The article presents the results of research on a new method of spatial analysis of walls and buildings moisture. Due to the fact that destructive methods are not suitable for historical buildings of great architectural significance, a non-destructive method based on electrical tomography has been adopted. A hybrid tomograph with special sensors was developed for the measurements. This device enables the acquisition of data, which are then reconstructed by appropriately developed methods enabling spatial analysis of wet buildings. Special electrodes that ensure good contact with the surface of porous building materials such as bricks and cement were introduced. During the research, a group of algorithms enabling supervised machine learning was analyzed. They have been used in the process of converting input electrical values into conductance depicted by the output image pixels. The conductance values of individual pixels of the output vector made it possible to obtain images of the interior of building walls, both flat intersections (2D) and spatial (3D) images. The presented group of algorithms has a high application value. The main advantages of the new methods are: high accuracy of imaging, low costs, high processing speed, ease of application to walls of various thickness and irregular surface. By comparing the results of tomographic reconstructions, the most efficient algorithms were identified.

Reactivation of pre-existing weaknesses in the upper crust can be documented using surface features, and has occurred throughout time and space, particularly in regions where the basement material dates from the Precambrian and has undergone successive deformation events. This study aims to use surface features such as fracture patterns to document evidence of such reactivation in the Paleozoic and Cenozoic of Nebraska and Kansas (units separated by an unconformity in the study area). The most prominent basement features in southeast Nebraska and northeast Kansas are oriented NE-SW, likely related to the midcontinent rift, and oriented NW-SE, likely related to fabrics from the Central Plains Orogen. These features are well defined in the potential fields data. Fracture patterns in the study area show an E-W oriented trend, as well as clearly discernable NE-SW and subsidiary N-S and NW-SE trends. The E-W trend is interpreted to be related to far-field stresses from Laramide and Ancestral Rocky Mountain orogenic events, whilst the NE-SW trend is interpreted to be related to subtle reactivation on the Mid-continent rift and related faults, observed in basement data. These movements produced stresses of sufficient magnitude to produce extensional fractures in the overlying rock units, but not sufficient to generate shear. Similarly, the ~N-S and NW-SE fracture trends are taken as evidence of subtle reactivation on the Nemaha Uplift and Central Plains Orogen systems, generating fractures but not shear movement. This contribution therefore provides a convincing case-study of the value of fracture orientations (that is, surface morphodynamics) in discerning buried tectonic trends and subtle reactivation thereon.

This study identified, analysed, and prioritised significant factors for standardising the Korean smart city project evaluation system. We analysed the efficiency and productivity of companies currently providing smart city services to consider both policy and practical aspects. The prioritisation of smart city planning reflects the latest trends in South Korea, where urban planning is moving towards smart city planning. Furthermore, the capacity building of public-private/private-private partnerships indicate the importance of business scalability. This indicates that smart city services are only stabilised when the private sector is involved and leads the project, rather than focusing on public development. The feasibility of building intelligent facilities indicates that smart city projects should be implemented after securing cost-benefit feasibility. The results were used as the basis for building an evaluation system, showing that in smart city convergence alliances, small- and medium-sized enterprises achieved the highest efficiency by reducing inputs to 81% and 86%, under the assumptions of constant and variable returns to scales, respectively. As the operational aspect is more problematic than the technical aspect, policy alternatives are necessary for smooth business progress, including increased flexibility of laws and institutions and the activation of policies that temporarily relieve regulations to demonstrate smart city projects.

Infectious bursal disease (IBD) is a viral poultry disease known worldwide for impacting the economy and food security. The disease is endemic in Nigeria, with reported outbreaks in vaccinated poultry flocks. To gain insight into the dynamics of infectious bursal disease virus (IBDV) evolution in Nigeria, near-complete genomes of four IBDVs were evaluated. Amino acid sequences in the hypervariable region of the VP2 revealed conserved markers (222A, 242I, 256I, 294I and 299S), associated with very virulent (vv) IBDV, including the serine-rich heptapeptide motif (SWSASGS). Based on the newly proposed classification for segments A and B, the IBDVs clustered in the A3B5 group (where A3 are IBDVs with vvIBDV-like segment A and B5 are from non-vvIBDV-like segment B) forming a monophyletic subcluster. Unique amino acid mutations with yet-to-be-determined biological functions have been observed in both segments. Amino acid sequences of the Nigerian IBDVs showed that they are reassortant viruses. Circulation of reassortant IBDVs may be responsible for the vaccination failures observed in the Nigerian poultry population. Close monitoring of changes in the IBDV genome is recommended to nip deleterious changes in the bud, through the identification and introduction of the most appropriate vaccine candidates and advocacy/extension programs for properly implementing disease control.

High-methoxyl apple pectin (AP) derived from apple was employed as the main ingredient facilitating rheological modification features for developing dysphagia-friendly fluidized alimentary matrices. Xanthan gum (XG) was also included as a composite counterpart to modify the viscoelastic properties of the thickened system under different thermal processes. The results indicate that AP is extremely sensitive to thermal processing, and the viscosity is greatly depleted under a neutral pH level. Moreover, the inclusion of calcium ions echoed a modification effect on the rheological properties of AP, and both the elastic property and viscosity value are promoted after thermal processing. The modification effect of viscoelastic properties (Gʹ and Gʹʹ) is observed while XG is incorporated into the composite formula. By promoting the XG ratio from 7: 3 to 6: 4 (AP: XG), it triggers the rheological transformation from a liquid-like form to a solid-like state, and the viscosity value shows that the AP-XG composite system exhibits better thermal stability after thermal processing. The ambient modifiers of pH (pH < 4) and calcium chloride concentration (7.5%) with an optimal AP-XG ratio of 7:3 lead to weak-gel-like behavior (Gʹʹ < Gʹ), helping to maintain the texture properties of dysphagia-friendly features similar to those prior to the thermal processing.

LoRa and its upper layers definition LoRaWAN is one of the most promising LPWAN technologies for implementing the Internet of Things (IoT). Although being a popular technology, several works in the literature have revealed various weaknesses regarding the security of LoRaWAN v1.0 (the official 1st draft). By using all these recommendations from the academia and industry, the LoRa-Alliance has worked on the v1.0 to develop an enhanced version and provide more secure and trustable architecture. The result of these efforts ended-up with LoRaWAN v1.1, which was released on Oct 11, 2017. This manuscript aims at demystifying the security aspects and provide a comprehensive Security Risk Analysis related to latest version of LoRaWAN. Besides, it provides several remedies to the recognized vulnerabilities. To the best of authors’ knowledge, this work is one of its first kind by providing a detailed security analysis related to latest version of LoRaWAN. According to our analysis, end-device physical capture, rogue gateway and replay attacks are found to be threating for safety operation of the network. Eventually, v1.1 of LoRaWAN is found to be less vulnerable to attacks compared to v1.0, yet possesses several security implications that need to be addressed and fixed for the upcoming releases.

The environmental Kuznets curve (EKC) hypothesis posits an inverted U-shaped relationship between economic growth and environmental degradation. However, there is no consensus regarding the EKC hypothesis among countries and regions of different income groups. In this study, we analyze the EKC hypothesis for 158 countries and 44 regions from 1990 to 2020, categorizing them into different income groups based on the World Bank's income classification (low, lower-middle, upper-middle, and high-income countries). Our findings reveal mixed patterns in the EKC across different income levels, highlighting the heterogeneous relationship between economic growth and carbon emissions and showing differentiated patterns among different income levels. While a rise in income for high-income countries should be reflected in a shift toward fewer carbon emissions, for lower-income countries, growth is still associated with rising emissions. This underscores the urgent need for policy interventions that decouple economic development from environmental degradation. A balanced approach to economic growth, which prioritizes carbon neutrality across all stages of development, by tailoring environmental and economic strategies to address CO2 emissions effectively, should be adopted, recognizing the different developmental stages and income levels of countries and regions.

This study explored the incidence of metaphorical virtual classrooms and interactive learning objects in the interaction of students in online mode. The main objective was to analyze how these digital tools, driven by a set of strategies to promote their use, affect the interaction of students in the virtual classroom system and their derived effects. To this end, the latest version of Moodle was implemented in conjunction with gamification plugins and interactive tools in the higher education institution used as a case study. The methodology consisted of data collection through ordinal instruments applied to the teachers and student performance metrics gathered using a plugin developed to extract accurate metrics of each student's usage and performance through direct queries to the Moodle database and its processing through a neural network. This facilitated the collection of standardized data on the actual metrics of each virtual classroom at the end of the teaching of each subject from both the previous LMS and the newly implemented one. This data was then analyzed using advanced statistical techniques, including Mahalanobis distances, confirmatory factor analysis, and the Wilcoxon signed-rank test. These methods provided a compelling comparison between the old and new systems, revealing significant improvements in the metrics and factors evaluated. The results showed a significant improvement in teachers' perceptions of the usability of the virtual classroom system and an increase in students' academic performance, interaction, progress, and time spent learning in virtual contexts. These results provide solid empirical evidence of the added value of these educational tools as effective strategies for improving student interaction, performance, and motivation in online education.

Chromosome analysis (CA) and chromosomal microarray analysis (CMA) have been successfully used to diagnose genetic disorders. However, many conditions remain undiagnosed due to limitations in resolution (CA) and detection of only unbalanced events (CMA). Optical genome mapping (OGM) has the potential to address these limitations by capturing both structural variants (SVs) resulting in copy number changes and balanced rearrangements with high resolution. In this study, we investigated OGM’s concordance using 87 SVs previously identified by CA, CMA, or Southern blot. Overall, OGM was 98% concordant with only three discordant cases: (1) uncalled translocation with one breakpoint in a centromere; (2) uncalled duplication with breakpoints in the pseudoautosomal region 1; and (3) uncalled mosaic triplication originating from a marker chromosome. OGM provided diagnosis for three previously unsolved cases: (1) disruption of the SON gene due to a balanced reciprocal translocation; (2) disruption of NBEA gene due to an inverted insertion; (3) disruption of the TSC2 gene due to a mosaic deletion. We show that OGM is a valid method for detection of many types of SVs in a single assay and is highly concordant with legacy cytogenomic methods; however, it has limited SV detection capabilities in centromeric and pseudoautosomal regions.

In this study, 12 organic waste materials were subjected to TG/DTG thermogravimetric analysis and DSC calorimetric analysis. These analyses provided basic information about thermochemical transformations and degradation rates during organic waste pyrolysis. Waste materials were chosen to cover the most abundant waste that can be found in the municipal solid waste stream. Based on TG results, kinetic parameters according to Coats–Redfern method were determined. The pyrolysis activation energy was the highest for cotton 134.5 kJ∙(mol∙K)-1 and the lowest for leather 25.2 kJ∙(mol∙K)-1. The DSC analysis showed number of transformations occurred during pyrolysis for each material. For each transformation, normalized energy required for transformation, or released during transformation were determined and then summarized to present energy balance. The study found that only for three waste materials: PET (-220.1 J⸱g-1), leather (-66.9 J⸱g-1), and chicken meat (-130.3 J⸱g-1) energy balance was negative, while the highest positive balance value was found for potato peelings (367.8 J⸱g-1). The obtained results may be applied for the modelling of energy and mass balance of municipal solid waste pyrolysis.

In recent years, numerous topologies of single phase and three phase Field Excited Flux-Switching Machine (FEFSM) have been developed for several applications. Comparative study of three types of single-phase low-priced Field Excited Flux-Switching Machine (FEFSM) is presented in this paper. Both the conventional 8S/4P sub-part rotor design and 6S/3P salient rotor design have an overlapped winding arrangements between armature coil and field excitation coil that depicts high copper losses as well as results in increased size of motor. Additionally, FEFSM with salient structure of the rotor have high flux strength in the stator-core that has much impact on high iron losses. Copper consumption and iron loss being a crucial proportion in total machine losses. Therefore a novel topology of single phase modular rotor field excited FSM with 8S/6P configuration is proposed, which enable non-overlap arrangement between armature coil and FEC winding that facilitates devaluation in the copper losses. The proposed modular rotor design acquires reduced iron losses as well as reduced active rotor mass comparatively to conventional rotor design. It is very persuasive to analyze the best range of speed for these rotors to avoid cracks and deformation, the maximum tensile strength (can be measured with principal stress in research) of the rotor analysis is conducted using JMAG. A deterministic optimization technique is used to enhance the performance of 8S/6P modular rotor design. The electromagnetic performance of conventional sub-part rotor design, F1-A3-3P design and proposed novel-modular rotor design are analyzed by 3D-Finite Element Analysis (3D-FEA), includes flux linkage, flux distribution, flux strength, back-EMF, cogging torque, torque characteristics, iron losses and efficiency.

