol-2-yl)propanohydrazide that were obtained through a microwave-assisted synthesis method. In more detail, we have joined two pharmacophore fragments in a single molecule, represented by an NSAID-type carprofen structure and a hydrazone-type structure, obtaining a new series of NSAID-N-acyl hydrazone derivatives that were further characterized spectrally using FT-IR, NMR, and HRMS investigations. Moreover, the compounds have been evaluated for their tuberculostatic activity, testing their effects on four M. tuberculosis strains (two of them susceptible to rifampicin (RIF) and isoniazid (INH), one susceptible to RIF and resistant to INH and one resistant to both RIF and INH). The results of our research highlight the potential of the prepared compounds in fighting against antibiotic-resistant M. tuberculosis strains.

The high prevalence of thyroid nodules and increased availability of neck ultrasound have led to an increased incidence of diagnostic thyroid fine needle aspirations, with approximately 20% yielding indeterminate results. The recent availability of molecular tests has helped guide the clinical management of these cases. This paper aims to review and compare three main commercially available molecular cytology platforms in the U.S. – Afirma GSC, Thyroseq GC, and ThyGeNEXT+ThyraMIR. Sequential improvements of the Afirma GSC and Thyroseq GC tests have led to higher positive and negative predictive values, sensitivity, and specificity. Comparative studies revealed similar diagnostic performance between these tests, with considerations for factors such as cost and processing time. Thyroseq GC provides detailed genomic information and specific management recommendations. ThyGeNEXT+ThyraMIR, though less studied, presents promising results, particularly in miRNA analysis for weak driver mutations. Challenges in interpreting results include variations in reporting and the evolving nature of testing platforms. Questions persist regarding cost-effectiveness and the utility of ultrasound characteristics in selecting candidates for molecular testing. While molecular testing has primarily served diagnostic purposes, advancements in understanding genetic alterations now offer therapeutic implications. FDA-approved options target specific genetic alterations, signaling a promising future for tailored treatments.

The integration of Artificial Intelligence (AI) with the Internet of Things (IoT) has propelled technological innovation across various industries. This systematic literature review explores the current state and future trajectories of AI in IoT, with a particular focus on emerging trends in intelligent data analysis and privacy protection. The proliferation of IoT devices, marked by voluminous data generation, has reshaped data processing methods, providing actionable insights for informed decision-making. While previous reviews have offered valuable insights, they often fall short of comprehensively addressing the multifaceted dimensions within the AI-driven IoT landscape. This review aims to bridge this gap by systematically examining existing literature and acknowledging the limitations of past studies. To achieve this aim, the study uses a meticulous approach guided by established methodologies. The chosen methodology ensures the rigor and validity of the review, aligning with PRISMA guidelines for systematic reviews. This systematic literature review serves as a comprehensive guide for researchers, practitioners, and policymakers, offering insights into the current landscape and paving the way for future research directions. The identified trends and challenges provide a valuable resource for navigating the evolving domain of AI in IoT, fostering a balanced, secure, and sustainable advancement in this dynamic field.

Collaborative robots (cobots) have largely replaced conventional industrial robots in today’s workplaces, particularly in manufacturing setups due to their improved performance and intelligent design. In the framework of Industry 5.0, humans are working alongside cobots to accomplish the required level of automation. However, human-robot interaction has brought up concerns regarding human factors (HF) and ergonomics. A human worker may experience cognitive stress as a result of cobots' irresponsive nature in unpredictably occurring situations, which adversely affects productivity. Therefore, there is a necessity to measure stress to enhance a human worker’s performance in a human-robot collaborative environment. In this study, factory workers’ mental workload has been assessed using physiological, behavioural, and subjective measures. Electroencephalography (EEG) and functional near-infrared spectroscopy (fNIRS) signals have been collected to acquire brain signals and track hemodynamic activity, respectively. The effect of task complexity, cobot’s movement speed, and cobot’s payload capacity on the mental stress of a human worker have been observed, for a task designed in the context of a smart factory. Task complexity and cobot’s speed have proved to be more impactful. As physiological measures are unbiased and more authentic means to estimate stress, eventually, they may replace the other conventional measures if they prove to correlate with the results of traditional ones. Here, regression and artificial neural networks (ANN) have been utilised to determine the correlation between physiological data and subjective and behavioural measures. Regression has performed better for most of the targets and the best correlation (rsq-adj = 0.654146) has been achieved for predicting missed beeps, behavioural measure, using a combination of multiple EEG and fNIRS predictors. The k-nearest neighbours (KNN) algorithm has been used to evaluate the accuracy of correlation between traditional measures and physiological variables, with highest accuracy of 77.8% achieved for missed beeps as the target. Results show that physiological measures can be more insightful and have the tendency to replace other biased parameters.

The engagement of the arresting hook with the arresting cable is a critical maneuver that is essential to the safe operation of aircraft landing on aircraft carrier. A comprehensive understanding of the engagement process dynamics is necessary to optimize landing performance and ensure the safety and efficiency of carrier operations. In this paper, an efficient and accurate simulation and analysis method is presented for studying the arresting hook engaging arresting cable process. The Finite Element Method and Multibody Dynamics (FEM-MBD) approach is employed. By establishing a rigid-flexible coupling model encompassing the aircraft frame, arresting hook, carrier deck and arresting gear system, the dynamic model for the engagement process is obtained. The model incorporates multiple coordinate systems to effectively capture the relative motion between the rigid and flexible components, enabling a thorough understanding of the dynamics characteristics. The analysis conducted in this paper takes into account various factors, including the material properties of the components, the characteristics of the arresting gear system, and the state of the aircraft during the engagement process. The analysis method is verified by comparing the simulation results with experiments of arresting hook rebound obtained from reference. Finally, simulations are performed to analyze the engagement process under different touchdown points and rolling angle of aircraft. The simulation results provide valuable insights into the distribution of stresses during the arresting hook and cable engagement, the center of gravity variations, as well as the response of the tire touch and rollover cable under specific scenarios. The proposed rigid-flexible coupling arresting dynamics model in this paper enables effective analysis of the dynamic behavior during arresting hook engaging arresting cable. The results obtained from this analysis offer valuable insights into the performance of the engagement process, which can be used to improve the design of carrier-based aircraft and techniques for carrier landing.

The article presents a bibliometric analysis of conference proceedings 2019-2021 indexed in Scopus and related to the topic "Artificial Intelligence and Energy". The relevance of the topic is considered in the context of the energy transition and the application of artificial intelligence for the rational use of energy resources. A comparative analysis of the publication activity of researchers from Russia, China, India, the United States, and Indonesia on the topic in question is given. Methodologically, the emphasis for determining the subject is not on the co-occurrence of keywords, but on the clustering of documents based on the thesis that the titles of publications most briefly and fully reveal the content of the publication and allow the subject specialist to do a relevant selection of publications necessary for their research. Two tools were used in this work: Carrot2 and Clustering App (CSV Explorer). It is shown that Russian researches are characterized by the tendency of prevailing engineering problems and insufficient attention is paid to environmental, economic and social problems of using AI in the energy sector. Studies from China and the United States are of the greatest informative interest, both in terms of the relevance of their topics and the actuality of their content. Studies from India and Indonesia are more general in nature; of interest are the efforts of these countries to engage in global scientific activities.

The goal of this study was to analyze the forest degradation in the Reserve for San Rafael National Park, Paraguay, during the period 2005-2019. This Reserve is one of the most important forest remnants of the Upper Paraná Atlantic Forest Ecoregion. A multitemporal analysis of degradation was carried out due to the occurrence of three disturbances: forest fires, a twister and illicit crops, using the Continuous Degradation Detection (CODED) algorithm, for which 3 factors were considered: variations due to pixel in the NDFI index values before, during and after every disturbance registered. In this context, the phenomenon with the greatest impact in terms of magnitude of degradation were the forest fires of 2005, being that year at the same time, the one that reported the highest degradation values. Secondly, there are the illicit crops established until the first semester of 2019, and lastly, the twister that occurred in 2017. Our findings demonstrate that CODED algorithm can detect multi-temporal degradation events in a Subtropical Broadleaf Forest, and the post-disturbance regeneration process after every disturbance tends to occur immediately. The response in terms of degradation-regeneration is highly variable, depending of the nature and severity of each disturbance and the vegetation recovery dynamics.

Cycloid drives are generally used in precision machinery requiring high reduction ratios, such as robot joint (RV) reducers, in which the contact load and stress property of the internal meshing pairs greatly affect the dynamic transmission performance of the reducers. Therefore, in this study, Isogeometric Analysis (IGA) was employed to explore the multi-tooth contact problem of the cycloid pinwheel drive. Based on the NURBS curved surface generation method, the NURBS tooth profile of the cycloid gear was reconstructed. In addition, the NURBS surface of the cycloid gear - pin tooth - output pin was generated via the element splicing method. A geometrical analysis model of cycloid pinwheel drive was established to solve the contact force of the meshing pair under different input angles, and compared with the finite element method in terms of convergence, resultant accuracy, and solving timeliness. The results show that the Isogeometric analysis has higher accuracy and efficiency than the finite element method in calculating the contact stress and contact force. This method can improve the contact simulation accuracy of the cycloid drive and provides a reference for the design evaluation of RV reducer.

Although buildings constitute 35% of global energy use and 38% of carbon emissions from energy, the amount of energy and energy-related carbon emissions are increasing rapidly. On the other hand, non-renewable usable energy resources are decreasing on the contrary. New buildings are being built due to the increasing population and the existing building stock not meeting the needs or losing its lifespan. Some of the existing building stock is demolished and renewed for structural reasons and some for reasons such as usage performance. It is possible to reduce both energy consumption and greenhouse gas emissions with strategic energy uses in existing building stocks. There are various techniques to measure the maximum performance of sustainable and energy-efficient use of existing building stocks with which changes. Building Information Modeling (BIM) technology is one of these techniques that provides wide opportunities to users in recent years, and it is almost a virtual laboratory of structures. Building stocks can be modeled with BIM, and alternative shell and system suggestions can be used to measure how building performance has changed and to achieve the best results. In this research study, improvement scenarios that optimize energy use in existing building stocks are investigated on a sample residential building by using the virtual laboratory facilities of BIM. After measuring the current energy performance of the existing building with BIM tools, 192 alternative results were obtained with 6 variables (external walls, roof, insulation layers, transparent surface materials, lighting, and photovoltaic panels). The obtained alternatives were compared with the current state of the existing building. The material expenditures and amortization periods required for these alternative scenarios are also calculated. The results obtained were evaluated according to annual / lifetime energy consumption, fuel, electricity, initial investment costs, energy use intensity, and carbon emission amounts. With the optimization of the current situation of the sample building, annual fuel consumption decreased by 61% and electricity consumption by 64%. The amortization period of the optimum improvement was determined as 12 years.

Background: This research presents the use of photoplethsmography combined with Traditional Tibetan Pulse reading for the estimation of the three energies of a person: Activity, Transformation and Stability. The growing interest to revive traditional finger pulse reading attests of the need to find alternative ways to approach complex multi-source diseases as well as individualised diagnostic wearable or portable cost effective systems. Method: Our work is presented in two studies. The first study presents the development of the technique of photoplethsmography to classify the three energies. The second study presents a validation of this methodology on mental stress and relaxation. Results: Energies classification achieved a sensitivity above 85% and specificity above 72%. Mental stress and relaxation could be significantly discriminated from baseline condition. Harmonic analysis gave further insights into the dynamic of the pulse wave under stress/relaxation. Conclusion: The photoplethsmogram contains information pertaining to the mental and physiological state of a person as interpreted with the Eastern energies concepts. The implication of this work points towards a holistic understanding and impact of human activities, health and its environment.

