Accompanied by increasing population growth and urban sprawl, most coastal cities are unprecedentedly vulnerable to climate change and its impacts, such as sea level rise, increasing extreme storm events, and coastal flooding. Coastal resilience and sustainable development are antidotes to vulnerability; they aim to enhance the adaptive capability of absorbing disturbances and resisting uncertainty. This study explores building a quantitative assessment framework to measure resilience and provide an objective and comparable method to understand the strengths and weaknesses in a given region. The proposed 25 resilience indicators incorporate the aspects of essential livelihood protection, infrastructure and natural resource maintenance, emergency facilities and institutions, floodplain management regulations, and adaptive planning process. Each indicator is assigned the resilience quality that includes robustness, resourcefulness, redundancy, and rapidity. The aggregated resilience quality scoring reflects the systematic performance of the city to cope with the coastal hazards. The innovative part of this framework is combining hazard mitigation measures, climate adaptation strategies, and sustainable development goals together to achieve a comprehensive assessment method. In the case of New Haven, the resilience assessment is taken as a practical monitoring tool and decision-making support.

Trichothecene mycotoxin T-2 toxin is an important environmental pollutant and poses a global threat to human and animal health. T-2 toxin could induce nephrotoxicity, however, the precise molecular mechanism remains unclear. In this study, the mice were intraperitoneally administrated with a single dose of 2 mg/kg T-2 toxin. The kidney function and ultrastructural observation were also assessed and found T-2 toxin exposure could cause kidney damage. Transmission electron microscopy showed a significant swelling and vacuolization of the mitochondria of renal cell. A total of 1122, 58, and 391 differential expression genes (DEGs) that were predominantly expressed in kidney tissues at 1 d, 3 d, and 7 d after T-2 toxin exposure, respectively. Early transcriptomic changes at 1 d after exposure were down-regulation of DEGs involved in the cell cycle, p53 signaling pathway, and cellular senescence, while up-regulation of DEGs referred to the ribosome pathway. The temporal variations in gene expression pattern in T-2 toxin exposure in mice kidney were presented and cellular metabolism was disturbed at the exposure recovery period with 7 d. In conclusion, this study, for the first time, provided a comprehensive comparative transcriptomic analysis of gene regulation in T-2 toxin exposure-induced nephrotoxicity at different temporal periods and explored the nephrotoxicity mechanism of T-2 toxin at the mRNA level.

This study aimed at exploring what role artificial intelligence techniques could play in the futural numerical analysis. In this paper, a convolutional neural network techniques based on modified loss function is proposed as a surrogate of finite element method(FEM). Several surrogate-based physics-informed neural networks(PINNs) are developed to solve representative boundary value problems based on elliptic partial differential equations (PDEs). Results from the proposed surrogate-based approach are in good agreement with ones from conventional FEM. It is found that modification of the loss function could improve the prediction accuracy of the neural network. It is indicated that to some extent the artificial intelligence technique could replace conventional numerical analysis as a great surrogate model.

A multispectral superconducting nanowire single photon detector sensitive to different incident photon wavelength bands, is proposed. The SNSPD consists of a Distributed Bragg Reflector, a gold mirror, and two regions employing four NbN nanowires. Using the DBR both as a filter and a reflector, two distinct detection bands are created. The first detection band has a peak absorbance of > 0.75 at a wavelength of 1143 nm, while the second band has an absorbance of > 0.70 in the wavelength range 1440 to 2000 nm. The design of the device can be tuned to provide sensitivity in different wavelength bands. While SNSPDs do not typically provide photon wavelength sensitivity, the band-selection design proposed in this work opens up potential applications for future quantum communication technology.

Reduced glutathione (GSH) is an antioxidant in plants and is one of the important ways for plants to combat low-temperature stress. In this paper, Eriobotrya japonica Lindl. cv. Zaozhong No. 6 seedlings were used to study the effects of exogenous 5-aminolevulinic acid (ALA) application on glutathione synthesis and cyclic metabolism of loquat seedlings under low-temperature stress and to explore the regulatory mechanism of ALA on loquat cold tolerance. The results showed that ALA treatment could increase the content of GSH and the reduced glutathione/oxidized glutathione (GSH/GSSG) ratio in loquat leaf slices under low-temperature stress; reduce the electrolyte leakage rate and GSSG, H₂O₂ and MDA contents in leaf tissues; and alleviate the peroxidation damage caused by low temperature. ALA treatment increased the activity of γ-glutamine synthetase (γ-ECS) in loquat leaf slices under low-temperature stress and promoted the biosynthesis of reduced glutathione, thereby increasing the GSH content in leaf tissues. On the other hand, ALA treatment could also improve the activities of glutathione reductase (GR), glutathione S-transferase (GST) and glutathione peroxidase (GPX) and promote the cyclic regeneration of GSH, accordingly maintaining a high GSH/GSSG ratio, promoting the removal of reactive oxygen species (ROS), and enhancing the antioxidant capacity of leaves. The regulatory effect of ALA on enhancing the antioxidant capacity of loquat seedlings under low-temperature stress can be inhibited by L-buthionine-sulfoximine (BSO, GSH biosynthesis inhibitor). The results showed that ALA improved the antioxidant capacity of loquat seedlings under low-temperature stress, and GSH was involved in the regulation of the antioxidant effect of ALA on loquat seedlings under low-temperature stress.

This is the first study to comprehensively evaluate the benefit of urban open spaces and cropland with different adjacent public facilities seen as locally undesirable (“not in my backyard,” NIMBY) or desirable (“yes in my backyard,” YIMBY). The total benefit increases or decreases for urban open space and cropland with adjacent NIMBY or YIMBY facilities in a municipality in Taiwan. The results show that for the city as a whole, the current arrangement of NIMBY and YIMBY in different zones decreases the total benefit of urban open spaces in highly urbanized zones and increases the total damage to cropland in extremely rural zones. This indicates a need to avoid further installing NIMBY or YIMBY facilities in already occupied urban open spaces. The results also demonstrate that locating NIMBY or YIMBY facilities near cropland fails to highlight the benefit of YIMBY facilities and magnifies opposition to NIMBY facilities. For individual housing units, the total damage is 1.87% of the average housing price for cropland-type open space with adjacent NIMBY or YIMBY facilities, and the total benefit is 7.43% of the average housing price for urban-type open space in a highly urbanized area. In contrast, the total benefit for open space with adjacent NIMBY or YIMBY facilities is a 2.95%-13.80% increase in the average housing price for areas with mixed urban open space and cropland.

The flat terrain in plain areas makes the land easily accessible for cultivation and farming, providing vast opportunities for agricultural development. Additionally, these areas are crucial for urban construction and economic growth. Soil mapping plays a crucial role in understanding soil characteristics and guiding land management practices. However, accurately mapping soils in plain regions can be challenging due to their low spatial variability and diverse land use types. This study focuses on the impact of land cover changes on the accuracy of soil mapping in plain areas, aiming to provide effective assistance in soil mapping through the analysis of their coupling relationship. Starting with a 20-year land cover change analysis, this study utilizes a unified approach that combines expert knowledge, mixed sampling methods, and random forest mapping techniques. The study incorporates environmental covariates that have minimal period influence and synergistically use NDVI (Normalized Difference Vegetation Index) and land cover data from the same year. The analysis is based on transition matrices, confusion matrices, and their derived indicators. The research findings indicate that Tongzhou District has experienced rapid development over the past 20 years, with the area of construction land nearly doubling. 29% of arable land has been converted into construction land, resulting in an increase in the accuracy of the soil map from 58.99% to 66.91% over the 20-year period. The soil change area during this period accounts for 16.5% of the total area, with 51.9% of the changed areas overlapping with land cover change areas. These overlapping regions are predominantly influenced by human activities. In terms of cultivated land types in the study area, the quantity of arable land has decreased by approximately 29% over the 20 years, while the proportion of sandy loam calcareous fluvo-aquic soil and light loam calcareous fluvo-aquic soil, which constitute nearly half of the soil types, has increased. These data demonstrate the coupling relationship between land cover changes and soil type variations, particularly the significant influence of human activities on soil structure. It is evident that on one hand, improving the extent of land use in plain areas enhances the credibility of soil mapping. On the other hand, human activities impact land cover, which in turn affects and reflects changes in the soil.

This paper proposes a novel biologically inspired design for an insect-scale flapping robot. The proposed scheme employs two motors to drive four wings, mimicking the flapping motion of nat-ural four-winged insects. The vehicle incorporates two pairs of flapping wings to generate lift force, with a transmission mechanism featuring flexure hinges instead of pivot joints, resulting in reduced weight and volume. The flexure hinges also exhibit nonlinear stiffness to facilitate smooth wing motion. The vehicle is designed to be symmetrical in structure, with the wings of each section generating greater lift through the clap-and-fling mechanism. The final product weighs 6.2g, pos-sesses a wingspan of 17cm, a one-sided flapping wing angle of 103 degrees, and generates lift that exceeds its weight, attesting to its successful design.

With the proliferation and development of social media platforms, social media data has become an important source for acquiring spatio-temporal information on various urban events. Providing accurate spatio-temporal information for events contributes to enhancing the capabilities of urban management and emergency response. However, existing research on mining spatio-temporal information of events often focuses solely on textual content, neglecting data from other modalities such as images and videos. Therefore, this study proposes an innovative spatio-temporal information extraction method for multi-modal social media data (MIST-SMMD), which extracts the spatio-temporal information of events from multi-modal data on Weibo at coarse and fine-grained hierarchical levels, serving as a beneficial supplement to existing urban event monitoring methods. This paper takes the "July 20th Zhengzhou Heavy Rainfall" incident as an example, to evaluate and analyze the effectiveness of the proposed method. The results indicate that in the coarse-grained spatial information extraction using only textual data, our method achieves a Spatial Precision of 87.54% within a 60m range, and reaches 100% Spatial Precision for ranges beyond 200m. For fine-grained spatial information extraction, the introduction of other modal data such as images and videos results in a significant improvement in Spatial Error. These results demonstrate the ability of the MIST-SMMD method to extract spatio-temporal information from urban events at both coarse and fine levels, and confirms the significant advantages of multi-modal data in enhancing the precision of spatial information extraction.

Threshing device is the core component of grain combine harvester, and its working performance determines the working quality and production efficiency of the harvester to a great extent. The straw guide plate plays an important role in the threshing device to dredge the threshing matter and control the threshing time of the combine harvester matter in the threshing chamber. In the past, the guiding structure of threshing device could not optimize the working performance of the machine by adjusting the spiral angle, that is, most cereal combine harvester may not be fed smoothly or even clogged when operating under different crop types, yield differences and operating environments, a kind of threshing device with adjustable guide straw board was studied. In this study, the movement model of the straw on the straw guide plate was analyzed, and it was found that the spiral angle “α”of the straw guide was 0<α<58°.Three-factor and three-level response surface method was used to carry out field experiment on drum speed, working speed and guide grass plate spiral angle, and the experimental data were analyzed by quadratic polynomial regression.The results show that the drum speed, working speed and the spiral angle of the guide grass plate have significant effects on the loss rate (PLR) , impurity content (PIR) and breakage rate (PBR) , the drum speed and working speed have an interactive effect on the impurity ratio (PIR) , and the working speed and the helical angle of the guide grass plate have an interactive effect on the loss ratio (PLR) and breakage ratio (PBR) , there is an interaction between the rotary speed of the roller and the helical angle of the guide grass plate on the crushing rate (PBR) .Further optimization analysis showed that the predicted value was PLR = 1.18% , PIR = 0.72% , PBR = 0.53% , the experimental verification value was PLR = 1.26% , PIR = 0.73% , PBR = 0.61% . The absolute error between the experimental value and the predicted value was very small, however, the optimized field test verified value decreased by 8.31% , 50.04% and 60.30% respectively, which indicated that the optimized harvester had better operation quality, in particular, PIR, PBR and other two indicators have a greater increase in the effect.

For traffic management under sudden disaster in high-density areas, the first and foremost step is to prevent traffic congestion in the disaster-affected area by traffic flow control, as to provide enough and flexible traffic capacity for emergency evacuation and emergency rescue. Catastrophe border identification is the foundation and the key to traffic congestion prediction under sudden disaster. This paper uses a mathematical model to study the regional traffic flow in the high-density area under sudden fire disaster based on the Cusp Catastrophe Theory (CCT). The catastrophe border is identified by fitting the CCT-based regional traffic flow model to explore the stable traffic flow changing to the instable state, as to provide a theoretical basis for traffic flow manage and control in disaster-affected areas, and to prevent the traffic flow being caught into disorder and congestion. Based on VISSIM simulator data by building simulation scenarios with and without sudden fire disaster in a Sudoku traffic network, the catastrophe border is identified as 439pcu/lane/h, 529pcu/lane/h, 377pcu/lane/h at 5s, 10s, 15s data collection interval respectively. The corresponding relative precision, which compares to the method of Capacity Assessment Approach (CAA), is 89.1%, 92.7% and 76.5% respectively. It means that 10s data collection interval would be the suitable data collection interval in catastrophe border identification and regional traffic flow control in high-density area under sudden fire disaster.