This study examines the nexus between oil prices and inflation in G20 economies, addressing critical gaps by adopting a comparative approach across three pivotal oil price downturns in 2008, 2014, and 2020 (COVID-19). The study utilized monthly time series data from January 2000 to December 2023 and the Bayesian Structural Time Series (BSTS) approach for causal impact analysis. The study found that during the global financial crisis (December 2007 to June 2014), advanced economies like Australia and the UK displayed varying degrees of negative absolute causal impact, aligning with the deflationary impact of falling oil prices. In contrast, emerging economies faced significant negative causal impacts. From June 2014 to January 2020, diverse inflation impacts were observed across G20 economies after a significant oil price decline. Advanced economies like Australia and emerging economies like Brazil experienced negative impacts, while others showed negligible effects. In the subsequent period from January 2020 to December 2023, amid the COVID-19 pandemic and substantial oil price decline, G20 countries exhibited varied inflation outcomes. Positive absolute effects indicated a notable rise in inflation with China standing out with a substantial negative impact. The wavelet coherence analyses also showed an asymmetrical impact of oil prices on inflation. The findings suggest that policymakers should adopt proactive and adaptive policy frameworks, considering the asymmetric responses of G20 economies to oil price dynamics.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

A comprehensive lipid profile was analyzed in patients with non-small cell lung cancer (NSCLC) using nanoflow ultrahigh-performance liquid chromatography-electrospray ionization-tandem mass spectrometry. The study investigated 297, 202, and 166 lipids in saliva, plasma, and fecal samples, respectively, comparing NSCLC patients to healthy controls. Lipids with significant changes (>2-fold, p<0.05) were further analyzed in each sample type. Both saliva and plasma exhibited similar lipid alteration patterns in NSCLC, but saliva showed more pronounced changes and fecal lipids had weak correlation with those of saliva and plasma. Total triglycerides (TGs) increased (>2–3 folds) in plasma and saliva but decreased in fecal samples. Three specific TGs (50:2, 52:5, and 54:6) were significantly increased in NSCLC across all sample types. A common ceramide species (d18:1/24:0) decreased in both plasma and saliva but increased in fecal samples. Additionally, phosphatidylinositol 38:4 decreased by approximately 2-fold in plasma and saliva. Phosphatidylserine 36:1 was selectively detected in saliva and showed a subsequent decrease, making it a potential biomarker for predicting lung cancer. The study identifies 27 salivary, 10 plasma, and 16 fecal lipids as candidate markers for NSCLC by statistical evaluations. Moreover, it highlights the potential of saliva in understanding changes in lipid metabolism associated with NSCLC.

This article is devoted to a bibliometric analysis of IEEE Energy Internet and Energy Systems Integration Conference proceedings posted in IEEE Xplore in 2017-2021. The main objective of the study was to identify the actual research issues on the Energy Internet topic. Author Keywords, INSPEC Controlled Terms, and terms compiled from n-grams derived from conference papers title and abstract texts were used to describe the actual issues. The terms were clustered using VOSviewer, and the terms included in each cluster were treated as a description of the actual issues. Brief descriptions of several publications relevant to the issue in question were given for task detail. The actual issue, which in my opinion deserves further, more detailed analysis, is proposed.

The rapid penetration of social media has been redefining every facet of the old marketing and customer engagement tactics, not only for the low-end and mass products but also for luxury brands. In this context, brands are dealing with the challenge of keeping the balance between using mass marketing strategies concurrent with accentuating the exclusivity of their offerings. Social media can be considered a boon if brands employ them to reach the right audience and use the right platform by incorporating the right content. In this work, we propose a sector-specific, integrated, and holistic investigation of the social media strategies of luxury brands, together with the impact they generate in terms of the engagement level of the users as an indicator of their success. We provide empirical validation of the method in the sector of luxury fashion brands in the Italian market, providing qualitative and quantitative analysis of the content shared on social media, considering the type, timing, and modality of the sharing. We evaluate consumer-brand engagement in different contexts, including important live events in the field.

Tick-borne encephalitis virus (TBEV) is a RNA-containing enveloped virus, a member of the Flaviviridae family. Here we describe a detailed analysis of the size and structure of inactivated TBEV (the Sofyin-Chumakov TBEV strain, used in vaccines). Four analytical methods were used to analyze individual TBEV particles—negative staining TEM, cryo-EM, AFM, and NTA. All methods confirmed that the particles were monodisperse, and their mean size was ~50 nm. Cryo-EM data were used to obtain a 3D electron density model of the virus with clearly distinguishable E-proteins. STEM-EELS analysis detected phosphorous in the particles, which was interpreted as the RNA signal. Altogether, the described analytical procedures can be valuable for the further analysis of vaccine inactivated virus samples.

One notable features of the SARS-CoV-2 genome is that the spike protein of SARS-CoV-2 has a functional polybasic (furin) cleavage site (RRAR) at the S1–S2 boundary through the insertion of 12 nucleotides encoding PRRA. To date, the furin cleavage site (FCS) remains an experimentally uncharted territory both structurally and functionally. For instance, whether or not FCS is actually cleaved, before or after viral cell entry or exit, still remains to be experimentally investigated. With currently available structural data, this article presents a computational structural characterization of the FCS inserted into SARS-CoV-2 spike glycoprotein, and puts forward a set of structural hypothesis against the hypothesis of SARS-CoV-2 from purposeful manipulation: (1), the inserted FCS does not alter, neither stabilize nor de-stabilize, the overall structure of SARS-CoV-2 spike glycoprotein; (2), the net structural consequence of FCS is the insertion of a furin cleavage site into SARS-CoV-2 spike glycoprotein, whose S1 and S2 subunits will still be bonded together even if the FCS is actually cleaved by furin protease.

The novel coronavirus SARS-CoV2 (CoV2) emerged in December 2019. This virus has 88% genomic similarity with SARS-CoV (CoV), and both viruses largely depend on their main protease (M^pro) to regulate infection. M^pro thus represents an attractive target for anti-SARS drug design. The CoV and CoV2 M^pro are 97% identical at the sequence level, with 12 variable residues, and their X-ray structures appear similar. We thus structurally analysed how these variable residues affect the intra-molecular interactions between key residues in the CoV2 M^pro active-site. Compared to CoV M^pro, the 12 divergent residues in CoV2 M^pro exhibit modified intra-molecular interaction networks that ultimately restructure the molecular micro-environment. These altered networks also indirectly affect the networks of other active-site residues at the entrance (T26, M49 and Q192) and near the catalytic region (F140, H163, H164, M165 and H172) of the M^pro. This suggest CoV2 indirectly (via neighbours) reshape key molecular networks around the M^pro active-site. It seems that the CoV2 M^pro deceives us with its apparent structurally identical to the CoV M^pro while this viral system accumulates mass mutations (12 variable residues) at key positions. Some of these identified CoV2 M^pro networks at the active-site might guide design of efficient CoV2 M^pro inhibitors.

Recently, volatile organic compounds (VOCs) have been shown to act as precursors of secondary organic particles that react with ultraviolet rays in the atmosphere and contribute to photochemical smog, global warming, odor, and human health risks, highlighting the importance of VOC management. In this study, we measured VOC concentrations in various contexts including industrial and residential areas of Bucheon, Korea, through mobile laboratory and proton-transfer-reaction time-of-flight mass spectrometry methods to determine winter VOC concentrations, visualized the data based on spatial information, and used the results to develop an air quality management plan. For this purpose, global information system (GIS)-based air quality data and various environmental variables were comprehensively reviewed to assess spatial and temporal concentrations in three dimensions rather than in tables and graphs. Among VOCs, the levels of toluene, methanol, and n+i-butene were relatively high, with average concentrations of 48.3 ± 67.2, 34.4 ± 102.7, and 32.6 ± 57.7 ppb, respectively, at the end of the working day. The highest concentrations occurred near the Ojeong Industrial Complex. Mobile pollution sources are also a major driver of VOCs, highlighting the necessity of comprehensively reviewing traffic variables such as road level, estimated traffic volume, and average speed when identifying hotspots of air pollution. GIS-based visualization analysis techniques will improve the efficiency of air quality management.

Ehlers–Danlos syndromes (EDS) are a heterogeneous group of heritable connective tissue disorders (HCTDs) characterized by joint hypermobility, skin hyperextensibility, and tissue fragility. Among the different types, the hypermobile EDS (hEDS) is the most frequent, and includes generalized joint hypermobility as the major diagnostic criterion. Joint hypermobility in hEDS is often associated with pain that not always allow the use of effective pain-reducing treatments. Patients with hEDS always talk about pain using a lot of descriptions. Eighty-nine patients with diagnosis of hEDS were recruited and evaluated. They were asked to write down what grief was to them. The texts were analyzed through LIWC. Correlational analyses were conducted between pain perception and language. A comparison of high/low pain perception and quality of metaphors was carried out. The results showed, depending on the level of pain perception, different language quality is evidenced. The greater the pain the lesser the positive effects and the greater the negative effects and dehumanizing metaphors. Moreover, greater pain seems to be related to a verbal experience of greater isolation and less self-care. In conclusion, the use of metaphors is a useful tool for exploring illness experience and may help clinicians in the rehabilitation program.

A phenomenological constitutive model is developed to describe the uniaxial transformation ratcheting behaviors of super–elastic shape memory alloy (SMA) by employing a cosine–type phase transformation equation with the initial martensite evolution coefficient that can capture the feature of the predictive residual martensite accumulation evolution and the nonlinear hysteresis loop on a finite element (FE) analysis framework. The effect of the applied loading level on transformation ratcheting are considered in the proposed model. The evolutions of transformation ratcheting and transformation stresses are constructed as the function of the accumulated residual martensite volume fraction. The FE implementation of the proposed model is carried out for the numerical analysis of transformation ratcheting of the SMA bar element. The integration algorithm and the expression of consistent tangent modulus are deduced in a new form for the forward and reverse transformation. The numerical results are compared with those of existing model and the experimental results to show the validity of the proposed model and its FE implementation in transformation ratcheting. Finally, a FE modeling is established for a repeated preload analysis of SMA bolted joint

We analyze the question of GDP Growth-GDPG rate in the context of Environmental, Social and Governance-ESG framework. We use World Bank data for 193 countries in the period 2011-2020 using different econometric techniques i.e., Panel Data with Fixed Effects, Panel Data with Random Effects, Pooled Ordinary Least Squares-OLS. We found that GDPG rate is positively associated, among others, to “Government Effectiveness” and “Prevalence of Undernourishment” and negatively associated among others to “Unemployment” and “Research and Development Expenditure”. Furthermore, we have applied the k-Means algorithm optimized with the Elbow method and we found the presence of four clusters in the sense of GDPG rate. Finally, we confront eight machine learning algorithms to predict the value of GDPG rate and we found that the Polynomial Regression is the best predictor. The Polynomial Regression predicts an increase of GDPG rate equal to 2.88% on average for the analysed countries.

As we know, the economy of science is to achieve optimal gains using scarce resources. Similarly, a problem where economies of the world are trying to resolve it is the issue of how to achieve an optimal economic contribution from limited tourism resources. According to the fact that global studies and statistics indicate that good governance is considered as the most important factor in developing countries and is considered as a strong governance of the development and as Information and Communication Technology (ICT) is effective in the interactions and economic and social exchanges of any society, it is the link between the tourism industry and the technology under the form of a robust tool and utilitarian in the tourism process called E-tourism can play a significant role. Therefore, the aim of this study was to investigate the effect of network Readiness Index and good governance on income from tourism industry. In this study, data and information about 14 selected countries were collected from Southwest Asia in the annual period of 2016-2011 in the form of panel data and the proposed model was used and estimated by the generalized torques system method. The estimated results of the model indicate that both hypotheses have a positive and significant impact on the amount of Network Readiness Index in the income of tourism industry, as well as the positive and significant effect of the index the amount of income from the tourism industry is confirmed, and their impact has been positive and significant, as well as exchange rate variables, revenue and commercial openness, also have a positive and significant effect on revenues of the tourism industry.

The increasing complexity of the space flight program and the increase in the duration of missions require improvement of psychological monitoring tools for astronauts in orbit. The article summarizes the experience of using quantitative content analysis of communication between the crews and the Mission control center (MCC). This method allows to assess dynamics of astronaut’s psycho-emotional state, to identify the communicative style, and to detect the communication phenomena of board-MCC communication. The method is based on a combination of coping strategies approach by Lazarus and Folkman as well as B.F. Lomov’s concept about the three functions of communication. We found influence of workload on the structure and volume of communication, defined the main stable communication styles of crewmembers, and confirmed presence of the emotional transfer phenomenon. We detected that astronauts successfully solve problems that arise in orbit using the capabilities of their communication style. An ineffective MCC communication style the leads to the psycho-emotional ill-being manifesting in emotional transfer phenomenon. The presence of “third quarter” phenomenon was not confirmed by materials from six-month space flights.

In the case of solid slabs made of reinforced concrete that are usually subjected to bending, large areas of the structure are stressed well below their load-bearing capacity. Contrary to this are shell structures, which can bridge large spans with little material if designed according to the force flow. To improve the efficiency of ceiling slabs, we want to utilize the shell load-bearing behavior on a smaller scale by resolving the solid interior accordingly. In order to be able to study a wide range of such constructions virtually, a parametric multiobjective simulation environment is being developed in an ongoing research project. The basic analysis approaches which were implemented are presented in this paper. The basic workflow, the used programs and material models and their calibration on the tests on textile-reinforced concrete (TRC) samples are described.

In order to further investigate the study of the effect of grouped stud effect on the force properties of stud connector, based on the premise that the correctness of the finite element simulation method in this paper, finite element modeling of grouped stud connectors was developed, the grouped stud effect and its sensitivity factors were analyzed, to validate the recommended formula for calculating the shear capacity of grouped stud connectors. Results show that the number of grouped stud rows and row spacing have a significant effect on the grouped stud effect, and the unevenness coefficient of grouped stud force Ⅰ is negatively correlated with the number of grouped stud rows as well as the grouped stud row spacing. For grouped stud connectors with commonly used concrete grades greater than C50 and height-to-diameter ratios greater than 4 in steel-concrete composite structural bridges, which is insensitive to changes in the concrete strength grades and the length of the studs. The direction of force transmission for the grouped stud changes with the change of loading angle, and the unevenness coefficient of force for the grouped stud will therefore be reduced. By comparing the results of the 62 existing groups of grouped stud connectors push-out tests, the mean value of the ratio of tested to calculated values is found to be 1.12, the variance is 0.023, the dispersion is small, it is shown that the recommended formula has a high degree of accuracy. The results of this paper can be used as a theoretical basis for the study of the shear stress performance of grouped stud connectors.