There is evidence that the tendency to adopt a particular pattern of causal inference, known as attributional style, is likely to be associated with specific pattern of psychopathology among youth. This study aims to assess preliminary psychometric properties of the Italian Children’s Attributional Style Questionnaire-Revised (CASQ-R) and to explore the presence of any subgroups of children and early adolescents from the general population who might exhibit internally homogeneous and externally heterogeneous attributional styles, through cluster analyses, delving also potential sociodemographic and clinical differences among the identified clusters of attributional styles. A sample of 337 children was recruited and their attributional styles and depressive symptoms were analyzed. Four distinct clusters emerged using the six CASQ-R subscales in a multivariate finite mixture model. In particular, high levels of depressive symptoms were reported by children showing high scores in all the negative attributional subscales (globality, internality and stability) and medium scores in all the positive attributional subscales. Conversely, low levels of depressive symptoms were reported by children showing medium-to-high scores in the positive attributional subscales and low-to-medium scores in the negative attributional subscales. The identified clusters shed light on distinct patterns associated with depressive symptoms, offering potential insights for targeted interventions.

The research presented in this paper examines a new proposed approach for identifying safety improvement sites on rural highways. Unlike conventional approaches, the proposed approach does not require crash history, but rather utilizes classified variables for traffic volume, geometric features, and roadside characteristics that do not require access to exact data or extensive technical expertise. The research validates the performance of the proposed approach using field data from a large sample of rural two-lane highway segments in the state of Oregon including traffic, roadway, and crash data. Using observed crash history as a reference, the performance of the proposed ap-proach was compared to two of the well-established methods in practice, namely: the Empirical Bayes (EB) and the Potential for Safety Improvement (PSI) methods. The study results suggest that, using crash density for highway segments, the performance of the proposed method was lower than that of the EB and PSI methods. This is despite the high R-square value of the predictive model used in the proposed method. However, when using crash frequencies for highway segments, the per-formance of the proposed method was found comparable to the well-established EB and PSI methods.

Recent studies suggest that PEBP1/RKIP and YY1, despite having distinct molecular functions, may interact and mutually influence one another's activity. They exhibit reciprocal control over each other's expression through regulatory loops, prompting the hypothesis that their interplay could be pivotal in cancer advancement and resistance to drugs. To delve into this interplay's functional characteristics, we conducted a comprehensive analysis using bioinformatics tools across a range of cancers. Our results confirm the association between elevated YY1 mRNA levels and varying survival outcomes in diverse tumors. Furthermore, we observed differing degrees of inhibitory or stimulatory effects of these two genes in various cancer pathways, along with correlations between their mRNA expression and immune infiltration. Additionally, YY1/PEBP1 expression (or methylation) displayed connections with genomic alterations across cancer types. Notably, we uncovered links between YY1/PEBP1 and different indicators of immunosuppression, such as immune checkpoint blockade response, and T-cell dysfunction/exclusion levels, across different patient groups. Overall, our findings underscore the significant role of the interplay between YY1 and PEBP1 in cancer progression, influencing genomic changes, tumor immunity or the tumor microenvironment. Additionally, these two gene products appear to impact the sensitivity of anticancer drugs, opening new avenues for cancer therapy.

Introduction: There are unique technical and management challenges associated with living donor liver transplantation (LDLT) for Budd-Chiari Syndrome (BCS). The outcomes of LDLT for BCS in comparison to other indications remains unclear and warrants elucidation. Methods: Data of 24 BCS patients who underwent LDLT between January 2012 and June 2019 were analyzed. There were 20 adults and 4 children. The early and long-term outcomes of adult LDLT BCS patients were compared to a control group of LDLT patients for other indications and matched using propensity scoring methodology. Results: Primary BCS was observed in 22(91.7%) patients. Caval replacement was performed in 7(29.1%) patients. Early and late hepatic venous outflow tract (HVOT) complications were seen in 1(5.5%) and 3(16.7%) patients. Preoperative acute kidney injury was identified as a risk factor for mortality in the BCS cohort (p =0.013). On comparison, BCS recipients were younger with fewer comorbidities, more large volume ascites and higher rates of PVT. They also had longer cold ischemia time, increased blood loss and transfusion requirements, increased hospital stay, and higher late outflow complications. The 1-year and 3-year survivals were similar to non-BCS cohort (84.2% vs 94% and 70% vs 91.9%, respectively, log rank test p=0.09). Conclusion: LDLT is remains a good option for symptomatic BCS who have failed non-transplant interventions. The clinical and risk factor profile of BCS recipients is distinct from non-BCS recipients. By following an algorithmic management protocol, we show on propensity-score matched analysis that outcomes of LDLT for BCS are similar to non-BCS indications.

With advances in the development of autonomous vehicles (AVs), more attention has been paid to the effects caused by adverse weather conditions on them. It is well known that the performance of self-driving vehicles is reduced when they are exposed to stressors that impair visibility or generate water or snow accumulation on sensor surfaces. This paper proposes a model to quantify weather precipitation, such as rain and snow, perceived by moving vehicles based on outdoor data. The modelling covers a wide range of parameters, such as varying wind direction and realistic particle size distributions. The model allows the calculation of precipitation intensity on inclined surfaces of different orientations and on a circular driving path. The modelling results were partially validated against direct measurements carried out by a test vehicle. The model outputs showed strong correlation with the experimental data for both rain and snow. Mitigation strategies for heavy precipitation on vehicles can be developed and correlations between precipitation rate and accumulation level can be traced using the presented analytical model. Dimensional Analysis of the problem has highlighted the critical parameters that can help the design of future experiments. The obtained results highlight the importance of the angle of the sensing surface on the perceived precipitation level. The proposed model is used to analyze optimal orientations for minimization of the precipitation flux, which can help to determine the positioning of sensors on the surface of autonomous vehicles.

Near-fault ground motions can cause severe damage to civil structures, including bridges. Safety assessment of these structures for near fault ground motion is usually performed through Non-Linear Dynamic Analyses, while faster methods are often used. IMPAb (Incremental Modal Pushover Analysis for Bridges) permits to investigate the seismic response of a bridge by considering the effects of higher modes, which are often relevant for bridges. In this work, IMPAb is applied to a bridge case study considering near-fault pulse-like ground motion records. The records were analyzed and selected from the European Strong Motion Database and the pulse parameters were evaluated. In the paper results from standard pushover procedures and IMPAb are compared with nonlinear Response-History Analysis (NRHA), considering also the vertical component of the motion, as benchmark solutions and incremental dynamic analysis (IDA). Results from the case study demonstrate that the vertical seismic action has a minor influence on the structural response of the bridge. Therefore IMPAb, which can be applied considering vertical motion, remains very effective conserving the original formulation of the procedure, and can be considered a well performing procedure also for near-fault events.

Background: Bibliometric analysis provides insight into knowledge gaps of a specific field. We want to know what part of medical care has been the subject of research in a group of Mexican physicians. The Instituto de Seguridad y Servicios Sociales de los Trabajadores del Estado (ISSSTE) cares for a wide spectrum of disease and it provides a unique vision of what specialists has investigated about health. Methods: Papers belonging to “ISSSTE” affiliation were harvested and downloaded to .csv Excel files from the Scopus database including most bibliometric variables. VOSviewer, biblioshiny and bibliometric were used to conduct the bibliometric. Results: 2,063 papers were found and re-trieved; internal medicine had the greatest number of papers with 831; nine institutions were listed claiming “ISSSTE” as their mother affiliation; original papers represent 82% of the total and 52% of them were written in Spanish. Research production in Mexico City and the most productive center is Centro Médico Nacional 20 de Noviembre. Discussion: We identified main institutions, prolific authors, top-cited researchers and their affiliations, however, our paper is a call to action for the medical community in Latin America to join our efforts in building a solid group of researchers for the future of science.

This study explored the incidence of metaphorical virtual classrooms and interactive learning objects in the interaction of students in online mode. The main objective was to analyze how these digital tools, driven by a set of strategies to promote their use, affect the interaction of students in the virtual classroom system and their derived effects. To this end, the latest version of Moodle was implemented in conjunction with gamification plugins and interactive tools in the higher education institution used as a case study. The methodology consisted of data collection through ordinal instruments applied to the teachers and student performance metrics gathered using a plugin developed to extract accurate metrics of each student's usage and performance through direct queries to the Moodle database and its processing through a neural network. This facilitated the collection of standardized data on the actual metrics of each virtual classroom at the end of the teaching of each subject from both the previous LMS and the newly implemented one. This data was then analyzed using advanced statistical techniques, including Mahalanobis distances, confirmatory factor analysis, and the Wilcoxon signed-rank test. These methods provided a compelling comparison between the old and new systems, revealing significant improvements in the metrics and factors evaluated. The results showed a significant improvement in teachers' perceptions of the usability of the virtual classroom system and an increase in students' academic performance, interaction, progress, and time spent learning in virtual contexts. These results provide solid empirical evidence of the added value of these educational tools as effective strategies for improving student interaction, performance, and motivation in online education.

African swine fever virus (ASFV) is the causative agent of African swine fever, an economically important disease of pigs, often with a high case fatality rate. ASFV has demonstrated low genetic diversity among isolates collected within Eurasia. To explore the influence of viral variants on clinical outcomes and infection-dynamics in pigs experimentally infected with ASFV, we have designed a deep sequencing strategy. Variant analysis revealed 3 distinct SNPs present in the virus inoculum (at 2.4%, 0.7%, and 13% frequency, respectively) that were maintained within all infected pigs (1-6 % frequency, and the latter at 16-21%). Several pigs displayed other unique SNPs at <10% frequency. In addition, a deletion of 10487 bp (resulting in the complete loss of 21 genes) was present at nearly 100% frequency in the ASFV DNA from one pig at position 6362-16849. This deletion was also found to be present at low levels in the virus inoculum and in two other infected pigs. The current methodology can be used for the currently circulating Eurasian ASFVs and also adapted to other ASFV strains and genotypes. Comprehensive deep sequencing is critical for following ASFV molecular evolution, especially for identification of modifications that affect virus virulence.

Within the eastern part of the Black Sea and Sea of Azov, the vegetation of charophytes was studied using the Brown-Blanquet approach. For the first time, five communities are described, including three associations and two subassociations from the alliance Charion canescentis Krausch 1964, the order Charetalia intermediae Sauer 1937, and the class Charetea intermediae F. Fukarek 1961. Diagnoses of the described syntaxa are given. A comparison with the Baltic and Mediterranean communities of charophytes is made. It is shown that all the Azov-Black Sea communities with the dominance of charophytes, in contrast to Western European ones, include Lamprothamnium papulosum with high constancy. At the same time, the communities of the southern seas of Russia are characterized by a lower occurrence and abundance of higher aquatic plants (except for Nanozostera noltei) and a slightly higher occurrence of red and green algae. An indirect ordination analysis showed the ecological isolation of the described phytocenoses and revealed two main factors influencing the floristic composition of communities – the granulometric composition of bottom sediments and water eutrophication.

Empowering teachers with Critical Thinking and understanding of sustainability is vital for guiding students’ informed decisions and actions in today’s world. Higher education needs innovative, student-centered methods like case-based teaching in order to promote Critical Thinking and the principles of Education for Sustainable Development. The aim of the study was to explore and evaluate pre-service teachers' Critical Thinking when engaged with case studies in a practicum preparation course centered on Education for Sustainable Development. Nine undergraduate students in Teacher Education participated in the study and answered four case studies. The case studies’ responses were analyzed through a bottom-up content analysis revealing eight higher-order categories. While approaching the case studies, student-teachers followed thinking processes similar to the processes proposed by the iterative models of Critical Thinking as perceived by Garrison (1991) and/or Brookfield (1987). Nevertheless, in some cases, pre-service teachers’ disengagement was evident. The rubric assessment highlighted that the responses fell under three profiles, namely the “Deficient Critical Thinker”, the “Emerging Critical Thinker” and the “Competent Critical Thinker”. The findings emphasize the need for targeted and individualized teaching interventions in teacher higher education programs aiming at Education for Sustainable Development complying with the learning needs of student-teachers’ Critical Thinking profiles.

