In Spain, the National Health System, of a public nature, provides care to Spaniards and other residents in Spain. It is a system adapted to the State of Autonomies, decentralized. Each Auton-omous Community has legislative capacity in its organization and management. We studied the agreement of private hospitals by the public system in La Rioja, an Autonomous Community of Spain located in the North of the Iberian Peninsula. Documentary sources from the General archives of La Rioja, the Institute of Riojan Studies, municipal funds (Logroño, Haro, Calahorra), and in-formation from catalogs and censuses of hospitals from the Ministry of Health, National Institute of Statistics, and Institute of Statistics of La Rioja have been reviewed. The hospital model of La Rioja is characterized by a predominance of public beds over private ones, although there is a growing trend in the number of private beds from 2013 onwards, due to the incorporation of two conva-lescent socio-health hospitals. A characteristic element of La Rioja has been the promotion of pub-lic-private collaboration, conceived as a strategic alliance. Regarding agreements, in La Rioja there has been a specialization in the socio-health space, whose formulas have been the management service contract and the concession of work. The development of the Health System in La Rioja, 1986-2019, has been determined by the presence of a mixed public-private hospital system and a progressively lower dependence on specialized hospitals from other Autonomous Communities.

Background: The COVID-19 pandemic has sped up digital health transformation across the health sectors to enable innovative health service delivery. Such transformation relies on competent managers with the capacity to lead and manage. However, the health system has not adopted a holistic approach in addressing the health management workforce development needs, with many hurdles to overcome. The objectives of this paper are to present the findings of a three-step approach in understanding the current hurdles in developing a health management workforce that can enable and maximise the benefits of digital health transformation, and to explore ways of overcoming such hurdles. Methods: A three-step, systematic approach was undertaken, including an Australian digital health policy documentary analysis, an Australian health service management postgraduate program analysis, and a scoping review of international literatures. Results: The main findings will guide the formulation of strategies in developing a digitally enabled health management workforce in the digital health era. Conclusions: With the ever-changing landscape of digital health, being able to lead and manage in times of system transformation requires a holistic approach to develop the necessary health management workforce capabilities and system-wide capacity. The evidence would support that this can be achieved with the required system, policy, educational and professional organizational enablers, which drive a digital health focused approach across all the healthcare sectors, in a coordinated and contextual manner.

In a dynamic production processes, mechanical degradation poses a significant challenge, impacting product quality and process efficiency. This paper explores a novel approach for monitoring degradation in the context of viscose fiber production, a highly dynamic manufacturing process. Using causal discovery techniques, our method allows domain experts to incorporate background knowledge into the creation of causal graphs. Further, it enhances the interpretability and increases the ability to identify potential problems via changes in causal relations over time. The case study employs a comprehensive analysis of the viscose fiber production process within a prominent textile industry, emphasizing the advantages of causal discovery for monitoring degradation. The results are compared with state-of-the-art methods, which are not considered to be interpretable, specifically LSTM-based autoencoders, showcasing the alignment and validation of our approach. This paper provides valuable information on degradation monitoring strategies, demonstrating the efficacy of causal discovery in dynamic manufacturing environments. The findings contribute to the evolving landscape of process optimization and quality control.

Grapevine is one of the most relevant crops in the world being used for economically important products such as wine. Yet, relevant grapevine cultivars are heavily affected by diseases such as the downy mildew disease caused by Plasmopara viticola. Improvements on grapevine resistance are made mainly by breeding techniques where resistance traits are introgressed into cultivars with desired grape characteristics. However, there is still a lack of knowledge on how resistant or tolerant cultivars tackle the P. viticola pathogen. In this study, using a shotgun proteomics LC-MS/MS approach, we unravel the protein modulation of a highly tolerant grapevine cultivar, V. vinifera ‘Regent’, in the first hours post inoculation (hpi) with P. viticola. At 6 hpi, proteins related to defence and to response to stimuli are negatively modulated while at 12 hpi there is an accumulation of proteins belonging to both categories. The co-occurrence of effector-triggered susceptibility (ETS) and effector-triggered immunity (ETI) is detected at both time-points, showing that these defence processes present high plasticity. The results obtained in this study unravel the tolerant grapevine defence strategy towards P. viticola and may provide valuable insights on resistance associated candidates and mechanisms, which may play an important role in the definition of new strategies on breeding approaches.

The intensification of modern farming methods in developed nations has exacerbated the issue of soil degradation and over-utilization of naturally available resources, hence, tinkering negatively with the health and productive capacity of soil. Chemical fertilizers, while increasing crop yields, have resulted in environmental pollution and health hazards. Green manuring presents a sustainable alternative by enriching soil fertility and reducing reliance on chemical fertilizers. This paper reviews the impact of green manuring on soil properties, crop yield, and farm economies. In-situ green manuring involves growing and incorporating the crops within the field, while ex-situ green manuring incorporates plant material from external sources. Leguminous green manures are particularly effective owing to nitrogen fixation capability and rapid decomposition. The inclusion of green manure improves the availability of nutrients, microbial count and carbon content of the soil, thereby, enhancing the overall health of soil and crop productivity. Additionally, green manures reduce pests and diseases, suppress weeds, and provide supplementary forage. Despite the benefits, challenges such as limited water resources, seed availability, and farmer reluctance hinder widespread adoption. Future research should focus on raising awareness, quantifying benefits, and developing location-specific cropping systems to optimize green manuring practices.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Positive Health (PH) has been described as a promising transformative innovation to address the challenges of promoting well-being and reducing the burden of disease. The aim of this study is to review the current state of knowledge about PH as introduced by Huber et al. (2016) within the available scientific literature. A rapid review of the literature following the Cochrane Rapid Review recommendations. Three databases were searched (PubMed, Google Scholar, and CINAHL). Data were extracted and synthesized using a narrative approach. A total of 55 articles were included. Initial evaluation studies reveal promising results both at individual and collective levels. However, a need is expressed in several articles for further refinement of the conceptualization of PH and ways to make the effects of the PH approach more measurable. Professionals also expressed a desire for a more informed application and elaboration of the PH method across various settings and populations to enhance its effectiveness in practice. This rapid review highlights the transformative potential of PH in shifting from a disease-focused to a health-oriented paradigm of healthcare. It underscores the need for continued research regarding further development of the concept and its practical method, along with the necessity for methodological innovation.

Cars are a highly inefficient mode of urban transport with significant negative impacts. Electric vehicles make it possible to eliminate direct CO2 emissions (though the total over a vehicle’s entire life cycle greatly offsets the advantages) but leave unchanged – or even aggravate – all the other negative effects on the quality of urban environments. Three visions for urban transport were presented: automobility, multimodality and accessibility. The first dominates North American cities, the second European one. The anomalies of these two visions have been examined. The automobility cities cannot manage the congestion and the attempts are self- defeating. The anomalies of multimodality city are related to the public space consumption for mobility and the impossibility to plan spatial proximity. The sustainable vision, that resolve the anomalies, is represented by the accessibility city in the Triple Access System (TAS) version which, however, still has a long way to go to be accepted and implemented.

Previous research suggests that the economic crisis can affect mental health. The purpose of this study was to analyse the association of risk of poor mental health with various socioeconomic, demographic, health, quality of life and social support variables; and to evaluate the contribution of socioeconomic variables most affected by the beginning of the economic crisis (employment situation and income) on the changes in the prevalence of the risk of poor mental health between 2005 and 2010. A study of prevalence evolution in adult population residents of the Valencian Community in the Spanish Mediterranean was conducted. We studied 5781 subjects in 2005 and 3479 in 2010. Logistic regression models have been adjusted to analyse the association between variables. A standardization procedure was carried out to evaluate which part of the changes in overall prevalence could be attributed to variations in the population structure by age, sex, employment status and income between the years under study. The prevalence of GHQ + increased from 2005 to 2010, in both men and women. Several variables were closely associated with the risk of poor mental health (sex, age, country of birth, number of non-mental chronic diseases, social support, disability, cohabitation in couple, employment status, and income). The changes produced as a result of the onset of the economic crisis in income and unemployment (increase in low income and in unemployment rates) contributed to the increase of poor mental health risk. This could confirm the sensitivity of mental health to the economic deterioration caused by the crisis.

COVID-19 is a potentially fatal viral infection. This study investigates geography, demography, socioeconomics, health conditions, hospital characteristics, and politics as potential explanatory variables for death rates at the state and county levels. Data from the Centers for Disease Control and Prevention, the Census Bureau, Centers for Medicare and Medicaid, Definitive Healthcare, and USAfacts.org were used to evaluate regression models. Yearly pneumonia and flu death rates (state level, 2014-2018) were evaluated as a function of the governors’ political party using repeated measures analysis. At the state and county level, spatial regression models were evaluated. At the county level, we discovered a statistically significant model that included geography, population density, racial and ethnic status, three health status variables along with a political factor. State level analysis identified health status, minority status, and the interaction between governors’ parties and health status as important variables. The political factor, however, did not appear in a subsequent analysis of 2014-2018 pneumonia and flu death rates. The pathogenesis of COVID-19 has greater and disproportionate effect within racial and ethnic minority groups, and the political influence on the reporting of COVID-19 mortality was statistically relevant at the county level and as an interaction term only at the state level.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

Concerning the hippocampal mechanisms that simultaneously function to map environmental position and to generate episodic memories, a developing consensus emerged by the early 21st century. The hippocampus was recognized as embodying the primary location of personal narrative development, with the ability to create stable and coherent narrative largely representing the mental health of individuals. Determining recent advances regarding the relationship among the hippocampus, narrative, and mental health, a limited, six-database review was conducted for peer reviewed articles published since 2019. Of the 127 records located, 14 reports were included for study. The results support the necessity of creating and maintaining a stable and coherent narrative as fundamental to human mental health such that facts will be distorted in personal accounts, sleep will be disrupted, and DNA altered to retain one’s personal narratives. With narrative development fundamental to human mental health, a goal of interventions concerning hippocampal function and positive health outcomes is enhancing personal narratives in providing individuals with the ability to construct and recall those that are robust and effective. One such intervention that has proven successful in this regard, the Health Narratives Research Process, is outlined with its most recent results presented, offering opportunity for further such research.

In the whole world, including Mexico, the rising prevalence of diabetes poses significant challenges to healthcare systems, with a notable impact on hospital admissions even being an ambulatory care sensitive condition, that means, hospital admissions are avoidable. Traditional healthcare methodologies have been instrumental in managing diabetes and preventing complications, yet they often face limitations such as merging, cleansing, and outlier analysis of health data to identify and address diseases effectively. This paper aims to address this gap by conducting a comprehensive comparison of the methodologies used in healthcare and data science for this purpose. This work uses hospital diabetes discharge records from 2010 to 2023, a total of 36,665,793 records, which belong to medical units of the Ministry of Health of Mexico. In this work, we seek to provide the arguments why as a data scientist it is mandatory to learn the field of knowledge of the problem and its implications if this is not done, and therefore to disclose insights that can help in policy decisions and reduce the burden of avoidable hospitalizations. The approach is mainly based on the standardization or adjust rates by sex and age groups. This study provides the foundations for a new way of data scientist must deal with health data.

Causation concepts for work-related musculoskeletal disorders vary among authors and academic disciplines. Major causation concepts are single-event and repetitive motion. The aim of this short communication is to share findings from a recent survey, conducted by the U.S. Bureau of Labor Statistics of United States employers about work-related musculoskeletal cases, and more specifically, about whether the employers regard the cause of their employee’s musculoskeletal problem as being from a single exposure or from multiple exposures. Recommendations are offered for using terminology consistent with employer understandings.