Offshore wind farms are increasingly built in the North Sea and the number of HVDC systems transmitting the wind power to shore increases as well. To connect offshore wind farms to adjacent AC transmission systems, onshore and offshore modular multilevel converters transform the transmitted power from AC to DC and vice versa. Besides, modern wind farms mainly use wind turbines connected to the offshore point of common coupling via voltage source converters. However, converters and their control systems can cause unwanted interactions, referred to as converter-driven stability problems. The resulting instabilities can be predicted by applying an impedance-based analysis in the frequency domain. Considering that the converter models and system data are often confidential and cannot be exchanged in real systems, this paper proposes an enhanced impedance measurement method suitable for black-box applications to investigate the interactions. The proposed method is applied to assess an offshore HVDC system’s converter-driven stability, using impedance measurements of laboratory converters and a wind turbine converter controller replica. The results show that the onshore modular multilevel converter’s interactions with AC grids of moderate short-circuit ratios can lead to instabilities. The offshore system analysis reveals that considering the offshore grid topology is crucial for assessing interactions between the wind turbine controllers and the offshore modular multilevel converter. It is shown that different stability margins result from varying offshore grid layouts.

This research aims to determine the similarities in groups of people to build a film recommender system for users. Users often have difficulty in finding suitable movies due to the increasing amount of movie information. The recommender system is very useful for helping customers choose a preferred movie with the existing features. In this study, the recommender system development is established by using several algorithms to obtain groupings, such as the K-Means algorithm, birch algorithm, mini-batch K-Means algorithm, mean-shift algorithm, affinity propagation algorithm, agglomerative clustering algorithm, and spectral clustering algorithm. We propose methods optimizing K so that each cluster may not significantly increase variance. We are limited to using groupings based on Genre and, Tags for movies. This research can discover better methods for evaluating clustering algorithms. To verify the quality of the recommender system, we adopted the mean square error (MSE), such as the Dunn Matrix and Cluster Validity Indices, and social network analysis (SNA), such as Degree Centrality, Closeness Centrality, and Betweenness Centrality. We also used Average Similarity, Computational Time, Association Rule with Apriori algorithm, and Clustering Performance Evaluation as evaluation measures to compare method performance of recommender systems using Silhouette Coefficient, Calinski-Harabaz Index, and Davies-Bouldin Index.

In laser-assisted milling, higher temperature in shear zone softens the material potentially resulting in a shift of mean residual stress, which significantly affects the damage tolerance and fatigue performance of product. In order to guide the selection of laser and cutting parameters based on the preferred mean residual stress, inverse analysis is conducted by predicting residual stress based on guessed process parameters, which is defined as the forward problem, and applying iterative gradient search to find process parameters for next iteration, which is defined as the inverse problem. An analytical inverse analysis is therefore proposed for the mean residual stress in laser-assisted milling. The forward problem is solved by analytical prediction of mean residual stress after laser-assisted milling. The residual stress profile is predicted through the calculation of thermal stress, by treating laser beam as heat source, and plastic stress by first assuming pure elastic stress in loading process, then obtaining true stress with kinematic hardening followed by the stress relaxation. The variance-based recursive method is applied to solve inverse problem by updating process parameters to match the measured mean residual stress. Three cutting parameters including depth of cut, feed per tooth, and cutting speed, and two laser parameters including laser-tool distance and laser power, are updated with respected to the minimization of resulting residual stress and measurement in each iteration. Experimental measurements are referred on the laser-assisted milling of Ti-6Al-4V grade 5 and ELI. The percentage difference between experiments and predictions is less than 5% for both materials, and the selection is completed within 50 loops.

To identify the exchange coefficients of a nonlinear polynomial tricompartmental general system of α+β , we follow the procedure; firstly, the recommended solution is to introduce an adequate time t*>0 in a determinable manner. That is, after injecting quantity a into the main compartment, wait a moment for the exchange in the polynomial α+β order nonlinear general system to settle, and then compare this compartment to compartment 2 at t*. Secondly, applying the Taylor formula will linearize the system and identify the exchange coefficients. Finally, we will prove that the linearization method is stable.

Understanding the genetic architecture of a disease is crucial for development of valid diagnostic and therapeutic interventions. The analysis of genomic variations associated with pathological conditions is the starting point for uncovering disease-causing pathways (candidate processes). However, the complexity of intergenic and genetic-environmental interactions hinders the identification of pathogenic values of genomic changes. Furthermore, heredity, epigenetics and somatic mosaicism make the interpretation of genomic data even more sophisticated. To succeed, a variety of bioinformatic techniques are applied. Here, reviewing own and literature data, knowledge-based prioritization of genomic variations is described. Theoretical basis of the knowledge-based prioritization is given with a special regard to gene ontology, heuristics, hermeneutics (genomic hermeneutics) and analytics. Practical and methodological issues of prioritization using ontology- or pathway-based systems analysis are considered in the light of optimistic and realistic scenarios of cumulative phenotypic effects of the variome (the whole set of genomic variations in an individual or specific set of genomic variations for a phenotypic outcome). In the present communication, copy number variants (CNVs) in children with neurodevelopmental diseases are used as a practical foundation for the prioritization, inasmuch as these genome variations are systematically overlooked in the so-called NGS era. Nonetheless, it is highly likely that the prioritization is applicable to almost all types of genomic variations (e.g. chromosome abnormalities, gene mutations, functional synonymous variants etc.). The present methodology seems to be a valuable addition to current biomedical science widening the opportunities for medical genomics and genetics.

The lab-on-a-chip concept, enabled by microfluidic technology, promises the integration of multi-ple discrete laboratory techniques into a miniaturised system. Research into microfluidics has generally focused on the development of individual elements of the total system (often with rela-tively limited functionality), without full consideration for integration into a complete fully opti-mised and miniaturised system. Typically, the operation of many of the reported lab-on-a-chip devices is dependent on the support of a laboratory framework. In this paper, a demonstrator platform for routine laboratory analysis is designed and built, which fully integrates a number of technologies into a single device with multiple domains such as fluidics, electronics, pneumatics, hydraulics, and photonics. This facilitates the delivery of breakthroughs in research, by incorpo-rating all physical requirements into a single device. To highlight this proposed approach, this demonstrator microsystem acts as a fully integrated biochemical assay reaction system. The re-sulting design determines enzyme kinetics in an automated process and combines reservoirs, three-dimensional fluidic channels, optical sensing, and electronics in a low-cost, low-power and portable package.

This study aims to develop an auditory experience evaluation questionnaire to improve the presence of metaverse environments, and to derive evaluation components considering auditory presence and auditory user experience (AUX) through a survey. After conducting a survey with a total of 232 participants, five evaluation components were extracted from auditory presence and AUX evaluation factors through principal component analysis (PCA) and reliability analysis (RA): 'realistic auditory background', 'acoustic aesthetics', 'consideration of acoustic control and accessibility', 'auditory utility and minimalist design', and 'auditory consistency'. In particular, although AUX evaluation factors such as 'ease of access to sound control' have limitations in improving the sense of presence, negative factors of presence such as 'distraction due to sound' can be improved by utilizing AUX evaluation factors, so it is judged that the sense of presence in the metaverse environments can be improved by enhancing the auditory sense of presence and AUX evaluation factors according to the composition of the five evaluation components derived in this study. This study can be used as a basis for developing an auditory experience evaluation questionnaire for the metaverse platform, creating sound design guidelines, and identifying sound development priorities.

The concept of collecting data of people using a domestic space is not novel. However, the methods and processes used to decipher this raw data and transform it into useful and appropriate information (i.e., sequence, duration, and timing derived from domestic activities) have been challenging and the focus of many research groups. But how are the results of the decoded transposition received, interpreted and used by the various professionals (e.g., occupational therapists and architects) who consume the information? This paper describes the inclusive evaluation process undertaken, which involved architects, engineers and end-users (not the occupant, but the care team managing the occupant). Finally, our study evidence the importance of making accessible to a multidisciplinary audience spatial, temporal and sequential aspects derived from people's domestic routines. Shedding light on how a systematic approach to collecting, processing and mapping low-level sensor data into higher forms and representations can be a valuable source of knowledge for improving the domestic living experience.

The cutter structure and layout scheme of PDC (Polycrystalline Diamond Compact) bits are important factors in improving efficiency. To further improve the drilling efficiency of PDC bits, axe, triangular prism, and cylindrical PDC cutters were used as research objects. Based on the measured granite data, a finite element model of non-homogeneous granite was established and verified by uniaxial compression simulation. The rock-breaking process of different cutter combination schemes was compared using the finite element method, and the parameters in the best scheme were optimized using the Box-Behnken response surface method. The results show that the constructed model of non-homogeneous granite is consistent with the stress-strain relationship of real granite and is reliable. The axe PDC cutter is more aggressive than the other two cutters and is more suitable for the front row of the bit blade tooth arrangement, while the triangular prism cutter is the second most aggressive and is suitable for the rear row of tooth arrangement, and the best combination scheme is the front row of axe cutter and the rear row of triangular prism cutter arranged alternately with the axe cutter. The optimal transverse and longitudinal distances of the optimized triangular prism cutter from the front axe cutter are 10mm and 7mm, and the optimal transverse and longitudinal distances of the rear axe cutter from the front cutter are 10.06mm and 7mm. The drilling speed is more stable during drilling and the PDC bit with mixed tooth arrangement has 16.8% and 16.6% higher rate of penetration(ROP) compared with the bit with single axe cutter and triangular prism cutter, and the drilling speed is more stable during working, which can effectively improve the rock breaking efficiency of the PDC bit. The field application proves that the bit with mixed cutter arrangement is easier to break the complex formations, with more stable ROP and better efficiency. The study can provide theoretical support for the cutter layout of the PDC bit.

Purpose- Betel nut (Areca catechu) is one of the major plantation crops grown in Assam. However, due to inefficiency in production, the productivity of betel nuts in the state is very low. Therefore, this study attempted to measure the level of technical efficiency and the factors affecting the technical inefficiency of betel nut growers in the Nagaon district of Assam.Design/methodology/approach – Primary data were collected from 240 households in the Nagaon district of Assam. Based on the Cobb-Douglas Production function for betel nut growers, the present study uses stochastic frontier analysis to estimate the production frontier and examine the effects of exogenous variables on farm-level technical inefficiency. Findings - The findings of the study reveal that, on average, 85 per cent of betel nut growers are technically efficient in the study area. Moreover, experience in betel nut plantations and gender have a significantly negative effect on technical inefficiency. In contrast, the age of the grower had a positive and significant effect on the technical inefficiency of betel nut cultivation. The findings suggest the availability of space for an increase in the productivity of betel nut plantations in the study area and scope for increasing the level of output through technical efficiency without raising inputs.Originality/Value: This study contribute to the estimation of the technical efficiency of betel nut growers and examines the factors responsible for technical inefficiency.The dataset is original and was especially collected for the present study.

Hypoxic-ischemic encephalopathy (HIE) secondary to perinatal asphyxia occurs when the brain does not receive enough oxygen and blood. A surrogate marker for ‘intact survival’ is necessary for the successful management of HIE. The severity of HIE can be classified based on clinical presentation, including presence of seizures, using a clinical classification scale called Sarnat staging; however, Sarnat staging is subjective and the score changes over time. Furthermore, seizures are difficult to detect clinically and are associated with a poor prognosis. Therefore, a tool for continuous monitoring on the cot side is necessary, for example, electroencephalogram (EEG) that non-invasively measures the electrical activity of the brain from the scalp. Then, multimodal brain imaging, when combined with functional near-infrared spectroscopy (fNIRS), can capture the neurovascular coupling (NVC) status. In this study, we first tested the feasibility of a low-cost EEG-fNIRS imaging system to differentiate between normal, hypoxic, and ictal states in a perinatal ovine hypoxia model. Here, the objective was to evaluate a portable cot side device and autoregressive (ARX) modelling to capture the perinatal ovine brain states during a simulated HIE injury. So, ARX parameters were tested with a linear classifier using a single differential channel EEG, with varying states of tissue oxygenation detected using fNIRS, to label simulated HIE states in a perinatal ovine hypoxia model. Then, we showed the technical feasibility of the low-cost EEG-fNIRS device and ARX modeling with support vector machine classification for a human HIE case series with and without sepsis. The classifier trained with the ovine hypoxia data labelled ten severe HIE human cases (with and without sepsis) as “hypoxia” group and the four moderate HIE human cases as the “control” group. Furthermore, we showed the feasibility of experimental modal analysis (EMA) based on the ARX model to investigate the NVC dynamics using EEG-fNIRS joint-imaging data that differentiated six severe HIE human cases without sepsis from four severe HIE human cases with sepsis. In conclusion, our study showed the technical feasibility of EEG-fNIRS imaging, ARX modeling of NVC for HIE classification, and EMA that may provide a biomarker to detect sepsis effects on the NVC in HIE.

Heritage conservation area designation is often resisted by communities due to concerns with overly strict regulations for property alterations and negative impacts on property values. This paper addresses these concerns by examining Freemans Bay and Onehunga – two Special Character Areas (SCAs) in Auckland, New Zealand. A property value analysis was used to assess the impact of SCA designation on property values and an online questionnaire survey gathered information on homeowners’ experiences and levels of satisfaction with living in an SCA. The results indicate that designated SCA properties have higher average values than non-designated properties and homeowners are overwhelmingly satisfied with living in a SCA. The main benefits are a sense of community and having certainty around the look and feel of their neighbourhood into the future. The main issue identified by respondents is the requirement for Resource Consent. The majority of people who had gone through the process found it to be a negative experience because of the high cost in terms of time and money. A historic urban landscape approach to the development of management plans and design guidelines is recommended to improve the implementation of the Special Character Areas in Auckland and beyond.