In the rapidly evolving field of data management, numerous terminologies, such as data warehouse, data lake, data lakehouse, and data mesh , have emerged, each representing a unique analytical data architecture. However, the distinctions and similarities among these paradigms often remain unclear. The present paper aimed to navigate the data architecture landscape by conducting a comparative analysis of these paradigms. The analysis a identified and elucidated the differences and similari- ties in features, capabilities, and limitations of these architectural constructs. The study outcome serves as a comprehensive guide, assisting practitioners in selecting the most suitable analytical data architecture for their specific applications.

Wire-driven hyper-redundant continuum manipulators are gaining more popularity and finding more applications in industry and in minimally invasive surgery. Unlike traditional rigid link manipulators, continuum robots with a flexible backbone structure are able to work in a highly constrained workspace and in an unstructured environment. However, in spite of a possible wide range of reachability, continuum manipulators have some issues related to payload capacity, accuracy and control. Therefore, in this research, we propose a novel hyper-redundant continuum robot with a passive sliding disc mechanism to improve payload capacity and accuracy. To prove the sliding mechanism concept, we demonstrate a comparison analysis with a conventional non-sliding continuum robot arm in a payload test, a bending test and a reachability test. Moreover, with this novel design, we are proposing robot kinematics and kinetic formulation and simulation results to validate the effectiveness of the sliding disc mechanism.

Hydrogen-bond (H-bond) energies in 310-helices of short alanine peptides were systematically examined by precise DFT calculations with the negative fragmentation approach (NFA), a modified method based on the molecular tailoring approach. The contribution of each H-bond was evaluated in detail from the 310-helical conformation of total energies (whole helical model; WH3-10 model), and the results were compared with the property of H-bond in a-helix from our previous study. The H-bond energies of the WH3-10 model exhibited tendencies different from those exhibited by the -helix, in that they depended on the helical position of the relevant H-bond pair. H-bond pairs adjacent to the terminal H-bond pairs were observed to be strongly destabilized. The analysis of electronic structures indicated that structural characteristics cause the destabilization of the H-bond in 310-helices. We also found that the longer the helix length, the more stable the H-bond in the terminal pairs of the WH3-10 model, suggesting the action of H-bond cooperativity.

Anarchic urbanization and land artificialization expose urban ecosystems and Ecosystem Services (ES) to the threat. Urban ecosystems and trees play a crucial role in improving urban environments, and their management depends on the perceptions and preferences of urban residents. An assessment of the socio-ecological factors determining the perception of the actors allows for the proper design and planning of ecological urban policies and urban adaptation to climate change. In this study, we assessed the perception and discriminating variables of the different stakeholders of urban ES provided in the city of Cotonou. Thus, 381 city dwellers were individually interviewed after statistical sampling. Focus group discussions with the stakeholders also made it possible to highlight the ES provided in the different Land Use Units (LU). The results show that 73.23% of the city dwellers agreed that they were aware of ecosystem services. The hierarchical classification shows two homogeneous groups of perceivers with ethnicity, age and education as statistically discriminating sociological variables (pv˂0.001). Urban dwellers in the city of Cotonou perceived more SEs in the cultural and regulatory services category significantly (pv<0.001; v-test>3). The principal component analysis (PCA) reveals the varying availability of ES according to the different LU in the city. This study adds scientific value in the application of urban ecology to decision-making in climate and environment policy planning for sustainable cities in Africa and all over the world.

Background: This study aimed to evaluate whether measles vaccine uptake can be predicted directly or indirectly by parental perceptions about the availability of measles vaccine services with parental hesitancy towards the measles vaccine as a potential mediator. Methods: This was a community-based cross-sectional study conducted at Omdurman locality in Khartoum state, Sudan in February 2019. The study population included parents/ guardians having at least one child aged 2 -3 years old. Mediation analysis was conducted using two models, the ordinary least squares path analysis and multiple logistic regression. Results: a total of 495 responded and the mean age of the mothers who participated in the study was 31.1 (SD=5.73). A half of the respondents (50.1%) completed university education and nearly three-quarters of the respondents (74.7%) were housewives. After controlling for the other factors, including the mother’s age and the number of children, parental perception about the accessibility and availability of the measles vaccine influences the uptake of the measles vaccine indirectly through the mediation effect of measles vaccine hesitancy. Conclusions: We suggest that intervening in measles vaccine hesitancy in addition to measles vaccination access issues will have positive impact on the uptake and coverage of the measles vaccine in Sudan.

Significant recent advances in cancer immunotherapeutics include the vaccination of cancer patients with tumor antigen-associated peptide-pulsed dendritic cells (DCs). DC vaccines with homogeneous, mature, and functional activities are required to achieve effective acquired immunity; however, the yield of autologous monocyte-derived DCs varies in each patient. Priming with a low dose of recombinant human granulocyte colony-stimulating factor (rhG-CSF) 16–18 h prior to apheresis resulted in 50% more harvested monocytes, with a significant increase in the ratio of CD11c+CD80+ DCs/apheresed monocytes. The detection of antigen-specific cytotoxic T lymphocytes after Wilms’ tumor 1-pulsed DC vaccination was higher in patients treated with rhG-CSF than those who were not, based on immune monitoring using tetramer analysis. Our study is the first to report that DC vaccines for cancer immunotherapy primed with low-dose rhG-CSF are expected to achieve higher acquired immunogenicity.

Aim was to develop a population pharmacokinetic model for methotrexate (MTX) during high-dose treatment (HDMTX) in pediatric patients with acute lymphoblastic leukemia (ALL) and non-Hodgkin’s lymphoma (NHL) and to describe the sources of variability. The study included 50 patients (1-18 years) who received 3 or 5 g/m2 of HDMTX. Nonlinear mixed effects modeling approach was applied for data analysis. Parameter estimation was performed by FOCEI, whereas stepwise covariate modeling was used to assess variability factors. The final two-compartment model incorporates the effect of body weight using allometric scaling and the influence of hemoglobin and serum creatinine on MTX clearance (CL). Population pharmacokinetic values for a typical 70 kg subject were: 11 L/h for clearance (CL), 46.5 L and 16.4 L for volume of central (V1) and peripheral compartment (V2), respectively, and 0.168 L/h for intercompartmental clearance (Q). According to the final model, MTX CL decreases with increasing serum creatinine, whereas a positive effect was captured for hemoglobin. A difference of almost 30% in MTX CL was observed among patients’ hemoglobin values reported in the study. In addition to renal function and body weight, it describes the influence of hemoglobin on CL, allowing better understanding of its contribution to HDMTX disposition.

Abstract: Understanding social media networks and group interactions are crucial to the ad-vancement of linguistic and cultural behaviour. This includes the manner in which people ac-cessed advice on health, especially during the global lockdown periods. Some people turned to social media to access information on health where most activities were curtailed with isolation rules, especially for older generations. Facebook public pages, groups and verified profiles, using "senior citizen health", "older generations", and "healthy living" keywords were analysed over a 12-month period to analyse the engagement promoting good mental health. CrowdTangle was used to source English language status updates, photo and video sharing information which resulted in an initial 116,321 posts and 6,462,065 interactions Data analysis and visualisation were used to explore large datasets, including natural language processing for “Message” content discovery, word frequency and correlational analysis and co-word clustering. Preliminary results indicate strong links to healthy aging information shared on social media which showed correla-tions to global daily confirmed case and daily death totals. The results can be used to identify public concerns early on and address mental health issues in the senior generation on Facebook.

We estimate the value of Research and Development Expenditures as a percentage of GDP-RDE in the context of Environmental, Social and Governance-ESG model. We use the ESG World Bank database. We analyze data from193 countries in the period 2011-2020. We apply a set of econometric techniques i.e. Pooled Ordinary Least Squares-OLS, Panel Data with Random Effects, Panel Data with Fixed Effects, Weighted Least Squares-WLS. We found that the level of RDE is positively associated, among others, to “Nitrous Oxide Emissions” and “Scientific and Technical Journal Articles”, and negatively associated, among others to “Heat Index 35”, “Maximum 5-day Rainfall”. Furthermore, we perform a cluster analysis with the application of the k-Means algorithm optimized with the Elbow Method. The results show the presence of four clusters. Finally, we confront eight different machine-learning algorithms to predict the future value of RDE. We find that Linear Regression is the best predictive algorithms. RDE is expected to growth on average of 0.07% for the analysed countries.

The spread of high-performance personal computers, frequently equipped with powerful Graphic Processing Units (GPU), raised the interest on a set of techniques able to extract models of electromagnetic phenomena (and devices) directly from available examples of the desired behavior. Such approaches are collectively referred to as Machine Learning (ML). A typical representative ML approach is the so called “Neural Network” (NN). Using such data-driven models allows evaluating the output in a much shorter time when a theoretical model is available, or allows predicting the behavior of the systems and devices when no theoretical model is available. With reference to a simple yet representative benchmark electromagnetic problem, some of the possibilities and the pitfalls of the use of NN for the interpretation of measurements (inverse problem) or to obtain the required measurements (optimal design problem) are discussed. The investigated aspects include the choice of the NN model; the generation of the dataset(s); the selection of hyperparameters (hidden layers, training paradigm). Finally, the capabilities in the handling of ill-posed problems are critically revised.

This study compared cortical responses to speech in preschoolers with typical language development (TLD) and Developmental Language Disorder (DLD), and in adults. We investigated whether top-down language effects modulate speech perception in an adult-like manner. We compared cortical mismatch responses (MMR) during passive perception of speech differing in linguistic complexity in three groups of participants: preschoolers with TLD (n=11), preschoolers with DLD (n=16) and adults (n=20). We also measured children’s phonological skills and investigated if they are associated with the cortical responses. MMR results indicated top-down language effects in adults, with enhanced cortical discrimination of lexical stimuli but not of non-words. In preschoolers, the TLD and DLD groups did not differ on the MMR measures and no top-down effects were detected. Moreover, we found no association between MMRs and phonological awareness skills, even though the DLD group’s phonological skills were significantly lower. Our findings suggest that top-down language modulations on speech discrimination may not be present during early childhood, and that children with DLD may not exhibit cortical speech perception deficits. The lack of association between phonological and MMR measures indicates that further research is needed to understand the link between language skills and cortical activity in preschoolers.

Background. In a changing European agricultural context, diversification of dairy farms is gaining attention. This study seeks to (1) assess musculoskeletal pain prevalence associated with tasks such as butter, yogurt, and cheese production; and (2) analyze associated risks. Methods. Observing 31 mostly female workers, it utilized the ERGOROM questionnaire, a methodology adapted from the Institut National de Recherche et de Sécurité, and Key Indicator Method forms. Results. Findings revealed that tasks like load carrying (42% of workers), manual work (17%), and awkward postures (14%) resulted in musculoskeletal pain, predominantly in the lower back (65%), neck (39%), and dominant upper limb areas (shoulder: 61%, elbow: 26%, and wrist: 65%). While psychosocial risks remained low, concerns arose from workload, hygiene standards, and resource unpredictability. Conclusions. As dairy farming evolves from artisanal to semi-industrial, the study emphasizes the importance of ergonomic adaptations to protect farmer health and prevent musculoskeletal disorders during diversification.

In this project, we use a statistical multiple regression to study the impact of eight various predictors (relative compactness, surface area, wall area, roof area, overall height, orientation, glazing area, glazing area distribution) to estimate the cooling load energy efficiency of residential buildings. We try to analyze and visualize the effect of each predictor with each of the response variable using different classical statistical analysis tools used in describing linear models, in such a way so that we can find out the most strongly related predictor variables. Before starting all of this, we use the idea of model selection by stepwise regression technique and compare the AIC of these models and identified a better model between all of them. Then, we compare a classical linear regression approach by simulations on 768 diverse residential buildings show that we can predict CL with low mean absolute error. By using ANOVA we determine variation in the different residuals. Also, we use non constant variance test to verify it. Furthermore, we check leverage and influence points as well as outliers as well as determined cook distance for influential points. By taking box cox transformation and weights, we also introduce WLS technique to fit the model for better results and did all type of important analysis to understand the energy efficiency. Finally, we show 5-fold cross validation to verify our model.