Most of the existing calibration methods for binocular stereo vision sensor (BSVS) depend on high-accuracy target with feature points that are difficult to manufacture and costly. In complex light conditions, optical filters are used for BSVS, but they affect imaging quality. Hence, the use of a high-accuracy target with certain-sized feature points for calibration is not feasible under such complex conditions. To solve these problems, a calibration method based on unknown-sized elliptical stripe images is proposed. With known intrinsic parameters, the proposed method adopts the elliptical stripes located on the parallel planes as a medium to calibrate BSVS online. In comparison with the common calibration methods, the proposed method avoids utilizing high-accuracy target with certain-sized feature points. Therefore, the proposed method is not only easy to implement but is a realistic method for the calibration of BSVS with optical filter. Changing the size of elliptical curves projected on the target solves the difficulty of applying the proposed method in different fields of view and distances. Simulative and physical experiments are conducted to validate the efficiency of the proposed method. When the field of view is approximately 400 mm × 300 mm, the proposed method can reach a calibration accuracy of 0.03 mm, which is comparable with that of Zhang’s method.

This paper explores the application of wavelet analysis, a multiscale approach for enhancing visual clarity, in the context of image denoising, which reduces the impact of noisy pixels, caused by various factors such as electronic sensor limitations, low-light conditions, or transmission errors in digital imaging systems. This paper introduces some common noise types like Gaussian noise and processes of image denoising, eliciting the strength of wavelet analysis. As a powerful image denoising technology, wavelet analysis needs five steps to process the image, and the key step is thresholding. There are many kinds of wavelet, and each wavelet has different advantages and functions, which makes it suitable for different applications. Hence, wavelet analysis also makes a contribution in various fields beyond signal processing and data analysis, such as Biomedical Imaging and Geophysics and Seismology, where preserving image quality is essential for accurate analysis and interpretation. In short, this research highlights the promise of wavelet analysis, emphasizing the use of high- quality image data.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Synthetic Aperture Radar (SAR) is an active type of microwave remote sensing. Using the microwave imaging system, remote sensing monitoring of the land and global ocean can be done in any weather conditions around the clock. Detection of SAR image targets is one of the main needs of radar image interpretation applications. In this paper, an improved two-parameter CFAR algorithm based on Rayleigh distribution and morphological processing is proposed to perform ship detection and recognition in high resolution SAR images. Through simulation experiments, comprehensive study of the two algorithms for high resolution SAR image target detection is achieved. Finally, the results of ship detection experiments are compared and analyzed, and the effects of detection are evaluated according to the Rayleigh distribution model and algorithms.

Additive manufacturing (AM) has been the core area of sustainable manufacturing commonly recognized for its high efficiency in enabling cost-effective production towards sustainability. There are three models this research constituted: In Collection-Recycling-Manufacturing (CRM) model, technologies and processes are benchmarked followed by Business model that evaluates industrial key criteria. However, these are insufficient for AM to effectively play dominant role as the realization requires human factors such as multi-entities authorities, policy making and AM society to initiate and execute the plan. Strategy control model focuses on human-centric approaches such as demography, population control, policy, regulations, and management. It investigates each nation’s demography, and enables strategy, plan and control to relocate overcrowding population to rural areas. It also produces robust workforce to support AM and materials recycling through the appropriate applications. Through the construction of AM and materials recycling, strategy control model creates job opportunities for those unemployed people. It further builds infrastructure for the livelihood of new residents and supports AM home-based business (HBB).

Abstract：This paper uses the balanced panel data from 29 provinces (autonomous regions and municipalities) in China for a total of 17 years from 2000 to 2016 as a research sample, and establishes an empirical model to examine the impact of environmental regulations and technological innovation on the quality of economic growth. Then this paper test technological innovation as a threshold variable, in which play a regulatory role. Taking the provincial balanced panel data as a research sample, a fixed effect model, a system GMM model, and a panel threshold model were established for empirical testing and the robustness test. Based on the empirical results, this article draws the following conclusions: from a national perspective, environmental regulations and technological innovation can significantly promote the quality of economic growth; from a regional perspective, there are regional differences in impact effects. Under the constraints of environmental regulations, the promotion effect of technological innovation on the quality of economic growth will be reduced; the impact of environmental regulation on the quality of economic growth will have a "threshold effect", and environmental regulation can significantly promote the quality of economic growth only after crossing the threshold and the threshold of technological innovation.

I propose a dynamic evolution hypothesis regarding the evolution of organisms by incorporating both diminished fitness returns and mutation rate tuning during adaptation to a constant environment. Basically, accumulating evidence from life history studies conducted over the past 70 years suggests that the evolution of individual fitness is subject to ecological constraints, leading to the evolutionary existence of an upper limit of individual fitness (ULIF). Given the existence of the ULIF, organismal evolution, which might initially have relatively great fitness returns through primarily Darwinian evolution, will eventually be subject to diminished fitness returns towards zero. With the diminished fitness return, Darwinian selection strength may eventually become smaller than the power of random genetic drift, leading to the occurrence of neutral evolution at both phenotypic and molecular levels. Meanwhile, mutation rates may change from an initial increase, due to the relatively strong fitness return, to subsequent decreases, due to both the diminished fitness return of beneficial mutations and the cost of deleterious mutations. The diminished fitness returns with subsequently reduced mutation rates are two potential evolution barriers leading to eventual evolutionary stasis. These findings provide important insights for understanding the conditions for the occurrences of different evolutionary patterns. Darwinian evolution theory, neutral evolution theory and punctuated equilibrium theory can be unified in the context of the dynamic evolution hypothesis formulated in this study.

Economic development and advancements in information technology contributed to the shift on accounting objective from commission responsibility view to decision-making useful view. The decision-making useful view claims that the accounting measurement methods should be changed to improve the usefulness of accounting information, to enable information users to make correct decisions. In addition, the development of financial instruments leads to the birth of fair value accounting. In recent years, fair value has been one of the most important measurement methods in the International Accounting Standard and US Generally Accepted Accounting Principles. However, China has been quite cautious when it comes to applying fair value full time, especially after the global financial crisis happened in 2008, wherein fair value accounting was exposed to strong suspicion. Hence, studying the value relevance of fair value is of great significance to exploring the accounting profession and reforming accounting standards. This paper attempts to investigate the value-relevance of fair value based on the data of listed financial companies and manufacturing companies in China. The results indicate that the fair value information in the financial industry has a strong explanatory influence to corporate share price. In contrast, the fair value information shows limited relevance in the manufacturing industry. Finally, consulting with the results of normative analysis and empirical study, this paper suggests several rational advices for the application of fair value in China.

Wetlands are recognized as one of the world’s most valuable natural resources. With the increasing world population, human demands on wetland resources for agricultural expansion and urban development continue to increase. In addition, global climate change has pronounced impacts on wetland ecosystems through alterations in hydrological regimes. To better manage and conserve wetland resources, we need to know the distribution and extent of wetlands and monitor their dynamic changes. Wetland maps and inventories can provide crucial information for wetland conservation, restoration, and management. Geographic Information System (GIS) and remote sensing technologies have proven to be useful for mapping and monitoring wetland resources. Recent advances in geospatial technologies have greatly increased the availability of remotely sensed imagery with better and finer spatial, temporal, and spectral resolution. This chapter presents an introduction to the uses of GIS and remote sensing technologies for wetland mapping and monitoring. A case study is presented to demonstrate the use of high-resolution light detection and ranging (LiDAR) data and aerial photographs for mapping prairie potholes and surface hydrologic flow pathways.

MicroRNA (miRNA) is small non-coding RNAs that play vital roles in post-transcriptional gene regulation by inhibiting mRNA translation or promoting mRNA degradation. Dysregulation of miRNA has been implicated in numerous human diseases, including cancers. The family members of miR-34 (miR-34s), composed of miR-34a, miR-34b, and miR-34c, have emerged as the most extensively studied tumor-suppressive miRNAs. In this comprehensive review, we aim to provide an overview of the major signaling pathways and gene networks regulated by the miR-34s in various cancers and highlight the critical tumor suppressor role of miR-34s. Furthermore, we will discuss the potential of using miR-34 mimics as a novel therapeutic approach against cancer, while also addressing the challenges associated with their development and delivery. It is anticipated that gaining a deeper understanding of the functions and mechanisms of miR-34s in cancer will greatly contribute to the development of effective miR-34-based cancer therapeutics.

The research fills the policy research gap for the women entrepreneurship and sustainability performance for examining key successful factors. Previous women entrepreneurship research fails to offer policy recommendations. The research purpose is to investigate these factors affect women entrepreneurship capabilities and sustainability performance by using SEM analysis and making policy recommendation. This research employs online and mail survey and obtains 175 women entrepreneur sample. The study finds that family support and motivation have positive effect on women entrepreneurship capabilities and sustainability performance. Barriers have no effect on performance. Hopefully, the research can provide the guidance to contribute to women’s entrepreneurship opportunities for achieving SDGs. Policy recommendation and managerial implication are discussed in the article.

Technology can be seen everywhere and has been integrated into our lives.We are always using technology and enjoying the convenience brought by technology. However, physical retailers and e-commerce companies are also gradually adopting advanced technologies. Technology improves the purchasing environment and purchasing experience. Virtual reality and augmented reality have been hotly discussed in recent years. Technology, although virtual reality and augmented reality technology have not yet matured, it can be said that they will in the future It has great development potential. Virtual reality and augmented reality are also beginning to sprout in the retail industry. However, research on the acceptance of the use of virtual reality and augmented reality in the apparel shopping process is still lacking because This study explores how usefulness, ease of use, hedonicity, customer experience, customer engagement and satisfaction. To influence customer loyalty, this study adopted questionnaire survey and convenience sampling methods, and collected a total of 308 valid questionnaires. The analysis method used confirmatory factor analysis and structural equation model to verify the research hypothesis relationship. The results of this study found. Hedonic has a significant impact on customer loyalty, while usefulness, ease of use, customer experience, customer engagement and satisfaction Satisfaction does not have a significant impact on customer loyalty. This study explains the academic contribution of the research results. The practical implications in marketing are put forward, and specific suggestions and directions for future research are given.

This paper presents a non-perturbative method for solving eigenproblems. This method applies to almost all potentials and provides non-perturbative approximations for any energy level. The method converts an eigenproblem into a perturbation problem, obtains perturbation solutions through standard perturbation theory, and then analytically continues the perturbative solution into a non-perturbative solution.

The ketogenic diet and walking exercise training activity are two key public health lifestyle factors. The potential of combined lifestyle factors interventions focused on getting to compliance in forced exercise. A balanced ketogenic diet and regular exercise activity is a key modifiable factor to the prevention and management of chronic diseases. Influence health across the lifespan and reduction of the risk of premature death through several biological mechanisms. Community older group’s lifestyle factors interventions contribute identity in their natural living environment. While the older health benefits of walking exercise training strategies are commonly to study, combined ketogenic diet and walking exercise interventions have induced greater benefits in community older groups.

The research examines the relationship between self-rated health situation and personal percep-tion of heat waves, and how social linkage of communities would be a moderator variable in residents’ perception of heat waves in Taiwan. This study uses the questionnaire conducted by Sinica “Responsive Capacity under Heat Wave: The Perspectives of the Locals”(2019), using OLS method for estimating the unknown parameters in multiple regression model. The author finds that the correlation of self-rated health situation and perception toward heat is significantly posi-tive. Also, social linkage in communities affects strongly as a moderator variable: While the sat-isfaction to with their community could reduce negative reaction to heat, contacts with neighbors could increase possibility people feel uncomfortable in high-temperature situation. This study ex-hibits the effects of social environment on community, and expects further related researches or practices to strengthen capability to resist heat wavesƒ for Taiwanese residents.

Epitranscriptomic RNA modifications play a crucial role in the posttranscriptional regulation of gene expression. N6-methyladenosine (m6A) is the most prevalent internal modification of eukaryotic RNA and plays a pivotal role in RNA fate. RNA m6A modification is regulated by a group of cellular proteins, methyltransferases (writers) and demethylases (erasers), which add and remove the methyl group from adenosine, respectively. m6A modification is recognized by a group of cellular RNA-binding proteins (readers) that specifically bind to m6A-modified RNA, mediating effects on RNA stability, splicing, transport, and translation. The functional significance of m6A modification of viral and cellular RNA is an active area of virology research. In this review, we summarize and analyze current literature on m6A modification of HIV-1 RNA, the multifaceted functions of m6A in regulating HIV-1 replication, and the role of viral RNA m6A modification in evading the innate immune responses to infection. Furthermore, we briefly discuss future directions and therapeutic implications of mechanistic studies of HIV-1 epitranscriptomic modifications.