: In this article, the authors propose an algorithmic approach to building a model of the dynamics of economic and, in particular, innovation processes. The approach under consideration is based on a complex algorithm that includes (1) decomposition of the time series into components using singular spectrum analysis; (2) recognition of the optimal component model based on fuzzy rules, and (3) creation of statistical models of individual components with their combination. It is shown that this approach corresponds to the high uncertainty characteristic of the tasks of the dynamics of innovation processes. The proposed algorithm makes it possible to create effective models that can be used both for analysis and for predicting the future states of the processes under study. The advantage of this algorithm is the possibility to expand the base of rules and components used for modeling. This is an important condition for improving the algorithm and its applicability for solving a wide range of problems.

The spread of charging infrastructure (CIS) for battery electric vehicles is crucial for coping with the increasing number of electric vehicles. Therefore, the selection of ideal (fast-) charging locations determines acceptance, utilization and, thus, the economic viability of a single site or the whole charging network. The methodology of the Integrated Model Approach STELLA[1] for site identification of CIS uses proven methods of traffic modeling such as the classic four-step traffic modeling in a new context to enable statements regarding the positioning of CIS. Based on different spatial analyzes and characterizations of urban quarters, traffic generated by individuals is calculated using the FGSV approach of 2010. Because only (electric) motorized individual traffic is of importance for CIS, the share of trips is calculated by differentiating the modal split between various transport groups. One approach is to concretize the modal split share of public transport based on analyzes of different criteria and data sets, e.g. the accessibility of stops. The model approach STELLA, which also combines various extensive data (e.g. transport networks and traffic volumes, settlement structures, vehicle characteristics, power supply data and user requirements), is currently developed for a planning area covering the entire territory of the Federal Republic of Germany. [1] STELLA is the acronym for the German term "STandortfindungsmodell für ELektrische LAdeinfrastruktur”.

Graphyne is a material that has unique mechanical properties, but little is known about how these properties change when the material has holes. In this work, the effect of hole geometry, considering circular, triangle, and rhombus hole configurations, on the mechanical nonlinear response of γ-graphyne structures is studied. Graphyne, graphdiyne, graphyne-3, and graphyne-4 structures are under investigation. An efficient nonlinear finite element analysis (FEA) method is adequately implemented under large deformations for this purpose. The study varied the size and shape of the holes to understand how these changes affect the nanostructure's mechanical response. The results indicate that the hole geometry significantly impacts the mechanical nonlinear response of γ-graphyne structures. The holes' size and shape affect the structures' elastic behavior, deformation, and strength. The findings can be used to optimize the design of γ-graphyne structures for specific mechanical applications. The study highlights the importance of considering the hole geometries in the design and fabrication of these materials.

Environmental nanoparticles have been shown to exist in most aquatic environments, and environmental nanoparticles in water distribution systems significantly affect water quality. However, little research has been conducted on the environmental nanoparticles in mineral water, which is a special water resource. Nanoparticle tracking analysis (NTA) and high-resolution transmission electron microscopy (HRTEM) were conducted. This study was the first to identify many environmental nanoparticles in natural mineral water in Zibo City, Shandong Province, China. The results of the NTA showed that the concentration of the particles was 5.5 ×106 particles/mL and the peak diameter of the size distribution was 180 nm. The HRTEM showed that the nanoparticles were granular, pinniform, rodlike, and flakey in shape, and some of the nanoparticles existed in aggregation. The energy-dispersive spectrometry results showed that most of the nanoparticles contained O, Mg, Ca, Si, Fe, Ti, and P, and some of them also contained F, V, S, and Mn. When combined with the characteristics of the selected area electron diffraction pattern, the nanoparticles were confirmed to be Ca-bearing nanoparticles, attapulgite nanorods, MnO2 nanosheets, and TiO2 nanoparticles. These results indicate a new form of elements occurring in mineral water. In addition, based on the chemical and physical characteristics of the nanoparticles and mineral water, these environmental nanoparticles in the mineral water are likely to be the weathering byproducts of minerals. These nanoparticles within mineral water provide a good opportunity for understanding the behavior of nanoparticles in varied systems. Moreover, environmental nanoparticle science is important for continuing efforts in water safety, treatment, and remediation.

In the second decade of the 21st century, social media changed the nature of communication and cooperation between participants of the culture services market. They became, among other things, an important marketing instrument in the area of contact with the customers of the cultural offer. However, despite their growing importance in various areas of activity of organisations in the cultural sector, the issue of building the cultural institution's brand equity by social media users is relatively seldom raised. Research on the impact of online consumer activity on brand equity is at an early stage of development. Therefore, this article is an attempt to fill the research gap in this area. The article presents the results of a survey conducted in 2018 on a group of 1021 consumers of cultural services, who at the same time regularly used social media. The statistical analysis carried out and the research results obtained prove that the 3C sustainable system developed by the authors, concerning the activity of consumers of cultural services in social media, stimulates the consumer-based brand equity (CBBE). Statistically significant relations have been observed in particular for CBBE components related to the awareness of a cultural institution's brand and for the relationship related to the perception of its quality. The study opens a review of literature on social media and consumer-based brand equity (CBBE). Next, based on the COBRA model (consumer's online brand-related activities), a proposal of the 3C sustainable system, concerning the activity of consumers of cultural services in social media, has been presented. The further part of the article presents research hypotheses, a conceptual model, research methodology as well as results and conclusions. The last part of the article discusses the results obtained and indicates the existing management implications.

Apple latent spherical virus (ALSV) is widely used as a virus-induced gene silencing (VIGS) vector for function genome study. However, the application of ALSV in soybean is limited by the resistance of many varieties. In this study, the genetic loci linked to the resistance of a resistant soybean variety Heinong 84 was mapped by high-throughput sequencing‒Bulk Segregation Analysis (HTS‒BSA) using a hybrid population crossed from Heinong 84 and a susceptible variety Zhonghuang 13. Results showed that the resistance of Heinong 84 to ALSV is controlled by two genetic loci located on chromosome 2 and 11, respectively. Cleaved amplified polymorphic sequences (CAPS) markers were developed for identification and genotyping. Inheritance and biochemical analyses suggest that the resistance locus on chromosome 2 plays a dominant dose-dependent role, while the other locus contributes a secondary role in resisting ALSV. The resistance locus on chromosome 2 might encode a protein that can directly inhibit viral proliferation, while the secondary resistance locus on chromosome 11 may encode a host factor required for viral proliferation. Together, these data reveal novel insights on the resistance mechanism of Heinong 84 to ALSV, which will benefit for the application of ALSV as a VIGS vector.

Statistical based reconstruction methods and signal processing tooling techniques are implemented and used to detect delaminations or debondings within composite items. From literature it appears that, although a single procedure for the estimation of the structural health is a fast solution, a multiple analysis based on different reconstruction methods or different damage parameters could provide more detailed information about the location and the severity of possible failures. This work discusses the advantage of using cross-correlation analysis in a data-driven approach based on ultrasonic guided waves (GW) tomographic technique and piezoelectrics (PWAS) in pitch-catch configuration. In this sense, this work evidences an improvement in damage detection when the cross-correlation is included as part of the GW-based system for damage assessment approach. The specimens used as test structures to demonstrate the validity of the methodology derive from an aircraft wing test article where damages are specified as skin delamination produced by low energy impact.

Soil quality is related to food security and human survival and development. In recent years, due to the acceleration of urbanization and the increase of abandoned land, land degradation occurs, poor topsoil quality. In this study, the minimum data set (MDS) was constructed through principal component analysis (PCA) to determine the indicator data set for evaluating topsoil quality in Tieling County, China. In addition, the soil quality index (SQI) was calculated to analyze the spatial distribution characteristics and influencing reasons of topsoil quality in Tieling County. The re-sults showed that MDS included total potassium (TK), Clay, zinc (Zn), soil organic matter (SOM), soil water content (SWC), cation exchange capacity (CEC), pH, and copper (Cu). The MDS indicators can well replace all indicators to evaluate the topsoil quality in the study area. The overall soil quality of Tieling County showed a trend of low in the east and high in the west, and gradually increased from the hilly area to the plain area. The evaluation results are consistent with field research, which can provide reference for other topsoil quality evaluation, and it also provide a basis for the formulation of soil quality improvement measures.

These days, numerous organizations and Analysis Centers (AC) offer various Ambiguity Resolution (AR) products using various methodologies. To use it for time-frequency transfer, there is no associated study. This paper chooses 16 MGEX stations with external high-precision atomic clocks to constitute 15 international time comparison links and uses AR products data from CNES, SGG, CODE, and PRIDE laboratory, using three ambiguity-fixed strategies, to thoroughly evaluate the effects of various strategies and AR products for high-precision time-frequency transfer. We reach the following results by using the IGS final clock product as a reference and comparing it to ambiguity-float. With various ambiguity-fixed procedures, the time stability STD of time transfer is increased for a single GPS, and the improvement ranges from 10% to 40%. The frequency stability has barely improved; up to 40%, the most notable improvement comes from FCB with GRM products. The time stability STD of combinations has improved after the addition of the Galileo system compared to the single GPS, and the improvement ranges from 2% to 9%. Most strategies have improved, while a few techniques have weakened with the GEC (GPS+Galileo+BDS) combination. We feel that the stability has not significantly increased with the system's increase within short-term stability after comparing multiple groups of linkages.

Motor impairments are among the most relevant, evident, and disabling symptoms of Parkinson’s disease that adversely affect quality of life, resulting in limited autonomy, independence, and safety. Recent studies have demonstrated the benefits of physiotherapy and rehabilitation programs specifically targeted to the needs of Parkinsonian patients in supporting drug treatments and improving motor control and coordination. However, due to the expected increase of patients in the coming years, traditional rehabilitation pathways in healthcare facilities could become unsustainable. Consequently, new strategies are needed, in which technologies play a key role in enabling more frequent, comprehensive, and out-of-hospital follow-up. The paper proposes a vision-based solution using the new Azure Kinect DK sensor to implement an integrated approach for remote assessment, monitoring, and rehabilitation of Parkinsonian patients, exploiting non-invasive 3D tracking of body movements to objectively and automatically characterize both standard evaluative motor tasks and virtual exergames. Preliminary results show the system’s ability to quantify specific features of motor performance, easily monitor changes and disease progression over time, and the possibility of using exergames to support motor condition assessment and training. The main innovation relies precisely on the integration of evaluative and rehabilitative aspects, which could be used as a closed loop to design new protocols for remote management of patients tailored to their actual conditions.

The Benford method can be used to detect manipulation of epidemiological or trial data during the validation of new drugs. We extend here the Benford method after having detected particular properties for the Fibonacci values 1, 2, 3, 5 and 8 of the first decimal of 10 runs of official epidemiological data published in France and Italy (positive cases, intensive care, and deaths) for the periods of March 1 to May 30, 2020 and 2021, each with 91 raw data. This new method – called “BFP” for Benford-Fibonacci-Perez - is positive in all 10 cases (i.e. 910 values) with an average of favorable cases close to 80%, which, in our opinion, would validate the reliability of these basic data.

The tobacco epidemic is one of the leading public health threats the world has ever faced and public health policy that seeks to limit the problem may not only have to target the price of tobacco but also the initiation stage in a smoker’s life – the adolescent stage. This research contributes to the health economics literature by using a Bayesian hierarchical logistic model, estimated using Hamiltonian Monte Carlo (HMC) methods to empirically identify what drives the intentions to quit smoking among adolescent smokers in Zambia. Results suggest that among the junior secondary school-going adolescent smokers in Zambia, about 63% have plans to quit smoking. We find socio-demographic characteristics and several tobacco-smoking-related factors as the main drivers of adolescent smokers’ plans to quit smoking. Most importantly, we provide insights that could be useful to help adolescent smokers realize their quitting plans.

One of the most serious concerns about mega event-related changes to small cities is how to effectively utilize newly developed public attractions after the Olympic Games. Making connections with existing local amenities and forming attraction networks can be effective strategies for continuing a city’s revitalization. However, despite the expected benefits, attraction network research shows that these benefits often fail to materialize. With the case of Gangneung, a 2018 winter Olympic hosting city, this study investigated visitation patterns to nineteen selected attractions using network analysis. The results indicate that the most influential nodes are located on the northern coast, the eastern coast, and in the south downtown area, those nodes being the central locations where the strongest of connections are made. New attractions such as the Olympic Park and Walwha Linear Park were rather isolated. While seasonal and periodic variations, visitors’ residences, and destination choice attitudes had a significant effect on visitation patterns, the attraction networks, modes of transportation, proximity to region, and type similarity were not significant factors in the forming of visitation patterns. The results make a methodological contribution to tourist behavior and network research. In addition, beyond individual attraction development, the results provide practical implications in regard to networking and cooperation between multiple attractions using temporal and spatial strategies such as management/investment prioritizing, travel route development, and program scheduling.

The interlaminar shear behavior of a [±45°] laminated carbon fiber reinforced plastic (CFRP) specimen was investigated utilizing microscale strain mapping in a wide field of view. A three-point bending device was developed under a laser scanning microscope, and the full-field strain distributions including normal, shear and principal strains of CFRP in a three-point bending test were measured using a developed sampling Moire technique. The microscale shear strain concentrations at interfaces between each two adjacent layers were successfully detected and found to be positive-negative alternately distributed before damage occurrence. The 45° layers slipped to the right relative to the -45° layers, visualized from the revised Moire phases and shear strain distributions of the angle-ply CFRP under different loads. The absolute values of the shear strain at interfaces gradually rose with the increase of the bending load, and the sudden decrease of the shear strain peak value implied the occurrence of interlaminar damage. The evolution of the shear strain concentrations is useful in the quantitative evaluation of the potential interlaminar shear failure.