Results from an explorative study revealing spatio-temporal patterns of the SARS-CoV-2/COVID-19 epidemic in Germany are presented. We dispense with contestable model assumptions and show the intrinsic spatio-temporal patterns of the epidemic dynamics. The analysis is based on COVID-19 incidence data, which are age-stratified and spatially resolved at the county level, provided by the Federal Government’s Public Health Institute of Germany (RKI) for public use. Although the 400 county-related incidence time series show enormous heterogeneity both with respect to temporal features as well as spatial distributions, the counties’ incidence curves organise into well distinguished clusters that coincide with East and West Germany. The analysis is based on dimensionality reduction, multidimensional scaling, network analysis, and diversity measures. Dynamical changes are captured by means of difference-in-difference methods which are related to fold changes of the effective reproduction numbers. The age-related dynamical patterns suggest a considerably stronger impact of children, adolescents and seniors on the epidemic activity than previously expected. Besides these concrete interpretations, the work mainly aims at providing an atlas for spatio-temporal patterns of the epidemic which serves as a basis to be further explored with the expertise from different disciplines, particularly sociology and policy makers. The study should also be understood as a methodological contribution to getting a handle on the unusual complexity of the COVID-19 pandemic.

In unicellular organisms, intracellular inclusions of amorphous calcium carbonate (ACC) have been initially described in cyanobacteria and, later, in unicellular eukaryotes of Lake Geneva (Switzerland/France). Inclusions in unicellular eukaryotes ‒named micropearls‒ consist of hydrated ACCs, frequently enriched in Sr or Ba, displaying internal oscillatory zonations due to variations in the Ba:Ca or Sr:Ca ratios. The analysis of our database consisting of 1597 micropearl analyses from Lake Geneva and 34 from Lake Titicaca (Bolivia/Peru) has shown that a certain number of Sr and Ba-enriched micropearls from these lakes contain As in amounts measurable by EDXS. A Q-mode statistical analysis has confirmed the existence of five geochemically distinct morpho-chemical groups of As-bearing micropearls, among which a new category identified in Lake Geneva, where As is often associated with Mg. This new type of micropearl is possibly produced in a small (7-12 m size) bi-flagellated organism. Micropearls from Lake Titicaca, which contain Sr, are found in an organism very similar to Tetraselmis cordiformis, observed in Lake Geneva. Lake Titicaca micropearls contain higher As concentrations which can be explained by the high As concentration in the water of this lake. The ubiquity of the biomineralization process observed points to the need for better understanding of the role of amorphous or crystalline calcium carbonates in As cycling in surface waters.

Laser marking on polymer composite surfaces can be difficult to contrast and cause readability problems for electronic decoding equipment on production lines due to poor interaction between the laser and the fibres used to reinforce these materials. This problem can be solved with the right choice of marking parameters, resulting in savings for companies by avoiding production problems such as rejection, scrap and customer complaints. The present work uses the PBT/glass fibre composite used in the manufacture of instrument panels for motorcycles. The tests were carried out with different laser marking parameters using a Nd: YAG laser. Subsequently, the laser-marked DMC codes were analysed using a Verifier to evaluate the quality according to the ISO/IEC 29158:2020 standard. A detailed analysis of these surfaces was also carried out to observe some physical and chemical changes using SEM microscopy and EDS spectroscopy. The optical analysis showed that the lower the radiation power and pulse frequency and the higher the marking speed, the weaker the laser marking and therefore the poorer the DMC code quality, which was confirmed by the SEM. EDS spectroscopy showed that the laser marking process did not affect the chemical changes on the sample surface.

In this article we estimate the level of Control of Corruption for 193 countries in the period 2011-2020 using data from the ESG World Bank Database. Various econometric techniques are applied i.e.: Panel Data with Random Effects, Panel Data with Fixed Effects, Pooled OLS, WLS. Results show that “Control of Corruption” is positively associated, among others, to “Government Effectiveness” and “Political Stability and Absence of Violence/Terrorism”, while it is negatively associated among others to “Agriculture, Forestry, and Fishing Value Added as Percentage of GDP” and “GHG Net Emissions/Removals by LUCF”. A cluster analysis implemented with the k-Means algorithm optimized with the Elbow Method shows four clusters. A confrontation among eight Machine Learning algorithms is proposed for the prediction of Control of Corruption. Polynomial Regression is the best predictor for the training data. The level of Control of Corruption is expected to growth by 10.36% on average.

membrane separation technology shows promise, particularly gas separation membranes, including ceramic membrane. Ceramic membranes are increasingly gaining attention for their acid and alkali stability, corrosion resistance, high-temperature tolerance, and mechanical strength. This study focuses on alumina support ceramic membrane for CO2 capture. The membranes were characterized using contact angle measurements, scanning electron microscopy (SEM), and Fourier Transform Infrared spectroscopy (FTIR) analysis. The contact angle measurements confirmed the hydrophilic, while SEM analysis showed even particle distribution in the alumina ceramic membranes respectively. EDAX analysis revealed the elemental composition in the alumina support matrix. FTIR analysis demonstrated chemical interactions of the support membrane. Single gas permeation experiments were conducted. It can be observed that Nitrogen gas permeated faster with increase in feed pressure through the unmodified ceramic inorganic hydrophobic membrane more than the other two single gases, O2, and CO2). As a result, only high permeance separation membranes with realistic size and pressure conditions may be considered of as a practical alternative for CO2 capture. However, the presence of non-selective defects limited the improvement in selectivity of hydrophilic ceramic membrane. In this case, there is need to modify the ceramic membrane used to increase the flux, permeance of CO2, and selectivity of CO2.

Abstract: membrane separation technology shows promise, particularly gas separation membranes, including ceramic membrane. Ceramic membranes are increasingly gaining attention for their acid and alkali stability, corrosion resistance, high-temperature tolerance, and mechanical strength. This study focuses on alumina support ceramic membrane for CO2 capture. The membranes were characterized using contact angle measurements, scanning electron microscopy (SEM), and Fourier Transform Infrared spectroscopy (FTIR) analysis. The contact angle measurements confirmed the hydrophilic, while SEM analysis showed even particle distribution in the alumina ceramic membranes respectively. EDAX analysis revealed the elemental composition in the alumina support matrix. FTIR analysis demonstrated chemical interactions of the support membrane. Single gas permeation experiments were conducted. It can be observed that Nitrogen gas permeated faster with increase in feed pressure through the unmodified ceramic inorganic membrane more than the other two single gases, O2, and CO2). As a result, only high permeance separation membranes with realistic size and pressure conditions may be considered of as a practical alternative for CO2 capture. However, the presence of non-selective defects limited the improvement in selectivity of hydrophilic ceramic membrane. In this case, there is need to modify the ceramic membrane used to increase the flux, permeance of CO2, and selectivity of CO2.

The objective of the study was to analyse the antimicrobial susceptibility trends of Spanish porcine bacteria to quinolones, cephalosporins and polymyxins. Isolates of Actinobacillus pleuropneumoniae, Pasteurella multocida, and Escherichia coli were isolated from sick pigs from 2019 to 2022. Antimicrobial susceptibility test was determined by minimal inhibitory concentration (MIC) following internationally accepted methodology. MIC categorization was based on distributing the range of MIC values in four categories being category one the most susceptible (lowest MIC value) and four the less susceptible one (highest MIC value). Moreover, clinical susceptibility (susceptible/resistant) was also determined according to CLSI and EUCAST clinical breakpoints. A logistic and multinomial logistic regression model was used to analyze the susceptibility data for dichotomized and categorized MIC data, respectively for any pair of antimicrobial/microorganism. In general terms, the antimicrobial susceptibility of pig bacteria to these antimicrobials remained stable or increased in the last four years in Spain. In the case of A. pleuropneumoniae and quinolones, it was observed a significant temporal trend where isolates from 2020 had significantly increased odds of being more susceptible than isolates from 2019. In the case of E. coli and polymyxins, a significant temporal trend was observed where isolates from 2020 and 2021 had significantly increased odds of being more susceptible than isolates from 2019 and 2020, respectively. Finally, a significant odd of being less susceptible was only observed for cephalosporins and E. coli for 2020 versus 2019, stagnating for the rest of study period. These results provide sound data on critical important antimicrobials in swine medicine.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

A comprehensive lipid profile was analyzed in patients with non-small cell lung cancer (NSCLC) using nanoflow ultrahigh-performance liquid chromatography-electrospray ionization-tandem mass spectrometry. The study investigated 297, 202, and 166 lipids in saliva, plasma, and fecal samples, respectively, comparing NSCLC patients to healthy controls. Lipids with significant changes (&gt;2-fold, p&lt;0.05) were further analyzed in each sample type. Both saliva and plasma exhibited similar lipid alteration patterns in NSCLC, but saliva showed more pronounced changes and fecal lipids had weak correlation with those of saliva and plasma. Total triglycerides (TGs) increased (&gt;2–3 folds) in plasma and saliva but decreased in fecal samples. Three specific TGs (50:2, 52:5, and 54:6) were significantly increased in NSCLC across all sample types. A common ceramide species (d18:1/24:0) decreased in both plasma and saliva but increased in fecal samples. Additionally, phosphatidylinositol 38:4 decreased by approximately 2-fold in plasma and saliva. Phosphatidylserine 36:1 was selectively detected in saliva and showed a subsequent decrease, making it a potential biomarker for predicting lung cancer. The study identifies 27 salivary, 10 plasma, and 16 fecal lipids as candidate markers for NSCLC by statistical evaluations. Moreover, it highlights the potential of saliva in understanding changes in lipid metabolism associated with NSCLC.

The rapid penetration of social media has been redefining every facet of the old marketing and customer engagement tactics, not only for the low-end and mass products but also for luxury brands. In this context, brands are dealing with the challenge of keeping the balance between using mass marketing strategies concurrent with accentuating the exclusivity of their offerings. Social media can be considered a boon if brands employ them to reach the right audience and use the right platform by incorporating the right content. In this work, we propose a sector-specific, integrated, and holistic investigation of the social media strategies of luxury brands, together with the impact they generate in terms of the engagement level of the users as an indicator of their success. We provide empirical validation of the method in the sector of luxury fashion brands in the Italian market, providing qualitative and quantitative analysis of the content shared on social media, considering the type, timing, and modality of the sharing. We evaluate consumer-brand engagement in different contexts, including important live events in the field.

The EU’s energy targets are to achieve at least 32% renewables in the energy mix by 2030. Part of the solution is strengthening consumer rights by empowering individuals to generate their own electricity. The study aimed to identify the most suitable energy system for electricity generation of up to 50 kW in the EU residential sector. The Multi-Criteria Decision Analysis was used to compare four systems: proton exchange membrane fuel cell with photovoltaic panels, photovoltaic panels, biomass powered Stirling engine, and solar powered Stirling engine. Based on the results, the most beneficial system for household electricity generation is the Biomass-fueled Stirling engine system due to its affordability, reliability, and low environmental impact. Governments and businesses can use these findings to improve information for the residential sector and enable the transition to renewable energy.

This study combines insights from psycholinguistics and text analysis to identify linguistic markers of intercultural competence (ICC) in 1,635 blogs about intercultural experiences, written by 672 Hotel Management students. By combining holistic ICC frameworks with a text-analytical approach at word level, we were able to demonstrate that blogs with a high perceived level of ICC contain significantly more I-words, more insights words and less quantifiers. These markers of ICC constitute concrete cues for teachers when assessing reflective writing assignments and allow them to pinpoint concrete areas for improvement in their feedback and interaction with students.