We aimed to evaluate the protective effects of acetyl-xylogalactan on the activity of RAW264.7 macrophages against heat stress. To this end, we assessed cell survival, phagocytic activity, in-tracellular Ca2+ level, mitochondria potential exchange, apoptotic assay findings, galactosidase activity and the RNA-seq by NGS and real-time polymerase chain reaction (PCR) expression. In our evaluation of macrophage morphology at 37°C and 41°C, the macrophages showed an oval shape at 41°C , unlike the spindle shape at 37°C. Therefore, 41°C was chosen as the heat stress condition. Subsequently, we designed an experiment to evaluate changes in the RAW264.7 macrophages after acetyl-xylogalactan treatment under heat stress. The survival of RAW264.7 macrophages treated with acetyl-xylogalactan was higher than that of controls that were not treated with acetyl-xylogalactan. Moreover, on the basis of the results of the annexin-V detection assay, the apoptotic activity of macrophages appeared to have reduced after treatment with ac-etyl-xylogalactan. Moreover, treatment with acetyl-xylogalactan resulted in a stronger recovery trend in the intracellular Ca2+ and mitochondrial membrane potential after heat stress. RNA sequencing and real-time polymerase chain reaction (PCR) illustrated that Sarcodia suieae acetyl-xylogalactan could upregulate the expression of the anti-apoptosis Cflar gene and down-regulate the expression of the apoptosis factors Ddit3, and Hyou1 to protect macrophages under heat stress.

Non-orthogonal multiple access (NOMA) has been investigated to support massive connectivity for Internet-of-things (IoT) networks. However, since most IoT devices suffer from limited power and decoding capabilities, it is not desirable to pair a large number of devices simultaneously, which encourages two-user NOMA grouping. Additionally, most existing techniques have not considered the diversity in the target QoS of IoT devices, which may lead to spectrum inefficiency. Few investigations have partially considered that issue by using an order-based power allocation (OPA) approach, where the power is allocated according to the order to the user's target throughput within a priority-based NOMA (PNOMA) group. However, this does not fully capture the effects of diversity in the values of the users' target throughputs. In this work, we handle both problems by considering a throughput-based power allocation (TPA) approach, that captures the QoS diversity, within a three-users PNOMA group as a compromise between spectral efficiency and complexity. Specifically, we investigate the performance of a time-division PNOMA (TD-PNOMA) scheme, where the transmission time is divided into two-time slots with two-users per PNOMA group. The performance of such TD-PNOMA is compared with a fully PNOMA (F-PNOMA) scheme, where the three users share the whole transmission time, in terms of the ergodic capacity under imperfect successive interference cancellation (SIC). The results reveal the superiority of TPA compared with OPA approach in both schemes, besides that the throughput of both schemes can outperform each other under imperfect SIC based on the transmit signal-to-noise ratio and the deployment scenarios.

In this study, we investigated the effects of three surface treatment techniques on 316L stainless steel, low-temperature immersion corrosion, shot peening followed by immersion corrosion, and electrochemical corrosion. Surface alterations were analyzed using scanning electron microscopy, Raman spectroscopy, and α-step thin-film thickness profiling. Human osteoblast adhesion was evaluated using Liu’s stain and metallographic optical microscopy. The results revealed weak cell adhesion after low-temperature immersion and shot peening followed by immersion corrosion. By contrast, electrochemical corrosion, particularly with a high current density and low corrosive solution concentration, resulted in a uniformly corroded surface, thus promoting dense cell adhesion. All three techniques resulted in porous oxide layers. Overall, our experimental findings highlighted shot peening (1 kg/cm2 for 20 s) and electrochemical corrosion (0.5 M HCl) as effective processes. Electrochemical corrosion produced uniformly dense corrosion pits, whereas shot peening produced semicircular grooves with small corrosion pits, both favorable for cell adhesion. Electrochemical corrosion also yielded excellent cell adhesion, emphasizing its suitability for biomedical activity. We developed a process for creating a porous surface layer and thereby enhancing the cell adhesion to 316L stainless steel for potential biomedical implant applications.

Endotoxins are toxic substances that widely exist in the environment and can enter the intestine with food and other substances. Intestinal epithelial cells are protected by a mucus layer that contains MUC2 as its main structural component. However, a detailed understanding of the mechanisms involved in the function of the mucus barrier in endotoxin penetration is lacking. Here, we established the most suitable proportion of Caco-2/HT-29 co-culture cells as a powerful tool to evaluate the intestinal mucus layer. Our findings significantly advance current knowledge as focal adhesion and ECM-receptor interaction were identified as the two most significantly implicated pathways in MUC2 small interfering RNA (siRNA)-transfected Caco-2/HT-29 co-culture cells after 24 h of LPS stimulation. When the mucus layer was not intact, LPS was found to damage the tight junctions of Caco-2/HT29 co-cultured cells. Furthermore, LPS was demonstrated to inhibit the integrin-mediated focal adhesion structure and damage the matrix network structure of the extracellular and actin microfilament skeletons. Ultimately, LPS inhibited the interactive communication between the extracellular matrix and the cytoskeleton for 24 h in the siMUC2 group compared with the LPS(+) and LPS(-) groups. Overall, we recognized the potential of MUC2 as a tool for barrier function in several intestinal bacterial diseases.

The service life of the reinforced concrete structure in the marine environment can be impaired significantly due to chloride-induced corrosion. However, how the chloride diffusion in pre-cracked concrete structures is affected by the hydrostatic pressure magnitude is poorly understood. This study experimentally examined the effect of hydrostatic pressure on the chloride diffusion in pre-cracked concrete. Cracks with five different widths, i.e., 20 μm, 40 μm, 60 μm, 80 μm, and 100 μm, were manually created using a splitting tensile apparatus respectively. The chloride diffusion in the concrete with a certain crack was then studied under four different hydrostatic pressures of 0 MPa, 0.1 MPa, 0.3 MPa, and 0.5 MPa. Experimental results show that the chloride diffusion in concrete with a crack greatly relies on both the hydrostatic pressure and the crack width. The chloride concentration increases as the hydrostatic pressure grows, particularly for the wider cracks with width ranging from 60 μm to 100 μm. Surprisingly, the hydrostatic pressure has a negligible effect on the chloride distribution in the concrete with a crack width no larger than 40 μm. Both the chloride diffusion coefficient and the surface chloride concentration of concrete increased gradually as the hydrostatic pressure increased. The experimental findings enrich our understanding of the behavior of pre-cracked concrete when exposed to chloride-induced corrosion at different depths of marine environments.

Antibiotic resistance (ABR) is concerning issue due to its direct and indirect repercusions on public health, since decreased therapeutic effect of certain antibiotic to treatment complications that can cause death. There are several mechanism as to how ABR can be transferred from one microoorganisms to another, and many of them are dependant many environmental factors. The food supply chain is a environment in which ABR gene transfer can occur is multiple pathways, which generate concerns regarding food safety. Here, we summarize relevant mechanisms which are implied in ABR in food supply chain but also we are addressing routes of transmission and prevalence of ABR, implications on public health, and the application of new alternatives to antibiotics such as antimicrobial peptides, mainly bacteriocins, in order to countermeasure ABR.

Cardiovascular disease (CVD) is one of the contributing factors to more than one-third of human mortality and the leading cause of death worldwide. Cardiac myocyte death is a fundamental process in cardiac pathologies caused by various heart diseases, including myocardial infarction. Thus, strategies for replacing fibrotic tissue in the infarcted region with functional myocardium have long been a goal of cardiovascular research. This review focuses primarily on induced-pluripotent stem cells (iPSCs), which have emerged as perhaps the most promising source of cardiomyocytes for both therapeutic applications and drug testing. We also briefly summarize other stems- and progenitor-cell populations that have been used for regenerative myocardial therapy and attempt to generate cardiomyocytes directly from cardiac fibroblasts (i.e., transdifferentiation), which, if successful, may enable the pool of endogenous cardiac fibroblasts to be used as an in-situ source of cardiomyocytes for myocardial repair.

The fatigue delamination damage is one of the most important fatigue failure modes of laminated composite structures. However, the developments of the theoretical framework, mathematical/physical model and numerical simulation of fatigue delamination are still challenging issues, and there is a lack of systematic classification. This article reviews the experimental phenomena of the onset and propagation stage of delamination under fatigue loading, and summarizes the commonly used phenomenological models for laminated composite structures. The research methods, general modeling formulas and development prospects of the phenomenological models are presented in detail. In the light of the analysis of finite element model (FEM) for the laminated composite structures, a number of simulation methods of fatigue delamination crack propagation damage model are carefully classified. Furthermore, within the theoretical framework of strength theory model (SM), fracture mechanics model (FM), damage mechanics model (DM) and hybrid model (HM), the complete procedure, application, capability assessment, advantages and limitations of the models are also discussed in detail. Finally, several valuable suggestions are given for the research interests, and challenging technical problems that need to be overcome on the fatigue delamination prediction of laminated composite structures in the future.

Device-to-device (D2D) communication is a promising paradigm for the fifth generation 2 (5G) and beyond 5G (B5G) networks. Although D2D communication provides several benefits, 3 including limited interference, energy efficiency, reduced delay, and network overhead, it faces a lot 4 of technical challenges such as network architecture, and neighbor discovery, etc. The complexity 5 of configuring D2D links and managing their interference, especially when using millimeter-wave 6 (mmWave), inspire researchers to leverage different machine-learning (ML) techniques to address 7 these problems towards boosting the performance of D2D networks. In this paper, a comprehensive 8 survey about recent research activities on D2D networks will be explored with putting more 9 emphasis on utilizing mmWave and ML methods. After exploring existing D2D research directions 10 accompanied with their existing conventional solutions, we will show how different ML techniques 11 can be applied to enhance the D2D networks performance over using conventional ways. Then, still 12 open research directions in ML applications on D2D networks will be investigated including their 13 essential needs. A case study of applying multi-armed bandit (MAB) as an efficient online ML tool 14 to enhance the performance of neighbor discovery and selection (NDS) in mmWave D2D networks 15 will be presented. This case study will put emphasis on the high potency of using ML solutions 16 over using the conventional non-ML based methods for highly improving the average throughput 17 performance of mmWave NDS.

Atopic dermatitis (AD) is a chronic inflammatory skin disease, which can cause skin barrier function damaged. Although co-incubation with docosahexaenoic acid (DHA) exerts a positive effect in deficient skin model, there is no study to investigate the effects of topical treatment with DHA in inflammatory reconstructed human epidermis (RHE) model. The effects of DHA on monolayer normal human epidermal keratinocyte (NHEK) cells were evaluated via CCK-8, qPCR and ELISA. The skin related barrier function was assessed by hematoxylin-eosin (HE) staining, western blot (WB), Immunohistofluorescence (IF) and ELISA in normal and inflammatory RHE models. DHA upregulated filaggrin and loricrin expression at mRNA levels in addition to suppress overexpression of TNF-α，IL-1α and IL-6 stimulated by poly I:C plus LPS (stimulation cocktail) in cultured NHEK cells. After topical treatment with DHA, cocktail induced inflammatory characteristics of skin diseases including barrier morphological, differentiation proteins and TSLP secretion, which were alleviated in RHE models. Supplementation with DHA can improved related barrier function and have anti-inflammation effects in monolayer keratinocytes and RHE models, which indicated that DHA may have a potential value for the treatment of inflammation-associate skin diseases.

Both lactic acid and short chain fatty acid (SCFA) play important roles in maintenance of intestinal epithelial structure and function. Trilactic glyceride (TLG) obtains both excellences of lactic acid and SCFA. This study was to investigate the effects of trilactic glyceride on growth performance, blood parameters, liver function, intestinal morphology and intestine function of piglets. Twelve weaned piglets (21±2 d) were randomly allocated to two treatment groups: 1) control group, piglets fed the basal diet; 2) TLG group, piglets fed the basal diet supplemented with 0.5 % TLG. On day 21 of the trial, D-xylose (0.1 g/kg·BW) was orally administrated to all piglets and blood samples were collected 1 h thereafter. Then, all the piglets were sacrificed to examine intestinal mucosal morphology and collect fatty tissue, liver and intestinal mucosa for further analysis. The results showed that: compared with the control group, TLG group decreased blood ALB and GGT on day 10 and 20, TLG group decreased blood TP and increased blood TG on day 20 of the trail (p < 0.05); TLG group decreased blood D-xylose and LDL, increased blood HDL (p < 0.05). These data suggested that supplementing trilactic glyceride had beneficial impacts on promoting nutrients’ metabolism, maintaining intestinal integrity, and alleviating oxidative stress and diarrhoea. Further research of molecular mechanisms showed changing expression levels of related proteins and genes, suggesting that these could be involved in the regulation of the impact. The community composition of the gut microbiota was also found to be altered in several operational taxonomic units within the genus, Prevotella (order Bacteroidales), and the order, Clostridiales.

The increased consumption of high fat-containing foods has been linked to the prevalence of obesity and abnormal metabolic syndromes. Rhizopus oligosporus, a fungus in the family Mucoraceae, is widely used as a starter for homemade tempeh. Although R. oligosporus can prevent the growth of other microorganisms, it grows well with lactic acid bacteria (LAB). Lactobacillus plantarum can produce β-glucosidase, which catalyzes the hydrolysis of glucoside isoflavones into aglycones (with greater bioavailability). Therefore, the development of a soybean-based functional food by the co-inoculation of R. oligosporus and L. plantarum is a promising approach to increase the bioactivity of tempeh. In this study, the ameliorative effect of L. plantarum in soy tempeh on abnormal carbohydrate metabolism in high-fat diet (HFD)-induced hyperglycemic rats was evaluated. The co-incubation of L. plantarum with R. oligosporus during soy tempeh fermentation reduced the homeostatic model assessment of insulin resistance, HbA1c, serum glucose, total cholesterol, triglyceride, free fatty acid, insulin, and low-density lipoprotein contents and significantly increased the high-density lipoprotein content in HFD rats. It also increased the LAB counts as well as the bile acid, cholesterol, triglyceride, and short-chain fatty acid contents in the feces of HFD rats. Our results suggested that the modulation of serum glucose and lipid levels by LAB occurs via alterations in the internal microbiota, leading to the inhibition of cholesterol synthesis and promotion of lipolysis. Tempeh, produced with both L. plantarum and R. oligosporus, may be a beneficial dietary supplement for individuals with abnormal carbohydrate metabolism.