Understanding the vulnerability of areas and the likelihood of specific disasters, particularly earthquakes, is one of the most important issues in Iran. One of the major concerns in Iran is the resilience of rural communities. The present study is devoted to spatial analysis of risk in rural areas and the evaluation of preparedness in the rural districts of the city of Abhar. In particular, this study evaluates the resilience to earthquakes. The research was conducted in two parts in which the first part has used the VIKOR Multiple criteria decision making model as well as the employment of this model in the ArcGis. The second part of the study used field studies, in the form of questionnaires, to evaluate the readiness of the local population against the risks of earthquakes. Four indicators, individual, physical, economic abilities and access, were assessed. The population included rural districts, where statistical samples were villagers. Results of the spatial analysis indicated that 15 villages are in the high-risk areas, 24 villages were in the medium-risk areas and all other villages were in low-risk areas. In terms of readiness of the locals, the results indicated a lack of planning with regards to the four mentioned indicators.

Our paper deals with an advanced statistical tool for the volatility prediction problem in financial (crypto) markets. Firstly, we consider the conventional GARCH involved volatility models. We next extend the corresponding GARCH based forecasting and calculate a specific probability associated with the predicted volatility levels. Since the probability evaluation is based on a stochastic model, we next develop an additional data-driven estimation of this probability. The proposed advanced statistical estimation uses real (historical) market data. The obtained theoretic results for the statistical probability of levels are also discussed in the framework of the integrated volatility concept. A possible application of the established probability estimation to the volatility clustering problem is also mentioned. Our paper includes a concrete practical implementation of the resulting (combined) volatility prediction tool and considers a novel module for trading and volatility estimation in crypto markets recently developed by 1ex Trading Board group in collaboration with the GoldenGate Venture. Moreover, we discuss shortly a possible using of the proposed model based and data-driven volatility prediction methodology in the financial risk management.

The current classification of acute myeloid leukemia (AML) relies largely on genomic alterations. AML with mutated Nucleophosmin1 (NPM1-mut) is the largest of the genetically defined groups, involving about 30% of adult AMLs and is currently recognized as a distinct entity in the actual AML classifications. NPM1-mut AML usually occurs in de novo AML and is associated predominantly with a normal karyotype and relatively favorable prognosis. However, NPM1-mut AMLs are genetically, transcriptionally, and phenotypically heterogeneous. Furthermore, NPM1-mut is a clinically heterogenous group. Recent studies have in part clarified the consistent heterogeneities of these AMLs and have strongly supported the need for an additional stratification aiming to improve the therapeutic response of the different subgroups of NPM1-mut AML patients.

With the continuous improvement of people's quality of life and aesthetics, furniture products have higher requirements. Excellent solid wood chairs are the most representative products in furniture to enhance space and taste and whose design may significantly impact consumers' emo-tional experience and purchase decisions. This study aims to evaluate how the modeling imagery of solid wood chairs affects user preferences and emotional experiences. The development of the current era is inseparable from the analysis of big data. Firstly, a representative sample was ob-tained by multidimensional scaling (MDS), and the sample was analyzed and evaluated by fac-tor analysis. Moreover, five groups of adjective vocabulary were selected to describe the model-ing imagery of solid wood chairs, such as "balanced and coordinated", "unique and novel", "prac-tical and simple", "quality and detailed" and "traditional and plain". Further, the triangular fuzzy theory was applied to analyze and discuss the 12 types of solid wood chairs in the five groups of adjective vocabulary. Then the study verified that the differences in the evaluations of the 12 sam-ples in the "unique and novel" and "quality and detailed" groups were significant, but more minor differences in the groups of "traditional and plain", "balanced and coordinated" and "practical and simple". Through comprehensive comparison, five groups with similar modeling imagery were created, and solid wood chairs with different modeling imagery should be placed in suita-ble spaces. According to the results of this study, the evaluation of the modeling imagery of solid wood chairs can not only rely on subjective judgments but can be reasonably described through data analysis and mathematical algorithms. It can scientifically and effectively reflect the poten-tial perception needs of consumers on the modeling imagery of solid wood chairs, as well as help to improve the design efficiency of the furniture product development stage.

The separation of rare earth metals (REM) from a neodymium magnet has been widely studied in the last year. We have shown that the waste of computer hard disk contains 25.41 % neodymium, 64.09 % iron, and <<1 % boron. To further isolate rare-earth metals, the magnet was acidically dissolved in open and closed systems. In both methods of dissolution was used concentrated nitric acid. The difference between these methods are the conditions of dissolution of magnet. The magnet was dissolved in a microwave sample preparation system at different temperatures and pressures in a closed system. In the open system, the acid dissolution of the magnet conducted at room temperature. 0.2 g of the neodymium magnet sample was taken under two conditions, and the dissolution process in the closed system lasted 1 hour, and in the open system-30-40 minutes. The open system is a non-laborious, simple and cheap method of dissolving the magnet by comparing both systems. Therefore, an open sample preparation system is used for further work. To remove the iron in the magnet, oxalic acid was used and precipitated as oxalates under both conditions. According to the result of the ICP-MS method, it is shown that the neodymium and iron contents in the precipitate are 24.66 % and 0.06 %, respectively. This shows that the iron has almost completely passed to the filtrate. Thus, it is possible to remove the iron from the sample.

Nowadays, with smartphones people can easily take photos, post photos to any social networks and use the photos for some purposes. This leads to a social problem that unintended appearance in photos may threaten the privacy of photographed person. Some solutions to protect facial privacy in photos have already been proposed. However, most of them rely on different techniques to de-identify photos which can be done only by photographers, giving no choice to photographed person. To deal with that, we propose an approach that allows photographed person to proactively detect whether someone is intentionally/unintentionally trying to take pictures of him/her. Thereby, he/she can have appropriate reaction to protect the privacy. In this approach, we assume that the photographed person uses a wearable camera to record the surrounding environment in real-time. The skeleton information of likely photographers who are captured in the monitoring video is then extracted to be put into the calculation of dynamic programming score which is eventually compared with a threshold for recognition of photo-taking behavior. Experimental results demonstrate that by using the proposed approach, the photo-taking behavior is precisely recognized with high accuracy of 92.5%.

Despite their obvious differences, biological systems at different scales tend to exhibit common organizational patterns. Unfortunately, these commonalities are usually obscured by the parcelled terminology employed by various scientific sub-disciplines. To explore these commonalities, this papers a comparative study of diverse applications of the maximum entropy principle, ranging from amino acids up to societies. By presenting these studies under a common language, this paper establishes a unified view over seemingly highly heterogeneous biological scenarios.

The COVID-19 pandemic resulted in government restrictions that altered the lifestyle of people worldwide. Studying the impact of these restrictions on exercise behaviors will improve our understanding of environmental factors that influence individuals’ PA. We conducted a retrospective analysis using an index of government pandemic stringency developed by Oxford and a wearable device for runners to compare strictness of lockdowns and exercise habits, using digitally-logged PA data from more than 7,000 runners on a global scale. Additionally, time-of-day of PA globally and levels of PA in 14 countries are compared between the pre-pandemic year of 2019 and the first pandemic year of 2020. We found that during the pandemic the time-of-day that people exercised experienced a major shift, with significantly more activities logged during standard working hours on workdays (p<0.001) and fewer during the same time frame on weekends (p<0.001). Of the countries examined, Italy and Spain had among the most strict lockdowns and suffered the largest decreases in activity counts, whereas France experienced a minimal decrease in activity counts despite enacting a similarly strict lockdown. This study suggests that there are several factors affecting PA, including government policy, workplace policy, and cultural norms.

We estimate the value of Research and Development Expenditures as a percentage of GDP-RDE in the context of Environmental, Social and Governance-ESG model. We use the ESG World Bank database. We analyze data from193 countries in the period 2011-2020. We apply a set of econometric techniques i.e. Pooled Ordinary Least Squares-OLS, Panel Data with Random Effects, Panel Data with Fixed Effects, Weighted Least Squares-WLS. We found that the level of RDE is positively associated, among others, to “Nitrous Oxide Emissions” and “Scientific and Technical Journal Articles”, and negatively associated, among others to “Heat Index 35”, “Maximum 5-day Rainfall”. Furthermore, we perform a cluster analysis with the application of the k-Means algorithm optimized with the Elbow Method. The results show the presence of four clusters. Finally, we confront eight different machine-learning algorithms to predict the future value of RDE. We find that Linear Regression is the best predictive algorithms. RDE is expected to growth on average of 0.07% for the analysed countries.

About half of the world's population is at risk of dengue infection. Epidemics of dengue fever caused an increased risk of morbidity and mortality in recent years, which led to the exploration of vaccines as a preventive measure. This systematic review and meta-analysis aimed to evaluate the efficacy, immune response, and safety of dengue vaccines in children by analyzing clinical trials. The review followed standard procedures for data extraction using PRISMA guidelines, and searching multiple databases including PubMed, CINAHL, Medline, Health Source, Science Direct, and Academic Search Premiere. Eligible studies involved children (0-17 years). Cochrane Collaboration criteria were used for quality assessment, with thematic data synthesis and meta-analysis. Among 38 selected studies, dengue vaccines showed varying efficacy against all four serotypes. CYD-TDV (Dengvaxia®), and Tekade (TAK-003) vaccines demonstrated strong protection against severe dengue, but their long-term efficacy varied. Vaccines triggered satisfactory immune responses, notably in those previously exposed to dengue. Safety profiles were mostly favorable, noting mild adverse events post-vaccination. Meta-analysis supported vaccine efficacy and immune response, but safety concerns warrant further exploration. In conclusion, dengue vaccines demonstrated promising efficacy and immune response, particularly against severe manifestations.

Social communication skills, especially eye contact and joint attention, are highly impaired in autism spectrum disorder (ASD) and predict functional outcomes. Applied Behavior Analysis is one of the best evidence-based treatments for ASD, but it is not accessible to most families in low- and middle-income countries (LMICs) as it is a costly and intensive and needs to be delivered by highly specialized professionals. Parental training has emerged as an effective alternative. The aim of this study was to test the efficacy of a parental intervention group via video modeling to acquire eye contact and joint attention. Four graded measures of eye contact and joint attention (full physical prompt, partial physical prompt, gestural prompt, and independent) were assessed in 34 children with ASD and intellectual disability (ID). There was a progressive reduction in the level of prompt required over time to acquire eye contact and joint attention, and a positive correlation between the time of exposure to the intervention and acquisition of the abilities. This parent training using video modelling to teach eye contact and joint attention skills to children with ASD and ID is a low-cost intervention that can be applied in low- resource settings.

Flood inundation causes socioeconomic losses for coastal tourism under climate extremes, progressively attracting global attention. Mapping, evaluating, and predicting the flood inundation risk (FIR) is significant for coastal tourism. The study develops a spatial tourism–aimed framework integrating a weighted k-Nearest Neighbors (WkNN), Geographic Information Systems, and flood-related spatially environmental criteria such as precipitation, elevation, soil, and drainage systems. These model inputs were standardized and weighted using distance, and integrated into WkNN to infer regional probability and distribution of FIR. Zhejiang province, China, was selected as a case study. The resulting map was pictured to denote the likelihood of the criteria at various risk categories, which was validated by historical Maximum Inundation Extent (MIE) extracted from World Environment Situation Room. The result indicates 80.59% of WkNN results reasonably confirm the MIE. Precipitation and elevation make a negative contribution to high-medium risk, and drainage systems positively alleviate the regional stress of FIR. The results can help stakeholders make suitable strategies to protect coastal tourism, and also weigh WkNN is superior to kNN in FIR assessment. The framework provides a productive way to yield a reliable assessment of FIR and can also be extended to other risk-related environmental studies under climate change.

Gastric cancer (GC) is a highly heterogeneous, complex disease and the fifth most common cancer worldwide (about one million cases and 784 000 deaths worldwide in 2018). CG is lately diagnosed and guarantees a poor prognosis for GC (the 5-year survival rate is less than 20%, but in early detection can reach 90%). This study evaluated the transcriptional profile in tumor gastric samples to find genes highly expressed during tumor establishment and use the related proteins as targets to find new anticancer molecules. Data was collected at Gene Expression Omnibus (GEO) bank to obtain 3 dataset matrices that analyze gastric tumor tissue versus normal gastric tissue, performed microarray using GPL570 platform, and from different sources. The genes found in silico analysis were confirmed in several lines of GC cells by RT-qPCR. The protein data bank was used to find the correspondent proteins. Then a structural-based virtual screening was done to find molecules, and docking analysis was done using the DockThor server. Our results of transcriptomic analysis, together with RT-qPCR, confirm the high expression of the genes AJUBA, FBXL13, CCDC69, CD80 and NOLC1 in GC lines. Based on that, the correspondent proteins were used in SBVS analysis. Five molecules, one each target, MCULE-2386589557-0-6, MCULE-7343047040-0-1, MCULE-5230409338-0-3, MCULE-9178344200-0-1 and MCULE -5881513100-0-29. All molecules have favorable pharmacokinetic, pharmacodynamic and toxicological properties. Molecular docking analysis revealed that the molecules interact with proteins in critical sites for their activity. Using a virtual screening approach, a molecular docking study was performed for proteins encoded by genes that play important roles in cellular functions for carcinogenesis. Combining a systematic collection of public microarray data with a comparative meta-profiling, RT-qPCR, SBVS, and molecular docking analysis provided a suitable approach to find genes involved in GC and work the correspondent protein to strive for new molecules with anticancer properties.

This study analyzes the effect of economic growth and income distribution on health inequality using data from the Organization for Economic Cooperation and Development (OECD). A panel analysis was conducted by combining 21 years of data (from 2000 to 2020) from 38 OECD countries. Life expectancy and avoidable mortality were set as the dependent variables; gross domestic product and poverty gap were set as the independent variables; body mass index, consumption, smoking rate, healthcare personnel, number of beds in health service facilities, national medical expenses, and unemployment were set as control variables. First, economic growth and poverty gap significantly affect life expectancy and avoidable mortality. It has been confirmed that to resolve health inequality, growth during growth and distribution must be prioritized. Second, it has been confirmed that as the poverty gap increases, life expectancy increases and the avoidable mortality rate decreases. A mechanism different from the existence of a medical security system targeting the lowest class or an increase in the welfare of society worked. In conclusion, as a policy proposal to alleviate health inequality, this study suggests that policy intervention is necessary to block or alleviate the negative impact of income inequality in health care policies.