Automated software bots infiltrate online surveys and corrupt data integrity, not to mention waste researcher time and budgets. Although resources exist to help keep bots out and identify bots when they do evade survey barriers, bot attacks may be a persistent problem for online surveys for a long time to come. Bots are evolving -- even as survey designers try ever more sophisticated methods to fend them off and weed their answers out. Vigilance needs to be high and the bot generators should not be under-estimated. We recount here some bot features we encountered after our own survey was attacked that helped to identify them, and that have not been detailed elsewhere. We also discuss reasons why commonly recommended strategies for how to keep bots out may not be feasible for many scientific researchers.

The SARS-CoV-2 virus, causative agent of COVID-19, is known for its genetic diversity. Virus variants of concern (VOCs) as well as variants of interest (VOIs) are classified by the World Health Organization (WHO) according to their potential risk to global health. This study seeks to enhance the identification and classification of such variants by developing a novel bioinformatics criterion centered on the virus's spike protein (SP1), a key player in host cell entry, immune response, and a mutational hotspot. To achieve this, we pioneered a unique phylogenetic algorithm which calculates EIIP-entropy as a distance measure based on the distribution of the Electron-Ion Interaction Potential (EIIP) of amino acids in SP1. This method offers a comprehensive, scalable, and rapid approach to analyze large genomic data sets and predict the impact of specific mutations. This innovative approach provides a robust tool for classifying emergent SARS-CoV-2 variants into potential VOCs or VOIs. It could significantly augment surveillance efforts and understanding of variant characteristics, while also offering potential applicability to the analysis and classification of other emerging viral pathogens and enhancing global readiness against emerging and re-emerging viral pathogens.

Optimizing the magnetic coupling of two coils of a dynamic wireless charging power supply for electric vehicles (EVs) is a challenging and crucial task. This article examines three situations of the magnetic coupling between two identical rectangular spiral coils with the same number of turns as a function of both the horizontal (X axis) and vertical (Z axis) alignment. In the first one, the analysis of the magnetic coupling between two copper air coils is presented. However, the obtained coupling coefficient was very low with a high leakage flux which affected the performance of the charging system. In the second case, a straightforward shielding method that involves inserting a magnetic material of the ferrite type is proposed to circumvent the aforementioned problems. Unfortunately, the obtained results show that simple shielding is still only a partial and insufficient solution. In the third situation, an aluminum sheet was consequently placed on the top of the ferrite to provide an adequate shielding structure. Additionally, a 3D analysis of the proper and mutual induction parameters separating the two coils as well as a magnetic field or induction distribution is also performed using the ANSYS Maxwell software. The results highlight the significance of the enhanced structure.

We consider a model of predator-prey interaction at fractional-order where the predation obeys the ratio-dependent functional response and the prey is linearly harvested. For the proposed model, we show the existence, uniqueness, non-negativity as well as the boundedness of the solutions. Conditions for the existence of all possible equilibrium points and their stability criteria, both locally and globally, are also investigated. The local stability conditions are derived using the Magtinon's theorem, while the global stability is proven by formulating an appropriate Lyapunov function. The occurance of Hopf bifurcation around the interior point is also shown analytically. At the end, we implement the Predictor-Corrector scheme to perform some numerical simulations.

Introduction: Patients’ satisfaction was extensively researched over the last decades, given its role in building loyalty, compliance to treatment, prevention, and eventually higher levels of wellbeing and improved health status. Patients’ feedback on the perceived quality of health services can be incorporated into practice; therefore, understanding factors and mechanisms responsible for patients’ satisfaction allows providers to tailor targeted interventions. Method: A questionnaire assessing patients’ perception of the quality of health services was administered to a country-representative sample of 1500 Romanian patients. Using a partial least squares—path modeling approach (PLS-PM), with cross-sectional data, we developed a variance-based structural model, emphasizing the mediating role of trust and satisfaction with various categories of health services. Results: We confirmed the mediating role of trust in shaping the relationship between the procedural accuracy of health professionals, along with the perceived intensity of their interaction with patients, and patients’ experienced quality of the health services. We confirmed the mediating role of satisfaction by the categories of services in the relationship between waiting time on the premises, attention received, and the perceived reliability of the information received, as predictors, and the experienced quality of the health services. In addition, indirect assessment of patients’ satisfaction is a good predictor for direct assessment, thereby affirming the idea that the results of the two types of evaluations converge. Discussions: One of the most efficient solutions to increase both patients’ satisfaction and their compliance is to empower the communication dimension between patients and health practitioners. Given the non-linear relationships among variables, we advocate that, unless the nature of the relationships between satisfaction and its predictors is understood, practical interventions could fail. The most relevant variable for intervention is the degree of attention patients perceive they received. We suggest three methods to turn waiting time into attention given to patients.

This paper presents a comprehensive bibliometric analysis of research on form and typology in architectural publications, spanning from 1999 to 2024. Utilizing the Web of Science database and the bibliometrix package in R, the study examines trends, influential works, and thematic evolution in the field. The findings reveal a progression from foundational themes such as "architecture," "culture," and "planning" to more specialized and diverse topics, including "sustainability," "parametric design," and "digital fabrication." Key influential works by authors like Jane Jacobs, Kevin Lynch, and Bill Hillier are highlighted. The study also underscores the collaborative nature of contemporary architectural research, with significant international co-authorship. While providing valuable insights into the research landscape, the study acknowledges limitations, such as database reliance and the need for qualitative analysis. The paper concludes with recommendations for future research, emphasizing the exploration of emerging technologies, interdisciplinary collaborations, and regional research dynamics.

A huge number of applications available for Android-based smartphone devices have emerged over the past years. Due to which a huge number of malicious applications has been growing explosively. Many approaches have been proposed to ensure the security and quality of application in the markets. Usually, Machine Learning approaches are utilized in the classification process of malicious application detection. Calculating accurate results of characterizing applications behaviors, or other features, has a direct effect on the results with Machine Learning calculations. Android applications emerge so quickly. The behavior of current applications has gotten progressively malicious. The extraction of malware-infected features from applications is thus become a difficult task. According to our knowledge, a ton of features have been extricated in existing work however no survey has overviewed the features built for identifying malicious applications efficiently. In this paper, we will in general give an extensive review of such sort of work that identifies feature applications by describing various practices of uses with various kinds of features. In this survey we have discussed the following dimensions: extraction and selection of feature methods if any, methods of detection and evaluation performed. In light of our review, we notice the issues of investigating malware-affected features from applications, give the scientific categorization and demonstrate the future headings.

The lymphatic system of the brain meninges and head plays a crucial role in the clearance of amyloid-β protein (Aβ), a peptide thought to be pathogenic in Alzheimer’s disease (AD), from the brain. The development of methods to modulate lymphatic clearance of Aβ from the brain coild be a revolutionary step in the therapy of AD. The opening of the blood-brain barrier (OBBB) by focused ultrasound is considered as a possible tool for stimulation of clearance of Aβ from the brain of humans and animals. Here, we propose an alternative method of non-invasive music-induced OBBB that is accompanied by the activation of clearance of fluorescent Aβ (Fαβ) from the mouse brain. Using confocal imaging, fluorescence microscopy and magnetic resonance tomography, we clearly demonstrate that OBBB by music stimulates the movement of Fαβ and Omniscan in the cerebrospinal fluid and lymphatic clearance of Fαβ from the brain. We propose the extended detrended fluctuation analysis (EDFA) as a promising method for the identification of OBBB markers in the electroencephalographic (EEG) patterns. These pilot results suggest that music-induced OBBB and the EDFA analysis of EEG can be a non-invasive, low cost, labelling free, clinical perspective and completely new approach for the treatment and monitoring of AD.

Different methodologies are being used to study the effects of autonomous vehicle (AV) in the mixed traffic indicating the interaction among autonomous and human-driven vehicles. Micro-scopic simulation tools are popular in such assessment as it offers scope to experiment in eco-nomical, robust, and optimistic way. Lack of reliable real-world data to calibrate and evaluate the connected autonomous vehicles (CAV) simulation model is a major challenge. One interesting methodology could be dealing the CAVs as conventional human driven vehicles and predict its possible characteristics based on the simulation inputs. The conventional human driven vehicles from real world, in this methodology, come to aid as benchmark to offer the measure of effective-ness (MoE) for the calibration and validation. For the three most common driving modules, a sensitivity analysis of the driving behaviors of AVs and an effect assessment of CAVs in a mixed traffic environment were done to explore the human alike autonomous technology. The findings show that, up to a point, which is directly re-lated to the quantity of interacting vehicles, the impact of CAVs is typically favorable. This study validates the approach and supports past studies by showing that CAVs perform better in traffic than AVs for traffic performance and safety aspects. On top of that, the sensitivity analysis has shown that enhancements in technology are required for obtaining the maximum advantages.

The Homotopy Analysis Method (HAM) is a useful method to derive analytical approximate solutions of black holes in modified gravity theories. In this paper, we study the Einstein-Weyl gravity coupled with Maxwell field, and obtain analytical approximation solutions for charged black holes by using the HAM. It is found that the analytical approximate solutions are sufficiently accurate in the entire spacetime outside the black hole's event horizon, and also consistent with numerical ones for charged black holes in the Einstein-Maxwell-Weyl gravity.

An outbreak of winter disease, complicated by severe respiratory syndrome, occurred in January 2020 in a high production dairy cow herd located in a hilly area of the Calabria region. Of the 52 animals belonging to the farm, 5 (9.6%) died with severe respiratory distress, death occurring 3-4 days after the appearance of the respiratory signs (caught and gasping breath). Microbiological analysis revealed absence of pathogenic bacteria whilst Real-time PCR identified the presence of RNA from Bovine Coronavirus (BCoV) in several organs: lungs, small intestine (jejunum), mediastinal lymph nodes, liver and placenta. Since being the only pathogen identified, BCoV was hypothesized to be the cause of the lethal pulmonary infection. Like the other CoVs, BCoV is able to cause different syndromes. Its role in calfhood diarrhoea and in mild respiratory disease is well known: we report instead the involvement of this virus in a severe and fatal respiratory disorder, with symptoms and disease evolution resembling that of Severe Acute Respiratory Syndromes (SARS).

It is widely accepted that plastic waste is one of our most urgent environmental concerns the world is currently facing. Plastic has contributed greatly to innovation in all fields, but the raw material for its production (fossil fuels), as well as the linear economy in which it is currently produced and used, makes the material problematic from a sustainability and human health perspectives. The emergence of bio-based plastics provides an opportunity to reduce dependency on fossil fuels and transition to a more circular plastics economy. For polyethylene terephthalate (PET), one of the most prevalent plastics in packaging and textiles, there exist two bio-based alternatives that are similar or superior in material property and recyclability. These are polyethylene furanoate (PEF) and polytrimethylene terephthalate (PTT). The overarching aim of this study was to examine the transition from fossil-based to renewable plastics, through the lens of PET upcycling into PEF and PTT. The process for the production of PEF and PTT from three feed streams (post-consumer PET waste, lignocellulosic biomass-derived cellulose and biodiesel-derived crude glycerol) was developed in the software SuperPro Designer and the economic viability assessed via a discounted cumulative cash flow (DCCF) analysis. This study represents a conceptual case study of the valorisation of existing plastic waste into new, recyclable bio-based plastics, for a more sustainable plastics production. A techno-economic analysis of the designed process revealed that the minimum selling price (MSP) of second generation-derived PEF and PTT is 3.13 USD/kg, and that utilities and the feedstock used for the production of 2,5-furandicarboxylic acid (FDCA) needed in PEF synthesis contributed the most to the process operating costs. The effect of recycling PEF and PTT through the process at three recycling rates (42%, 50% and 55%) was investigated and revealed that increased recycling could reduce the MSP of the 2G bio-plastics (by 48.5%) to 1.61 USD/kg. This demonstrates that increasing recycling rates would have a beneficial effect on the economic viability of the plastic biorefinery.