Introduction: congenital ureteral stenosis is one of the leading causes of impaired urinary drainage and subsequent dilatation of urinary collecting system, known as hydronephrosis or ureterohy-dronephrosis. Mechanism that leads to obstruction is not clearly known. Multiple studies in rat models have shown increased angiotensin 11 and TGFβ levels in obstructed ureteral tissue. The aim of the study is to investigate expression of fibrosis related genes in obstructive and normal ureteral tissue. Material and methods: it is a monocentric study in which nineteen patients were selected prospec-tively. 17 patients of which underwent Hynes-Anderson pyeloplasty due to the PUJO, 2 patients underwent ureteroneocystostomy due to ureterovesical junction obstruction (UVJO) and 6 patients were chosen for control group: 5 underwent nephrectomies due to the kidney tumor and 1- upper pole heminephrectomy due to the duplex kidney with normal pyeloureteric junctions in all. Tissue RNA was chemically extracted after freezing the biopsy samples in liquid nitrogen, with cDNA synthesis performed immediately after nucleic acid isolation. qPCR to evaluate the relative expres-sion of Tgfb1, Mmp1, Timp1, Pai1, Ctgf and Vegfa was performed. Expression levels of Gapdh and Gpi genes (geometric average) were used to calculate the relative expression of the investigated genes. Outliers were removed prior to calculating confidence intervals for the experimental groups, and Wilcoxon rank-sum test was performed to determine statistical significance of the differences. Results: significant differences between healthy and stenotic tissue samples in Ctgf gene expression levels were observed, with the samples from afflicted tissue showing lower expression. No statistical difference in expression levels of Tgfb1, Timp1, Vegfa, Mmp1, Pai1 was found. Discussion and conclusions: These findings suggest that tissue fibrosis similar to other tissues and organs is not the leading cause of stenosis, at least at the moment of surgery. Decreased CTGF ex-pression is indicative of developmental origin of obstruction.

The vacuolar H+-ATPase is a multisubunit enzyme which plays an essential role in the acidification and functions of lysosomes, endosomes, and synaptic vesicles. Many genes encoding subunits of V-ATPases, namely ATP6V0C, ATP6V1A, ATP6V0A1 and ATP6V1B2, have been associated with neurodevelopmental disorders and epilepsy. The autosomal dominant ATP6V1B2 p.Arg506* variant can cause both deafness, congenital, with onychodystrophy, autosomal dominant (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS). Some but not all individuals with this truncating variant have intellectual disability and/or epilepsy, suggesting incomplete penetrance and/or variable expressivity. To further explore the impact of the p.Arg506* variant in neurodevelopment and epilepsy, we generated Atp6v1b2emR506* mutant mice and performed standardized phenotyping using the International Mouse Phenotyping Consortium (IMPC) pipeline. In addition, we assessed the EEG profile and seizure susceptibility of Atp6v1b2emR506* mice. Behavioral tests revealed that the mice present locomotor hyperactivity and show less anxiety-associated behaviors. Moreover, EEG analyses indicate that Atp6v1b2emR506* mutant mice have interictal epileptic activity and that both heterozygous (like patients) and homozygous mice have reduced seizure thresholds to pentylenetetrazol. Our results confirm that variants in ATP6V1B2 can cause seizures and that the Atp6v1b2emR506* heterozygous mouse model is a valuable tool to further explore the pathophysiology and potential treatments for vacuolar ATPases-associated epilepsy and disorders.

Abstract: Windtech device is a novel tool for measuring the sensation of the ‘cold’. Cold poses numerous challenges for industrial operations, human survival, and living convenience. The impact of the cold is not possible to be quantified just based on temperatures; however other factors such as wind speed, humidity, irradiance have to be taken into consideration. Efforts have been made to develop combined indices such as wind chill temperature (WCT), AccuWeather RealFeel®, and others. The presented article discusses these along with the industrial standards that emphasize on the quantification of the ‘cold’. The following article introduces the Windtech device and its operating principle involving ‘heated temperature’, where the ‘heated temperature’ is affected by environmental parameters including ambient temperature, humidity, wind velocity, and irradiance. The discussed Windtech device is calibrated for operation according to the ISO 11079:2007 standard.

Objective: To examine the associations between menstruation features and symptoms and hormone-immune-metabolic biomarkers. Methods: Forty-one women completed questionnaires assessing characteristic menstruation symptoms, duration of menstrual cycle and number of pads used/day and completed the Daily Record of Severity of Problems (DRSP) during the consecutive days of their menstrual cycle. Menses-related symptoms (MsRS) were computed from the sum of 10 pre- and post-menses symptoms and the menstruation blood and duration index (MBDI) was computed based on the daily number of pads and duration of menses. We assayed serum levels of various biomarkers at days 7, 14, 21, and 28 of the subjects’ menstrual cycle. Results: MBDI was significantly associated with a) MsRS including low abdominal cramps, and gastro-intestinal (GI) and pain symptoms (positively); b) plasma levels of haptoglobin (Hp), CCL5, insulin growth factor (IGF)-1, and plasminogen activator inhibitor (PAI)1 (all positively); and c) estradiol and paraoxonase (PON)1 arylesterase activity (both inversely). MsRS were significantly predicted by CCL5 and IGF-1 (both positively) and progesterone (inversely). Low-abdominal cramps, and gastro-intestinal and pain symptoms were associated with lower progesterone levels. The MBDI+MsRS score was significantly predicted by the cumulative effects of (in descending order of importance): Hp, IGF-1, PON1 arylesterase, estradiol and PAI. Conclusion: Menstruation-related features including estimated blood loss, duration of menses, cramps, pain and GI symptoms are associated with hormone-immune-metabolic biomarkers, which mechanistically may explain those features. Women with an increased MBDI+MsRS index ≥ 0.666 percentile may be considered to have menstruation-related distress, including dysmenorrhea symptoms.

Disease related malnutrition (DRM) is prevalent in hospitals and is associated with increased care needs, prolonged hospital stay, delayed rehabilitation and death. Nutrition care process related activities such as screening, assessment and treatment has been advocated by scientific societies and patient organizations but implementation is variable. We analyzed the cross-sectional nutritionDay database for prevalence of nutrition risk factors, care processes and outcome for medical patients. In 59126 medical patients included between 2006-2015 the prevalence of recent weight loss (45%), history of decreased eating (48%) and low actual eating (53%) was more prevalent than low BMI (8%). Each of these risk factors was associated with a large increase in 30 days hospital mortality. Nutrition care processes increases slightly with presence of risk factors but never done in more than 50% of patients. Only a third of patients not eating in hospital receive oral nutritional supplements or artificial nutrition. We suggest that political action should be taken to raise awareness and formal education on all aspects related to DRM for all stakeholders, to create and support responsibilities within hospitals, and to create adequate reimbursement schemes. Collection of routine and benchmarking data is crucial to tackle DRM.

The link between language processing and motor systems has been the focus of increasing interest to Cognitive Neuroscience. Some classical papers studying Event Related Potentials (ERPs) induced by linguistic stimuli have found differences in electrophysiological activity when comparing action and non-action words; more specifically, a bigger p200 for action words. On the other hand, a series of studies have validated the use of a grip force sensor (GFS) to measure language-induced motor activity during both isolated words and sentence listening, finding that action words induce an augmentation in the grip force around 250-300 ms after the onset of the stimulus. The purpose of the present study is to combine both techniques to assess if the p200 is related to the augmentation of the grip force measured by a GFS. We measured ERP and GFS changes elicited by listening to action and non-action words while maintaining an active grasping task in 10 healthy subjects. Our results show that the amplitude of the p200 in central electrodes is correlated to the augmentation in the GFS around 300 ms induced by linguistic stimuli. To our knowledge, this is the first study where the electrophysiological activity and the changes in the grip force induced by auditory language processing are put together, opening new venues of interpretation for the sensorimotor interaction in language processing.

The mechanization of agricultural activities has led to indiscriminate deposition of toxic xenobiotics, including organophosphates in the biomes, and this has led to intoxication characterized with deleterious oxidative and neuronal changes. This study investigated the consequences of oxidative and neurogenic disruptions that follow exposure to two organophosphates, chlorpyrifos (CPF) and dichlorvos (DDVP) on neuro-cognitive performance and anxiety-like behaviors in rats Thirty-two adult male Wistar rats (150 – 170g) were randomly divided into 4 groups, orally exposed to normal saline (NS), DDVP (8.8mg/kg), CPF (14.9mg/kg) and DDVP+CPF for 14 consecutive days. On day 10 of exposures, anxiety-like behaviors and amygdala dependent fear learning were assessed using Open Field and Elevated Plus Maze paradigms respectively, while spatial working memory was assessed on day 14 in the Morris water maze paradigm, following 3 training trials each on days 11, 12 and 13. On day 15, the rats were euthanized, and their brains excised, hippocampus and amygdala removed, 5 of which were homogenized and centrifuged to analyze nitric oxide (NO) metabolites, total reactive oxygen species (ROS), and acetylcholinesterase (AChE) activity, and the other three processed for histology (cresyl violet stain) and proliferative marker (Ki67 immunohistochemistry). Marked (p≤0.05) loss in body weight, AChE depletion, and overproduction of both NO and ROS were observed after repeated exposure to individual and combined doses of CPF and DDVP. Insults from DDVP exposure appeared more severe owing to the observed greater losses in the body weights of exposed rats. There was also a significant (p≤0.05) effect on the cognitive behaviors recorded from the exposed rats, and these deficits were related to the oxidative damage and neurogenic cell loss in the hippocampus and the amygdala of the exposed rats. Taken together, these results provided an insight that oxidative and neurogenic damages are central to the severity of neuro-cognitive dysfunction and increased anxiety-like behaviors that follow organophosphate poisoning.

The present short communication aimed to determine the effects of vegetable cultivation on health. We conducted a qualitative study using responses to an open-ended question that was part of a survey on regional differences on vegetable intake. Participants in this study were residents of Gunma Prefecture, Japan, and were aged between 20–74 years. In the questionnaire, we asked: “Aside from increasing vegetable intake, how does vegetable cultivation affect your health?” We were able to categorize the answers into six subcategories related to physical health, mental health, and social well-being.

Background: Drinking and smoking have economic consequences and are the main risk factors of mortality and morbidity. Disease-specific deaths attributable to using substances present the primary health indicator in this study. This analysis focuses on mortality in productive age, 15 to 64 years since those deaths are considered the highest economic burden. Method: In the analytical part, data from the Registry of deaths of the Czech Republic for 1994 to 2017 were used. The number of deaths attributable to smoking and drinking was calculated using attributable fractions, based on literature review. This research aimed to reveal the gender differences in deaths attributable to drinking and smoking, according to age, and the differences in deaths regarding smoking or drinking. Results: The mortality attributable to smoking and drinking differs across age groups and genders. The highest median share of tobacco-related deaths is in the age group, 60—64 years. The highest median share of alcoholic deaths is in the age group of 50—54 years. Conclusions: There are significant differences between genders in both, smoking and drinking. A prevention program should be targeted to different age groups.

Background: The potential of Artificial intelligent (AI) models to process and interpret large health datasets at scale could revolutionize public health and epidemiology, providing a foundation for public health. Ethics has been recognized as a priority concern in the development and deployment of AI. Because AI technology can jeopardize patient safety, privacy, and posing a new set of ethical problems that must be addressed. Objectives: We aim to provide a holistic view on what are the different ethical and legal principles that was addressed in the included studies regarding the use of AI in public health and what are the ethical challenges that can arise.Methods: Following PRISMA guideline, five bibliographic databases were used in our search: PubMed, Scopus, JSTOR, IEEE Xplore, and Google Scholar from 2015 to February 2022. Four reviewers carried out study selection and data extraction, and the data extracted was synthesized by a narrative approach. Results: This review included 23 unique publications out of a total of 1123 items that were initially identified. Different ethical principles regarding the uses of AI in public health and community health were identified and discussed distinctly in the current review. The common ethical and legal themes that this review focused on are equity, bias, privacy and security, safety, transparency, confidentiality, accountability, social justice, and autonomy. In addition, five ethical challenges were mentioned. Conclusion: Research regarding ethical and legal principles and challenges about using AI in public health specifically consider a new filed, because all previous themes are concerning the physical and patients’ area where it focuses only on the clinical settings.

Shared public buildings have become centers of innovation, integrating advanced technologies to meet evolving societal needs. With a heightened emphasis on occupants’ health and well-being, these buildings serve as hubs for technological convergence, facilitating seamless connectivity and intelligent data analysis and management. Within this context, environmental monitoring emerges as a foundational element, pivotal to all aspects of building management. This article provides findings from the nationally funded RE-START project, which focuses on shared public buildings, with special regard to educational and medical facilities. The project explores enhanced indoor air quality monitoring, focusing in particular on CO2 concentration that is directly correlated with occupancy, as a fundamental element for developing health and safety protocols, energy efficiency strategies, integration of smart building technologies, and data-driven energy management. The intersection of environmental monitoring, energy efficiency, security, and IoT technologies in in indoor spaces are relevant. The outcomes of the study reveal the delicate nature of all the involved components, that need to be carefully developed in an integrated manner.