Land Use /Land Cover (LULC) change is a major global concern and a topic of scientific debate. In West Africa, the key among the past changes is the loss of natural vegetation related to changes in different Land Use/Land Cover (LULC) categories, e.g., water bodies, wetland and bare soil. However, not all detected changes in these LULC categories are relevant for LULC change management intervention in a resource-constrained continent, as a massive change in the dominant LULC types may be due to errors in the LULC maps. Previous LULC change analysis detected large discrepancies in the existing LULC maps in the Africa continent. Here we applied an open and synergistic framework to update and improve the existing LULC maps at every five years intervals from 1990 to 2020 in West Africa at a finer spatial resolution of 30m. Next, we detected spatial temporal pattern in past and present LULC changes with the intensity analysis framework in the periods of 1990–2000, 2000–2010, and 2010–2020. A faster annual rate of overall transition was detected in 1990–2000 (first period) and 2010–2020 (recent period) than in 2000–2010 (middle). We observed consistent gains in rangeland (shrubland and grassland) in all the periods, which confirms the observed re-greening of rangeland in the West Africa continent. By contrast, forestland areas experienced consistent losses for the entire periods, which indicate deforestation and degradation. As regards cropland, a net loss was observed in the drought period and net gains in the subsequent periods. The settlement category also gained actively in all periods. Net losses of wetland and bare land categories were also observed in all the periods. We observed net gains in water bodies in 1990–2000 and net losses in the last period. We highlighted the active forestland losses as systematic and hence a clarion call for an intervention. The simultaneous active gross loss and gain intensity of cropland raises food security concern and must send an early warning signal to policy makers that the food security of marginal geographic locations is under threat despite the massive expansion of cropland observed in this study area. The intensity analysis framework was vital to identify the settlement category as relevant for LULC change management intervention across time and space in West Africa instead of focusing on dynamics of all the LULC categories that may be irrelevant and hence a cost effective LULC change management approach. Policies to control the expansion of settlements will indirectly regulate the expansion of cropland field because we observed that as settlement encroached on cropland, simultaneously cropland encroached on natural vegetation to meet the food security requirements of the inhabitants.

Background: A growing number of clinical practice guidelines (CPGs) with regards to non-pharmacological interventions for breast cancer survivors are available. However, given the limitations in guideline development methodologies and inconsistency of recommendations, it remains uncertain how best to design and implement such non-pharmacological strategies to tailor interventions for breast cancer survivors with varied health conditions, healthcare needs, and preferences. Aim: To critically appraise and summarise available non-pharmacological interventions for symptom management and health promotion that can be self-managed by breast cancer survivors based on the recommendations of the CPGs. Methods: Clinical practice guidelines which were published between January 2016 and September 2021 and described non-pharmacological interventions for breast cancer survivors were systematically searched in six electronic databases, nine relevant guideline databases, and five cancer care society websites. The quality of the included CPGs was assessed by four evaluators using the Appraisal of Guidelines for REsearch and Evaluation, second edition tool. Content analysis was conducted to synthesise the characteristics of the non-pharmacological interventions that were recommended by the included CPGs, such as the intervention’s form, duration and frequency, level of evidence, grade of recommendation, and source of evidence. Results: Fourteen CPGs were identified and analysed. Of the 14 CPGs appraised, only five were rated as high quality. The domain with the highest standardised percentage was “scope and purpose” (84.61%), while the “applicability” domain had the lowest standardised percentage (51.04%). Five guidelines were assessed as “recommended”, seven were rated as “recommended with modifications”, and the remaining two were considered “not recommended”. Regarding the content analysis, physical activity/exercise, meditation, hypnosis, yoga, music therapy, stress management, relaxation, massage, and acupressure were the common self-managed non-pharmacological interventions recommended by the 14 CPGs. Physical activity/exercise was the only self-managed non-pharmacological intervention that was mostly recommended for psychological and physical symptom management by the included CPGs. However, there were significant disparities in terms of level of evidence and grade of recommendation in the included CPGs. Conclusion: The recommendations for the self-managed non-pharmacological interventions were varied and limited among the 14 CPGs, and some were based on medium- and low-quality evidence. More rigorous methods are required to develop high-quality CPGs in order to guide clinicians in offering high-quality and tailored breast cancer survivorship care.

In this paper mathematical analysis of the HIV/AIDS deterministic model exposed in [Espitia, C. et. al. Mathematical Model of HIV/AIDS Considering Sexual Preferences Under Antiretroviral Therapy, a Case Study in San Juan de Pasto, Colombia, Journal of Computational Biology 29 (2022) 483–493] is made. The objective is to gain insight into the qualitative dynamics of the model determining the conditions for the persistence or effective control of the disease in the community through the study of basic properties such as positiveness and boundedness, calculus of basic reproduction number, stationary points such as disease free equilibrium (DFE), boundary equilibrium (BE) and endemic equilibrium (EE) are calculated, local stability (LAS) of disease free equilibrium. It research allow to conclude that the best way to reduce contagion and consequently to reach a DFE is thought to be the reduction of homosexual partners rate as they are the most affected population by the virus, and are therefore the most likely to become infected and to spread the infection. Increasing the departure rate of infected individuals, leads to a decrease in untreated infected heterosexual men and untreated infected women.

The global focus on geopolymer binder production has increased due to the adoption of waste materials and industrial byproducts. Given the gradual decline of the availability of fly ash and ground granular blast furnace slag (GGBFS) resulting from the decarbonization process in electricity and steel productions, waste clay brick powder (WCBP), could be a viable substitute of these pozzolanic by-products. This research is dedicated to thoroughly investigate the techno-eco-efficiency performance of WCBP when utilized as a geopolymer precursor. The favorable mechanical characteristics exhibited by fly ash-GGBFS-WCBP-based geopolymer binder emphasize the importance of assessing its sustainability alongside its technical viability. The study employed life cycle analysis (LCA), following ISO 14040-44 standards, and using the Simapro software, to evaluate the environmental implications of the use of WCBP-based geopolymer mixtures. Human toxicity emerged as the primary impact. Moreover, the analysis of life cycle costs highlighted key financial factors, with around 65-70% attributed to alkaline activators of the total cost. The production of alkaline activators was identified as a critical point for both environmental impact and economic considerations due to energy consumption. While WCBP-rich samples exhibit a 1.7-0.7% higher environmental impact compared to the control mix (CM), their high mechanical strength and cost-effectiveness make them technologically and economically efficient geopolymer mixes. In conclusion, the portfolio analysis for techno-eco-efficiency affirms that mixes containing 40%, 30%, and 20% WCBP are more efficient than those using 10% and 0% WCBP, respectively.

This study employs molecular docking techniques to investigate a spectrum of targets within Escherichia coli (E. coli), with a specific focus on four key proteins: Beta-lactamase, MccE protein, Penicillin G acylase, and DNA polymerase II. The research explores the binding interactions of various natural compounds, emphasizing Hypericin. Through computational analyses, the study aims to unveil the potential interactions between these compounds and essential proteins in E. coli. Notably, Hypericin demonstrates remarkable binding energy scores of approximately -10.5 kcal/mol within the Ligand Binding Site of the specified proteins. This observation suggests Hypericin's potential as a potent modulator of E. coli targets, prompting further investigation into its antimicrobial properties and therapeutic applications.

Increasing groundwater levels (GWL) may become one of the most serious issues for Odessa City, Ukraine. This study investigated the spatial distribution characteristics and multifractal scaling behaviour of groundwater level/depth fluctuation for a Quaternary aquifer in Odessa City using a geostatistical approach and a Multifractal Detrended Fluctuation Analysis (MF-DFA). These two methods were applied to monthly GWL fluctuation time series from 1970 to 2020 to monitor 72 hydrogeological wells situated in different parts of Odessa City. The spatial distribution of GWL revealed an overall trend of decline and recovery from 1970 to 2020 in the study area, except for most of the southern region, where a persistent recovery of groundwater depth was observed. The MF-DFA results suggest that the dynamics of GWL fluctuations have multifractal characteristics in the Odessa City area. In addition, both long-range correlation and fat-tail probability distribution contribute to multifractality. However, long-range correlations among fluctuations made a major contribution to the observed multifractality of the GWL fluctuations time series. The generalized Hurst exponent shows a wide range of change (0.20 &lt; h(q) &lt; 2.85), indicating the sensitivity of GWL fluctuations to changes in small scale factors and large-scale factors. Regarding the long range correlations of GWL depth, the Hurst exponents (q = 2) demonstrated the positive persistence of groundwater depth recovery in the southern region and the persistence of groundwater depth variation in the other regions of the study area. The dynamic changes in GWL depth in the Odessa City area may be affected by both natural structural and anthropogenic factors.

In the end, this paper analyzed the economy from the investment in plant construction, raw material collection, product production and product sales. The resulting products include pyrolytic carbon, pyrolytic oil, pyrolysis gas. The results showed that when the treatment scale was 1 ton h−1, the pyrolysis plants with three loading modes will always be in a state of loss during the 20-year running time. When the processing scale was 9 ton h−1, the pyrolysis plant can be profitable in the first year. In the sensitivity analysis, the influence of three pyrolysis products on the total return on investment was explored. The results showed that the price change of pyrolysis oil has the greatest influence on the total return on investment (Total ROI) under the three loading methods, The price change of pyrolysis gas has minimal impact on the Total ROI. This study provides basic data and basis for the commercialization of coal-biomass co-pyrolysis technology and investment in plant construction.

Urinary tract infections are among the most frequent infectious diseases and require screening of a great amount of urine samples from patients. However, a high percentage of samples results as negative after urine culture plate test (CPT), demanding a simple and fast preliminary technique to screen out the negative samples. We propose a digital holographic microscopy (DHM) method to inspect fresh urine samples flowing in a glass capillary for 3 minutes, recording holograms at 2 frames per second. After digital reconstruction, bacteria, white and red blood cells, epithelial cells and crystals were identified and counted and the samples were classified as negative or positive according to clinical cutoff values. Taking CPT as reference, we processed 180 urine samples and compared the results with those of urine flow cytometry (UFC). Using standard evaluation metrics for our screening test, we found similar performance for DHM and UFC, indicating DHM as a suitable and fast screening technique retaining several advantages. As a benefit of DHM, the technique is label-free and does not require sample preparation. Moreover, the phase and amplitude images of the cells and other particles present in urine are digitally recorded and can serve for further investigation afterwards.

Zero-rate output (ZRO) drift induces deteriorated micro-electromechanical system (MEMS) gy-roscope performances, severely limiting its practical applications. Hence, it is vital to explore an effective method toward ZRO drift reduction. In this work, we conduct an elaborate investigation on the impacts of the internal and packaging stresses on the ZRO drift at the thermal start-up stage, and propose a temperature-induced stress release method to reduce the duration and magnitude of ZRO drift. Self-developed high-Q dual mass tuning fork gyroscopes (TFGs) are adopted to study the correlations between temperature, frequency and ZRO drift. Furthermore, a rigorous finite element simulation model is built based on the actual device and packaging structure, revealing the temperature and stresses distribution inside TFGs. Meanwhile, the relationship between temperature and stresses are deeply explored. Moreover, we introduce a temperature-induced stress release process to generate thermal stresses and reduce the temperature-related device sensitivity. By this way, the ZRO drift duration is drastically reduced from ~2000 s to ~890 s, and the drift magnitude decreases from ~0.4 °/s to ~0.23 °/s. This stress release method achieves a small bias instability (BI) of 7.903 °/h and a low angle random walk (ARW) of 0.792 °/√h, and the long-term bias performance is significantly improved.

The Haar wavelet decomposition technique is used to detect the planetary magnetosphere boundaries and discontinuities. We use the magnetometer data from the CASSINI and MESSENGER spacecraft to identify the abrupt changes in the magnetic field when the spacecraft crossed the magnetospheric bow shocks and magnetopauses of Saturn and Mercury, respectively. The results confirm that the Haar transform can efficiently identify the planetary magnetosphere boundaries characterized by the abrupt magnetic field changes. It is suggested that this technique can be applied to detect the planetary boundaries as well as the discontinuities such as the shock waves in the interplanetary space.

Space vehicles may be propelled by solar sails exploiting the radiation pressure coming from the sun and applied on their surfaces. This work deals with the adoption of Shape-Memory Alloy (SMA) elements in the sail deployment mechanism activated by the Joule Effect, i.e. using the same SMA elements as a resistance within suitable designed electrical circuits. Mathematical models were analyzed for the thermal analysis by implementing algorithms for the evaluation of the temperature trend depending on the design parameters. Several solar sail prototypes were built up and tested with different number, size and arrangement of the SMA elements, as well as the type of the selected electrical circuit. The main parameters have been discussed in the tested configurations and advantages discussed as well.

Nucleoid-associated proteins (NAPs) play an architectural role by bending, bridging, and wrapping the DNA along with a regulatory role of controlling various transcriptional units in the cell. Previews reviews have highlighted the role of HU and its paralog IHF plays in intracellular function as a transcriptional regulator, nucleoid bending protein and sometimes also moonlights in other functions. This review highlights along with the canonical functions of HU and IHF which affects genes responsible for translational machineries, cell wall biosynthesis, aerobic respiration and virulence ; other non-canonical roles which HU plays outside the cellular milieu, notably in acting as an adhesin and playing role in host-cell adhesion, its role in biofilm architecture and its association with cationic low complexity region, resembling histone like H1 proteins. HU and IHF thus has evolved as a hub protein performing a vast type of functions which makes it a important drug target for antibacterial therapy.