Broadband reverse saturable absorption is systematically investigated via Z-scan, transient absorption spectrum (TAS). The excited state absorption and negative refraction of Orange IV are observed in the Z-scan experiment at 532 nm. Meanwhile, two-photon induced excited-state absorption and pure two-photon absorption are observed at 600 nm and 700 nm with the pulse width of 190 fs, respectively. An ultrafast broadband absorption in visible wavelength region is observed via TAS. The different nonlinear absorption mechanism at multiple wavelengths is discussed and interpreted from the results of TAS. In addition, the ultrafast dynamics of negative refraction in the excited state of Orange IV is investigated via degenerate phase object pump probe, from which the weak long-lived excited state is extracted. All studies indicate that Orange IV has the potential to be further optimized into a superior broadband reverse saturable absorption material and also has certain reference significance for the study of optical nonlinearity in organic molecules containing azobenzene groups.

Water quality monitoring was an important objective in the surroundings. In this study, we investigated the sensing characteristics of the arrayed flexible chloride sensor with XBee wireless sensing system. The sensitivity and linearity of the wireless chloride sensing devices were 91.6 mV/pCl and 0.988, respectively. The hysteresis voltages were 50.14 mV and 36.71 mV during the cycles of 1 M → 10⁻¹ M → 1 M → 10⁻³ M → 1 M and 1 M → 10⁻³ M → 1 M → 10⁻¹ M → 1 M, respectively. The selectivity coefficients of the ClO⁻ ion, ClO₄⁻ ion, NO₃⁻ ion and I⁻ ion for Cl⁻ ion were 5.0 × 10⁻², 1.0 × 10⁻¹, 5.9 × 10⁻³ and 5.6×10⁻¹, respectively. The sensing characteristics of real time measurement were investigated for dynamic microfluidic. The arrayed flexible chloride sensor was integrated with the microfluidic device, syringe pump and wireless sensing system. The sensitivity and linearity were 273.1 mV/pCl and 0.978 at 35 μL/min, respectively.

A series of ZnO doped nitrogen-carbon materials (xZnO-N-C) with ZnO content of 5-40% are prepared by vacuum curing-carbonization strategy using polyamide-imide as N-C source and zinc nitrate as metal source for propane dehydrogenation (PDH). 20ZnO-N-C exhibits outstanding initial activity (propane conversion of 35.2% and propene yield of 24.6%) and relatively low deactivation rate (0.071 h-1) at 600 ◦C. The detailed characterization results show that small ZnO nanoparticles (5.5 nm) with high dispersion on the catalyst could be obtained by adjusting ZnO loading. Moreover, much more nitrogen-based species especially ZnNx species are formed on 20ZnO-N-C by comparison with 20ZnO-N-C-air prepared by curing-carbonization without vacuum, which may contribute for the higher product selectivity and catalytic stability of 20ZnO-N-C. The probable active sites for PDH reaction on the catalyst system are proposed to be C=O species and Zn2+ species. Moreover, the aggregation of ZnO nanoparticles is the primary reason for the activity loss on this catalyst system. The present finding not only provides the feasible construction strategy for the metal oxide doped nitrogen-carbon materials but also valuable guidance for the design of efficient catalyst in dehydrogenation of light alkane.

The plant graft healing process is an intricate development influenced by numerous endogenous and environmental factors. This process involves the histological changes, physiological and biochemical reactions, signal transduction, and hormone exchanges in the grafting junction. Studies have shown that applying exogenous plant growth regulators can effectively promote the graft healing process and improve the quality of grafted plantlets. However, the physiological and molecular mechanism of graft healing formation remains unclear. In our present study, transcriptome changes in the melon and cucurbita genomes were analyzed between control and NAA treatment, and we provided the first view of complex networks to regulate graft healing under exogenous NAA application. The results showed that the exogenous NAA application could accelerate the graft healing process of oriental melon scion grafted onto squash rootstock through histological observation, increase the SOD, POD, PAL, and PPO activities during graft union development and enhance the contents of IAA, GA3, and ZR except for the IL stage. The DEGs were identified in the plant hormone signal-transduction, phenylpropanoid biosynthesis, and phenylalanine metabolism through transcriptome analysis of CK vs. NAA at the IL, CA, and VB stage by KEGG pathway enrichment analysis. Moreover, the exogenous NAA application significantly promoted the expression of genes involved in the hormone signal-transduction pathway, ROS scavenging system, and vascular bundle formation.

High dietary phosphate intake and poor adherence to phosphate-binding-therapy elevate the risk of hyperphosphatemia in maintenance hemodialysis (HD; MHD) patients. Therefore, chronic kidney disease-related mineral and bone disorder (CKD-MBD) indicators increase; consequently, risks of CKD-MBDs and inflammation are elevated. This double-blind, randomized control trial intervention study was designed to investigate the possibility of reducing blood CKD-MBD indicators and modulating inflammatory indicators by consuming low-phosphate (LP) meals accompanied by a minimum dose of a calcium-based phosphate binder (CaCO3). MHD patients were recruited and randomly assigned to an LP meal group (LP group) or a control group. After initial data collection, blood collection, and dietary counseling, subjects were asked to consume a washout diet for 1 week. During the washout diet period, subjects consumed their usual diet but took 1 tablet of calcium carbonate (1CaCO3) as a phosphate binder with each meal. After the washout diet period, subjects in the LP group and control group respectively consumed LP meals and regular meals twice a day for 1 week. Meat in the LP meals was boiled before the regular cooking process, but meat in control meals was not. All meals were supplied by a central kitchen so that the contents of phosphate and other nutrients could be identified. In total, 40 MHD patients completed the study program. After 1 week of the dietary intervention, the blood Ca x P product and dietary phosphate had significantly decreased in the LP group compared to the control group (p&lt;0.05). The LP group had significantly lower variations in dietary phosphate intake, blood calcium, Ca x P product, and tumor necrosis factor (TNF)-α than the control group by comparing differences between after the dietary intervention and the baseline (△after intervention - baseline, p&lt;0.05). The increase in dietary phosphate intake (△3rd - 2nd dietary phosphate intake) augmented the increase in the TNF-α level by 6.24-fold (odds ratio [95% confidence interval]: 6.24 [1.12~34.92], p&lt;0.05). These results highlighted the conclusion that LP meals accompanied by a minimum dose of CaCO3 downregulated pro-inflammation by reducing CKD-MBD indicators which was triggered by decreasing dietary phosphate intake.

The first paper of this two-part series paper discussed the development of a novel lightweight 3D wood dowel-reinforced glass epoxy hybrid composite material (3DdrFRP) and its manufacturing procedures. It also experimentally compared the performance of scaled utility poles made from conventional 2D E-glass epoxy and 3DdrFRP materials. In the second part, we developed robust finite element (FE) models in LS-DYNA, calibrated them based on experimental results, and used them to simulate the performance of equivalent 2D and 3D poles, proving the integrity of the numerical model. Additionally, we developed a simplified analytical calculation method for engi-neers to determine the stiffness of 3D-DrFRP poles accurately and quickly.

With a software-defined network (SDN), the control plane is separated from the data plane, allowing the control of network flows to be easy and dynamic at the same time. While the controller, which is equipped with various control applications, is capable of analyzing a large amount of data, it may become overburdened when it is faced with a large volume of traffic. The intrusion detection system (IDS) is an example of control applications that can be used to detect intrusions. It is recommended to deploy instances of the IDS across the data plane. This will improve the processing power and detection rate and as a result reduce the load on the controller at the same time. While there is no doubt that an IDS would be beneficial for improving detection rates, installing one at each switch in the data plane would be costly. To address this issue, this paper proposes the deployment of IDS chains across the data plane. The controller directs incoming traffic via alternative paths, including the IDS chain, which increases the detection rate while avoiding overloading. In order to improve transmission efficiency, our study proposes a method of balancing the distribution of flows and assigning them to specific IDS chains. This approach minimizes the cost of flow grouping through the use of a new incoming traffic grouping technique. Our method is tested and evaluated through the use of a test bed and trace-based simulation, and has been proven to effectively reduce delays and hop counts across various traffic scenarios.

The pursuit of sustainable wellbeing is one of the research objectives of positive experience design. Driven by this goal, the purpose of this paper is to provide an impact-centered sustainable positive experience design model. Firstly, the literature review method was used to define the research status and concept of impact-centered sustainable design. Secondly, an impact-centered sustainable positive experience design model was constructed, and relevant formulas for concept generation and concept evaluation were proposed. Thirdly, design verification was conducted through a workshop. Finally, the Technology Acceptance Model (TAM) questionnaire was used to evaluate and discuss the design model. An impact-centered sustainable positive design model was proposed, which includes the important impact dimensions of sensory experience and meaningful experience on users’ quality of life at different levels: healthy living (pleasure index, health behavior), harmonious community (social connectivity, social contribution), and livable environment (living environment, environmental contribution). Based on positive experience related theory, this study takes long-term impacts as the starting point for sustainable positive experience design, which helps designers to generate design concepts from a systematic and long-term perspective.

In Germany, as in many developed countries, over 60% of buildings were constructed before 1978, where most are in critical condition, requiring either demolition with plans for redevelopment or renovation and rehabilitation. Given the urgency of climate action and relevant sustainable development goals set by the United Nations, more attention must be shifted toward the various sustainability aspects when deciding on the strategy for renovation or redevelopment of existing buildings. To this end, this study focused on developing a smart decision support framework for aging buildings based on lifecycle sustainability considerations. The framework integrated digital technological advancements, such as building information modeling (BIM), point clouds processing with field information modeling (FIM)®, and structural optimization, together with life-cycle assessment to evaluate and rate the environmental impact of different solutions. Three sustainability aspects, namely, cost, energy consumption, and carbon emissions, were quantitatively evaluated and compared in two scenarios, namely, renovation, and demolition or deconstruction combined with redevelopment. A real building constructed in 1961 was the subject of the experiments to validate the framework. The result outlined the limitations and advantages of each method in terms of economics and environmental impact. It was further observed that optimizing the building design with the goal to reduce embodied energy and carbon in compliance with modern energy standards, was crucial to improve overall energy performance. This work demonstrated that the developed BIM-based framework to assess the environmental impact of rehabilitation work in aging buildings can provide effective ratings to guide decision-making in real-world projects.

This study aims to optimize the subway platform passenger flow guidance method using Anylogic simulation software. The objective of the study is to minimize overcrowding within subway carriages, enhance transportation capacity, and augment service levels by guiding passengers on the platform to board trains in a distributed manner. The study achieves a balanced flow of passengers in each carriage by taking into consideration the number of passengers in each carriage, the number of passengers at the station, and the expected number of passengers disembarking from the trains. The standard deviation of balance is used to optimize the subway platform passenger flow guidance method. We simulated Guangzhou Metro Zhujiang New Town Line 5 platform to compare different guidance methods and evaluate their effects on the uneven distribution of passengers with passenger flows ranging from 120K to 600K people per day. Our results show that guidance method 2, relative to manual guidance, improves by 38.5% under a daily passenger flow of 240K people on Zhujiang New Town Line 5. Guidance method 3 improves by 25.7% relative to guidance method 2 and by 54.4% relative to manual guidance.

In recent years, video anomaly detection technology , which can intelligently analyze massive video and quickly find abnormal phenomena, has attracted extensive attention with the wide application of video surveillance technology . To address the complex and diverse problem of abnormal human behavior detection in surveillance videos, a surveillance video abnormal behavior detection and localization supervised method based on the deep network model and the traditional method is proposed. Specifically, we combined AGMM and YOLACT methods to obtain more accurate foreground information by fusing the foreground maps extracted by each technique. To further improve the accuracy , we use the PWC-Net technique to extract features of the foreground images and input them into an anomaly classification model for classification. The proposed method effectively detects and locates the abnormal behavior in the monitoring scene. In addition to the aforementioned methods, this paper also employs YOLOV5 and DeepSORT networks for object detection and tracking in the video, which allows us to track the detected objects for better understanding of the scene in the video. Experiments on the UCSD benchmark dataset and the comparison with state-of-the-art schemes prove the advantages of our method.

Simultaneous Localization and Mapping (SLAM) is considered as a challenge in environments with many moving objects. This paper proposes a novel LiDAR Inertial Odometry framework, ID-LIO, for dynamic scenes that builds on LIO-SAM. To detect the pointclouds on the moving objects, a dynamic point detection method is integrated, which is based on pseudo occupancy along the spatial dimension. Then, we present a dynamic points propagation and removal algorithm based on indexed points to remove more dynamic points in the local map along the temporal dimension and update the status of the point features in keyframes. In the LiDAR odometry module, a delay removal strategy is proposed for history keyframes and the sliding window-based optimization includes the LIDAR measurement with dynamic weights to reduce error from dynamic points in keyframes. We perform the experiments both on the public low dynamic and highly dynamic data set. The results show that the proposed method greatly increases the localization accuracy in high dynamic environments. And the ATE(Absolute Trajectory Error) average RMSE((Root Mean Square Error) of our ID-LIO can be improved by 67% and 85% in the UrbanLoco-CAMarketStreet dataset and UrbanNav-HK-Medium-Urban-1 dataset respectively when compared with LIO-SAM.