Interprofessional learning (IPL) is essential to prepare healthcare trainees as the future public health workforce. WHIRL was an innovative IPL intervention that engaged multi-professional teams of volunteer healthcare trainees (n=20) to deliver health checks (n=464), including tailored advice and signposting, to employees in the UK construction industry (across 21 events, 16 sites, 10 organisations) as part of an ongoing research programme called Test@Work. Volunteers undertook a four-part training and support package of trainer-led education, observations of practice, self-directed learning and clinical supervision, together with peer mentoring. In a one-group post-test only design, IPL outcomes were measured using the Inventory of Reflective Vignette - Interprofessional Learning (IRV-IPL), and the psychometric properties of the IRV-IPL tool were tested. WHIRL demonstrably improved healthcare trainees’ interprofessional skills in all five areas of collaboration, coordination, cooperation, communication, and commendation. The IRV-IPL tool was found to be a valid and reliable measure of interprofessional competencies across three scenarios; before and after health promotion activities, and as a predictor of future health promotion competence. This industry-based workplace IPL programme resulted in attainment of health check competencies, and bridged the gap between research, education and clinical practice.

Antimicrobial resistance (AMR) is an increasingly pressing threat to human, animal, and environmental health. Reducing the use of antibiotics in agriculture has been identified as a key way to curb the spread of AMR. However, the effect of such policies on AMR prevalence, and their broader impacts on agricultural, health, and economic outcomes at the population level have proven very difficult to estimate and compare. This paper draws on and formalises ideas presented at the JPIAMR New Perspectives on Bacterial Drug Resistance workshop in June of 2022. With reference to emerging literature on the topic, it proposes a quantitative framework for estimating the relevant causal relationships needed to quantify the cross-sectoral impacts of AMR policies in agriculture, and for comparing these outcomes in like terms in a way which can feed directly into policy decision-making, notably without prohibitive data requirements. The ability of researchers to apply frameworks such as this will be increasingly necessary in order to holistically capture the impacts of AMR policies and to situate them in the broader policy context; especially where the mechanisms of transmission are opaque or complex, where data availability is limited; and where policymakers must allocate scarce resources among many competing objectives.

(1) Background: With continuous globalization and modernization of people's lives, lifestyle has changed dramatically, with decreased physical activity and increased unhealthy eating patterns in many nations throughout the world. With the COVID-19 pandemic and changes taking place in people’s health and lifestyles around the world, the need for rehabilitation is expected to rise in the coming years.(2)Methods: This paper analyzes the integration model of sports and health care using theoretical analysis, literature reviews, logical reasoning, and other methods.(3)Results: The integration of sports and health care in China has entered the stage of practical implementation after many years of development, forming a few representative integration patterns. Governments, communities, community hospitals, hospitals, and third-party institutions are the main participants, with the community playing an important role in the integration. Pharmacies, sports venues, and schools with sufficient staff have a relatively low participation rate.(4)Conclusion: The grading treatment has been applied in health management and sports rehabilitation, based on the development of digital medicine, a government-led grading treatment model of "health management center" can promote the participation of multiple subjects in the integration of sports and health care, solving the problems existing in the current integration process to a certain extent.

There is a need for strategic healthcare workforce planning to address shortages and ensure universal health coverage, aiming to optimize work-force per population ratio, distribution, and competencies. Amidst rising demands exacerbated by aging populations and events like the COVID-19 pandemic, strategic workforce planning becomes crucial for addressing healthcare inequalities by forecasting needs, bridging skill gaps, and adapting to changing demographics and care models. Israel has invested in strategic planning to tackle healthcare workforce challenges; however, globally there is insufficient planning informed by health labor market analysis, which hinders efforts to address healthcare inequalities. The paper reviews national policies in Israel, Australia, Germany, and Norway, ex-amining statistics and government publications to highlight strategic plan-ning considerations and address challenges in healthcare workforce plan-ning. This paper focuses both on the critical role of physicians in healthcare systems, and on the changing borders between healthcare professions and different national contexts which demand more context dependent strategic workforce planning. We highlight common themes among national policies, including the need for data collection, increasing the capacity of domestic training programs, and the need to address geographic maldistribution of physicians. Ultimately, we aim to guide policy in the development of a re-silient and sustainable healthcare workforce capable of meeting diverse community needs and promoting equity in healthcare services.

Dust inhalation is a huge concern in the mining environment and within all its operations. In fact, dust to be one of the most serious occupational hazards in the mining industry. Coal and crystalline silica dust are the causes of serious, sometimes fatal lung diseases such as pneumoconiosis, which affects coal miners, as well as silicosis, tuberculosis, chronic bronchitis, emphysema, chronic obstructive pulmonary disease, and chronic renal disease, which affect coal and other types of miners. The resulting effects both affect workers and nearby communities. The mining industry has in the past, employed several approaches to reduce effects of dust. But these strategies have often been ineffective because the grass withers during the dry season and sprayed water is rapidly absorbed or evaporates. This paper endeavors to review information on dust in the mining environment and how it is a nuisance to workers and communities and establish what strategies exist for this.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score >5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

Objective: This study aimed to determine impact of eHealth literacy on health promotion activities and preventive health practice among adolescents. Methods: This cross-sectional study was conducted between March and May 2022 with 706 adolescents in Çorum, Turkey. A face to face questionnaire form including socio demographic characteristics, preventive health practices, eHealth Literacy scale and Adolescent Health Promotion Scale were used. The data of the research were analyzed with the SPSS 22.0 program. Percentage, mean, Pearson Correlation analysis and multiple regression analysis were used in the analyzes. The p<0.05 value was considered statistically significant in the evaluations. Results: In the study, 55.8% were female and the mean age of the whole group was 16.09±2.63 years. The mean score of eHealth Literacy scale was 29.40±6.29. The mean of the total scores obtained from the Adolescent Health Promotion Scale was 137.97±21.87. Among the adolescents 96.0% didn’t use alcohol and 81% didn’t smoke. The rate of annual weight measure was 68.8%. Measurements of annual blood pressure, annual blood iron, annual cholesterol, annual dental examination and regular exercise rate were below 50%. There was a significant positive correlation between eHealth literacy and the Adolescent Health Promotion Scale (p<0.001). Multiple linear regression analysis was performed to predict eHealth literacy using the variables of Adolescent Health Promotion and preventive health practices. eHealth literacy was positively and significantly predicts health promotion behaviors (β= 0.27, t (695)= 7.54, p<0.001). eHealth literacy increased annual weight measurement by more than 0.13 (β=0.13), the annual blood iron measurement by more than 0.16 (β=0.16), annual dental examination by more than 0.11 (β=0.11). Conclusions: Adolescents ehealth literacy was high and effected via health promotion activities and preventive health practices. Developing eHealth litracy interventions will be important for environments with a high concentration of adolescents (schools, courses). Also, primary health care services should be entegrated with school environment.

Zoonoses are diseases transmitted from (vertebrate) animals to humans. Control and prevention of these diseases require an appropriate way to measure health for prudent and well-balanced decisions in public health. We propose a framework that aims to explore, understand and open up a conversation about the non-monetary value of animals through environmental and normative ethics. As an example of its application, participants can choose what they are willing to give in exchange for curing an animal in hypothetical scenarios selecting a human health condition to suffer, the amount of money, and lifetime as a tradeoff. We believe that considering animals beyond their monetary value in public health decisions will contribute to a more rigorous assessment of the burden of zoonotic diseases, among other health decisions. This method might help us complement the existing metrics in health, adding more comprehensive values for animal and human health for the “One Health” approach.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

Deregulation of cell growth and development lead to cancer, a severe condition that claims millions of lives worldwide. Targeted or selective approaches used during cancer treatment determine the efficacy and outcome of the therapy. In order to enhance specificity and targeting and better treatment options for cancer, novel and alternative modalities are currently under development. Photodynamic therapy has the potential to eradicate cancer and combination therapy would yield even greater outcomes. Nanomedicine-aided cancer therapy shows enhanced specificity for cancer cells and minimal side-effects coupled with effective cancer destruction both in vitro and in vivo. Nanocarriers used in drug-delivery systems are well able to penetrate cancer stem cell niche, simultaneously killing cancer cells and eradicate drug-resistant cancer stem cells, yielding therapeutic efficiency up to 100 fold against drug-resistant cancer in comparison with free drugs. Safety precautions should be considered when using Nano-mediated therapy as the effects of extended exposure to biological environments are still to be determined.

Cyperus rotundus L. exhibits promising potential for the development of functional foods due to its documented pharmacological and biological activities. This study investigated the antioxidant and anti-diabetic properties of C. rotundus kombucha. The results demonstrated potent antioxidant activity with an IC50 value of 76.7±9.6 uL/mL for the DPPH assay and 314.2±16.9 uL/mL for the ABTS assay. Additionally, the kombucha demonstrated alpha-glucosidase inhibitory with an IC50 value of 142.7±5.2 µL/mL. This in vitro antioxidant potential was further validated in vivo using Drosophila. Drosophila fed a high-sugar diet and supplemented with pure kombucha revealed significant increases in DPPH and ABTS free radical scavenging activity. Drosophila on a high-sugar diet supplemented with varying kombucha concentrations manifested enhanced resistance to oxidative stresses induced by H2O2 and paraquat. Concurrently, there was a notable decline in lipid peroxidation levels. Additionally, significant upregulations in CAT, SOD1, and SOD2 activities were observed when the high-sugar diet was supplemented with kombucha. Furthermore, in vivo assessments using Drosophila demonstrated significant reductions in alpha-glucosidase activity when fed with kombucha. A comprehensive GC-MS and HPLC analysis of C. rotundus kombucha detected the presence of antioxidative and anti-glucosidase compounds. In conclusion, C. rotundus kombucha exhibits considerable antioxidant and anti-diabetic properties, demonstrating its potential as a beneficial beverage for health promotion.

This study aims to understand the temporal and spatial characteristics of public concern for "children's mental health" in China in the context of the COVID-19 epidemic. Baidu Index is a research tool to collect and analyze massive data of Chinese netizens' behaviors. Using Baidu Index as the research tool, this paper analyzes the trend and distribution of Chinese netizens' attention to "children's mental health" from December 1st, 2019 to March 20th, 2022 from three aspects of trend research, need map, and crowd portrait. The study found that since the outbreak of COVID-19, the search trend of "children's mental health" has shown a cyclical change, peak in May and valley around the Spring Festival and National Day, and stable in other periods. "Mental health", "handwritten newspaper on mental health" and "youth mental health" are the most popular buzzwords among the public. The groups concerned of "children's mental health" is mainly distributed in Guangdong, Jiangsu, Beijing, and the majority are women between 30 and 39 years old. Meanwhile, search trend for "mental health" are like that for "children's mental health." The factors influencing the search volume change of "children's mental health" include Chinese traditional holidays, Spring Festival, National Day, Chinese Mental Health Day, and policies and instructions on children's mental health issued by the PRC Ministry of Education. The public would like to know about "mental health", "handwritten newspaper on mental health" and "adolescent mental health".

Polycystic ovary syndrome (PCOS) usually comes along with metabolic disturbances attributed to androgen excess and obesity, but the contribution of each has not been defined, and the occurrence of metabolic disturbances is frequently not investigated. We evaluated 99 PCOS and 41 non-PCOS women. Clinical biomarkers of glucose-, liver-, and endothelial-related metabolic alterations were measured; participants were categorized into four groups according with obesity (OB) and hyperandrogenemia (HA) statuses: Healthy (no-HA, lean), HA (HA, lean), OB (no-HA, OB), and HAOB (HA, OB). Metabolic disturbances were highly frequent in PCOS women (70%). BMI correlated with all biomarkers, while free testosterone (FT) only with glucose- and hepatic-related indicators. Despite insulin sensitivity and liver enzymes were associated with FT, women with obesity exhibited lower M [coeff = 8.56 – 0.080(FT) –3.71(Ob); p &lt;0.001)] and higher aspartate aminotransferase (coeff = 26.27 + 0.532(FT) + 8.08(Ob); p = 0.015)] than lean at the same level of FT. Women with obesity exhibited greater risk of metabolic disorders than lean, independently of hyperandrogenemia. Clinicians are compelled to search for metabolic alterations in PCOS women; obesity must be handled in all cases, but hyperandrogenemia needs to be managed also in those with glucose- or liver-related disturbances.