Objective: This systematic review and meta-analysis compared the patient-reported outcomes of intra-articular facet joint injections of normal saline and selected active substances to identify a more effective agent for treating subacute and chronic low back pain (LBP). Methods: The PubMed, Embase, Scopus, Web of Science, and CENTRAL databases were searched for randomized controlled trials and observational studies published in English. A research quality assessment was performed using ROB2 and ROBINS-I. A meta-analysis was conducted using a random-effects model, and the mean differences (MD) with 95% confidence intervals (CI) in efficacy outcomes, including pain, numbness, disability, and quality of life, were assessed. Results: Of the 2,467 potential studies, three were included (247 patients). The active substances and normal saline had similar therapeutic effects on pain within 1 h, after 1-1.5 months, and after 3-6 months, with MD and 95% CI of 2.43 and -11.61 to 16.50, -0.63 and -7.97 to 6.72, and 1.90 and -16.03 to 19.83, respectively, as well as the quality of life after 1 and 6 months. Conclusion: The short- and long-term clinical effects of intra-articular facet joint injections of normal saline are comparable to those of other active substances in patients with LBP.

Lung cancer is a prevalent malignancy that impacts individuals of all genders and is often diagnosed late due to delayed symptoms. To catch it early, researchers are developing algorithms to study lung cancer images. One such method uses computer aided detection to classify as benign or malignant from the histopathological images. Standard histopathological images were used from a Lung and Colon Cancer Histopathological Image Dataset (LC25000) which contains two classes of benign and malignant of 5000 each. Images were preprocessed and features extracted using Particle Swarm Optimization (PSO) and Grey Wolf Optimization (GWO). Feature selection methods used are KL Divergence and Invasive Weed Optimization (IWO). Seven different classifiers like SVM, KNN, Random Forest, Decision Tree, Softmax Discriminant, Multilayer Perceptron, and BLDC were used to analyze and classify the images as benign or malignant. Results were compared using standard metrics, and kappa analysis assessed classifier agreement. The Decision Tree Classifier with GWO feature extraction achieved good accuracy of 85.01% without Feature selection and Hyperparameter Tuning approaches. Furthermore, we present a methodology to enhance the accuracy of the classifiers by employing hyperparameter tuning algorithms based on Adam and RAdam. By combining features from GWO and IWO, and using the RAdam algorithm, the Decision Tree classifier achieves the commendable accuracy of 91.57%

Followed by the aspect of respect for rights 20, the social and environmental issue has a score of 19.9, the dialogue issue is 19. In short, the proximity plan indicates that the policies used regarding the issue of generating employment and economic growth (Empresa Mantaro Perú SAC), continue to be the strategic variables in the first instance, but they are far from the social actors (rural communities of Aco, Vico, Cruz Pampa and others) and environmental (Junín environmental dialogue table) and Ombudsman's Office (rights) that are currently closer together. The actor from the Archbishop of Huancayo referred to communication is one of the driving variables of power. The proximity plan shows us that the policies used regarding the issue of generating employment and economic growth (Empresa Mantaro Perú SAC), continue to be the strategic variables in the first instance, but that they are far from the social actors (Rural Communities of Aco , Vico, Cruz Pampa and others) and environmental (Junín Environmental Dialogue Table) and Ombudsman's Office (rights) that are currently closer together. The actor from the Archbishop of Huancayo referred to communication is one of the driving variables of power. The proximity plan shows us that the policies used regarding the issue of generating employment and economic growth (Empresa Mantaro Perú SAC), continue to be the strategic variables in the first instance, but that they are far from the social actors (Rural Communities of Aco , Vico, Cruz Pampa and others) and environmental (Junín Environmental Dialogue Table) and Ombudsman's Office (rights) that are currently closer together. The actor from the Archbishop of Huancayo referred to communication is one of the driving variables of power. but they are far from the social actors (rural communities of Aco, Vico, Cruz Pampa and others) and environmental (Junín Environmental Dialogue Table) and the Ombudsman's Office (rights) that are closer together today. The actor from the Archbishopric of Huancayo referred to communication, is within the driving variables of power. but they are far from the social actors (rural communities of Aco, Vico, Cruz Pampa and others) and environmental (Junín Environmental Dialogue Table) and the Ombudsman's Office (rights) that are currently closer together. The actor of the Archbishopric of Huancayo referred to communication, is within the driving variables of power.

The combination of new-generation information technology and manufacturing technology has resulted in major and profound impact on future development paradigm of manufacturing. It is challenging for existing methods to conduct a multidimensional trend exploration related to machine tool domain, which is the basis of virtually everything in manufacturing. In this paper, we proposed an integrating approach framework combined topic models, bibliometric, trend analysis and patent analysis to mine insightful information about future development from multi-source data related to machine tool, such as papers, grants, patents and news. Specifically, papers and grants provided two different perspectives to explore the current focuses and future trends in machine tool research. Furthermore, the future technology development of machine tool was investigated through patents analysis. Finally, news related to machine tool industry in recent years was analyzed to analyze future machine tool business mode. The integration of the above various analytical methods and the multi-dimensional mining of literatures enabled the analysis of the future development of machine tool domain systematically from multi-perspectives which include research, technology development and industry. The conclusions obtained in this paper is beneficial to different communities of machine tool in terms of determining the research directions for researchers, identifying industry opportunities for corporations and developing reasonable industry policy for policy makers.

This article presents a rigorous approach to the Collatz Conjecture, focusing on fundamental properties of Collatz sequences. We establish key properties of the Collatz function and its inverse, including surjectivity and injectivity. The structure of Collatz sequences is analyzed in depth, proving important results such as the Bounded Subsequence Property and the uniqueness of cycles. Central theorems on the properties of Collatz sequences, including the boundedness of all sequences and the nature of the unique cycle, are presented and proved. These results culminate in a complete resolution of the Collatz Conjecture, demonstrating that all Collatz sequences eventually reach the cycle {1, 4, 2}. We provide a rigorous proof of the conjecture, while emphasizing the need for thorough peer review and verification by the mathematical community given the significance of this long-standing problem.

Finding the key factor and possible "Newton's laws" in financial markets has remained the central issue in this area. However, with the development of information and communication technologies, financial models are becoming more and more realistic but complex which is contradictory to the objective law “Greatest truths are the simplest”. Therefore, this paper attempts to discover the most critical parameter and establishes an evolutionary model which is independent of micro features. In the model, information is the only key factor and stock price is the emergence of the collective behavior. The statistical properties of the model are significantly similar to the real market. It also explains the correlations of stocks within an industry, which provide a new idea for the study of key factors and core structures in the financial market.

An increase in the use of smartphones has laid to the use of the internet and social media platforms. The most commonly used social media platforms are Twitter, Facebook, WhatsApp and Instagram. People are sharing their personal experiences, reviews, feedbacks on the web. The information which is available on the web is unstructured and enormous. Hence, there is a huge scope of research on understanding the sentiment of the data available on the web. Sentiment Analysis (SA) can be carried out on the reviews, feedbacks, discussions available on the web. There has been extensive research carried out on SA in the English language, but data on the web also contains different other languages which should be analyzed. This paper aims to analyze, review and discuss the approaches, algorithms, challenges faced by the researchers while carrying out the SA on Indigenous languages.

Energy efficiency of Data Center (DC) operations heavily relies on IT and cooling systems performance. A reliable and efficient cooling system is necessary to produce a persistent flow of cold air to cool servers that are subjected to constantly increasing computational load due to the advent of IoT- enabled smart systems. Consequently, increased demand for computing power will bring about increased waste heat dissipation in data centers. In order to bring about a DC energy efficiency, it is imperative to explore the thermal characteristics analysis of an IT room (due to waste heat). This work encompasses the employment of an unsupervised machine learning modelling technique for uncovering weaknesses of the DC cooling system based on real DC monitoring thermal data. The findings of the analysis result in the identification of areas for energy efficiency improvement that will feed into DC recommendations. The methodology employed for this research includes statistical analysis of IT room thermal characteristics, and the identification of individual servers that frequently occur in the hotspot zones. A critical analysis has been conducted on available big dataset of ambient air temperature in the hot aisle of ENEA Portici CRESCO6 computing cluster. Clustering techniques have been used for hotspots localization as well as categorization of nodes based on surrounding air temperature ranges. The principles and approaches covered in this work are replicable for energy efficiency evaluation of any DC and thus, foster transferability. This work showcases applicability of best practices and guidelines in the context of a real commercial DC that transcends the set of existing metrics for DC energy efficiency assessment.

The co-circulation of duck hepatitis A virus subtypes 1 (DHAV-1) and 3 (DHAV-3) in ducklings has resulted in significant economic losses. Because ducklings infected with DHAV-1 or DHAV-3 show similar clinical signs and gross lesions, it is important to discriminate these subtypes as early as possible for better clinical management. On the basis of multiple alignments of the 5′-noncoding region sequences of strains DHAV-1 and DHAV-3, universal and type-specific primers were designed and synthesized. Using the primers in a one-tube reverse transcription-PCR (RT-PCR) assay, reference strains of DHAV-1 and DHAV-3 (isolated over a span of 60 years and covering many different countries) were successfully amplified, indicating that the primer sequences were completely conserved. The amplicon sequences results and the sizes of amplicons from reference DHAV-1 and DHAV-3 isolates correlated completely with their genotypes. Moreover, with this one-tube RT-PCR system, the amplicon sizes of liver samples of reference DHAV-1- or DHAV-3-infected birds matched perfectly with their respective genotypes, as determined by virus isolation and neutralization tests. No other RNA viruses of duck origin were detected with the synthesized primers. The sensitivity of viral RNA detection was 10 pg. With this system, 20% genotype 1, 45% genotype 3, and 9% co-infection of the two genotypes were detected in 55 clinical samples. This novel approach could be used for the rapid genotyping DHAV-1 and/or DHAV-3 infection in routine clinical surveillance or epidemiologic screening.

Blood gas analysis is a diagnostic tool to evaluate the partial pressures of gas in blood and acid-base content. The use of blood gas analysis enables to clear understanding the respiratory, circulatory, and metabolic disorders. The arterial blood gas (ABG) explicitly analyzes blood taken from an artery, assessing the patient's partial pressure of oxygen (PaO2), carbon dioxide (PaCO2) pH (acid/base). PaO2 indicates the oxygenation status, and PaCO2 indicates the ventilation status (chronic or acute respiratory failure). PaCO2 is affected by hyperventilation characterized by rapid or deep breathing, and hypoventilation characterized by slow or shallow breathing. The acid-base balance tested by the ABG procedure measures the pH and PaCO2 directly while the use of the Hasselbach equation gives the serum bicarbonate (HCO3) and base deficit or excess. The measured HCO3is based on strong alkali that frees all CO2 in serum, including dissolved CO2, carbamino compounds, and carbonic acid the calculation uses a standard chemistry analysis giving the amount of "total CO2", the difference will amount to around 1.2 mmol/L. Though ABG is frequently ordered in emergency medicine contests for acute conditions it may also be needed in other clinical settings. The ABG analysis shows to be an exceptional diagnostic tool including the group of those diseases known as acid-base diseases (ABDs) which include a great variety of conditions as such severe sepsis, septic shock, hypovolemic shock, diabetic ketoacidosis, renal tubular acidosis, chronic respiratory failure, chronic heart failure, and diverse metabolic diseases.