In the context of the new crown epidemic, remote physical training will already be in order under the guidance of the Ministry of Education. There is a global focus on current lifestyle behaviors and the future health and well-being of youth. Youth physical activity, aerobic activity and muscle fitness levels are declining.[1] Research on the effects of youth physical training and group attitudes is still in its infancy. This study conducted in-depth interviews with online physical training students, parents, teachers involved in the construction of online physical training, and sports practitioners through interview methods, documentation, and mathematical statistics. The results of the interviews were qualitatively coded using NVivo to summarize the attitudes of different subjects toward physical fitness training and the influencing factors, (1) students were basically satisfied with the teaching effect of online physical fitness training (2) parents thought the teaching effect of online physical fitness training was average (3) physical education teachers thought the effect of online physical fitness training was average (4) physical education practitioners thought the effect of online teaching was poor.

Noisy data is always encountered in real applications, such as bioinformatics, neuroimage and remote sensing. Existing methods mainly consider linear or generalized linear errors-in-variables regression, while relatively little attention is paid for the multivariate response case, and how to evaluate the estimation performance under perturbed covariates is still an open question. In this paper, we consider the information-theoretic limitations of estimating a low-rank matrix in the multi-response errors-in-variables regression model. By application of the information theory and statistical techniques on concentration inequalities, the minimax lower bound is provided in terms of the squared Frobenius loss, which recaptures the rate provided under the clean covariate assumption in previous literatures. Hence our result further indicates that though under the more realistic errors-in-variables situation, no more samples are required so as to achieve a rate-optimal estimation.

The cuttlebone-like structure is a complex porous bionic structure with asymmetric sinusoidal S-shaped wall structure connecting laminar septa, and studies have shown that the cuttlebone-like structure has light weight, high strength and excellent energy absorption capability. It has become an important research to investigate the mechanical mechanism of cuttlebone-like structure and to design a bionic structure beyond nature structure based on it. In order to investigate the mechanical properties of the static compression and shearing processes of the cuttlebone-like structure, this paper establishes theoretical formulas and analyzes the influence of dimensionless parameters such as height-to-thickness ratio $\lambda$, period-to-thickness ratio $\xi$ and amplitude to period ratio $\eta$ on the compression and shearing processes with the help of ABAQUS finite element software.The parameter sensitivity analysis method was used to compare the important influence degree of each dimensionless parameter on the mechanical properties of the structure and to determine the relative optimal parameters of the structural mechanical properties under compression and shearing. Based on the relatively optimal parameter of the cuttlebone-like structure, the cross-sectional geometry of the structure is improved to build a new cuttlebone-like structure.The experimental results showed that the new cuttlebone-like structure with revised cross-section improved the mechanical properties of the cuttlebone-like structure.The study results are of theoretical guidance to enhance the mechanical properties and geometric design of cuttlebone-like structures.

Forest fire identification is important for forest resource protection. Effective monitoring of forest fires requires the deployment of multiple monitors with different viewpoints, while most traditional recognition models can only recognize images from a single source. By ignoring the information from images with different viewpoints, these models produce high rates of missed and false alarms. In this paper, we propose a graph neural network model based on the similarity of dynamic features of multi-view images to improve the accuracy of forest fire recognition. The input features of the nodes on the graph are converted into relational features of different gallery pairs by establishing pairs (nodes) representing different viewpoint images and gallery images. The new feature library relationship is used to update the image gallery with dynamic features in order to achieve the estimation of similarity between images and improve the image recognition rate of the model. In addition, to reduce the complexity of image pre-processing process and extract key features in images effectively, this paper also proposes a dynamic feature extraction method for fire regions based on image segment ability. By setting the threshold value of HSV color space, the fire region is segmented from the image, and the dynamic features of successive frames of the fire region are extracted. The experimental results show that, compared with the baseline method Resnet, this paper's method is more effective in identifying forest fires, and its recognition accuracy is improved by 2%. And the scheme of this paper can adapt to different forest fire scenes, with better generalization ability and anti-interference ability.

Wireless sensor networks are attractive largely because they need no wired infrastructure. But precisely this feature makes them energy constrained. Recent studies find that sensing behaviors that are otherwise deemed efficient consume comparable energy with communication. The duty cycle scheduling is perceived as contributing to achieving energy efficiency of sensing. Because of different research assumptions and objectives, various scheduling schemes have various emphases. This paper designed an adaptive sensing scheduling strategy. The objective function of the scheduling strategy includes minimizing average energy expenditure and maximizing sensing coverage (reducing event miss-rate), and it requires relatively loose assumptions. We determine the functional relationship between the variables of the objective function and the step-size parameters of the proposed strategy through the numerical fitting. We found that the objective function aggregated by the fitting functions is a bivariate multi-peak function that favors the Fibonacci tree optimization algorithm. Once the optimization of parameters is done, the strategy can be easily deployed and behaves consistently in the coming hours. We name the proposed strategy as “FTOS”. The experimental results show that the Fibonacci tree optimization algorithm gets a better optimistic effect than the comprehensive learning particle swarm optimization (CLPSO) algorithm and differential evolution (DE) algorithm. The FTOS strategy is superior to the fixed time scheduling strategy in achieving the scheduling objectives. It also outperforms other strategies with the same scheduling objectives such as LDAS, BS, DSS and PECAS.

Under the dual background of underemployment and health inequality, this paper empirically analyzes the impact of education level on underemployed workers’ health based on CLDS2016 data. The results show that underemployment is significantly related to the decline of self-rated health, increased depression tendency, and morbidity in a certain period. The results indicate that underemployment can significantly reduce the health level of workers in the low education level group and the high education level group. However, it has no significant impact on workers’ health in the middle education level group; even if we change the measurement method of indicators and consider endogeneity, the research conclusion is still robust. Moreover, this kind of health inequality mainly comes from the difference in economic effect and leisure effect of underemployment to workers with different educational levels. This paper provides empirical support for increasing the labor protection mechanism of underemployed people and reducing the health inequality caused by educational level differences.

The end of 2019 marked a bushfire crisis for Australia that affected more than 100000km2 of land and destroyed more than 2000 houses. Here, we propose a method of in-orbit bushfire detection with high efficiency to prevent a repetition of this disaster. An LEO satellite constellation is first developed through NSGA-II (Nondominated Sorting Genetic Algorithm II), optimising for coverage over Australia. Then edge computing is adopted to run a bushfire detection algorithm using several constellation satellites as edge nodes to reduce fire detection time. A geostationary satellite is used for inter-satellite communications, such that an image taken by a satellite can be distributed among several satellites for processing. The geostationary satellite also maintains a constant link to the ground, so that a bushfire detection can be reported back without any significant delay. Overall, this system is able to detect fires that span more than 5m in length, and can make detections in 1.39s per image processed. This is faster than any currently available bushfire detection method.

As a novel layered noble metal dichalcogenide material, palladium diselenide (PdSe₂) has attracted wide interest due to its excellent optical and electronic properties. In this work, a strong third-order nonlinear optical response of 2D PdSe₂ films is reported. We conduct both open-aperture (OA) and closed-aperture (CA) Z-scan measurements with a femtosecond pulsed laser at 800 nm to investigate the nonlinear absorption and nonlinear refraction, respectively. In the OA experiment, we observe optical limiting behaviour originating from large two photo absorption (TPA) in the PdSe₂ film of β = 3.26 ×10^-8 m/W. In the CA experiment, we measure a peak-valley response corresponding to a large and negative Kerr nonlinearity of n₂ = -1.33×10^-15 m²/W – two orders of magnitude larger than bulk silicon. In addition, the variation of n₂ as a function of laser intensity is also characterized, with n₂ decreasing in magnitude when increasing incident laser intensity, becoming saturated at n₂ = -9.96×10^-16 m²/W at high intensities. Our results show that the extraordinary third-order nonlinear optical properties of PdSe₂ have strong potential for high-performance nonlinear photonic devices. Keywords: 2D materials, PdSe₂ films, Z-scan technique, Kerr nonlinearity, nonlinear photonics.

In order to establish a new discipline specializing in accident science from the perspective of safety science. Under the guidance of the current research theories and methods of safety science, combined with the research paradigm of humanities and social medicine, this paper puts forward new viewpoints, new theories and new models about accident research. First of all, through literature retrieval, this paper analyzes the relevant research results of accidents at home and abroad, and expounds the existing problems and the basic trend of accident science research. Secondly, it puts forward eight kinds of attribute relations of the accident, and makes clear the characteristics and connotation of the accident. In the study of accident types, a hierarchical classification model based on accident cognition is created for the first time. It also points out the logical relevance of five levels of accident science research and the realistic relevance of three levels. At the same time, according to the thought of science of science, this paper puts forward a new definition of safety under the thinking of accident science and other basic concepts related to safety science, and explains the connotation. In addition, it creates and constructs the basic concept of accident science, establishes the conceptual model of accident science, and points out the “3-4-5” model of accident science research and its connotation. Thirdly, draw lessons from the interdisciplinary paradigm to study the relevant theoretical basis and discipline classification relationship of accident science, and construct the tree of accident science. Finally, the research contents of three main aspects of accident science are summarized. The results show that the research results in this paper not only play a fundamental role in the basic construction of accident science, but also further enrich and perfect the discipline system of safety science, which has a certain theoretical significance.

Modern medicine adopted four presumptions when it evolved from ancient experienced-based mind-body medicine. To understand its failure in finding cures for chronic diseases, we examined four presumptions, and found that statistical population of health properties does not exist for most research purposes, mathematical models are misused to model intensive properties, synthetic drugs are inherently more dangerous than nature-made medicines under their respective application conditions, and reductionist treatments are inferior and inherently dangerous. We found that clinical trials are valid only for research where treatment effect is much stronger than the total effects of all interfering or co-causal factors or errors introduced by misused mathematical models can be tolerated. In all other situations, clinical trials introduce excessive errors and fail to detect treatment effects, or produce biased, incorrect or wrong results. We further found that chronic diseases are manifestation of small departures in multiple process attributes in distinctive personal biological pathways networks, that modern medicine lacks required accuracy for accurately characterizing chronic diseases, and that reductionist treatments are good at controlling symptoms and safe for short term uses. For all stated reasons, as long as modern medicine continues relying on the flawed presumptions, it can never find predictable cures for chronic diseases. By implication, predictable cures to chronic diseases are adjustments to lifestyle, dietary, emotional, and environmental factors to slowly correct departures in process attributes responsible for chronic diseases.

To understand lung damage caused by COVID-19, we deduced two-phase lung damage mechanisms. After the lungs are infected with SARS-CoV-2 virus, the affected lung tissue swells and surface properties of pulmonary capillaries change, resulting in an increased flow resistance of affected capillaries. If a sufficient number of capillaries are affected by the infection, the swelling and increased cell wall adhesion collectively raise pulmonary vascular resistance. The increased vascular resistance further increases the dwell times of WBCs in affected capillaries and nearly capillaries. When pulmonary pressure is sufficiently higher, WBCs are forced to squeeze into interstitial spaces or alveolar spaces when local pressures are higher than what the capillaries can withstand. When more and more WBCs are dynamically retained, the flow resistance of more capillaries rises, pulmonary vascular resistance rises, and pulmonary pressure rises. The rise in the pulmonary pressure in turn results in elevated capillary pressures. When capillary pressures around the alveoli are sufficiently high, they cause interstitial pressures to change from normally negative values to positive values. The positive pressures cause fluid leakage to the alveolar space and thus degrade lung function. Tissue swelling, and occupation of WBCs in interstitial spaces and alveolar spaces further reduce compressible volume, and thus cause further rise in the pulmonary vascular resistance and pulmonary pressure. When the pulmonary pressure has reached a critical point as in the second phase, the blood breaks capillary walls and squeezes through interstitial spaces to reach alveolar spaces, resulting in irreversible lung damages. The available free volume in the thorax cage, organ usable capacities, temperature and humid are expected to have great impacts on degree of lung damages. The free volume in the thorax cage, lung usable surplus capacity, and other organ usable capacities determine the arrival time of last-phase irreversible damage. The mechanisms imply that the top priority for protecting lungs is maintaining pulmonary micro-circulation and preserving organ functions in the entire disease course while controlling viral reproduction should be stressed in the earliest time possible. The mechanisms also explain leukecytes are recruited and migrated into inflamed tissues by increasing their dwell times caused by increased local flow resistance.