The interaction of human immunodeficiency virus with human cells is responsible for all stages of the viral life cycle, from the infection of CD4+ cells to reverse transcription, integration, and the assembly of new viral particles. To date, a large amount of OMICs data as well as information from functional genomics screenings regarding the HIV-1-host interaction has been accumulated in the literature and in public databases. We processed databases containing HIV-host interactions and found 2910 HIV-1-human protein-protein interactions, mostly related to viral group M subtype B, 137 interactions between human and HIV-1 coding and non-coding RNAs, essential for viral lifecycle and cell defense mechanisms, 232 transcriptomics, 27 proteomics, and 34 epigenomics HIV-related experiments. Numerous studies regarding network-based analysis of corresponding OMICs data have been published in recent years. We overview various types of molecular networks, which can be created using OMICs data, including HIV-human protein-protein interaction networks, co-expression networks, gene regulatory and signaling networks, and approaches for the analysis of their topology and dynamics. The network-based analysis can be used to determine the critical pathways and key proteins involved in the HIV life cycle, cellular and immune responses to infection, viral escape from host defense mechanisms, and mechanisms mediating different susceptibility of humans to infection. The proteins and pathways identified in these studies may represent a basis for developing new anti-HIV therapeutic strategies such as new small-molecule drugs preventing infection of CD4+ cells and viral replication, effective vaccines, "shock and kill" and "block and lock" approaches to cure latent infection.

Corrosion is considered as one of the main factors in the structural performance deterioration of steel members. In this study, experimental and numerical methods were used to assess the reduction in compressive strength of short tubular steel columns with local corrosion damage. The corrosion damage was varied with different depths (0, 1.5, 2, 3, 4, 4.5, and 6 mm), height (0, 20, 40, 60, 80, 100, 120, 140, 160, and 180 mm), circumference (0, 90, 180, 270, and 360°), and location along the column. A parametric numerical study was performed to establish a correlation between the residual compressive strength and the severity of corrosion damage. The results showed that as the corrosion depth, height and circumference increased, the compressive strength decreased linearly. As for the corrosion height, the residual compressive strength became constant after decreasing linearly when the corrosion height was greater than the half-wavelength of buckling of the short columns. An equation is presented to evaluate the residual compressive strength of short columns with local corrosion wherein the volume of the corrosion damage was used as a reduction factor in calculating the compressive strength. The percentage error using the presented equation was found to be within 11.4%.

Hepatitis-C is one of the most common viral diseases caused by hepatitis C virus (HCV). It is responsible for millions of deaths each year in the developing world. The common dissemination paths of HCV include the use of contaminated water and transfusion of infected blood. Control of this virus has become a challenge for scientists and health professionals due to its versatility and adaptability in different host environments. Along with other problems, lack of efficient diagnosis, quantification and genotyping of viral strains are the major hindrances in a management of this notorious epidemic. The knowledge of HCV genotype and an amount of virus in patient’s blood are pre-requisites to determine the duration and method of treatment. In this review, we discuss the implications of HCV molecular diagnostic methods and their clinical applications. We conclude that while, several commercial and home-brewed methods are available for this purpose, and there is a visible vacuum for cost effective, robust, sensitive assays that can detect multiple viral genotypes in a single reaction. We are of the view that the level of sensitivity offered by Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) technique is unequivocal as compared to other techniques. Therefore, researchers may explore further possibilities using this technique in the management of HCV.

This study reports multivariate statistical techniques applied including cluster analysis to evaluate and classify the river pollution level in Taiwan, and principal component analysis-multiple linear regression (PCA-MLR) to identify the possible pollution source. Water quality and heavy metal monitoring data from Taiwan Environmental Protection Administration (EPA) was evaluated for 14 rivers in the four regions of Taiwan. The Erren River was classified as the most polluted River in Taiwan. Biochemical oxygen demand, ammonia, and total phosphate concentration in this river were the highest of the 14 rivers evaluated. In addition, heavy metal levels of the following rivers exceeded the Taiwan EPA standard limit: lead - in the Dongshan, Jhuoshuei, and Xinhuwei Rivers; copper - in the Dahan, Laojie, and Erren Rivers; and manganese - in all rivers. Water pollution in the Erren River was estimated to originate 72% from industrial sources, 16% from domestic black water, and 12% from natural sources and runoff from other tributaries. Our research showed that PCA-MLR and the cluster analysis model accomplished our study objectives and will be helpful tools to evaluate water quality in rivers and we suggest that the continuous monitoring should be conducted to monitor water pollution from anthropogenic activities.

Electric Vehicles (EVs) are increasing the interdependence of transportation policies and the electricity market. EMMEV (Electricity Market Model with Electric Vehicles) is an experimental agent-based model that analyses how carbon reduction policy in transportation may increase number of Electric Vehicles and how does that would influence on the electricity price. Agents are ESCOs (Energy Service Providers) which can distribute fuels and their objective is to maximize their profit. In this paper, EMMEV is used to analyze the impacts of the LCFS (Low Carbon Fuel Standard), a performance-based policy instrument, on electricity prices and EV sales. The agents in EMMEV/regulated parties in LCFS should meet a certain CI (Carbon Intensity) target for their distributed fuel. In case, they cannot meet the target, they should buy credit to compensate for their shortfall and if they exceed, they can sell their excess. The results, considering the assumptions and limitations of the model, show that the banking strategy of the agents contributing in the LCFS might have negative impact on penetration of EVs, unless there is a regular Credit Clearance to trade credits. It is also shown that the electricity price as result of implementing the LCFS and increasing number of EVs has increased between 2–3 percent depending on banking strategy.

With the increasing demand for precise condition monitoring and diagnosis of gas-insulated switchgears (GIS), it has become a challenge to improve the detection sensitivity of partial discharge (PD) induced in the GIS spacer. This paper deals with the elimination of the capacitive component from the phase resolved partial discharge (PRPD) signal generated in GIS spacer based on the discrete wavelet transform. Three types of typical insulation defects were simulated using PD cells. The single PD pulses were detected and were further used to determine the optimal mother wavelet. As a result, the bior6.8 was selected to decompose the PD signal into 8 levels and the signal energy at each level was calculated. The decomposed components related with capacitive disturbance were discarded whereas those associated with PD were de-noised by a threshold and a thresholding function. Finally, the PRPD signals were reconstructed using the de-noised components.

UV SO₂ cameras have become a common tool to measure and monitor SO₂-emission-rates, mostly from volcanoes but also from anthropogenic sources (e.g. power plants or ships). In the past years, the analysis of UV SO₂ camera data has seen many improvements. As a result, for many of the required analysis steps, several alternatives exist today. This inspired the development of Pyplis, an open-source software toolbox written in Python 2.7, which aims to unify the most prevalent methods from literature within a single, cross-platform analysis framework. Pyplis comprises a vast collection of algorithms relevant for the analysis of UV SO₂ camera data. These include several routines to retrieve plume background radiances as well as routines for cell and DOAS based camera calibration. The latter includes two independent methods to identify the DOAS field-of-view within the camera images. Plume velocities can be retrieved using an optical flow algorithm as well as signal cross-correlation. Furthermore, Pyplis includes a routine to perform a first order correction of the signal dilution effect. All required geometrical calculations are performed within a 3D model environment allowing for distance retrievals to plume and local terrain features on a pixel basis. SO₂-emission-rates can be retrieved simultaneously for an arbitrary number of plume intersections. Pyplis has been extensively and successfully tested using data from several field campaigns. Here, the main features are introduced using a dataset obtained at Mt. Etna, Italy on 16 September 2015.

Carbon dioxide capture and storage (CCS) is a necessary requirement for high-emitting CO2 industries to significantly reduce volumes of greenhouse gases released to the atmosphere and mitigate the climate change. Geological CO2 storage into depleted oil and gas fields is the fastest and most accessible option for CCS deployment allowing for re-purposing of existing infrastructure and utilizing the significant knowledge about the subsurface acquired during the field production operations. Location of such depleted fields in neighbourhood of high-emitting CO2 industries is additional advantage available for matured on-shore Europe fields. Considering these advantages, the oil and gas operators are now evaluating different possibilities for CO2 sequestration projects for the fields approaching end of production. This article describes an integrated approach to reservoir simulations focused on evaluating CO2 injection pilot at one of such matured fields operated by MND and located in the Czech Republic. The potential CO2 injection site in focus is a naturally fractured carbonate reservoir. This oil-bearing formation has a gas cap at the top and a limited aquifer at the bottom of the reservoir and was produced mainly by pressure depletion with quite limited pressure support from water injection. The article summarizes results of efforts taken by the multi-disciplinary team to develop and apply an integrated approach to reservoir simulation started from geological modelling of the naturally fractured reservoir and integrating results of laboratory studies and their interpretation (geomechanical and geochemistry laboratory experiments) and dynamic field data analysis (pressure transient analysis including time-lapse) into the history matching of the reservoir model and simulations of pilot CO2 injection. Attention is given to evaluating and modelling stress-sensitive fracture properties and safe injection envelope preventing induced fracturing as well as impact of potential salt precipitation in the near wellbore area. These effects are considered in the context of pilot CO2 injection and addressed in reservoir simulations of the injection scenarios. Single porosity and permeability reservoir simulations with dominating fracture flow and black-oil formulation with CO2 simulated as a solvent were used in this study and arguments for such choice of the simulation approach for the site in focus are shortly discussed. The reservoir simulations have indicated larger site injection capacity than required for the pilot injection and allowed to evaluate CO2 migration pathway within the reservoir. The application of the approach to the site in focus has also revealed large uncertainties, related to fracture description and geomechanical evaluations, resulted in an uncertain safe injection envelope. These uncertainties should be addressed in further studies in preparation to the pilot. The article concludes with an overview of the outcomes of the integrated approach and its application to the field in focus including discussion of issues and uncertainties revealed.

As an on-going pandemic caused by the out-break of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) or simply COVID-19 sweeps through the globe at an unprecedented rate leaving behind trails of high infection and mortality, it is crucial to understand the propagation dynamics of the virus in a host population in order to take urgent and effective remedial and mitigating steps to save life. It is already observed in many countries and communities that accurate and timely testing, tracing, and tracking of the infection lead to better containment and slowing down of the spread. In this exploratory research, the early growth dynamics of infection within a population is pursued based on real data. The study posits that the early growth in a homogenous population follows an exponential pattern motivating further rigorous quantitative treatment based on a number of analytical models such as logistic model, Richard’s model, and Gompertz model– the acceleration pattern of the outbreak is ascertained from the daily inflection data, and regression analysis against population models yields dynamic growth indices which allow very accurate prediction of the successive outbreak size when calibrated continually with updated data. The performance of the various models is evaluated with the real dataset. More, the basic reproduction number of the COVID-19 virus propagation in the community is estimated based on the on-set phase dataset using multi-compartmental epidemiological model. Also, the maximum infection size, infection doubling time and the scope of the herd immunity are also inferred for COVID-19 in a population.

Research on early stages of corrosion of steel bars, together with the formation and development of cracks induced in the surrounding concrete and caused by chloride penetration, is relevant in improving the durability of reinforced concrete structures. This paper uses integration of the analytical models examined in the published literature, combined with experimental research in corrosion induced at the concrete/steel interface, in estimating the time-to-crack initiation of reinforced concrete subjected to corrosion. This work studies the influence of the porous network and electric current density on the cracking process at early ages. The experimental campaign was performed by using an accelerated corrosion test on a conventional concrete (CC) and a concrete with silica fume (SFC) by submitting them to a current density of 50μA/cm² and 100μA/cm². Examination performed by scanning electron microscopy (SEM) and energy-dispersive X-ray spectroscopy (EDS) provided both qualitative and quantitative information on the penetration of the rust layer in the surrounding concrete porous network. Strain gauges were used to measure corrosion-induced deformations between steel and concrete matrices, as well as the formation of corrosion-induced cracks. A good correlation between the rate of penetration of the rust products in the surrounding pores and the delay of the cracking pressure in concrete was observed from the experimental results. This phenomenon is incorporated into the analytical model by using a reduction factor, which mainly depends on the pore size of the concrete. The crack width obtained exhibited a significant dependency on electric current density at the beginning of the test, depending mainly on the pore size of the concrete later.

In the crustacean immune system, leucine-rich repeat (LRR) is one of the major structures for recognizing pathogen-associated molecular patterns (PAMPs). LRR domain-containing proteins belong to the LRR family, which is a large group of proteins with more than 6000 genes in the database. They are involved in very diverse physiological functions mainly by interacting with other proteins. In a previous study, the LvLRRm, a transmembrane protein containing only LRR domain, was identified in the white leg shrimp, Litopenaeus vannamei. Its versatile role in performing multiple immunomodulation activities has been reported. However, there is still a lack of research on its efficient function at the protein level. To investigate its interactions with other proteins, we applied a convenient method called ‘Hybrid LRR technique’ to produce a recombinant LvLRRm. The LvLRRm and hagfish’s variable lymphocyte receptors (VLRs) fragments were fused to the conserved LxxLxLxxN motif while retaining the β-strand. In addition, we established interactions between hybrid-proteins and flagellin of Salmonella by performing surface plasmon resonance (SPR) analysis. The designed hybrid proteins showed potential for universal applications without losing protein functions.