Hypoxic-ischemic encephalopathy (HIE) secondary to perinatal asphyxia occurs when the brain does not receive enough oxygen and blood. A surrogate marker for ‘intact survival’ is necessary for the successful management of HIE. The severity of HIE can be classified based on clinical presentation, including presence of seizures, using a clinical classification scale called Sarnat staging; however, Sarnat staging is subjective and the score changes over time. Furthermore, seizures are difficult to detect clinically and are associated with a poor prognosis. Therefore, a tool for continuous monitoring on the cot side is necessary, for example, electroencephalogram (EEG) that non-invasively measures the electrical activity of the brain from the scalp. Then, multimodal brain imaging, when combined with functional near-infrared spectroscopy (fNIRS), can capture the neurovascular coupling (NVC) status. In this study, we first tested the feasibility of a low-cost EEG-fNIRS imaging system to differentiate between normal, hypoxic, and ictal states in a perinatal ovine hypoxia model. Here, the objective was to evaluate a portable cot side device and autoregressive (ARX) modelling to capture the perinatal ovine brain states during a simulated HIE injury. So, ARX parameters were tested with a linear classifier using a single differential channel EEG, with varying states of tissue oxygenation detected using fNIRS, to label simulated HIE states in a perinatal ovine hypoxia model. Then, we showed the technical feasibility of the low-cost EEG-fNIRS device and ARX modeling with support vector machine classification for a human HIE case series with and without sepsis. The classifier trained with the ovine hypoxia data labelled ten severe HIE human cases (with and without sepsis) as “hypoxia” group and the four moderate HIE human cases as the “control” group. Furthermore, we showed the feasibility of experimental modal analysis (EMA) based on the ARX model to investigate the NVC dynamics using EEG-fNIRS joint-imaging data that differentiated six severe HIE human cases without sepsis from four severe HIE human cases with sepsis. In conclusion, our study showed the technical feasibility of EEG-fNIRS imaging, ARX modeling of NVC for HIE classification, and EMA that may provide a biomarker to detect sepsis effects on the NVC in HIE.

To investigate the dynamics of land surface temperature (LST) in Afghanistan in the period 2000-2021 and to assess the impact of such factors as soil moisture, precipitation, and vegetation coverage on it, remotely sensed soil moisture data from Land Data Assimilation System (FLDAS), precipitation data from Climate Hazards Group Infra-Red Precipitation with Station (CHIRPS), and NDVI and LST from Moderate Resolution Imaging Spectroradiometer (MODIS) were downloaded and correlations between them were analyzed using the regression method. The result shows that the LST in Afghanistan has a slightly decreasing, but insignificant trend during the study period (R=0.2, p-value=0.25), while vegetation coverage, precipitation, and soil moisture had an increasing trend. It was revealed that soil moisture has the highest impact on LST (R=0.7, p-value=0.0007), and the soil moisture, precipitation, and vegetation coverage explain almost 80% of spring (R2=0.73) and summer (R2=0.76) LST variability in Afghanistan. The LST variability analysis done separately for Afghanistan’s rivers subbasins shows that the LST of the Amu Darya subbasin had an upward trend in the study period, while for the Kabul subbasin the trend was downward.

Background: Newer personalized medicine including targeted therapies such as PARP inhibitors and CDK 4/6 inhibitors have shown to improve survival of breast and gynaecological cancer patients. However, efficacy outcomes may be hampered by treatment discontinuation due to targeted therapy-related adverse drug reactions or resistance. Studies suggest that add-on mistletoe (Viscum album L., VA) improves quality of life and ameliorates cytotoxic side effects of standard oncological therapy in cancer patients. The primary objective of this real-world data study was to determine the safety profile of targeted therapy in combination with add-on Helixor® VA therapy in breast and gynecological cancer patients. Methods: The present study is a real-world data study utilizing demographic and treatment data from the accredited national Network Oncology (NO) registry. The study has received ethics approval. The safety profile of targeted with or without Helixor® VA therapy as well as safety - associated variables were evaluated by univariate and adjusted multivariable regression analyses. Results: All stage breast or gynecological cancer patients (n = 242) were on average 54.5±14.2 years old. One hundred and sixty patients (66.1%) were in the control (CTRL, targeted therapy) and 82 patients (33.9%) in the combinational (COMB, targeted plus Helixor® VA therapy) group. The addition of Helixor® VA did not hamper the safety profile (χ2 = 0.107, p-value = 0.99) of targeted therapy. Furthermore, no adverse events and a trend towards an improved targeted therapy adherence were observed in the COMB group. Conclusions: The present study is the first of its kind showing the applicability of Helixor® VA in combination with targeted therapies. The results indicate that add-on Helixor® VA does not negatively alter the safety profile of targeted therapies in breast and gynaecological cancer patients.

The urban planning transformations modify the morphological shape of the territory changing land uses and permeability of the areas involved in the evolution processes, thus also altering the hydrologic responses to climatic events, namely the urban drainage runoffs that impact on the environmental risk of modern cities. Using the watershed hydrologic concept, in its dynamic evolution, it is possible to consider the morphological layout together with the transformations implemented by the human activities and any different territorial portions could be analyzed in connection with the other areas related by the dynamics of the surface runoff, thus highlighting the reciprocal influences between the different areas. By examining the morphological shapes impacting surface outflows, the hydrological roles of upper-mountain, intermediate-hillside, and lower-valley areas reveal urban and non-urban connections. This elucidates hydromorphic complexities in urban transformations and assesses climate change adaptability. The proposed approach has been applied to the urban district of “Sasso Caveoso”, belonging to the city of Matera and consents to quantitatively synthesize the response of the context analyzed, referring to different scenarios and providing useful decision support tools.

Glioma accounts for 80% of all malignant brain tumors and is the most common adult primary brain tumor. Age is an important factor affecting the development of cancer as somatic mutations accumulate with age. In this study, we aimed to analyze the significance of age-related non-silent somatic mutations in glioma prognosis. Histological tumor grade depends on age at diagnosis in patients with IDH1, TP53, ATRX, and EGFR mutations. The hierarchical clustering of patients was dominantly separated by IDH1 and EGFR mutations. Furthermore, patients with IDH1 mutation were dominantly separated by TP53 and ATRX double mutation and its double wildtype counterpart. Patients with the double mutation showed poorer prognosis than those with the double wild type genotype. In conclusion, among the many somatic mutations, those in IDH1, TP53, ATRX, and EGFR are important for glioma classification based on histological grade. Patients with EGFR mutation had the poorest prognosis, whereas those with only IDH1 mutation showed the best prognosis.

The earlier analytical analysis (part A) of the Susceptible-Infectious-Recovered (SIR) epidemics model for a constant ratio k of infection to recovery rates is extended here to the semi-time case which is particularly appropriate for modeling the temporal evolution of later (than the first) pandemic waves when a greater population fraction from the first wave has been infected. In the semi-time case the SIR model does not describe the quantities in the past; instead they only hold for times later than the initial time t=0 of the newly occurring wave. Simple exact and approximative expressions are derived for the final and maximum values of the infected, susceptible and revovered/removed population fractions as well the daily rate and cumulative number of new infections. It is demonstrated that two types of temporal evolution of the daily rate of new infections j(tau) occur depending on the values of k and the initial value of the infected fraction I(0)=eta: in the decay case for k > 1-2 eta the daily rate monotonically decreases at all positive times from its initial maximum value j(0)=eta (1-eta). Alternatively, in the peak case for k<1-2 eta the daily rate attains a maximum at a finite positive time. By comparing the approximated analytical solutions for j(tau) and J(tau) with the exact ones obtained by numerical integration, it is shown that the analytical approximations are accurate within at most only 2.5 percent. It is found that the initial fraction of infected persons sensitively influences the late time dependence of the epidemics, the maximum daily rate and its peak time. Such dependencies do not exist in the earlier investigated all-time case.

During the 2008 Great Recession, many families with children relied on cash assistance from Temporary Assistance for Needy Families (TANF) program. The present study applied Exploratory Spatial Data Analysis (ESDA) tools to analyze geographically varying spatial clusters of states’ unemployment rates, TANF caseload growth rates, TANF policy choices such as benefit levels and TANF responsiveness rates to the recession. We analyzed 45 contiguous states and Washington D.C. A standardized TANF responsiveness index was developed to compare states’ TANF growth rates relative to their labor market conditions. The western states were found to be very responsive to the recession with ratios greater than one. In contrast, Texas and Arizona, with ratios below 1, were unresponsive to the recession. The presence of strong spatial clusters in unemployment rate and TANF maximum aid were found. In the case of maximum aid, there was a strong presence of Low-Low spatial clusters in Southern States and High-High clusters in Northeastern States. The findings suggest that several neighboring states in the northeast and some in the south had similar levels of financial commitment during the 2008 recessionary as the ones found by earlier research conducted during non-recessionary periods. The findings have implications for future federal actions and for state level collaboration.

In recent years, e-commerce platforms have replaced conventional marketplaces. People are rapidly adopting internet shopping due to the convenience of making purchases from the comfort of their homes. Online review sites allow customers to share their thoughts on products and services. Customers and businesses are increasingly relying on online reviews to assess and improve the quality of products. Existing literature uses Natural language processing (NLP) to analyze customer reviews for different applications. Due to the growing importance of NLP for online customer reviews, this study attempts to provide a taxonomy of NLP applications based on existing literature. This study also examined emerging methods, data sources, and research challenges by reviewing 154 publications from 2013 to 2023 that explore state-of-the-art approaches for diverse applications. Based on existing research, the taxonomy of applications divides literature into five categories: sentiment analysis, review analysis, customer feedback and satisfaction, user profiling, and marketing and reputation management. It is interesting to note that the majority of existing research relies on Amazon user reviews. Additionally, recent research has encouraged the use of advanced techniques like Bidirectional Encoder Representations from Transformers (BERT), Long Short-Term Memory (LSTM), and ensemble classifiers. The rising number of articles published each year indicates increasing interest of researchers and continued growth. This survey additionally addresses open issues, providing future directions in online customer review analysis.

In the second decade of the 21st century, social media changed the nature of communication and cooperation between participants of the culture services market. They became, among other things, an important marketing instrument in the area of contact with the customers of the cultural offer. However, despite their growing importance in various areas of activity of organisations in the cultural sector, the issue of building the cultural institution's brand equity by social media users is relatively seldom raised. Research on the impact of online consumer activity on brand equity is at an early stage of development. Therefore, this article is an attempt to fill the research gap in this area. The article presents the results of a survey conducted in 2018 on a group of 1021 consumers of cultural services, who at the same time regularly used social media. The statistical analysis carried out and the research results obtained prove that the 3C sustainable system developed by the authors, concerning the activity of consumers of cultural services in social media, stimulates the consumer-based brand equity (CBBE). Statistically significant relations have been observed in particular for CBBE components related to the awareness of a cultural institution's brand and for the relationship related to the perception of its quality. The study opens a review of literature on social media and consumer-based brand equity (CBBE). Next, based on the COBRA model (consumer's online brand-related activities), a proposal of the 3C sustainable system, concerning the activity of consumers of cultural services in social media, has been presented. The further part of the article presents research hypotheses, a conceptual model, research methodology as well as results and conclusions. The last part of the article discusses the results obtained and indicates the existing management implications.

Pilots can be one of the factors in many air traffic accidents. When one or both pilots are impaired (e.g. fatigue, drunk), disabled, capable but wrong-headed, don’t have sufficient training, distracted, miscommunicate with the air traffic controller, or follow wrong instructions from the air traffic controller, the risk of accident will increase dramatically. In some of these cases, the risk can be mitigated by using big data and machine learning. The system will collect and analyze large amount of data about the state of the aircraft, e.g., the flight path, the immediate environment around the aircraft, the weather and terrain information, and the pilots’ input to control the aircraft. Additional sensors such as eye tracking devices and biological monitor can also be added to determine the condition of the pilots. If the pilots’ input do not match proper reaction to the situation or the pilots are impaired, the learning machine will first provide an advisory to the pilots. If both pilots are impaired or incapable, a warning will be sent to the flight attendants and air traffic controllers so that they can take appropriate actions. The learning machine will be trained by both accident database and an automatic training system.

Nonparametric assessments of police technical and scale efficiency is challenging because of the stochastic nature of criminal behavior and because of the subjective dependence on multiple decision criteria, which can lead to a more or less efficiency prospect depending on the regulation, necessity, or organizational objective. There is a trade-off between efficiency and effectiveness in many police performance assessments, i.e., efficient departments (producing more clear-ups with a given resource) are crime-specialized or cannot reproduce those good results effectively on more severe or complex occurrences. This study proposes a combined methodology for carrying out efficiency and effectiveness analysis of Police departments. A conditional non-parametric approach, which allows to include crime as an external factor in the analysis, is combined with a non-compensatory ranking based on the PROMETHEE II methodology for the approach illustrated on the multidimensional efficiency and effectiveness comparison of 145 Pernambuco (Brazil)'s police departments. The application results offer compelling perspectives for public administrations concerning the strategic prioritization of units for rewards or interventions.