To predict how the COVID-19 pandemic progresses, we developed a systematic method for predicting disease outcomes. In the method, we evaluate how personal disease outcomes are mainly affected by viral concentration and exposure time and four defense mechanisms: human innate immunity/host response, acquired immune response, inflammation resolution and micro circulation, and the available space in the thorax cage. By considering how pandemic measures affect viral exposure and those mechanisms, we found many pandemic measures are misused or abused to deliver long-term adverse impacts. We noted that lifestyles have been changed as a result of movement restriction measures. By using the method, we found that altered lifestyles are predicted to raise infection rate, disability and death risks in the future. We show that a person can use personal, environmental, emotional factors to reduce infection rate and death risk. To prove the validity of this finding, we extensively examined medical research models, holistic and reductionist models, epidemiological models, disease risk factors, etc, and found that population methods are unfit for studying holistic health, statistical population does not exist in most clinical trials, mathematical models were misused for studying disease properties for a population, mathematical equations for modeling personal diseases are beyond human ability to solve, statistical models are misused, population-derived treatments are inherently dangerous to patients, vaccines have limited benefits due to unique lung structure and rapid RNA mutation, and immune system damage is caused by fast viral replication rate. We found that altering biological properties to improve the defense mechanisms could prevent a super majority of deaths and prevent the virus from reaching a point to damage the immune system. For vulnerable persons, such measure is a viable strategy for surviving from the pandemic. As a whole, holistic personalized medicine is more powerful than population-based reductionist treatment by one to several orders of magnitudes. We urge people do their parts to force the medical establishment to abandon population treatment models that are responsible for failure of medicine and dissemination of misleading and factually wrong information on the effectiveness of medical treatments.

We analyzed the affinity-proteomics data of saliva absorbed to plate-bound Spike protein of SARS-CoV-2, and identified major virus-binding proteins as MUC7, MUC5B, DMBT1, and neutrophil defensins. Furthermore, we found that saliva from healthy donors inhibited the binding of Spike-protein-specific polyclonal antibodies to Spike antigen. These data suggest that the Spike protein’s glycoprotein-binding domains (GBD) may be targeted to block virus adherence or entry of SARS-CoV-2.

We previously proposed a public intervention framework concept that would allow people to resume personal and economic activities. We showed that intervention measures are used in a quantitative scale to reduce transmission probabilities and disease severity. In this article, we systematically examine the origin, assumptions, performance and limitations of epidemiological models from different views used in past review. We found that nearly all model assumptions fail to hold or are remote from reality; R0 does not exit or has no utility in guiding treatment options; personalized intervention measures are vitally important to COVID-19 due to its transmission characteristic; and current epidemiological models are unable to accurately assess the true benefits of personalized intervention measures. We suggest that poor performance of the models are attributed to flawed assumption that health/disease properties can be treated as transferable properties. The flaw creates a fiction that disease properties such as infection probabilities and death risks can be transferred from any vulnerable persons to anyone in the population and thus severely limit societal ability to fight the pandemic. We finally show that the benefits of personalized mitigation measures could be determined directly by using variable Ri values for infected persons (or nodes) together assessment of death rate and disability rate; the attempt of avoiding the disease by defeating all potential transmission probabilities is unrealistic; but mitigating disease severity for specific persons is more feasible and reliable. A most reliable strategy for reviving economy is using personalized protective measures and improving person health before effective vaccine is available.

The COVID-19 pandemic has great adverse impacts on personal life, the U.S. economy, and the world economy. Freezing all human activities is not a sustainable measure. Thus we want to develop a public intervention framework that allows people to resume personal and economic activities. In this article, we examined transmission routes, disease severity, personal vulnerability, available treatments, and person-person interactions to establish a general public intervention framework. We divide people into risk groups, non-risk group and group that may serve as viral transmitters, explore interactions between individual persons within each group and between different groups, and propose interaction behavior modifications to mitigate viral exposures. For the non-risk groups, we identified preventive measures that can help them avoid the most serious exposures and infections that pose higher death risks. The invention measures for the vulnerable groups include prior-exposure measures, heightened protective measures, interaction behavior changes, post-exposure remedial measures, and multiple factors treatments to reduce death and disability risks. The multiple interventions and two-ways defensive behavior modifications are expected to result in reduced rate of detectable infections and lowered disease severity for the vulnerable groups. In this framework, most human activities and economic activities can continue as normal. With time passing, the population acquires population immunity against the COVID-19 virus. Implementation of this intervention framework requires considerable resources and governmental effects while the multiple factors treatment protocol requires the support of health care professionals.

We conducted many model simulations to understand the causes of the damages of coronavirus (COVID-19) to lung tissue and constructed a diagram showing apparent viral reproduction, immune response and damage accumulation curves. We found that lung damages include virus-caused damage, tissue damage caused by immune responses and tissue damage caused by accumulated wastes. The virus-caused damage is proportional to the phase lag between the viral reproduction curve and the delayed adaptive immune response curve, while waste-induced damage is attributed to imbalance in removing viral, cellular and metabolic by-products. We found that treatment strategies should slow down viral reproduction and speed up immune response, and improve blood micro-circulation in the lungs. Consistent with the strategies, measures are taken to void direct lung infection, strengthen innate responses, promote immune responses, dilute viral concentration in lung tissue, maintain waste removal balance, protect heart and kidneys, control other infections, avoid allergic reactions and other inflammation, etc. We show that medical, dietary, emotional, lifestyle, environmental, mechanical factors, etc. may be simultaneously used to mitigate lung damages and prove that multiple factor health optimization method is magnitudes more powerful than a single factor treatment. Such a method does not depend on molecular specificity and can be used in parallel to antiviral drugs.

In the war against the COVID-19 pandemic, the world is experiencing severe resource constraints. Although transmission routes are well understood, we suspect that they cause different disease consequences. We evaluate them in different forms to understand how they affect infection rates and disease severity. In determining how they affect disease outcome, we evaluated target tissue vulnerability, functional role, defense mechanisms, viral concentration, infection vicinity to target vital tissue, and host factors. We found that direct lung infection is the most lethal transmission route followed by bronchi infection. Transmissions by physical contacts, foods, and blood by low viral concentration (as expected in normal human activities) pose lower or much lower risks unless the infection is followed by subsequent lung exposures. After adding transmission route, treatment timings, and improper treatments into the list of known risk factors, we found that death rate and disability rate for young or healthy persons are nearly zero. We show that population based medical model improperly shifts nominal death rate from few vulnerable people to the population resulting in unnecessary population panic, and such panic is responsible for shutting down human activities and the world economy. Finally, we examined limitations in population-based mitigating measures and proposed for governmental and private adoption community guidelines, which are mainly to enable vulnerable people avoid exposures, prevent non-vulnerable people from serving as viral transmitters, get rid of high-risk exposure modes in working environment, improve safety for people in buses, ships and planes, and reduce death and disability rates for infected people.

To understand great disparities in disease outcomes between CIVID-19 patients, we explore infection and host responses in kinetics. From existing data, we deduced a model that the lungs are damaged by rapidly rising flow resistance as a result of retaining white blood cells in lung tissues. The retention of white blood cells is initially triggered by viral infection but aggravated by injuries caused by low temperature. Lungs are initially damaged by fluid leakage, rapidly followed by extruding blood into alveolar spaces. The step of blood extruding is predicted to take place in a very short time. Our simulations show that as little as 0.1% retention of white blood cells in the lungs can lead to their failure in 5 to 10 days. The small degrees of imbalance implies that this imbalance could be corrected by a large number of factors that are known to reduce flow resistance. The model implies that the top priority is maintaining blood micro-circulation and preserving organ functions in the entire disease course, especially after the virus has spread the whole lungs. From exploring a large number of hypothetical infection modes, we propose preventive, mitigating and treatment strategies for ultimately ending the pandemic. The first strategy is avoiding exposures that could result in widespread damages to lungs and taking post exposure mitigating measures that would reduce disease severity. The second strategy is reducing death rate and disability rate from the current levels to one tenth for infected patients by using multiple factors health optimization method. The double reduction strategies are expected to generate a series of chain reactions that favor mitigating or ending the pandemic. Some reactions include a big reduction of the amount of viral discharges from infected patients into the air, the avoidance of panic, chronic stress and emotional distress, and cross-infections which are expected in quarantines. The double reductions would have a final effect of ending the pandemic.

A novel coronavirus (2019-nCoV) was first identified in Wuhan, Hubei Province, and then spreads to the other Provinces of China. 2019-nCoV was reported to share the same receptor, Angiotensin-converting enzyme 2 (ACE2), with SARS-CoV. Previous studies have found ACE2 is abundantly present in humans in the epithelia of the lung and small intestines, and they found ACE2 expression in the basal layer of the non-keratinizing squamous epithelium in nasal and oral mucosa and the nasopharynx. Here based on the public single-cell RNA-Seq datasets, we analyzed the ACE2 expression in the nasal, mouth, lung, and colon tissues. We find that the number of ACE2-expressing cells in the nasal tissue and mouth is comparable to the number of ACE2-expressing cells in the lung tissue and colon. We also find that ACE2 tends to be co-expressed with HLA-DRB1, which plays a central role in the immune system by presenting peptides derived from extracellular proteins, in the nasal, mouth, lung, and colon tissues at single-cell resolution. We hope this provides valuable information for virus-prevention strategy and therapeutic strategy development.

We examined special roles of the Central Nervous System (CNS) in an attempt to resolve the puzzle that chronic diseases cannot be cured by medicine. By exploring a skill-learning model, we found that the CNS is able to remember certain information reflecting biochemical and cellular (B&C) processes in the body. From the skill using ability, we found that the CNS is able to control basic B&C processes that drive and power the skill. From the ability to adjust forces and force direction of a physical act, we found that the CNS is able to adjust B&C processes that drive the physical act. From this adjustment capability, we further inferred that the CNS must also store information on the baseline B&C processes. As a whole, we found that the CNS can maintain information on baseline B&C processes, up-regulate or down-regulate the processes, and make comparisons in performing its regulatory functions. We found that chronic diseases are the results of deviated baseline B&C processes. Per the proved hypothesis, the CNS maintains deviated baseline B&C processes, and thus protects the body states of fully developed diseases. We then used the three CNS roles to explain that cancer progresses with increasing malignancy, cancer quickly returns after a surgery, cancer cells repopulate after chemotherapy and radiotherapy, cancer develops drug resistance inevitably, immune cells rebound after suppression, generally poor benefits of cancer drugs such as beta-blockers, etc. We further showed that long-term exercises generally push most, if not all, baseline B&C processes in diametrical opposing directions against the diseased B&C processes, implying that exercises play unique roles in reversing chronic diseases. Finally, we proposed several strategical approaches to resetting the CNS’ state memory as the essential condition for curing chronic diseases.

After reviewing cancer theories, cancer treatment development histories, randomized clinical trial's performance, cancer treatment strategy, trial follow-up times, and conducting numerous simulations using existing data, the authors found: (1) medical treatments come with three to four lethal factors: treatment side-effects, emotional distress and chronic dress, lack of exercises or physical inactivity, and excessive nutrition in some cases; (2) clinical trial exaggerates the benefits of fast-acting treatments and underestimates the slow-delivering adverse side effects as a result of statistical averaging, interfering effects of personal lifestyle factors, and insufficient follow-up times; (3) the benefits of medical treatments are limited by chain comparison, where surgery sets up a negative standard relative to the best way for resolving cancer; (4) the strategy of destroying the tumor is unworkable; (5) medical treatments can turn natural cancer growth curve into approximately doubly exponential curve; (6) multiple factor non-medical measures are much more powerful than medical treatments in controlling cancer growth and metastasis rates; and (7) cancer early diagnosis and over treatments are bad strategies that have great adverse impacts on cancer patients. Based on huge increases in cancer growth rate constants, substantial of loss of organ functional capacity, and severe systemic aging-like cellular damages, the authors concluded that medical treatments promote cancer growth and metastasis rates and shorten patient lives in most cases, and the claimed benefits are caused by triple biases of clinical trials. The authors believe that the better strategy for ending the global cancer epidemic is abandoning clinical trails as the research model, changing caner treatment strategy from killing cancer cells to slowing down cancer growth rates by using multiple factors optimization approach in personalized medicine.

Chronic diseases are still known as incurable diseases, and we suspect that the medical research model is unfit for characterizing chronic diseases. In this study, we examined accuracy and reliability required for characterizing chronic diseases, reviewed implied presumptions in clinical trials and assumptions used in statistical analysis, examined sources of variances normally encountered in clinical trials, and conducted numeric simulations by using hypothetical data for several theoretical and hypothetical models. We found that the sources of variances attributable to personal differences in clinical trials can distort hypothesis test outcomes, that clinical trials introduce too many errors and too much inaccuracies that tend to hide weak and slow effects of treatments, and that the means of treatments used in statistical analysis have little or no relevance to specific patients. We further found that a large number of uncontrolled co-causal or interfering factors normally seen in human subjects can greatly enlarge the means and the variances of the experimental errors, and the use of high rejection criteria (e.g., low p values) further raises the chances of failing to find treatment effects. As a whole, we concluded that the research model using clinical trials is wrong on multiple grounds, under any of our realistic theoretical and hypothetical models, and that misuse of statistical analysis is most probably responsible for failure to identify treatment effects for chronic diseases and to detect harmful effects of toxic substances in the environment. We proposed alternative experimental models involving the use of single-person or mini optimization trials for studying low-risk weak treatments.