The application of distributed fiber optic strain and temperature measurement can be utilized to address a multitude of measurement tasks across a diverse range of fields, particularly in the context of structural health monitoring in the domains of building construction, civil engineering, and special foundation engineering. However, a comprehensive understanding of the influences on the measurement method and the sensors is essential to prevent misinterpretations or measurement deviations. In this context, this study investigated the effects of moisture exposure, including various salt solutions and a high pH value, on a distributed strain measurement using Rayleigh backscattering. Three fiber optic sensors with different coating materials and one uncoated fiber were exposed to five different solutions for 24 hours. The study revealed significant discrepancies in deformation between the three coating types depending on the surrounding solution. Furthermore, in contrast to the prevailing literature, which predominantly describes swelling effects, a negative deformation was observed in a magnesium chloride solution. The findings of this study indicate that corresponding effects can impact the precision of measurement, potentially leading to misinterpretations. Conversely, these effects could be used to conduct large-scale monitoring of chemical components using distributed fiber optic sensing.

Mercury contamination in the Amazon is a significant public health concern arising from both natural sources and intensive mining activities in the region. This metal is used to separate Au from sediments, forming an amalgam that facilitates the extraction of precious metals. Accordingly, this study aimed to address the following question: What is the impact of mining on mercury contamination in the animal and human populations of the Amazon? The overall objective of this study was to conduct a systematic review of the existing literature to identify gaps in geographic coverage and assess the impact of Hg contamination on human and animal populations in the Amazon region. Our hypothesis was that higher mercury concentrations in tissue samples would be found closer to the mining areas. We employed the PECO and PRISMA-ScR protocols to collect articles published between 2017 and 2023, selected based on criteria representing projected points on a map within the biogeographic boundaries of the Amazon. Mercury concentrations increase with trophic levels, reaching high values of 3.7 µg/g in the muscles of predatory fish and 34.9 µg/g in human hair. The average level of mercury in humans exceeds 6 µg/g, surpassing tolerance levels. Although mining regions show high concentrations of Hg, the highest incidence was observed among populations with fish-based diets. Research on fish is crucial for assessing the risk to human health, given that fish are the main source of protein in the region.

Objectives Asylum seekers in Germany represent a highly vulnerable group from a health perspective due to a variety of risk factors. At the same time their access to healthcare is restricted. While the introduction of the Electronic Health Insurance Card (EHIC) for asylum seekers instead of healthcare-vouchers is discussed controversially using politico-economic reasons, there is hardly any empirical evidence on its actual impact on the use of medical services Study design Thus, the aim of this study is to examine the influence of the possession of the EHIC on the use of medical services by asylum seekers as measured by their consultation rate of ambulant physicians (CR). For this purpose, a standardized survey was carried out to 260 asylum seekers in different municipalities of which some have introduced the EHIC for asylum seekers, while others have not. Methods Various CR were differentiated considering possible third variables as well as confounding factors. The period prevalence was compared between the groups "with EHIC" and "without EHIC" using a two-sided t-test. Multivariate analysis was done using a linear OLS regression model. Results Asylum seekers who are in possession of the EHIC are significantly more likely to seek ambulant medical care than those receiving healthcare-vouchers. Their CR, however, does not differ significantly from the age-corrected CR of the autochtonous population. Taking into account relevant covariables, the possession of the EHIC can be viewed as an independent influencing factor on the asylum seekers' use of medical care. Conclusions The results of this study suggest that having to ask for healthcare-vouchers at the social security office could be a relevant barrier for asylum seekers. Nevertheless, the ownership of the EHIC does not seem to lead to an overuse of medical services.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

The Japanese Association for Acute Medicine Committee recently proposed a novel classification system for the severity of heat-related illnesses. The illnesses are simply classified into three stages based on symptoms and management or treatment. Stages I, II, and III broadly correspond to heat cramp and syncope, heat exhaustion, and heat stroke, respectively. Our objective was to examine whether this novel severity classification is useful in the diagnosis by healthcare professionals of patients with severe heat-related illness and organ failure. A nationwide surveillance study of heat-related illnesses was conducted between June 1 and September 30, 2012, at emergency departments in Japan. Among the 2130 patients who attended 102 emergency departments, the severity of their heat-related illness was recorded for 1799 patients, who were included in this study. In the patients with heat cramp and syncope or heat exhaustion (but not heat stroke), the blood test data (alanine aminotransferase, creatinine, blood urea nitrogen, and platelet counts) for those classified as stage III were significantly higher than those of patients classified as stage I or II. There were no deaths among the patients classified as stage I. This novel classification may avoid underestimating the severity of heat-related illness.

Escherichia coli is an indicator microorganism in One Health antibiotic resistance surveillance programmes. The purpose of the study was to describe and compare E. coli isolates obtained from pigs and human contacts from a commercial farm in South Africa using conventional methods and whole genome sequencing (WGS). Porcine E. coli isolates were proportionally more resistant phenotypically and harboured a richer diversity of antibiotic resistance genes, as compared to human E. coli isolates. Different pathovars, namely ExPEC (12.43%, 21/169), ETEC (4.14%; 7/169), EPEC (2.96%, 5/169), EAEC (2.96%, 5/169) and STEC (1.18%, 2/169) were detected at low frequencies. Sequence type complex (STc) 10 were the most prevalent (85.51%, 59/169) among human and porcine isolates. Six STcs (STc10, STc86, STc168, STc206, STc278 and STc469) were shared at the human-livestock interface according to multilocus sequence typing (MLST). Core genome MLST and hierarchical clustering (HC) showed that human and porcine isolates were overall genetically diverse, but some clustering at HC2 to HC200 were observed. In conclusion, even though the isolates shared a spatio-temporal relationship, there were still differences in the virulence potential, antibiotic resistance profiles, and cgMLST and HC according to the source of isolation.

To support the development of research evidence and behavioral health policy that aligns with the priorities of youth and families serviced in child and youth mental health systems, this project documents the service outcomes that caregivers value most. A diverse group of caregivers, representing six regions of the United States, participated in two rounds of virtual one-hour focus groups. In round 1, participants identified what they hoped to gain from using behavioral health services for themselves, their families, and their child and discussed what made services a positive experience for them. They then reported their top three most hoped for outcomes. In round 2, groups validated and refined summary findings from round 1. Caregivers prioritize service quality outcomes, primarily. They expressed a desire for an accessible, respectful, and supportive treatment environment underpinned by well-trained and culturally responsive professionals. Caregivers also desire seamless cross-sector provider collaboration and care transitions which integrate the insights and preferences of families and children themselves to craft a customized care plan. Priority outcomes not related to service quality included hoping to gain increased knowledge, resources, and tools and techniques to support the mental health needs of their children, help them improve their daily functioning, and develop more effective interpersonal communication skills. Caregivers also reported hoping to experience less stigma related to the mental health needs of their children and to achieve personal fulfillment for themselves and their children. Research and policies should prioritize and be designed to address the outcomes that matter to youth and families.

The Ministry of Health (MOH) in the Kingdom of Saudi Arabia (KSA) established a National School-based Screening Program (NSBSP) for health screening of school-going children. Students from specific grades were systematically screened for several health problems including obesity, visual and auditory problems, dental cavities, scoliosis, and attention-deficit/hyperactivity disorder (ADHD). This cross-sectional study aimed to determine the prevalence of these health problems among primary school students based on secondary data obtained from the NSBSP. We included 444,259 screened school children from the 1st and 4th grades of 50% of the selected schools (both private and public) across the KSA during the academic year 2018-2019. Among them, the most prevalent health problems identified were dental cavities (38.7%), eye refractory errors (10.9%), and overweight and obesity (10.5%); the less prevalent problems included ADHD (2.81%), auditory problems (0.6%), and scoliosis (0.48%). A greater prevalence of most health problems was observed in girls than boys. The NSBSP successfully aided the detection of health conditions with high and low prevalence among primary school students in the KSA, and thus, identification of health problems of specific concern. Implementation of effective school health services for the prevention, early detection, diagnosis, and treatment of these health problems is imperative.

Since its initial outbreak in late 2019, the COVID-19 pandemic has profoundly affected the global community. In addition to the negative health consequences of contracting COVID-19, the implementation of strict quarantine and lockdown measures has also disrupted social networks and devastated the global economy. As a result, there is rising concern that the pandemic has taken a toll on the mental health of the general population. To better understand its impact, an increasing number of studies examined the effects of the pandemic on mental health and psychosocial implications of enforced quarantine and lockdown. In this article, we aim to review and summarize the findings from a variety of studies that have explored the psychosociological effects of the pandemic and its impact on the mental well-being of the general population. We will also examine how various demographic groups, such as the elderly and youth, can be more susceptible or resilient to the pandemic’s mental health effects. We hope to provide a broader understanding of the underlying causes of mental health issues triggered by the pandemic and provide recommendations that may be employed to address mental health issues in the population over the long-term.

This study analyses key aspects of the professional life of primary school teachers in a southern European context. In the social changes of last two decades profoundly impacted the well-being of teachers putting a strain on their ability to adapt to sometimes unfair working conditions. For this purpose twenty teachers (M = 38.85; DS = 9.17) were interviewed from different areas of Italy, data were analyzed using the Grounded Theory Method. Through data analysis were summa-rize and emphasize eight core themes. The results show the effects of a gradual impoverishment of the recognition of the role of teacher, highlighting the difficulty for teachers of renegotiating more flexible workload assessments and of reinforcing psycho-emotional skills for the development of a teaching methodology attentive to the psycho-emotional needs of pupils. Schools emerge as a rigid working context, in which a competent organizational function is often absent. Practical psychological implications are discussed.

Hispanics are disproportionately affected by low rates of physical activity and high rates of chronic diseases. Hispanics generally and Mexican Americans specifically are underrepresented in research on physical activity and its impact on mental well-being. Some community-based interventions have been effective in increasing physical activity among Hispanics. This study examined data from a sample of low-income Hispanic participants in free community exercise classes to characterize the association between self-reported frequency of exercise class attendance, intensity of physical activity, and participant well-being. As part of two cross-sectional samples recruited from a stratified random sample of community exercise classes, 302 participants completed a questionnaire consisting of a modified version of the Godin-Shephard Leisure-Time Exercise Questionnaire (LTEQ) and the Mental Health Continuum Short Form (MHC-SF). Adjusted binary logistic regression analyses indicated that those who achieve moderate and strenuous self-reported physical activity have 130% higher odds (p = 0.0422) of positive mental well-being after adjustment for age, attendance, and self-reported health. This study provides evidence that physical activity intensity and time are associated with flourishing mental health among Hispanics. The study provides insight into the planning and development of community-based physical activity programming tailored to low-income populations.

Burden of diseases measured as disability-adjusted life years per 100,000 people can be mined from public domain data, when they are made available by population health surveillance systems. This can be analysed to allow insightful comparisons with the national average, and to understand differences in trends between the sexes, age groups, time periods, geographic regions and sub-regions. In this illustrative case study, we have analysed the Scottish burden of disease database to understand what ailed the population of the Grampian region before the COVID-19 pandemic. We have identified selected cancers, ischaemic heart disease, Alzheimer’s disease and other dementias amongst the highest contributors to the burden; that drug use disorders and colorectal cancer are showing worsening trends and require health promotion and disease prevention measures from ages 15 and 25 respectively, especially in Aberdeen City; and that males are more vulnerable to atrial fibrillation and flutter, diabetes mellitus and oesophageal cancer, while females are to cerebrovascular disease. We demonstrate the usefulness of our analysis and methodology for the wider health system, allowing targeted medical research investments and coordinated response from public health and health service delivery. We also show the need for up-to-date surveillance data, forecasts and evidence on the impact of interventions to be made available widely.

Objectives: This study validated the Japanese version of O’Donovan et al.’s (2020) composite measure of psychological safety scale and examined the associations of psychological safety with mental health and job-related outcomes. Methods: Online surveys were administered twice to Japanese employees with teams of more than three members. Internal consistency and test-retest reliability was tested using Cronbach’s α and intra-class correlation coefficient (ICC). Structural validity was examined using confirmatory factor analysis (CFA) and exploratory factor analysis (EFA). Convergent validity was tested. Multiple linear regression analyses were conducted to examine the relationship between psychological safety and psychological distress, work engagement, job performance, and job satisfaction. Results: Two hundred healthcare workers and 200 non-healthcare workers were analyzed. The Cronbach’s alpha of the total score was 0.92 - 0.96 and ICC was 0.88 - 0.92. CFA demonstrated poor fit, and EFA yielded a two-factor structure, suggesting one factor combined with peers and team. The scale showed good convergent validity. The total score of the scale showed significant associations with all outcomes in adjusted model in all workers. Conclusions: The Japanese version of the measure of the psychological safety scale presented good reliability and validity. Psychological safety is important for employees’ mental health and performance.