Evaluating the efficacy of the traceability systems (TS) plays an important role not only for planning system implementation before development, but also for analyzing system performance once the system is in use. In the present work, we evaluate the traceability granularity using a comprehensive and quantifiable model and try find its influencing factors via an empirical analysis with 80 vegetable companies in Tianjin city, China. Granularity indicators were collected mostly by the TS platform to ensure the objectivity of the data, and the granularity score was evaluated by using a TS granularity model. The results show a clear imbalance in the distribution of companies as a function of score. The number of companies (21) scoring in the range [50,60] exceeded the number in the other score ranges. Furthermore, the influencing factors on traceability granularity were analyzed by using a rough set method based on nine factors pre-selected by using a published method. The results show that the factor “number of TS operation staff” is deleted because it is unimportant. The remaining factors rank according to importance as follows: Expected revenue &gt; Supply chain (SC) integration degree &gt; Cognition of TS &gt; Certification system &gt; Company sales &gt; Informationization management level &gt; System maintenance investment &gt; Manager education level. Based on these results, the corresponding implications are given with the goal of (i) establishing the market mechanism of high price with high quality, (ii) increasing government investment for constructing the TS, and (iii) enhancing the organization of SC companies.

Black barley seeds are a health-beneficial diet resource because of their special chemical composition and antioxidant properties. The black lemma and pericarp (BLP) locus was mapped in a genetic interval of 0.807 Mb on chromosome 1H, but its genetic basis remains unknown. In this study, targeted metabolomics and conjunctive analyses of BSA-seq and BSR-seq were used to identify candidate genes of BLP and the precursors of black pigments. The results revealed that five differentially expressed genes identified on the 1H chromosome were candidate genes of the BLP locus, and 17 differential metabolites, including the precursor and repeating unit of allomelanin, were accumulated in the grain-filling stage of black barley. Phenol nitrogen-free precursors such as catechol (protocatechuic aldehyde) or catecholic acids (caffeic, protocatechuic, and gallic acids) may promote black pigmentation. BLP can manipulate the accumulation of benzoic acid derivatives (salicylic acid, 2,4-dihydroxybenzoic acid, gallic acid, gentisic acid, protocatechuic acid, syringic acid, vanillic acid, protocatechuic aldehyde, and syringaldehyde) through the shikimate/chorismite pathway other than the phenylalanine pathway and alter the metabolism of the phenylpropanoid-monolignol branch. Collectively, it is reasonable to infer that black pigmentation in barley is due to allomelanin biosynthesis in lemma and pericarp, and BLP regulates melanogenesis by manipulating the biosynthesis of its precursors.

The city administration of China planned numerous metro projects and more metros can hardly avoid undercrossing a bridge. While metro shield construction when undercrossing a bridge (MSCUB) is frequently located in complicated natural and social context, which made the construction process more susceptible to safety accidents. Therefore, it is crucial to look into safety risk of MSCUB. The paper identified the safety risk factors during SSCUR by using literature review and experts’ evaluation, proposed a novel safety risk assessment model by integrating CFA and FER, and then selected a project case to test the validity of the suggested model. Research results show that (a) a safety risk factors list of MSCUB was identified, including 4 first-level safety risks and 37 second-level safety risk factors; (b) the proposed safety risk assessment model can be used to measure the risk values of the overall worksite safety risk, the first-level safety risks and the safety risk factors of MSCUB; (c) environment-type safety risk and personnel-type safety risk have higher risk values when shield construction undercrossing a bridge; (d) when compared to worker-type safety risk, manager-type safety risk is the higher risk value. The research can enrich the theoretic knowledge of MSCUB safety risk assessment and provide references to safety managers for conducting scientific and effective safety management on the construction site when subway undercrossing a river.

In an epoch characterized by the swift pace of digitalization and urbanization, the essence of community well-being hinges on the efficacy of urban management. As cities burgeon and transform, the need for astute strategies to navigate the complexities of urban life becomes in-creasingly paramount. This study employs time series analysis to scrutinize citizen interactions with the coordinate-based problem mapping platform in the Municipality of Patras in Greece. The research explores the temporal dynamics of reported urban issues, with a specific focus on identifying recurring patterns through the lens of seasonality. The analysis, employing the sea-sonal decomposition technique, dissects time series data to expose trends in reported issues and areas of the city that might be obscured in raw big data. It accentuates a distinct seasonal pattern, with concentrations peaking during the summer months. The study extends its approach to forecasting, providing insights into the anticipated evolution of urban issues over time. Projec-tions for the coming years show a consistent upward trend in both overall city issues and those reported in specific areas, with distinct seasonal variations. This comprehensive exploration of time series analysis and seasonality provides valuable insights for city stakeholders, enabling informed decision-making and predictions regarding future urban challenges.

The paper describes the use of topological indices in conjunction with high cholesterol drugs, specifically Fibrates, to predict their physicochemical properties and biological activities. Fibrates are known to lower high triglycerides, increase HDL cholesterol, and reduce the small dense fraction of LDL cholesterol. The study uses a quantitative structural-property relationships (QSPR) approach, which involves analyzing the relationships between physicochemical properties and topological indices using curvilinear regression. The QSPR model predicts the physicochemical properties of the drugs based on degrees and distances determined from topological indices. The study also conducted (DFT) calculations at the B3LYP/6-31G(d,p) level on the four investigated derivatives to gain insights into their optimized geometries, DOS plots, HOMO and LUMO orbital energies, and distribution. The theoretical results presented in the study suggest that the use of topological indices in QSPR models could provide a powerful tool for predicting the physicochemical properties and biological activities of molecules, including drugs. These findings could lead to the development of new cholesterol-lowering drugs with desirable properties.

The Chinese honeybee (Apis cerana cerana) sacbrood virus (CSBV) causes death of larvae and colony collapse, and could damage the beekeeping industry in China. We sequenced complete genomes of CSBV strains derived from the Maerkang area, Wenjiang area, and Wanyuan area of Sichuan province of China. The genome length of CSBV strains from Sichuan was 8863bp, and it contained one complete Open Reading Frame of a gene with 8544 bp that encoded a protein with 2848 amino acids. The (G+C) % and (A+T) % composition ranged from 40.6 to 40.7 and 59.3 to 59.4, respectively. A phylogenetic tree was constructed using the three CSBV strains and previously reported SBV and CSBV sequences from other regions. We found that viral strains clustered based on their region of origin and host species. The genetic sequences of the CSBV strain from Maerkang were 98.7% and 99.6% similar to CSBV strains from Wanyuan and Wenjiang, respectively. In addition, CSBV from Maerkang had 88.4%-95.2% sequence similarity to previously published genomes of CSBV or SBV from other areas. The VP1 gene sequenced in our study had a 43 bp deletion compared to VP1 sequences of CSBV from other regions in Asia. We detected 10 antigenic determinants on the VP1 protein of CSBV form Aba. Our study provides new insight into the diversity of CSBV strains in China and may help with identifying methods to prevent infection of honeybee colonies.

This work explores five falling film evaporator (FFE) simulation approaches combined with energy consumption minimization strategies, namely Mechanical Vapor Recompression and Thermal Vapor Recompression (MVR and TVR respectively). Global system analysis and advanced dynamic optimization strategies are then investigated to minimize steam consumption, the cost of steam, the total annualized cost and maximizing product yield. The results indicate that a higher TVR discharge pressure, or MVR compression ratios, along with higher feed temperatures enhance evaporation with but increase operational costs. The most economic option includes three evaporator effects with TVR for achieving 50% product dry mass content. However, for a 35% dry mass content, MVR becomes cost-effective with an 11% reduction in unit electricity prices or a simultaneous 7% drop in electricity prices and a 5% increase in gas-based steam prices. Furthermore, switching from milk powder production to milk concentrates, an annual cost reduction ranging from 10.75 to 44% is achieved. Also, a forecasted 20% (or more) reduction of biomass-based steam cost can lead to lower annual expenditure comparing with the nominal NG-based steam Case. Regarding the total annualized cost, for a new plant design, optimization strategies lead to a 9 - 45% reduction in the total cost depending on the Case under consideration.

In this study, we have focused on studying the heterogenous degradation kinetics of regarding the decomposition of emergency contraceptive agent levonorgestrel (LNG), which is a second-generation synthetic progestogen that is the active component of the racemic mixture of norgestrel. The degradation processes of the active pharmaceutical ingredient (API) were compared with the ones obtained from model system containing the API along with the excipients that are found in a commercialized pharmaceutical formulation in a mass ratio of 1:1 (LNGMIX), in order to observe if the excipients have a stabilizing or destabilizing effect for the degradation of this progestogen. To achieve this, the following investigational methods were used: FTIR (Fourier transform infrared) spectroscopy and thermal analysis (TG/DTG/DSC analysis). For the kinetic analysis the data obtained from two main decomposition processes observed on the DTG curves were used and processed with a preliminary method, namely ASTM E698 and two isoconversional methods: Friedman and Flynn-Wall-Ozawa. The isoconversional study revealed that the decomposition mechanism of both LNG and LNGMIX are complex, and the excipients have a stabilizing effect over decomposition of API in tablet.

Gas Path Analysis and matching turbine engine models to experimental data are inverse problems of mathematical modelling which are characterized by parametric uncertainty. This results from the fact that the number of measured parameters is significantly lower than the number of components’ performance parameters needed to describe the real engine. In these conditions, even small measurement errors can result in a high variation of results, and obtained efficiency, loss factors etc. can appear out of the physical range. The current methods of engine model identification have developed considerably to provide stable, precise and physically adequate solutions. Presented in this work is an estimation method of engine components’ parameters based on multi-criteria identification which provides stable estimations of parameters and their confidence intervals with the known measurement errors. A priori information about the engine, its parameters and performance is used directly in the regularised identification procedure. The mathematical basis for this approach is the fuzzy sets theory. Forming objective functions and scalar convolutions synthesis of these functions is used to estimate gas-path components’ parameters. A comparison of the proposed approach with traditional methods showed that its main advantage is high stability of estimation in the parametric uncertainty conditions. Regularization reduces scattering, excludes incorrect solutions which do not correspond to a priori assumptions, and also helps to implement the Gas Path Analysis at the limited number of measured parameters. The method can be used for matching thermodynamic models to experimental data, Gas Path Analysis and also adapting dynamic models for the needs of the engine control system.

The proportion of area under various crops at a given point in time, known as a cropping pattern, plays an essential role in determining the level of agricultural production. In this study, cropping patterns of three sub-counties in Murang’a County, a typical African smallholder farming area in Kenya, were mapped. Specifically, we compared the performance of eight classification scenarios for mapping cropping patterns; namely using (i) only Sentinel-2 reflectance bands (S2), (ii) S2 and S2 derived vegetation indices (VIs); (iii) S2 and S2 vegetation phenology (VP); (iv) S2 and Sentinel-1 radar backscatter data (S1); (v) S2, VIs, and S1; (vi) S2, VP, and S1; (vii) S2, VIs and VP, and (viii) S2, VIs, VP and S1. Reference data of the dominant cropping patterns and non-croplands were collected. The guided regularized random forest (GRRF) algorithm was used to select the optimum variables and to perform the respective classification for each scenario. The most accurate result of the overall accuracy of 93.16% was attained from the scenario (viii) S2, VIs, VP, and S1. The McNemar’s test of significance did not show significant differences (p≤0.05) among the tested scenarios. Our study demonstrated the strength of GRRF and the synergetic advantage of S2 and S1 derivatives to map cropping patterns in a heterogeneous landscape where high resolution imagery are inaccessible. Our cropping pattern mapping approach can be used in other sites of relatively similar agro-ecological conditions.