Revealing the multidimensional value of cultivated land resources, improving calculation methods, and exploring their spatial distribution characteristics and influencing factors are crucial for the enhancement of natural resource accounting system and the protection of cultivated land resources. This study take Guangxi, China as an example and construct a comprehensive multidimensional value evaluation system for cultivated land resources at the county scale. The income capitalization method, substitution market method, and value equivalent correction method were applied to calculate the economic, social, and ecological values of cultivated land resources in 111 counties. Furthermore, spatial autocorrelation analysis was employed to study their distribution characteristics and influencing factors. The results show that: (1) The total value of cultivated land resources in Guangxi reach 19,729.2 billion yuan, and the average cultivated land value is 5.3511 million yuan/hm2, of which the ratio of economic, social and ecological values is about 6:1:2; (2) The value of cultivated land has a certain distribution pattern in the global space, and the average economic and social value show the spatial distribution patterns of "low in the west and high in the east" and "low in the northwest and high in the southeast" respectively."(3) There is a significant spatial clustering effect of all values of cultivated land resources in local space, with "high-high" and "low-low" clustering. (4) Economic development level is significantly negatively correlated with the ecological value of cultivated land, while has a significant positive correlation with social value; (5) Natural conditions, economic development and agricultural development approaches are the key factors affecting the value of cultivated land resources.

AliAmbra is a project developed to explore and promote high-quality catches of the Amvrakikos Gulf GP to Artas’ wider regions. In addition, this project aimed to implement an integrated plan of action, to form a business identity with high-added value and achieve integrated business services adapted to the special characteristics of the area. The action plan for this project was to actively search for new markets, create a collective identity for the products, promote their quality and added value, engage in gastronomes and tasting exhibitions, dissemination and publicity actions, as well as enhance the quality of the products and markets based on the customer needs. The primary focus of this publication is to observe and analyze the data retrieved from various tasting exhibitions of the AliAmbra project, with a target goal of improving customer experience and product quality.

Natural language processing (NLP) is being widely used globally for a variety of value-creation tasks ranging from chat-bots and machine translations to sentiment and topic analysis and multilingual large language models (LLMs). However, most of the advances are initially implemented within the English language framework, and it takes time and resources to develop comparable resources in other languages. The advances in machine translations have enabled the rapid and effective conversion of content in global languages into English and vice-versa. This creates potential opportunities to apply English language NLP methods and tools to other languages via machine translations. However, although this idea is powerful, it needs to be validated and processes and best practices need to be developed and kept updated. The present research is an effort to contribute to the development of best practices and an evaluation framework. We present a systematic and repeatable state-of-the-art process to evaluate the viability of applying English language sentiment analysis tools to Italian text by using multiple English language machine translation mechanisms such that it can be easily extended to other languages. hor[RU,RA]{\large Richard Anderson} \address[RU]{\large Rutgers University, USA} \address[RA]{\large [email protected]} \author[RU]{\large Carmela Scala} \author[RU]{\large Jim Samuel} \author[UC]{\large Vivek Kumar} \address[UC]{\large University of Cagliari, Italy} \author[RU]{\large Parth Jain}

The present paper describes a study case of the failure investigation of Duplex stainless steel (UNS S31803) on the tube and tube sheet section of a shell and tube heat exchanger BEM TEMA type with seawater as the cooling medium. Although UNS S31803 offers high strength, high resistance to chloride-induced SCC, and high resistance to pitting attack in chloride environments, in this study case, the heat exchanger experienced some material degradation; 26 tubes were leaked and plugged on both sides, and scales plugged 76 tubes. The examination in this study case revealed the formation of biofilm inside the tubes, XRD examination revealed that the film contained aragonite (CaCO3), and by using microstructural examination on the inner surface of the tube, the austenite grains were preferentially attacked by crevice corrosion. In this case, the failure was caused by crevice corrosion, and crevice corrosion was enhanced by microbiological-induced corrosion (MIC). Recommendations to avoid similar failures are also suggested in this paper.

Background: Cervical laminoplasty is a useful for treatment of cervical myelopathy. However, this procedure has limitations for kyphotic cervical alignments. We used the finite element (FE) analysis and investigated the biomechanical changes in an intact and laminoplasty models with lordosis, straight, and kyphosis cervical alignments. Methods: A three-dimensional FE model of the cervical spine (C2-C7) with ligaments was created from computed tomography. The model was modified with the following cobb angles and the C3-C6 laminoplasty was conducted; a) laminoplasty-lordotic model (LM-L; C2-C7 angle: -10°), b) laminoplasty-straight model (LM-S; C2-C7 angle: 0°), and c) laminoplasty-kyphotic model (LM-K; C2-C7 angle: 10°). A pure moment with a compressive follower load of 100N to represent the weight of the head/cranium and cervical muscle stabilization was applied to these models. The range of motion (ROM), annular stress, nucleus stress and facet forces were analyzed. Results: ROM of LM-K increased when compared to the other models except for flexion. The LM-K had the highest mobility with 49% increase in ROM observed under extension, compared to the intact model. In all motion except for flexion, LM-L models’ ROM decreased by more than 10%, and LM-S and LM-K models’ ROM increased by more than 10% at C2-C7 compared to the intact model. The annular stresses and nucleus stresses in LM-K were higher compared to the other models. The maximum increase in annular stresses was about 194% in LM-K compared to the intact model, observed at the C3-C4 segment. The facet contact forces were lowest in the LM-K, compared to the other models.Conclusions: Patients with a cervical kyphosis alignment are at a disadvantage of increased kyphosis compared to cases with lordosis or straight alignment and should be treated with caution.

Evidence of familial inheritance in non-medullary thyroid cancer (NMTC) has accumulated over the last few decades. However, known variants account for a very small percentage of the genetic burden. Here, we focused on the identification of common pathways and networks enriched in NMTC families to better understand its pathogenesis with the final aim of identifying one novel high/moderate-penetrance germline predisposition variant segregating with the disease in each studied family. We performed whole genome sequencing on 23 affected and 3 unaffected family members from five NMTC-prone families and prioritized the identified variants using our Familial Cancer Variant Prioritization Pipeline (FCVPPv2). In total, 31 coding variants and 39 variants located in upstream, downstream, 5′ or 3′ untranslated regions passed FCVPPv2 filtering. Altogether, 210 genes affected by variants that passed the first three steps of the FCVPPv2 were analyzed using Ingenuity Pathway Analysis software. These genes were enriched in tumorigenic signaling pathways mediated by receptor tyrosine kinases and G-protein coupled receptors, implicating a central role of PI3K/AKT and MAPK/ERK signaling in familial NMTC. Our approach can facilitate the identification and functional validation of causal variants in each family as well as the screening and genetic counseling of other individuals at risk of developing NMTC.

INTRODUCTION: The purpose of the study was to determine (a) the overall preclinical character; (b) the cumulative cutoff values and the risk ratio, and (c) the factors associated with severity by a unidimensional and multidimensional analysis on 2173 Sars-Cov2 patients. METHODS: The machine learning study population consisted of 2173 patients (1587 mild and non symptoms patients, 377 moderate patients, 209 severe patients). The status of the patients was recorded from September 2021 to March 2022. RESULTS: The Covid19 Severity directly links with a significant correlation to Age, Score index of the chest X-ray, percentage and quantity of neutrophils, Albumin, C reactive protein, and ratio of Lymphocytes. Their important cut off values (from regression analysis) respectively are: 77.56 years old (the mild-moderate group), 5.53 (the mild-moderate group) and 10.51 (the moderate-severe group), 84.80% (the mild-moderate group) and 87.74%(the moderate-severe group), 11.77G/L (the moderate-severe group), 29.73g/L (the moderate-severe group), 7.46mg/dL (the mild-moderate group), 6.32% (the moderate-severe group). Their significant (p<0.0001) R score correlation with the severity of Covid19, are: 0.44, 0.52 and 0.52, 0.33 and 0.44, 0.42, -0.43, 0.40, -0.41. Their significant risk ratio (p<0.00001) from the meta-analysis, respectively are: 4.19 [3.58-4.95], 3.29 [2.76-3.92] and 3.03 [2.4023;3.8314], 3.18 [2.73-3.70] and 3.32 [2.6480;4.1529], 3.15 [2.6153;3.8025], 3.4[2.91-3.97], 0.46 [0.3650;0.5752] (p<0.00001), 0.34 [0.2743;0.4210]. The pair ALT – Leucocytes and Transferrin – Anion Chloride get the most important correlation shift. ALT – Leucocytes show the important negative link (R=-1, p<0.00001) in the mild group to the significant positive correlation in the moderate group (R=1, p<0.00001). Transferrin–anion Chloride has an important positive association (R=1, p<0.00001) in the mild group with a significant negative correlation in the moderate group (R=-0.59, p<0.00001). The network map and HCA show that in the mild-moderate group, the closest neighbors with the Covid19 severity are ferritins, Age. Then there is C-reactive protein, SI of X-ray, Albumin, and Lactate dehydrogenase, which are the next close neighbors of these three factors. In the moderate-severe group, the closest neighbors with the Covid19 severity are Ferritin, Fibrinogen, Albumin, the quantity of Lymphocytes, SI of X-ray, white blood cells count, Lactate dehydrogenase, and quantity of neutrophils. CONCLUSIONS: Complete multidimensional study in 2173 Covid19 patients in Vietnam shows the whole picture of all the preclinical factors, which may become the clinical reference marker for surveillance and diagnostic management

Anti-microbial drugs and coccidiostat compounds are commonly used in poultry farming. These compounds are subsequently excreted and released into the environment via broiler litter (BL) and can re-enter the food chain as fertilizer and/or animal feed. Residues of such drugs can encourage the appearance of antibiotic-resistant bacteria (ARB), as well as toxicity, when found in animal feed. The aim of this study was to develop a multi-residue analytic method for assessing 30 an-ti-microbial drugs and coccidiostats associated with BL and investigate the effects of stacking treatment on anti-microbial and coccidiostat residue degradation in BL used for ruminant feed at the lab-scale. Today, most analytical methods used to identify and quantitate these drug residues are traditional, and may be specific to some antimicrobials. All call for lengthy sample preparation and may present limitations in assessing broiler litter. Such conventional mul-ti-anti-microbial/coccidiostat residue detection assays employ liquid-liquid extraction (LLE) and solid phase extraction (SPE) for sample purification. In our research, LLE and SPE were replaced by Quick, Easy, Cheap, Effective, Rugged and Safe (QuEChERS) clean-up steps for 30 an-ti-microbials and coccidiostats used in broiler farming and detection by liquid chromatography mass spectrometry (LC/MS/ MS). Using this method, recoveries were 70-120%, with the exception of norfloxacin and narasin, which showed recoveries of 67 and 68%, respectively. This analytical meth-od results show that eight samples were not detected in 42 samples, while in 34 samples, one or more drugs were present. Eighteen anti-microbial and coccidiostat residues were detected dur-ing one year sample collaction. The most frequently detected residues were narasin, nicarbazin, monensin, robenidine, oxytetracycline, chlortetracycline, norfloxacin and sulfachloropyridazine, seen at levels from 0.4 to 8.9 mg•kg-1 (ppm). Nineteen anti-microbials and one coccidiostat were degraded to 95% by the stacking treatment. However, tilmicosin and eight coccidiostats persisted in litter (26-100%). The use of antimicrobials and coccidiostats in animal farming is of paramount concern with respect to human, animal and environmental contamination issues and as a source of resistant pathogenic bacteria. Still, most farmers use BL as ruminant feed and fertilizer without processing. Even though the effects of the stacking treatments on degradation of antimicrobials were significantly high, the degradation of coccidiostats and tilmicosin was limited. Clearly, BL should be treated and supervised before use as feed supplement or for land application. Hence, the present method, designed to support these goals, was optimized in terms of sensitivity and se-lectivity for the analytes addressed.

The treatment of insulin-dependent diabetes mellitus is characterized by artificial supplementation of pancreatic β-cell ability to regulate sugar levels in the blood. Even though various insulin analogs are crucial for reasonable glycemic control, understanding the dynamic mechanism of the insulin analogs may help to improve the best-protracted insulin analog to assist people with Type 1 Diabetes (T1D) to live comfortably while maintaining tight glycemic control. Here we present the high-resolution crystal structure of NN304, known as insulin detemir, to 1.7 A resolution at cryogenic temperature. We computationally further investigated our crystal structure's monomeric-dimeric conformation and dynamic profile by comparing it with a previously available detemir structure (PDB ID: 1XDA). Our structure (PDB ID: 8HGZ) obtained at elevated pH provides a distinct alternative dimeric conformation compared to the previous structure, suggesting it might induce an intermediate state in the dissociation pathway of the insulin detemir’s hexamer:dihexamer equilibrium. Combined with orientational cross-correlation analysis by Gaussian Network Model (GNM), this alternate oligomeric conformation offers the distinct cooperative motions of a protracted insulin analog that has not been previously observed.

Leucine-rich repeat receptor-like kinases (LRR-RLKs) have been reported to play important roles in plant growth, development and stress responses. However, no comprehensive analysis of this family has been performed in Gossypium, which are important economic crop and suffer various stresses in growth and development. Here we conducted a comprehensive analysis of LRR-RLK family in four Gossypium species (G. arboreum, G. barbadense, G. hirsutum and G. raimondii). A total of 1641 LRR-RLK genes were identified in the four Gossypium species involved in our study. Maximum-likelihood phylogenetic tree revealed that all the LRR-RLK genes were divided into 21 subgroups. Exon-intron organization structure of LRR-RLK genes kept relative conserved in subfamilies and between Arabidopsis and Gossypium. Subfamilies XI and XII were found dramatically expanded in Gossypium. Tandem duplication acted as an important mechanism in expansion of Gossypium LRR-RLK gene family. Function analysis suggested that plant hormone signaling and plant-pathogen interaction pathway were enriched in Gossypium LRR-RLK genes. Promoters analysis and expression profiles analysis revealed that Gossypium LRR-RLK genes were extensively regulated by TFs, phytohormone and various environmental stimuli, and play key roles in stress defense and diverse development processes. Our study provided valuable information for further function study of Gossypium LRR-RLK genes.