The research is carried out to assess factor affecting the health condition of the elderly people in the slum areas in Sylhet City. This research was quantitative type. In Quantitative approach, primary data were collected and used from the randomly selected elderly people in the Sylhet City slum areas. The secondary data were collected from many articles, documents, newspaper, magazine etc. By analyzing the survey data, it is illustrated that the slum dwellers are deprived from the basic needs. Meanwhile, elderly people can‟t fulfill their medical treatment due to their financial condition because of their work incompatibility. This study identifies the factor affecting health condition such as financial condition, lack of knowledge about proper medical facilities, communication gap between the authority and patient, unemployment, and so on. These factors also affect their health situation. Many diseases like asthma, heart disease are occurred. This study also mentions about the livelihood of slum people are so poor in condition. Due to financial condition, aged people can‟t take their proper treatment and their family member can‟t afford it. This study also understands that the people from slum areas are getting concerned about their medical care. They are easily going to the hospital and take their service because of low pricing. On the other hand, people are meanwhile stopped their treatment of financial situation. This study finds the health situation of elderly people at slum areas in metropolitan city and their consciousness.

Resumo: Este estudo teve como objetivo avaliar a Saúde Mental Positiva (SPM) e a sua relação com características sociodemográficas, literacia em saúde mental e escala de vulnerabilidade psicológica (PVS) em estudantes universitários portugueses com idades compreendidas entre os 17 e os 62 anos. Foi realizado um estudo descritivo-correlacional. Uma pesquisa online foi realizada para avaliar variáveis ​​demográficas, e vários questionários foram aplicados para avaliar saúde mental positiva, vulnerabilidade psicológica e alfabetização em saúde mental. Os dados foram coletados de 1º de novembro de 2019 a 1º de setembro de 2020. No geral, 3.405 alunos participaram do estudo. Os resultados mostram que 67,8% dos alunos revelaram um alto nível de PMH, 31,6% apresentaram um nível médio de PMH e 0,6% apresentaram um nível baixo de PMH. Os estudantes do sexo masculino relataram maior satisfação pessoal (t (3170) = -2,39, p=0,017) e autonomia (t (3170) = -3,33, p=0,001), no PMH em relação ao sexo feminino. Alunos sem bolsa pontuaram mais alto (t (3.127) = -2,04, p=0,42) no PMH do que alunos com bolsa. Estudantes que não foram deslocados de casa relataram maior (t (3170) = -1,99, p=0,047) Autocontrole em PMH do que aqueles deslocados de sua casa. Estudantes universitários com resultados de PMH mais altos têm resultados de PVS mais baixos e resultados de Alfabetização mais altos. Os achados deste estudo contribuirão para identificar as necessidades de intervenção dos alunos na PMH. Estudantes universitários com resultados de PMH mais altos têm resultados de PVS mais baixos e resultados de Alfabetização mais altos. Os achados deste estudo contribuirão para identificar as necessidades de intervenção dos alunos na PMH. Estudantes universitários com resultados de PMH mais altos têm resultados de PVS mais baixos e resultados de Alfabetização mais altos. Os achados deste estudo contribuirão para identificar as necessidades de intervenção dos alunos na PMH.

Suicide dynamics form a complex system deeply influenced by interrelated factors, necessitating advanced methodologies for comprehensive analysis. This study pioneers the application of Particle Markov Chain Monte Carlo (PMCMC) methods in suicide research, recognized for their enhanced sampling efficiency over traditional techniques in complex, high-dimensional models. PMCMC is particularly adept at handling non-Gaussian distributions and navigating parameter spaces efficiently, preventing the entrapment in local optima. Utilizing PMCMC, our research simulated a broad spectrum of potential outcomes, clarifying the probable scenarios and their likelihoods, thus enriching the predictive accuracy and understanding of suicide dynamics. These methods facilitated the exploration of dynamic interactions among key risk factors such as mental health issues, trauma, substance use, social isolation, and access to harmful means, whose complex interplays challenge predictive modeling. The study extends previous applications of PMCMC in complex systems like H1N1, opioid crises, and COVID-19 to the domain of suicide, suggesting its potential in enhancing decision-making and intervention strategies. However, limitations due to the model's simplified assumptions and the specificity of the data to certain populations underscore the necessity for broader application to validate findings across varied demographics. In summary, while PMCMC offers robust capabilities for the dynamic modeling of suicide, it requires careful parameter selection and consideration of computational demands. Future research should continue to leverage this approach in more complex settings, enhancing our ability to predict and mitigate suicide risks effectively.

Health services play an important role in people's lives and are the basic right of every individual. Equal and quality access to health services is crucial for people's welfare. This study aims to analyze the effectiveness of public service innovation in achieving 100% UHC in Semarang City, with a focus on PANGERAN DIPONEGORO’s inspirational contribution, in order to provide insight regarding the implementation of the health insurance program and its impact on UHC. The method used in this research is qualitative using the Double Diamond approach with primary data collection through documentation and innovation supporting literature studies and secondary data collection through literature studies and Focus Group Discussions. The results of the study show that the "PANGERAN DIPONEGORO" innovation succeeded in having a significant positive impact in achieving Universal Health Coverage (UHC) in Semarang City. There has been an increase in community participation, accessibility and quality of health services, as well as a competitive advantage that is rarely possessed by other agencies. There have been many studies using public service objects. However, little has been discussed about the contribution and innovation of public services, especially those that focus on the health sector.

More than 13.5 billion COVID-19 vaccine doses have so far been delivered between 2021 and 2023 through a mix of delivery platforms, with mass vaccination campaigns being the main approach. In 2022, with the most likely scenario of continued circulation of SARS-CoV-2 and the need for periodic booster doses, there was a need for countries to plan for more sustainable approaches to provide COVID-19 vaccination. In this context of uncertainty, a global tool for integrating COVID-19 vaccines into immunization programmes and primary health care was published jointly by WHO and UNICEF to respond to country needs. The guidance leveraged existing health system frameworks, proposed four steps for the COVID-19 integration journey, and identified investment areas. The development process maximized robust global stakeholder and country engagement, and the timeframe was aligned with donor funding windows to support the integration of COVID-19 vaccination. The rapid dissemination of guidance allowed its use by countries to ascertain their readiness for integrating COVID-19 vaccination and inform the development of national plans and funding applications. While progress has been made in specific areas (e.g., optimizing cold chain and logistics leveraging COVID-19 vaccination), in the context of decreasing demand for COVID-19 vaccines, reaching adult COVID-19 vaccine high-priority-use groups and engaging and coordinating with other health programmes (beyond immunization) remains a challenge. We share the learning that despite the uncertainties of a pandemic, guidance documents can be developed and used within a short timeframe. Working in partnership with stakeholders beyond immunization towards a common objective is powerful and can allow progress to be made on integrating health services and preparing better for future pandemics.

The practice of nurse health coaching (NHC) draws from the art and science of nursing, behavioral sciences, and evidence-based health coaching methods. This secondary analysis of the audio-recorded natural language of participants during NHC sessions of our recent 8-week RCT evaluates improvement over time in cognitive-behavioral outcomes: Change Talk, Resiliency, Self-Efficacy/Independent Agency, Insight & Pattern Recognition, and Building Towards Sustainability. We developed a measurement tool for coding, Indicators of Health Behavior Change (IHBC), that was designed to allow trained health coach experts to assess the presence and frequency of the indicators in the natural language content of participants. We used a two-step method for randomly selecting the 20-minute audio-recorded session that was analyzed at each time point. Fifty-six participants had high-quality audio recordings of the NHC sessions. Twelve participants were placed in the social determinants of health (SDH) group based on the following: low income (<$20,000/year), early-onset hypertension, and social disadvantages. Our analyses significantly improved Change Talk and the other four factors over time. Our factor analyses indicated two distinct factors at each measurement point of the study, demonstrating the stability of the outcome measures over time. Our newly developed measurement tool, IHBC, proved stable in structure over time and sensitive to change. This NHC program shows promise in improving cognitive-behavioral indicators associated with health behavior change in both non-SDH and SDH individuals.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

In this article, we analyse the ESG determinants of the “Elderly People Treated in Integrated Home Care”-EPIHC in the Italian regions between 2004 and 2022. We used data from the ISTAT-BES database. We used different econometric techniques i.e.: Panel Data with Random Effects, Panel Data with Fixed Effects, Pooled Ordinary Least Squares-OLS and Weighted Least Squares-WLS. The results show that the EPIHC is positively associated with “Nurses, midwives, and Soil sealing by artificial cover" and negatively associated with "Museum heritage density and relevance" and "Trust in law enforcement agencies and firefighters fire". Furthermore, we have applied a k-Means algorithm with the Silhouette Coefficient and we find the presence of two clusters. Finally, we propose a confrontation among eight different machine-learning algorithms and we find that Linear Regression is the best predictive algorithm.

The aim of this article is to present the course of the COVID-19 pandemic in Poland in 2020-2022, the formation of ad hoc health and anti-crisis policies, an assessment of crisis management and the perceived impact of the pandemic and anti-crisis measures.The paper draws on literature, official reports on the pandemic, data from Eurostat and other information from state institutions and public organisations.Particular attention was paid to the analysis and evaluation of the objectives, instruments and effects of the policies pursued by the state in a coordinated manner, i.e. the anti-pandemic policy and the anti-crisis policy. The anti-pandemic policy in Poland has failed to protect the country from significant personal losses and negative impacts on the health of the population and demographic processes.The anti-crisis policy of the state carried out with the mobilisation of businesses and disciplined society, in the form of anti-crisis shields supplemented and adjusted on an ongoing basis, allowed Poland to avoid a deep crisis and economic recession. Attention was drawn to the need to coordinate the management of health and economic crises nationally and internationally, and to the need to have a medium-term anti-crisis state strategy and a system for the early detection of crisis symptoms.

Little research has been done on occupational health ramifications of informal electronic waste (e-waste) recycling work, which is increasingly common in low- and middle-income countries, and very little is known about this in high-income countries. Our study evaluated informal and formal e-waste recycling workers in Chile, which was recently recognized as a high-income country. In 2017 we recruited 78 informal recycling workers from two cities, and 15 formal e-waste recycling workers from one recycling facility. Participants completed a questionnaire and health assessment regarding their involvement in, and potential impacts of, e-waste recycling, among other measures. Participants were primarily male, middle-aged, married with children, and had worked in e-waste recycling for an average of 12 years. Participants generally reported good health status, and chronic disease prevalence was similar to the national prevalence. Workers commonly reported exposures to several occupational stressors, including mental health stressors and noise, as well as insufficient income. Occupational injuries were common and use of safety equipment was low. No significant differences were found between informal and formal workers. Informal e-waste workers in Chile face occupational health challenges. The extent to which these issues impact the health of informal Chilean e-waste workers is unclear and warrants further research.

Teachers’ time resources are becoming increasingly scarce and time poverty will have a direct impact on the long-term sustainability of their professional development. However, the current state of teachers’ time poverty and its potential harmful consequences are unclear. Therefore, this research conducts two cross-sectional studies to investigate the current situation and group differences in time poverty among Chinese teachers (Sample 1), as well as the influence of teachers’ time poverty on job burnout (Sample 2). The results indicate that: (1) there is a high level of time poverty among teachers; (2) there is no significant difference in gender, teaching years, or teaching section, and there is a significant difference in teaching responsibilities; (3) time poverty could positively and significantly predict job burnout, and job burnout could positively and significantly predict mental health; (4) mental health factors (including depression, anxiety and stress) play the mediating role in the relationship between teachers’ time poverty and job burnout. To create a sustainable development environment for teachers, it is suggested that teachers improve time management skills and establish a self-regulation mechanism; schools should clarify the boundaries of teachers’ work and respect their right to rest; and society should provide positive and adequate spiritual support.