Landslide is a sliding movement of rock mass, debris and soil along the slope under the action of gravity. Small Baseline Subset (SBAS) is an established method for the investigation and monitoring of landslide moments. This study focuses on monitoring the long-temporal displacement of mountainous terrain in Danba County, Sichuan Province via SBAS technique, based on 31 scenes of L-band ALOS/PALSAR data from Feb. 2007 to Oct. 2010.The results show that the largest velocity rates in LOS direction are ±120 mm/yr and maximum accumulated displacement is up to -300, which indicates fast movement of the mountainous terrain during the observation time. These results get good consistency against the results of previous study. This demonstrates the strong potential of SBAS technique for monitoring the landslides geohazard.

This paper studies the contemporaneous relationship between S&P 500 index returns and log-increments of the market volatility index (VIX) via a nonparametric copula method. Specifically, we propose a conditional dependence index to investigate how the dependence between the two series varies across different segments of the market return distribution. We find that: (a) the two series exhibit strong, negative, extreme tail dependence; (b) the negative dependence is stronger in extreme bearish markets than in extreme bullish markets; (c) the dependence gradually weakens as the market return moves toward the center of its distribution, or in quiet markets. The unique dependence structure supports the VIX as a barometer of markets' mood in general. Moreover, applying the proposed method to the S&P 500 returns and the implied variance (VIX²), we find that the nonparametric leverage effect is much stronger than the nonparametric volatility feedback effect, although, in general, both effects are weaker than the dependence relation between the market returns and the log-increments of the VIX.

Vibrotactile displays have been reported effective in enhancing awareness of flight attitude for pilots and releasing other heavily loaded sensory channels. Although some work have been done on vibrotactile coding of flight altitude, there is lack of a systematic investigation into coding methods with combination of multiple coding parameters. In this paper, seven coding methods with combinations of multiple coding parameters (location, rhythm, intensity, and mode) were systematically studied to cue flight attitude for pilots with a vibrotactile vest. We conducted two psychophysical experiments in a static tactile sensory environment in which the attitude commands in the form of vibrotactile feedback are presented randomly, and quantitatively evaluated the effectiveness of the vest according to the users’ recognition accuracy, reaction time and information transfer rate. The results show that vibrotactile vest is effective to cue attitude information. The preferred coding method with combinations of location, rhythm and mode allowed users to perform with lowest reaction time and highest recognition accuracy and yield about 255 bits/min of information transfer rate. Overall, the presented work provides valuable insights and guidance for the design of haptic displays for vibrotactile aids for the pilots.

GNSS have been widely used in navigation, positioning and timing. Nowadays, the multipath errors previously considered detrimental may be re-utilized for the remote sensing of geophysical parameters (soil moisture, vegetation and snow depth), e.g. GPS- Multipath Reflectometry (GPS-MR). In this paper, a new element describing bistatic scattering properties of vegetation is incorporated into the traditional GPS-MR model. This new element is the first-order radiative transfer equation model. The new forward GPS multipath simulator is able to explicitly link the vegetation parameters with GPS multipath observables (signal-to-noise-ratio (SNR), code pseudorange and carrier phase observables). The trunk layer and its corresponding scattering mechanisms are ignored since GPS-MR is not suitable for high forest monitoring due to the coherence of direct and reflected signals. Based on this new model linking the GPS observables (SNR, phase and pseudorange) with detailed vegetation parameters, the developed simulator can present how the GPS signals (L1 and L2 carrier frequencies, C/A, P(Y) and L2C modulations) are transmitted (scattered and absorbed) through vegetation medium and received by GPS receivers. Simulation results show that wheat will decrease the amplitudes of GPS multipath observables, if we increase the vegetation moisture contents or the scatters sizes (stem or leaf), the amplitudes of GPS multipath observables (SNR, phase and code) decrease. Although the Specular-Ground component dominates the total specular scattering, vegetation covered ground soil moisture has almost no effects on the final multipath signatures. Our simulated results are consistent with published results for environmental parameter detections with GPS-MR.

A perirectal abscess, while typically considered benign, has the potential to invade extraperitoneal spaces, including the space of Retzius, resulting in complications with severe systemic illness. It is postulated that there is communication within adipose tissue between the pararectal spaces and the vesical extraperitoneal space anteriorly, secondary to the termination of the umbilical-vesical fascia at the reflection of the vesical peritoneum. While occurrences of perirectal abscess ex-tending to the extraperitoneal space are infrequent, a thorough understanding of the anatomical structure, physiology, and the subsequent therapeutic approach remains crucial. For assessment, a computed tomography scan with intravenous contrast is preferred for evaluation, given the probable insidious and nonspecific nature of the clinical presentation, physical exam signs, and even laboratory studies. Primary therapeutic modalities involve immediate resuscitation, intra-venous administration of broad-spectrum antibiotics, and percutaneous drainage. Surgical in-tervention may become necessary in cases where there is no prompt improvement in septic progression. Additionally, the underlying comorbidities and baseline illness could be indicative of unfavorable outcomes. If fever or sepsis is not efficiently controlled, a more comprehensive workup or intervention should be contemplated, considering the associated higher risks of complications and mortality rates. In this study, we presented the case of a 68-year-old male with diffuse pain located in the lower abdomen. Fortunately, an immediate computed tomography scan played a pivotal role in iden-tifying a perirectal abscess with upward extension to the space of Retzius, which was subse-quently treated appropriately. Above all, this rare case presentation underscores the anatomic complexity within pelvic compartments and emphasizes the importance of maintaining high-index suspicions and analyzing overall differential diagnosis.

Insulin resistance, as a common pathological process of many metabolic diseases, including diabetes and obesity, has attracted much attention due to its relevant influencing factors. To date, studies have mainly focused on the mechanisms between mitochondrial stress and insulin resistance, and they are now pursued as a very attractive therapeutic target due to their extensive involvement in many human clinical settings. In view of the complex pathogenesis of diabetes, natural drugs have become new players in diabetes prevention and treatment because of their wide targets and few side effects. In particular, plant phenolics have been paid more attention because of their close relationship with oxidative stress. In this review, we briefly review the mechanisms by which mitochondrial stress leads to insulin resistance. Moreover, we list some cytokines and genes that have recently been found to play roles in mitochondrial stress and insulin resistance. Furthermore, we describe several natural drugs that are currently widely used and give a brief overview of their therapeutic mechanisms. Finally, we suggest possible ideas for future research related to the unique role that natural drugs play in the treatment of insulin resistance through the above targets.

The optimization of the pile driver frame is very important to the overall performance of the pile driver. This paper takes the large body structure of a model of hydraulic static pile driver as the research object. ANSYS APDL finite element software is used to perform static analysis and sensitivity analysis on the large body structure of the pile driver. On the premise of meeting the design requirements, according to the most dangerous working conditions of the pile driver, the size optimization of the frame structure of the pile driver is carried out based on sensitivity analysis. The mathematical model is established with the plate thickness as the design variable, the strength and stiffness of the body structure as the constraints, and the minimum mass of the body structure as the objective function. The optimization results show that the optimization design model based on sensitivity analysis not only meets the strength and stiffness conditions of the large structure, but also reduces the structural quality by 22.1% and greatly saves the production cost.

Cancer/testis (CT) antigens exhibit selective expression predominantly in immunoprivileged tissues in non-pathological contexts but are aberrantly expressed in diverse cancers. Because of their expression pattern, they have historically been attractive targets for immunotherapies. The investigation of mechanistic roles of CT antigens in promoting oncogenesis has historically been a prominent research question, and a growing number of studies implicate CT antigens in promoting almost all the hallmarks of cancer. This suggests that CT antigens may act as cancer drivers. CT antigens are expressed in head and neck squamous cell carcinomas, although their role in the pathogenesis, prognostication, and treatment for this family of cancers remains poorly studied. Given that CT antigens hold intriguing potential as therapeutic targets and as biomarkers for prognosis and therapeutic response and that they can provide novel insights into oncogenic mechanisms, their further study in the context of head and squamous cell carcinoma is warranted.

With the diversified development of media forms, livestreaming e-commerce has become a new sales model. Unlike the traditional sales model, this paper constructs a three-party game model composed of manufacturers, social media influencers and consumers based on the livestreaming model. It explores the equilibrium strategy selections of each participant in the supply chain system. In analyzing the evolutionary game stability of each participant, this paper obtains the equilibrium strategy and stability factors by analysis of the income and expenditure matrix. It uses the simulation model to analyze reasons for strategy selections of different game participants in the livestreaming e-commerce model. The results show that the strategies of manufacturers, social media influencers and consumers' selections have different impacts on their decision-making mechanism, and man-ufacturers are more sensitive to consumers' active participation in livestreaming e-commerce.

Metal organic frameworks (MOFs) composed of metal ions and multifunctional organic ligands are one of the most attractive porous materials. Their potential applications in gas storage, separation, catalysis, biomedicine and many other fields have attracted much attention. In this study, Nano-Mn-MOF-74 with nano size were successfully synthesized by adding acetic acid and characterized it by SEM, TEM and XRD. Furthermore, a new method to trace the degradation process of nanoMOFs through detection of ligand concentration under physiological conditions was developed.

Metal organic frameworks (MOFs) composed of metal ions and multifunctional organic ligands are one of the most attractive porous materials. Their potential applications in gas storage, separation, catalysis, biomedicine and many other fields have attracted much attention. In this study, Nano-Mn-MOF-74 with nano size were successfully synthesized by adding acetic acid and characterized it by SEM, TEM and XRD. Furthermore, a new method to trace the degradation process of nanoMOFs through detection of ligand concentration under physiological conditions was developed.

Hydraulic conductivity is the key and one of the most uncertain parameters in groundwater modeling. The grid based numerical simulation require spatial distribution of sampled hydraulic conductivity at un-sampled locations in the study area. This spatial interpolation has been routinely performed using variogram based models (two-point geostatistics methods). These traditional techniques fail to capture the complex geological structures, provides smoothing effects and ignore the higher order moments of subsurface heterogeneities. In this work, a multiple-point geostatistics (MPS) method is applied to interpolate hydraulic conductivity data which will be further used in WASH123D numerical groundwater simulation model for regional smart groundwater management. To do this, MPS need ‘training images (TIs) as a key input. TI is a conceptual model of subsurface geological heterogeneity which was developed by using concept of ages, topographic slope as an index criteria and knowledge of geologist. After considerations of full physics of study area, an example shows the advantages of using multiple-point geostatistics compared with the traditional two-point geostatistics methods (such as Kriging) for the interpolation of hydraulic conductivity data in a complex geological formation.

For improving the tracking accuracy and model switching speed of maneuvering target tracking in nonlinear systems, a new algorithm named interacting multiple model fifth-degree spherical simplex-radial cubature filter (IMM5thSSRCKF) is proposed in this paper. The new algorithm is a combination of the interacting multiple model (IMM) filter and fifth-degree spherical simplex-radial cubature filter (5thSSRCKF). The proposed algorithm makes use of Markov process to describe the switching probability among the models, and uses 5thSSRCKF to deal with the state estimation of each model. The 5thSSRCKF is an improved filter algorithm, which utilizes the fifth-degree spherical simplex-radial rule to improve the filtering accuracy. Finally, the tracking performance of the IMM5thSSRCKF is evaluated by simulation in a typical maneuvering target tracking scenario. Simulation results show that the proposed algorithm has better tracking performance and quicker model switching speed when disposing maneuver models compared with IMMUKF, IMMCKF and IMM5thCKF.

In this paper, we study the constrained minimization problem for an energy functional which is related to the following Kirchhoff type equation \begin{equation*} -\Big(\eta+b\big(\int_{\R^{3}}|\nabla u|^{2}dx\big)^{s}\Big)\Delta u+V(x)u=\mu u +\lambda|u|^{p}u,\end{equation*} where $b$ is a positive constant, parameters $\eta\geq0, \lambda>0$, exponents $s>0$, $0

In pursuit of sustainable human survival, the effective utilization of renewable energy has become critical to technological advancement. Ocean Thermal Energy Conversion (OTEC) technology, which generates electricity by leveraging the temperature differential between surface and deep ocean waters, enables stable power generation around the clock. In this domain, the combination of thermoelectric generators (TEGs) and heat exchangers has exhibited immense potential for ameliorating the deficiencies of conventional OTEC. This study uses numerical simulation to investigate the fluid dynamics characteristics of heat exchangers with flat fins and different types of longitudinal vortex generators (LVGs) under the same number of fins. The research encompasses heat exchangers with rectangular, triangular, and trapezoidal LVGs. Concurrently, the analysis examines how the vortices generated by the LVGs influence the thermoelectric performance of the TEGs. The results demonstrate that heat exchangers integrating flat fins and LVGs can enhance the power generation efficiency of TEGs. However, the pumping power required by the LVGs constrains the thermoelectric conversion efficiency. Compared to rectangular and triangular LVGs, trapezoidal LVGs achieve a superior balance between output and pumping power. Heat exchangers utilizing trapezoidal LVGs can attain the highest TEG thermoelectric conversion efficiency with a specific seawater flow velocity. Overall, these findings provide valuable reference information for applying TEGs and heat exchangers in OTEC design.