Background: This study aimed to explore the association between the emotional impact of COVID-19 and emotional eating and the risk of alcohol use disorder among Peruvian health science students. Methods: We conducted a cross-sectional analytical study in which an online questionnaire was administered to 456 health science interns from four cities in Peru. We used the COVID-19 Emotional Impact Profile questionnaire, Mindful Eating Questionnaire, and Alcohol Use Disorders Identification Test. Spearman’s correlations were calculated and two multiple linear regression models were developed. Results: 68.4% of the participants were emotional eaters and 8.6% reported low-risk levels of alcohol use disorder. Based on the results of the first model, the overall emotional impact of COVID-19, being overweight or obese, depression and anxiety levels, and living with only one parent were factors associated with emotional eating. The results of the second model showed that the level of depression, living with just one parent, living alone, sex, and number of months as an intern were factors associated with the risk of alcohol use disorder. Conclusion: To reduce emotional eating and the risk of alcohol use disorder among interns, universities should implement interventions aimed at reducing the emotional impact of COVID-19 and provide nutritional counseling.

Background: The COVID-19 pandemic has seen a considerable expansion in the way work settings are structured with a continuum emerging between working fully in-person and from home. The pandemic has also exacerbated many risk factors for poor mental health in the workplace, especially in public-facing jobs. Therefore, we sought to test the potential relationship between work setting and self-rated mental health. Methods: We modeled the association of work setting (only working from home, only in-person, hybrid) on self-rated mental health (Excellent/Very Good/Good vs. Fair/Poor) in an online survey of Canadian workers during the 3rd wave of COVID-19. Mediating effects of vaccination, masking, and distancing were explored due to the potential effect of COVID-19 related worries on mental health among those working in-person. Results: Among 1,576 workers, most reported hybrid work (77.2%). Most also reported good self-rated mental health (80.7%). Exclusive work from home (aOR: 2.79, 95%CI:1.90,4.07) and exclusive in-person work (aOR: 2.79, 95%CI: 1.83,4.26) were associated with poorer self-rated mental health than hybrid work. Vaccine status mediated only a small proportion of this relationship (7%), while masking and physical distancing were not mediators. Conclusion: Hybrid work arrangements were associated with positive self-rated mental health. Compliance to vaccination, masking, and distancing did not meaningfully mediate this relationship.

To describe the main health surveillance strategies for the control of COVID-19 in Brazil, with emphasis on decisions and actions taken at the federal level to prevent the infection caused by the new SARS-CoV-2. This is a scoping review study carried out from November 2019 to January 2021 using the DECS and MeSH health descriptors in Portuguese and English in four databases, in addition to the legislation found on the Brazilian Government's legislation portal. Based on the analysis of the documents, the actions describe non-pharmacological and pharmacological measures, measures related to decisions on closing and opening international borders, the acquisition of supplies and essential services. Although some strategies for containing the pandemic were identified, discrete and unnoticed surveillance measures are observed in view of the number of cases and number of deaths during the period of research analysis. The results show the absence of the federal level as support for the states and municipalities and imply decision-making and planning of actions by the Unified Health System to control the pandemic.

Students are regarded as frequent users of mobile phones which has proven to be a convenient and acceptable method to promote healthy lifestyle. Students usually engage in relatively high levels of risky behavior and make unhealthy lifestyle choices, a study that investigates how health students access health information is necessary. The study adopted a descriptive cross-sectional study which was undertaken among third-year nursing students from three nurses training institutions in Ghana. A total of 270 students participated in the study. Most of the respondents who were currently subscribers of the health messages reported that they usually received health information on reproductive health issues, nutrition, and practicing safe sex. Most of the health students revealed that they needed more information on safe sex, diet, managing weight, and stress management. The results also show that health students are likely to remember and share short messages with friends. The findings serve as an ‘eye-opener’ for health educators and mobile service providers concerning factors that should be taken into consideration when framing health text messages that will attract health students.

Background. Perinatal depression is one of the leading causes of disability in perinatal women and is highly prevalent in disadvantaged communities in LMICs. However, care capacity remains low in most LMICs. As such, we decided to find and assess a screening program that addresses perinatal mental health problems in a resource-efficient manner. This leads us to a critically appraisal of the Perinatal Mental Health Project (PMHP), a screening program based in peri-urban Western Cape Town that stresses task sharing and stepped care intervention. Method. PubMed, Ovid Medline (1946 to 2018), and Google Scholar were searched for publications until March 2018, with data or evaluation of the PMHP. PMHP website publications were used for data and interpretation. The program’s viability was evaluated based on criteria published by UK National Screening Council. The program’s impact was analyzed using published patient outcome data. Access to care was evaluated at three barriers to accessing care proposed by Gjerdingen et al. (2007). The financial model was evaluated using the “four-pillars” of sustainable organization financial management proposed by León (2001). Findings. The PMHP’s screening program viability satisfies most criteria of the UK National Screening Council, and the program’s benefits outweigh its harms. Patient self-reports indicate successful impact with several highlights in accessibility. The program also demonstrates financial sustainability and potential for scaling-up. Interpretations. The operation model of the PMHP shows satisfactory viability and sustainability. With modifications fitting local context and government cooperation, this model offers promising potential in bringing public health and economic benefits.

Objective: Taiwan Government’s organizations have endeavored to promote the applications of big data and open data. The “My Health Bank” is one of the measures promoted by the National Health Administration, Ministry of Health and Welfare. This study proposes the perspective of the “value co-creation” with the attempt to extend the concept of service ecosystem and apply it on the platform of My Health Bank to examine whether people (patients, families, and caregivers) can promote their health literacy? Method: This cross-sectional study, with people that have registered at “My Health Bank” as subjects. Complying with the inclusion criteria, 401 questionnaires were delivered, with 391 valid ones, excluding those incompletely and inaccurately filled. Result: That the affecting factors of the co-creation of values: age, education level, annual income, and platform operation show to be significant ( p＜0.05); and gender, occupation, and resource exchange do not reach the significant level (p＞0.1). Conclusion: We found My Health Bank changed the inertia of “value creation” in the traditional medical value, it allows the traditional medical and healthcare industry to expose to the impacts of the mega trend of the internet, the transformation of the platform in a necessary trend.

Access to maternal healthcare services is a challenge in most low and middle-income countries. South Africa is one of the countries striving to improve the accessibility of maternal healthcare services. Although South Africa has put some interventions to improve the accessibility of maternal healthcare services, vulnerable women including women with disabilities are still facing numerous challenges when trying to access maternal healthcare services. The aim of the study was to explore the experiences of women with disabilities in the province of KwaZulu-Natal in South Africa in accessing public maternal healthcare services. Twelve women with disabilities (four with physical impairments, four with hearing impairments and four with visual impairments) were interviewed for this study. Data were transcribed verbatim and analysed utilising the Framework of Assessing Access to Maternal Healthcare Services by Peters et al. 2008. The study found that narrow passages and information in inaccessible formats were a challenge for women with visual impairments. The women with hearing impairments had challenges in communication as most facilities did not have sign language interpreters, negative attitudes of health care workers and being ignored when they asked for help. The women with physical impairments encountered inaccessible buildings, narrow passages, small consultation rooms and equipment which is not adjustable such as beds and scales.

Background: Appendicular skeletal muscle (or lean) mass (ALM) estimated using dual-energy X-ray absorptiometry (DXA) is considered to be a preferred method for sarcopenia studies. However, DXA is expensive, has limited portability, and requires radiation exposure. Bioelectrical impedance analysis (BIA) is inexpensive, easy to use, and portable; thus BIA might be useful in sarcopenia investigations. However, a large variety of models have been commercially supplied by different companies, and for most consumer products, the equations estimating ALM are not disclosed. It is therefore difficult to use these equations for research purposes. In particular, the BIA equation is often age-dependent, which leads to fundamental difficulty in examining age-related ALM loss. The aims of the current study were as follows: (1) to develop and validate an equation to estimate ALM using multi-frequency BIA (MF-BIA) based on theoretical models, and (2) to establish sarcopenia cutoff values using the equation for the Japanese population. Methods: We measured height (Ht), weight, and ALM obtained using DXA and a standing-posture 8-electrode MF-BIA (5, 50, 250 kHz) in 756 Japanese individuals aged 18 to 86-years-old (222 men and 301 women as developing equation group and 97 men and 136 women as a cross validation group). The traditional impedance index (Ht²/Z₅₀) and impedance ratio of high and low frequency (Z₂₅₀/Z₅) of hand to foot values were calculated. Multiple regression analyses were conducted with ALM as dependent variable in men and women separately. Results: We created the following equations: ALM = (0.6947 × (Ht²/Z₅₀)) + (−55.24 × (Z₂₅₀/Z₅)) + (−10,940 × (1/Z₅₀)) + 51.33 for men, and ALM = (0.6144 × (Ht²/Z₅₀)) + (−36.61 × (Z₂₅₀/Z₅)) + (−9332 × (1/Z₅₀)) + 37.91 for women. Additionally, we conducted measurements in 1624 men and 1368 women aged 18 to 40 years to establish sarcopenia cutoff values in the Japanese population. The mean values minus 2 standard deviations of the skeletal muscle mass index (ALM/Ht²) in these participants were 6.8 and 5.7 kg/m² in men and women, respectively. Conclusion: The current study established and validated a theoretical and age-independent equation using MF-BIA to estimate ALM and provided reasonable sarcopenia cutoff values.

Tyrosine kinase inhibitors (TKI) and immune checkpoint inhibitors (ICI) significantly improve the outcomes of patients with advanced clear cell renal cell carcinoma (ccRCC), but high-grade toxicities can occur, particularly during combination therapy. Herein, we report a patient with advanced metastatic ccRCC, who developed grade 4 cholestasis during combined therapy with nivolumab and cabozantinib. After the exclusion of common disorders associated with choles-tasis and a failure of corticosteroids (CS), a liver biopsy was performed that demonstrated severe ductopenia. Consequently, a diagnosis of vanishing bile duct syndrome related to TKI and ICI administration was made, resulting in CS discontinuation and ursodeoxycholic acid administra-tion. After a 7-months follow-up, liver tests had returned to normal values. Immunological studies revealed that our patient had developed robust T-cells and macrophages infiltrates in his lung metastasis, as well as in skin and liver tissues at the onset of toxicities. At the same time, peripheral blood immunophenotyping revealed significant changes in T-cell subsets suggesting their potential role in the pathophysiology of the disease.

As a result of the COVID-19 pandemic, as well as other outbreaks such as SARS and Ebola, bats are recognized as a critical species for mediating zoonotic infectious disease spillover events. While there is a growing concern of increased antimicrobial resistance (AMR) globally during this pandemic, knowledge of AMR circulating between bats and humans is limited. In this paper, we have reviewed the evidence of AMR in bats and discussed the planetary health aspect of AMR to elucidate how this is associated with the emergence, spread and persistence of antibiotic resistance at the human-animal interface. The presence of clinically significant resistant bacteria in bats and wild life has reflective and broad impact on zoonotic pandemic surveillance, disease transmission and treatment modalities. We searched MEDLINE through PubMed and Google Scholar to retrieve relevant studies (n=38) that provided data on resistant bacteria in bats till September 30, 2022. There is a substantial variability in the results from studies measuring the prevalence of AMR based on geographic location, bat types and time. We found all major groups of gram positive and gram negative bacteria in bats which are resistant to commonly used antibiotics. The most alarming issue is- recent studies have increasingly identified Methicillin Resistant Staphylococcus aureus (MRSA), ESBL producing and Colistin resistant Enterobacteriaceae in samples from bats. This evidence of superbugs abundance in both humans and wild mammals like bats, could facilitate a greater understanding of which specific pathways of exposure should be targeted. We believe that these data will also facilitate future pandemic prepareness as well as global AMR containment during the pandemic events and beyond.

Pet ownership is common in modern society. In Portugal, 38% and 31% of all households own, at least, one dog or cat, respectively. Few studies have ascertained the knowledge of pet owners about pet ownership and zoonoses, and none of them was carried out in Portugal. The aim of the present study was to assess household knowledge and practices related to pet ownership and zoonoses in the North of Portugal. A questionnaire was completed by 424 pet owners, during November 2019 to February 2020. Most respondents (97.2%) considered pets as an important part of the family, especially women (p = 0.036); 73.1% allowed their pets free access to indoors; 41.3% denied sharing the bed with their pets and 29% assumed they did it daily; 20.3% reported never kissing their pets/pets licking their faces; 73.6% considered animals as potential sources of diseases to humans, but only 25.9% reported knowing the definition of zoonoses; 96.9% considered important the role of veterinarians in protecting public health. The low level of knowledge of pet owners and the occurrence of high-risk behaviors indicate a need to strengthen communication between veterinarians, physicians, pet owners and the general public to reduce the risk of acquisition and transmission of zoonoses.

Asthma is a significant public health concern. This study identified the provinces with the highest morbidity and mortality rates due to asthma among the working-age population (15-69 years) in the Republic of Ecuador. The secondary objective was to explain the possible differences attribut-able to occupational exposure. This nationwide ecological and exploratory study was conducted in 24 provinces between 2016 and 2019. Government databases were used as sources of infor-mation. Standardized rates were calculated for codes the J45 and J46. The hospitalization mor-bidity rate for asthma decreased from 6.51 to 5.76 cases per 100,000 working-age population, and the mortality rate has consistently been low and stable from 0.14 to 0.15 deaths per 100,000 working-age population. Geographic differences between the provinces were evident. The risk of hospitalization and death due to asthma was higher in the Pacific coast (five provinces) and the Andean region (two provinces). The high rates observed in provinces with greater agricultural and industrial development could be the main determinants of national heterogeneity and could act as occupational risk factors. The contribution of occupational hazards in each province should be examined in depth through ad hoc studies. These findings provide valuable information for creating public policies aimed at promoting and safeguarding the respiratory health of the popu-lation, particularly that of workers.

Electroencephalography (EEG) enabled earbuds represent a promising frontier in evaluating brain activity beyond traditional laboratory settings. However, these devices need more comprehensive characterization before widespread health related usage. A toolbox was developed to facilitate and expand the assessment of ear-EEG devices. The first component of this toolbox is a desktop application (“EaR-P Lab”) that integrates EEG validation paradigms. This application is designed to be used with EEG amplifiers compatible with the Lab Streaming Layer (LSL) protocol. The second element of the toolbox introduces an adaptation of the phantom testing concept, to the domain of ear-EEG by using 3D ear scans of the tested individuals, allowing controlled assessment of ear-EEG devices. The EEG paradigms were validated for scalp acquisitions and applied on ear-EEG measurements, under wet ear electrode conditions. The ear-EEG phantom was successful in measuring useful metrics in EEG system characterization, highlighting performance differences within the electrodes on the tested earpieces. This knowledge was factored in to select an optimal electrode reference which resulted in increased response power on the auditory steady-state response (ASSR). Through this work, an ear-EEG evaluation toolkit is made available with the intention to enable future and systematic assessment of novel ear-EEG devices from the hardware to the neural signals.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

The durability of ecological concrete in a marine environment was studied. Specimens of a six-year-old submerged ecological concrete from a breakwater located in the East Mediterranean sea were analyzed for their biological carbonate deposition cover, chloride effective diffusion, carbonation, and mineralogy. About 57% of the surface was found to be covered by biogenic-deposited carbonates. The effective chloride diffusion coefficient and the carbonation rate were found to be reduced proportionally to the biogenic-carbonate cover. Most of the aluminates were found in non-crystalline minerals. No evidence of a sulfate attack was found.

Apathy is a fundamental neuropsychiatric symptom of Korsakoff’s syndrome (KS) and has also been reported in patients with alcohol use disorder with no (AUD) or less severe cognitive disorders (ALC). However, research on the nature of apathy is limited in these groups. Aim of this study was to examine the multidimensional nature of apathy in patients with KS, ALC and AUD. Moreover, we examined differences between apathy ratings by patients and their professional caregivers, and related apathy to everyday functioning and overall cognition. Twenty-four patients with KS, 24 patients with ALC and 21 patients with AUD participated in this study. Apathy was measured using the Apathy Motivation Index (AMI), which distinguishes behavioral, emotional and social apathy. Both patients and professional caregivers reported social apathy as most prominent symptom, compared to behavioral and emotional apathy. Apathy ratings did not differ across the three patient groups. Discrepancies between patient and caregiver ratings were observed in patients with KS and ALC, with more severe apathy reported by caregivers. Caregiver-reported behavioral and social, but not emotional, apathy was related to everyday functioning. These results show that apathy is present in a substantial proportion of patients with alcohol addiction with or without cognitive impairments.

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

EZH2 overexpression is associated with tumor proliferation, metastasis, and poor prognosis. Targeting and inhibiting EZH2 may be an effective therapeutic strategy for head and neck squamous cell carcinoma (HNSCC). We previously analyzed EZH2 mRNA expression in a well-characterized dataset of 230 (110 original and 120 validation cohorts) human head and neck cancer samples. This study aimed to investigate the effects of inhibiting EZH2, either via RNA interference or via pharmacotherapy, on HNSCC growth. EZH2 upregulation was significantly correlated with recurrence (P < 0.001) and the methylation index of tumor suppressor genes (P < 0.05). DNMT3A was significantly upregulated upon EZH2 upregulation (P = 0.043). Univariate analysis revealed that EZH2 upregulation was associated with poor disease-free survival (log-rank test, P < 0.001). In multivariate analysis, EZH2 upregulation was evaluated as a significant independent prognostic factor of disease-free survival (hazard ratio: 2.085, 95% confidence interval: 1.390–3.127; P < 0.001). Cells treated with RNA interference and DZNep, an EZH2 inhibitor, showed the most dramatic changes in expression, accompanied with a reduction in the growth and survival of FaDu cells. These findings suggest that EZH2 upregulation is correlated with tumor aggressiveness and adverse patient outcomes in HNSCC. Evaluation of EZH2 expression might help predict the prognosis of HNSCC patients.

Garment sector has crucial working field in Turkey.It has also very high risky occupational health conditions and safety.The objective of this study is to define level of job level, work-related stress’ symptoms, social support and coping mechanisms of garment workers and to determine any related factors.This study is descriptive and cross-sectional. The study population comprised garment workers in the 16-65 age range. The data was collected by Assessment Form, The Brief Stress Coping Profile and Brief Job Stress Questionnaire. The level of work-related stress was statistically higher among the workers who had chronic disease, low economic, education status and poor quality of sleep. Psychological and physical physiological reactions to stress were found higher among women workers and those with chronic disease.It also was seen that job stress scores had a meaningful relationship with “emotional expression involving others” (r =.20) and “Avoidance and suppression” coping profile (r =.16; p <.01).Psychological symptom scores were found to have a low level of meaningful relationship with “Seeking help for solution” (r =-.08), “changing point of view” (r=.13) and “emotional expression involving others” coping profiles (r=.21). Work-related stress causes many health and behavioral problems. Work related reasons and coping profiles have powerful effects on stress.

Age-related diseases (ARDs) are the leading cause of death worldwide, and contribute to 90% of mortality in developed countries. Interestingly, the mortality rates of individual ARDs increase exponentially with age. Processes described by the exponential growth function typically involve a branching chain reaction or, more generally, a positive feedback loop. Here I propose that each ARD is mediated by one or several positive feedback loops (vicious cycles). I then identify critical vicious cycles in five major ARDs: atherosclerosis, hypertension, diabetes, Alzheimer’s and Parkinson’s. I also propose that the progression of ARDs can be halted by selectively interrupting the vicious cycles and suggest the most promising targets. An evolutionary perspective is also offered.

We aimed to directly compare the cost-effectiveness of the NELSON and NLST screening protocols, two trials influencing lung cancer screening implementation internationally. A decision-analytic model analyzing the cost-effectiveness of the NELSON protocols was manipulated to reflect the protocols of the NLST, while maintaining features specific to the Hungarian healthcare setting. In the NELSON protocol, there are three possible outcomes to the initial round of screening: positive, negative, or indeterminate, indicating an uncertain degree of suspicion for lung cancer. This pro-tocol differs from the NLST protocol, in which the only possible screening outcomes are positive or negative, with no indeterminate option. The NLST pathway for smokers aged 55-74 resulted in a 43 € increase in total average lifetime costs compared to the Hungarian screening pathway and re-sulted in a lifetime gain of 0.006 QALYs. The incremental costs and QALYs yield an ICER of 7875 €/QALY. Our results demonstrate that assigning any suspicious LDCT screen as a positive result (NLST protocol) rather than indeterminate (NELSON protocol) can yield a slight QALY gain that is worth the additional use of resources according to Hungary’s willingness to pay threshold. Our study provides insight on the cost-effectiveness, advantages, and disadvantages of various LDCT screening protocols for lung cancer and can assist other countries as they implement their screening programs.

We take what we see, hear, smell and feel for the reality. However, as neuroscientists, we know that this reality, that is, our perceptual world, is in fact made up by the brain from the processing of the nerve impulses coming from receptors. Ancient Greeks used to think that this perceptual world, sometimes called our 3D movie (Chalmers), is emitted and has its own physical nature. Given how real the 3D movie looks to us, it is still difficult today to consider that all we would be dealing with would be patterns of brain activity The present study thus aimed at testing whether the perceptual world could have some physical existence in addition to that of the neural patterns responsible for it. To achieve that goal, we tried to see whether brains could be sensitive to the 3D movie of others. This, admittedly unusual, operational hypothesis was based on two assumptions. First, brains are sensitive to the 3D movie, as our experience includes reactions to our perceptual world. Second, the physicality at stake does not differ across individuals. We recorded the event-related brain potentials (ERPs) evoked by stimuli of the international affective picture system in pairs of closely-related participants. Most importantly, they could neither see the stimuli simultaneously presented to their partners nor their reactions to them. As in Bouten et al. (2015), around 400 ms after the onset of the stimuli, ERPs started being more positive in inconsistent conditions. Namely, when the two subjects of each pair were presented with the same stimulus whereas they were told it would be a different one and vice-versa (i.e., different-stimuli expected to be same). ERPs were less positive when the two subjects of a pair were presented with the same stimuli and were told they were the same and conversely (i.e., different-stimuli expected to be different). The same experiment was then run in pairs of strangers. No significant effect of consistency on ERPs was observed even though participants could, this time, see, in the very periphery of their visual field, the reactions of their partner to the stimuli. We thus use the results of both studies to support a new version of the emission theory of consciousness and to suggest that the sensitivity to the perceptual world of others may depend on their prior familiarity with it.

Background: In 2020, health providers were expected to provide care to individuals with coronavirus disease 2019 (COVID-19) putting them at risk of acquiring COVID-19. The possibility of acquiring poorly understood infectious diseases while providing care may have an impact on the mental health of providers. We conducted a study to explore the effects of COVID-19 on the mental health of healthcare providers. Methods: Between April and August 2021, we conducted in-depth interviews with 60 health providers in the infectious disease unit (IDU) and other units in the hospital (non-IDU). Health providers completed an online self-administered survey form with demographic data (age, sex, average income, and known contact with a COVID-19 patient). We used semi-structured interview guides to understand health providers’ lived experiences with stress, anxiety, depression, and their associated factors. We transcribed interviews verbatim, coded and analyzed the transcripts to derive thematic concepts related to mental health experiences. Results: Health providers had a median age of 37 years, [IQR 20.0-58.0], 56.7% were female, 30.0% nurses, 18.3% medical doctors, and 11.7% laboratory technologists. Health providers reported increased stress during the pandemic attributed to high demand for patient care, changes in social life, and fear of COVID-19 infection. They also reported experiences of anxiety and depression as a result of limited knowledge at the beginning of the pandemic and the perception that ‘COVID-19 resulted in death’. Testing positive for COVID-19, high exposure to COVID-19 risks, and death of patients and colleagues reportedly affected health providers’ mental health. Additionally, health providers reported mental health support through debriefing meetings, peer-to-peer support, and psychological counseling with privacy and confidentiality concerns. Conclusion: Health providers faced mental health issues such as stress and anxiety while taking care of COVID-19 patients. An effective mental health response requires institutional practices that address context-specific challenges such as privacy and confidentiality.

The pandemic of Covid-19 has contributed to the increase of the number of cases of anxiety, depression, and stress, especially in vulnerable workers. The objective of this study was to analyze factors associated with mental health of waste pickers and street sweepers in Brasília, Brazil, during the Covid-19 pandemic. It was a cross-sectional cohort study with a quantitative approach. SRQ-20 test was used to assess mental health. The study sample included 886 workers: 601 street sweepers and 285 waste pickers. Of the total, 71 workers (8.0%) had SRQ-20 ≥ 7, which is equivalent to adverse mental health. The characteristics associated with adverse mental health were women (PR: 3.36; 95%CI:1.86;6.08), worker between 18-39 years old (PR: 2.19; 95% CI 1.32;3.65), waste pickers (PR: 1.65; 95%CI:1.01;2.70), worker who reported two (PR: 3.24; 95%CI:1.72; 6.12), three or more (PR: 4.73; 95%CI:2.40;9.32) health problems. For the symptoms, 17.05% of the people interviewed said they felt sad and 18.25% nervous, tense, and worried. Female waste pickers, young adults, with many health problems were more susceptible to adverse mental health and it doesn't just affect them, but also their families. Public policies are needed to protect these professionals so that they can work safely and establish early interventions to maintain these workers' mental integrity.