This study explores the advanced integration of Bi2Te3-based thermoelectric systems in Ocean Thermal Energy Conversion (OTEC) to optimize performance. OTEC, a promising renewable energy source, needs help in efficiency maximization. We address this by implementing Bi2Te3 thermoelectric generators (TEGs), known for their high thermoelectric efficiency at low-temperature differences. Our research encompasses a comprehensive simulation and analysis of these TEGs in OTEC systems, examining material properties, system design, and environmental impact. We present a novel approach to integrating these TEGs, optimizing their arrangement, and interfacing with the OTEC cycle to enhance overall efficiency. The study also investigates the durability and cost-effectiveness of Bi2Te3 TEGs in marine environments. Results demonstrate a significant improvement in energy conversion efficiency, highlighting the potential of Bi2Te3 TEGs in sustainable ocean energy exploitation. This work advances material science in renewable energy, providing valuable insights into the practical application of thermoelectric materials in large-scale energy systems. It paves the way for future research on material optimization and system integration, essential for developing efficient and sustainable OTEC systems.

In response to the growing need for efficient energy conversion technologies, this pa-per introduces an innovative Tubular Thermoelectric Generator (TTEG), specifically de-signed for high-efficiency conversion of waste heat into electrical energy. Unlike conven-tional flat plate thermoelectric generators (FTEGs), the TTEG incorporates full-ring ther-moelectric elements within a tubular layout, offering a novel approach to thermal energy recovery from fluid-based systems. This design significantly enhances the heat transfer capabilities, thereby improving the efficiency of energy conversion. Comprehensive simulations and analyses form the core of this study, where the per-formance of the TTEG is rigorously compared with traditional FTEGs. These comparisons highlight the advantages of the tubular design in terms of energy conversion efficiency and practical applicability in various scenarios. The findings reveal that the TTEG not only outperforms its flat plate counterparts but also presents a scalable and adaptable so-lution for waste heat recovery in a wide range of industrial and automotive applications. This research contributes to the field of energy science and technology by presenting a detailed experimental setup, complete with reproducible procedures and results. It opens new pathways for the development of more sustainable and efficient energy conversion systems, aligning with the goal of harnessing renewable and sustainable energy sources. The potential applications of this technology in enhancing energy efficiency and reducing environmental impact are vast, making it a significant step forward in the quest for clean and sustainable energy solutions.

This comprehensive study delves into the implementation and effectiveness of the flipped classroom model in engineering EMI (English as a Medium of Instruction) courses in Taiwan. Situated within the strategic framework of Taiwan's Bilingual Nation 2023 policy, this research aims to enhance the global competitiveness of Taiwan's semiconducting manufacturing engineering sector. The study’s primary focus is on understanding the perceptions and learning outcomes of EFL (English as a Foreign Language) students in engineering courses. Through a methodical approach using descriptive statistics and chi-square tests, the study analyzes data from 33 junior engineering students specializing in mechanical and mechatronic fields. The findings highlight a significant positive influence of the flipped classroom model on various aspects of student learning, including increased engagement, heightened creativity, and enhanced problem-solving skills. Additionally, the study emphasizes the critical role of timely L1 support in facilitating effective learning in EMI settings. These outcomes not only demonstrate the flipped classroom's viability as a sustainable educational approach but also provide crucial insights for educators and policymakers. By aligning cutting-edge teaching methods with the evolving needs of engineering education, this study contributes to the discourse on educational innovation. It ultimately guides the development of future engineering programs that cater to diverse student needs and fosters the cultivation of skilled engineering professionals.

The thermoelectric generator (TEG) has much potential as a renewable energy technology that could be used in ocean thermal energy conversion (OTEC). This technique employs TEGs and heat exchangers as substitutes for the intricate elements found in conventional OTEC systems, including pressure valves, evaporators, condensers, and turbine generators. By harnessing the temperature difference between warm surface seawater and cold deep seawater, it facilitates the conversion of this thermal gradient into electrical energy. This study used computer simulations to look at and compare three different types of heat exchangers: a cavity-type heat exchanger, a heat exchanger with flat fins, and a heat exchanger with longitudinal vortex generators (LVGs). The objective was to evaluate the influence of these designs on the thermoelectric conversion performance when implemented in OTEC systems. The study's findings indicate that using heat exchanger configurations featuring flat fins, or LVGs, enhances the efficiency of thermal energy transfer from warm seawater to TEGs, resulting in a notable enhancement in the output power of TEGs. Furthermore, the efficiency of TEG thermoelectric conversion is influenced by varying seawater flow rates in relation to the performance of flat fins and LVGs. In contrast to the cavity-type heat exchanger, the utilization of a heat exchanger equipped with flat fins has been found to yield a notable enhancement in the output power of TEGs by approximately 22.92%. Furthermore, this configuration demonstrates a substantial improvement in thermoelectric conversion efficiency, exhibiting an increase of around 40.01%. These improvements are observed under certain conditions pertaining to flow rates and fin heights. Utilizing heat exchangers equipped with LVGs has been found to enhance the output power of TEGs by 13.02% and improve the overall thermoelectric conversion efficiency by 17.72%. These improvements are observed under certain conditions, including specific flow rates, LVG tilt angles, and locations.

In this study, we present a federated learning approach that combines a multi-branch network and the Oort client selection algorithm to improve the performance of federated learning systems. This method successfully addresses the significant issue of non-iid data, a challenge not adequately tackled by the commonly used MFedAvg method. Additionally, one of the key innovations of this research is the introduction of uniformity, a metric that quantifies the disparity in training time amongst participants in a federated learning setup. This novel concept not only aids in identifying stragglers but also provides valuable insights into assessing the fairness and efficiency of the system. Experimental results underscore the merits of the integrated multi-branch network with the Oort client selection algorithm and highlight the crucial role of uniformity in designing and evaluating federated learning systems.

Micro-electro-mechanical systems (MEMS) are once proposed in 1970s and evolving rapidly. The current researchers are seeking for better designs and better applications of MEMS actuators. This work presents an electrostatic driven dual-axis scanning micromirror, i.e., two-dimensional (2D) scanning micromirror with a mirror size of 500 μm × 500 μm. The scanning mirror is implemented by using bulk micromachining process on silicon on insulator (SOI) substrate, which is compatible with present complementary metal oxide semiconductor (CMOS) manufacturing technology. The scanning frequencies of the slow and the fast axis are 4.87 kHz and 31.15 kHz, respectively. The impact factors of the dimensions of comb fingers and torsional beams are analyzed and discussed in this study. Under the driving voltage difference of 100 volts and 70 volts, the deviation angle is 4.57° × 13.08°. Therefore, a simple design of a dual-axis MEMS scanning micromirror is proposed, which can be precisely controlled without additional complex sensors or circuits.

In order to study the strength changes of concrete specimens under different loading conditions, based on the principle of minimum energy dissipation and from the Angle of concrete failure energy per unit area, the finite element numerical simulation software was applied to concrete specimens with different failure modes of tension, compression, bending and torsion, and the double-broken line damage constitutive model was adopted to simulate and analyze the failure forms of concrete specimens under different loading conditions. The failure area and failure energy of each specimen during loading were quantitatively calculated under each failure mode, and the relationship between the failure area and failure energy consumed under different failure modes was analyzed. The results show that under different failure modes, the failure area of concrete specimens is different, the energy consumed during failure is different, and the strength is different. However, in the process of failure, no matter how the failure mode changes, the failure energy W per unit area remains unchanged and is a constant, which is related to the physical properties of concrete itself.

This study employs traditional OLS (ordinary least squares) regression analysis to investigate the influence of various external factors on Bitcoin price fluctuations from January 2014 to March 2023 using a multidimensional approach. We use factors from the traditional financial market, such as economic policy uncertainty (EPU), oil prices, the NASDAQ index, and gold prices, to identify factors contributing to Bitcoin volatility. Considering the unique situation in the Bitcoin market, that is, 24-hour trading and the short duration of its existence, we incorporate the broadest possible data range to achieve alignment between Bitcoin data and other datasets. The findings of the statistical analysis indicate that EPU and the NASDAQ index promote positive fluctuations in Bitcoin volatility, whereas gold prices act as a dampener. However, we find no empirical support for the influence of energy prices on Bitcoin volatility. These results suggest that Bitcoin should not be underestimated; all stakeholders should treat the issue of Bitcoin volatility seriously, including governments, who should actively regulate the Bitcoin market, and investors, who should recognize the dangers of this volatility, making rational decisions based on individual circumstances and employing flexible trading strategies.

Embracing innovative digital technologies within educational systems is essential for overcoming challenges in modern learning environments, especially in the post-COVID-19 era. Teaching sustainability management in higher education institutions with innovative digital tools plays a fundamental role in the transition toward sustainable societies. Suitable game design elements play a significant role in facilitating sustainable learning. This study explored the effectiveness of incorporating business simulation games with project-based learning (PBL) in a flipped classroom setting. This approach was adopted within the context of a university cross-border e-commerce course to prepare students for acquiring 21st -century skills as higher-order thinking skills in a rapidly changing educational landscape. A quasi-experimental method was employed, involving a total of 60 university students from China's Zhejiang Province. Participants completed an online questionnaire designed to assess their learning engagement across three dimensions (cognitive, emotional, and behavioral) as well as their higher-order thinking skills (problem-solving, critical thinking, and creativity). The results show that the business simulation games combined with flipped classroom learning had a significantly positive impact on students’ learning outcomes, enhancing their problem-solving, critical thinking, and creative capabilities. Importantly, this approach also improved student engagement and promoted sustainable practices by applying real-life scenarios in an interactive environment. We conclude that business simulation games integrated with project-based learning (PBL) in flipped classroom settings represent a valuable educational approach. This approach not only enhances learning engagement but also fosters the development of higher-order thinking skills, encouraging students to adopt sustainable learning practices.

The vegetation types on the Qinghai-Tibet Plateau are complex and diverse, and the ecological environment is fragile and sensitive. It is very important to study the dynamic changes in vegetation and the main factors related to these changes to grasp the present state of the regional ecosystem, maintain the balance of the ecosystem and promote the sustainable development of the ecosystem. Therefore, this paper is based on SPOT/VEG NDVI (normalized difference vegetation index) data, land use data, topographic data and meteorological data from 1999 to 2019. The spatiotemporal variation in the NDVI over the Tibetan Plateau in the last 21 years and its response to different driving factors were investigated by using the Sen slope method, Mann–Kendall mutation test, partial correlation analysis and geographical detector method. The results showed that (1) the vegetation coverage on the Qinghai-Tibet Plateau showed an increasing trend from 1999 to 2019, with increases in approximately 67.00% of the plateau area. (2) The spatial differences in vegetation coverage were large; notably, low-density vegetation areas decreased obviously, moderate-density vegetation areas accounted for approximately 50% of the total area, high-density vegetation areas were the least common, and the overall growth rate was significant. (3) The NDVI was positively correlated with temperature and precipitation, and a positive correlation was observed in more than 66% of the region. (4) The order of the influence of single driving factors on the NDVI was as follows: precipitation > soil type > altitude > temperature > gradient > slope > population density > GDP. (5) The effect of multiple factors was significantly higher than that of single driving factors, with a notable nonlinear influence. The interactions between meteorological factors, such as precipitation, and topographic factors, such as altitude, were important, with a q value over 0.79.

The objective of this study is to investigate the use of excavation behavior prediction and analysis software in the field of civil en-gineering. PLAXIS and SoilWorks, widely used in the engineering and academic communities, were employed as research tools for analyzing gravel layers and deriving appropriate ranges of soil elastic modulus for different software programs. By collecting excavation cases in the Xindian area of New Taipei City, Taiwan, and conducting deep excavation analysis using the displacement of retaining walls, this study provides recommended ranges for localized selection of soil elastic modulus. The suggested range for PLAXIS is 7,840 N/m² to 9,800 N/m², while Soil-Works suggests a range of 2,450 N/m² to 3,430 N/m². These ranges allow for reasonable estimation of maximum deformations during the final excavation stage. Based on the research findings, it is recommended that engineers refer to the provided ranges when selecting soil elastic modulus for excavation analysis in gravel layers using different soft-ware programs in the Xindian area of Taiwan to improve the accuracy of deformation predictions during the final excavation stage. These results serve as important references for engineers and contribute to the effective prediction and management of excavation behavior in civil engineering projects.

In recent years, with the popularity of smart mobile devices, the interaction between devices and users, especially in the form of voice interaction, has become increasingly important. If smart devices can understand more users' emotional states through voice data, more customized services can be provided for users. This paper proposes a novel machine learning model for speech emotion recognition, which combines convolutional neural networks (CNN), long short-term memory neural networks (LSTM), and deep neural networks (DNN), called CLDNN. To make the designed system can recognize the audio signal closer to the human auditory system does, this article uses the Mel frequency cepstral coefficients (MFCCs) of audio data as the input of the machine learning model. First, the MFCCs of the voice signal is extracted as the input of the model, and the feature values of the data are calculated using several local feature learning blocks (LFLB) composed of one-dimensional CNN. Because the audio signals are time-series data, the feature values obtained from LFLBs then input into LSTM layer to enhance the learning on time-series level. Finally, fully connected layers are used for classification and prediction. Three databases RAVDESS, EMO-DB and IEMOCAP are used for the experiments in this paper. The experimental results show that the proposed method can improve the accuracy compared to other related researches in speech emotion recognition.