Environmental lead exposure is a population health concern in many low- and middle-income countries. Lead is found throughout Myanmar and prior to the 1940s, the country was the largest producer of lead worldwide. The aim of this study was to examine any potential association between lead mining and adult literacy rates at the level of the 330 townships in Myanmar. Townships were identified as lead or non-lead mining areas and 2015 census data were examined with association being identified using descriptive, analytical and spatial statistical methods. Overall, there does appear to be a significant relationship between lead mining activity and adult literacy levels (P<0.05) among townships with both low access [OR= 2.701 (1.136-6.421)] as well as townships with high access to safe sanitation [OR=18.40 (1.794-188.745)]. LISA cluster maps confirm these findings. This exploratory analysis is a first step in the examination of potential environmental lead exposure and its implications in Myanmar.

People from Black and Asian backgrounds are more likely to die from Covid-19 but less likely to be vaccinated, threatening to exacerbate health inequalities already experienced by ethnic minority groups. Literature suggests that mistrust rooted in structural inequality may be a key barrier to Covid-19 vaccine uptake. We need to better understand how structural inequalities influence vaccine confidence. Understanding and addressing these processes is likely to lead to longer-term impacts than information alone. We draw on health and sociological theories of structure and agency to inform our understanding of structural factors. We conducted qualitative interviews and focus groups with 22 people from London and surrounding areas in December 2021 to March 2022. Fifteen participants were members of the public from ethnic minority backgrounds and 7 were professionals working with the public to address concerns and encourage vaccine uptake. Our findings suggest that people from ethnic minority backgrounds make decisions regarding Covid-19 vaccination based on a combination of how they experience external social structures (including political authority, social positioning and racial inequality) and internal processes (what they believe and understand about Covid-19 vaccines). We may be able to support knowledge accumulation through the provision of reliable and accessible information, particularly through primary and community care. But we recommend a number of changes to research, policy and practice which address structural inequalities. These include working with communities to improve ethnicity data collection, increasing funding allocation to health conditions where ethnic minority communities experience poorer outcomes, greater transparency and public engagement in the vaccine development process, and culturally adapted research recruitment processes.

This article delves into the pivotal role that biodiversity of soil microbes plays in bolstering tree health and overall agroecosystem productivity. With the advent of regenerative agricultural practices, there has been a resurgence of interest in understanding the complex interactions between soil microbiota and plant roots, particularly through processes like rhizophagy. Rhizophagy, the digestion of living root cells by soil microorganisms, stands out as a fundamental mechanism in nutrient cycling and overall tree vitality. By examining the impact of enhanced microbial diversity on tree health, we shed light on the practical applications, such as the utilization of the BEAM Inoculant product, which has demonstrated remarkable efficacy in augmenting soil health and, consequently, tree Vigor

COVID-19 has proven to be detrimental across the globe, most notably affecting the United States at an alarming rate compared to comparable countries. The pandemic has had multifactorial implications on the way communities in the United States prevent, prepare for, and address the virus; however, the impact of the pandemic on rural health is less well understood. Historically, rural communities have faced a unique set of challenges regarding accessing and receiving adequate healthcare, addressing chronic illness, and eliminating health disparities closely associated with the population’s socioeconomic status; the pandemic has exacerbated these challenges. The purpose of the current study was to conduct a systematic review of the literature to evaluate the effect of the COVID-19 pandemic on rural populations both at the individual and community level. Results indicated that rural health disparities increased both at the individual and system-wide levels as a direct result of the pandemic. Budget cuts significantly affected the infrastructure of rural hospitals resulting in them being unequipped to handle such high volumes of COVID-19 cases. The lack of infectious disease specialists, access to larger medical centers with substantial numbers of ICU beds and ventilators, and an overall lack of preparedness overwhelmed rural communities. Although comorbidities such as diabetes and heart disease were associated with poorer health outcomes for a multitude of reasons, the lack of clinic and physician availability for routine care during the pandemic further exacerbated the clinical link from COVID-19 positivity to comorbidities. Furthermore, mental health deteriorated as substance use increased to a greater extent in rural communities compared to urban, during the pandemic. This study shows that health comorbidities, mental health, substance use, health literacy, access to healthcare, among others can serve as key indicators for improving healthcare in rural communities. Future studies should seek to identify key issues that disproportionately affected rural communities in comparison to their urban counterparts considering the pandemic, as well as identify gaps in the availability of rural health resources that can improve the lives of millions of Americans now and during the next pandemic.

Objective: to assess level of trust in health services during COVID-19 pandemic in Brazil. Methods: Cross-sectional study, carried out between 2020 and 2021, among Brazilians over 18. A non-probabilistic sampling was used. Descriptive and inferential statistics were applied, using the Local Bivariate Moran’s technique was used to verify the existence of spatial dependence between the incidence and mortality of COVID-19 and trust in health services. Furthermore, multinomial regression was also used to analyze the factors associated with the confidence level, with the calculation of the Odds Ratio and with a confidence interval of 95%. Results: 50.6% reported trust in hospital services while 41.4% did not trust Primary Health Care services. With the application of the Local Bivariate Moran, both for the incidence and mortality of COVID-19, the trust in tertiary care and primary care services showed a statistically significant spatial association predominant in the Midwest (High-Low) and North (Low-High) regions of Brazil. The level of trust was associated with education, religion, region of the country and income. Conclusions: The level of trust in hospital services, more than Primary Health Care services, may be related to the population's culture of prioritizing the search for hospital care at the detriment of health promotion and disease prevention

Rotorcrafts operate HUMS for fault diagnosis, but the capabilities of HUMS analysts are important due to the complex mechanical configuration of rotorcraft and the difficulty of analysis. Accordingly, an advanced algorithm is needed to identify faults, and flight data can be used to develop the algorithm. However, flight data contains abnormal or missing data due to problems such as sensor defects, which can be a major problem in algorithm development. Therefore, in this paper, we study a gap filling method using MLP to obtain normal data when there are problems such as abnormal or missing data in rotorcraft flight data. Existing methods typically fill the gap through interpolation or curve fitting using the before and after values of missing data. However, in this study, normal values were estimated using the values of other parameters at the moment of missing or abnormal data occurred. As a result of evaluating the performance of the trained MLP using normal data, it was confirmed that the output of the model well estimates the changing trend of the target. And when abnormal data was applied to the trained model, it was confirmed that point outliers were eliminated and appropriate values were found in the case of missing data.

Introduction: Bovine tuberculosis is a zoonotic disease of considerable impact, especially in livestock countries, which can cause human disease. Despite its importance, Colombia is a country in which few studies analyse its behaviour, and none develop maps using geographic information systems to characterise it. Objective: To describe the temporal-spatial distribution of bovine tuberculosis in Colombia between 2001 and 2019. Methods: Retrospective cross-sectional descriptive study, based on reports by the Colombian Agricultural Institute, of tuberculosis surveillance in cattle on farms in Colombia from 2001 to 2019. The data were converted into databases in Microsoft Access 365®, and multiple epidemiological maps were generated with the Kosmo RC1®3.0 software coupled to shape files of all the country's departments. Results: During the study period, 5,273 tuberculosis cases in bovines were identified in the different departments of Colombia (mean 278 cases/year). Regarding its temporal distribution, the number of cases varied from a maximum of 903 cases (17.12% of the total) in 2015 to a minimum of 0 between 2001 and 2004 and between 2017 and 2019 (between 2005 and 2016, the minimum was 46 cases, 0.87%). Conclusions: GIS is an essential tool for understanding the temporospatial behaviour of zoonotic diseases in Colombia, as is the case of bovine tuberculosis, with its potential implications for Human and One Health.

Background: Australia’s healthcare system is complex and fragmented which can create challenges in healthcare, particularly in rural and remote areas. Aboriginal people experience inequalities in healthcare treatment and outcomes. This study aimed to investigate barriers and enablers to accessing healthcare services for Aboriginal people living in rural and remote Australia. Methods: Semi-structured interviews were conducted with healthcare delivery staff and stakeholders recruited through snowball sampling. The communities were selected for their high proportion of Aboriginal people and geographical representation (coastal, rural, and border). Thematic analysis identified barriers and enablers. Results: Thirty-one interviews were conducted (n =5 coastal, n=13 remote, and n=13 border) and six themes identified: 1) Improved coordination of healthcare services; 2) Better communication between services and patients; 3) Trust in services and cultural safety; 4) Importance of prioritizing health services by Aboriginal people; 5) Importance of reliable, affordable and sustainable services; 6) Distance and transport availability. These themes were often present as both barriers and enablers to healthcare access for Aboriginal people. They were also present across the healthcare system and within all three communities. Conclusions: This study describes a pathway to better healthcare outcomes for Aboriginal Australians by providing insights into ways to improve access.

Background: According to metacognitive theory, Cognitive–Attentional Syndrome (CAS) is a transdiagnostic factor and main mechanism of psychopathology maintenance. The main goal of this study was to examine whether CAS predicted symptoms of stress and trauma-related symptomatology in the first months of the COVID-19 pandemic and three months later. Methods: Initially 1,792 participants were recruited online via social media; data was collected at two time points. Measures included the Cognitive–Attentional Syndrome Questionnaire, Adjustment Disorder – New Module 20, the International Trauma Questionnaire, and additional measures. Results: Structural equation modeling was conducted in order to determine relations between reported stressors, CAS, and symptomatology. At both time points, CAS was a significant mediator between stressors and symptoms of adjustment disorder. Despite the decrease in the intensity of adjustment disorder symptoms between waves, it was a significant predictor of other psychopathology at both time points, except for traumatic stress. Conclusions: The findings confirm the assumption that CAS is a transdiagnostic factor of psychopathology, and has a mediating role in the relationship between stressors and adjustment disorder and co-occurring symptomatology. The effect was particularly significant in the initial phase of the pandemic, which was highly stressful for many people.

Postpartum depression (PPD) can predispose to physical and mental health problems in women. However, PPD is associated with health and perceived social support but their causal relationship is unclear. Therefore, this study intended to evaluate the association of PPD with insomnia, mental health, and physical health. Convenience sampling technique was used to collect data from 320 (52.8 %) young and middle aged postpartum women, in the outpatient departments of obstetrics and gynecology in Government Maula Bakhsh Hospital, District Head Quarter in Sargodha, Pakistan. The Edinburgh Postnatal depression scale, Pittsburg sleep quality index, Warwick-Edinburgh mental wellbeing scale, Patient health questionnaire, and Multidimensional scale of perceived social support were used to measure study variables. Results revealed a significant positive relationship of PPD with physical health (r= .45, p=.001), while a negative relationship with insomnia (r= -.24, p<.001), and perceived social support (r= -.38, p=.001). Results further confirmed that perceived social support played a moderating role (β = .97, p=.01) in the relationship between PPD and mental health among females. This study concluded that perceived social support has an important role in PPD and women’s health. The study also concluded that poor health is a risk indicator for identifying aid in the early stages of postpartum among women.

Aging is accompanied by frontal lobe and non-dominant hemisphere recruitment that supports executive functioning, such as inhibitory control, which is crucial to all cognitive functions. Yet, the spatio-temporal sequence of processing underlying successful inhibition and how it changes with age is understudied. Thus, we assessed N200 (conflict monitoring) and P300 (response inhibition, performance evaluation) event-related potentials (ERPs) in young and healthy older adults during comparably performed successful stop-signal inhibition. We additionally interrogated the continuous spatio-temporal dynamics of N200- and P300-related activation within each group. Young adults had left hemisphere dominant N200, while older adults had overall larger amplitudes and right hemisphere dominance. N200 activation was biphasic in both groups but differed in scalp topography. P300 also differed, with larger right amplitudes in young, but bilateral amplitudes in old, with old larger than young in the left hemisphere. P300 was characterized by an early parieto-occipital peak in both groups, followed by a parietal slow wave only in older adults. A temporally similar but topographically different final wave followed in both groups that showed anterior recruitment in older adults. These findings illuminate differential age-related spatio-temporal recruitment patterns for conflict monitoring and response inhibition that are critically important for understanding age-related compensatory activation.