With a highly efficient optical absorption capability, bismuth selenide (Bi2Se3) nanomaterial can be used as an outstanding photothermal agent for anti-tumor treatment and shows promise in the field of nanotechnology-based biomedicine. However, little research has been done on the relevant mechanism underlying the photothermal killing effect of Bi2Se3 nanomaterial. Herein, the photothermal effects of Bi2Se3 nanoparticles on A549 cells were explored with emphasis put on autophagy. Firstly, we characterized the structure and physicochemical property of the synthesized Bi2Se3 and confirmed their excellent photothermal conversion efficiency (35.72%), photostability, biocompatibility and ability of photothermal killing on A549 cells. Enhanced autophagy was detected in Bi2Se3-exposed cells under an 808 nm laser. Consistently, an elevated expression ratio of LC3-II to LC3-I, a marker of autophagy occurrence, was induced in Bi2Se3-exposed cells upon NIR irradiation. Meanwhile, the expression of cleaved-PARP was increased in the irradiated cells dependently on the exposure concentrations of Bi2Se3 nanoparticles. Pharmacological inhibition of autophagy by 3-methyladenine (3-MA) further strengthened the photothermal killing effect of Bi2Se3. Meanwhile, stress-related signaling pathways including p38 and SAPK/JNK were activated coupled with the attenuated PI3K/Akt signaling. Our study figures out that autophagy and the activation of stress-related signaling pathways were involved in the photothermal killing of cancerous cells by Bi2Se3, which provides a more understanding of photothermal nanomaterials.

Apathy is a fundamental neuropsychiatric symptom of Korsakoff’s syndrome (KS) and has also been reported in patients with alcohol use disorder with no (AUD) or less severe cognitive disorders (ALC). However, research on the nature of apathy is limited in these groups. Aim of this study was to examine the multidimensional nature of apathy in patients with KS, ALC and AUD. Moreover, we examined differences between apathy ratings by patients and their professional caregivers, and related apathy to everyday functioning and overall cognition. Twenty-four patients with KS, 24 patients with ALC and 21 patients with AUD participated in this study. Apathy was measured using the Apathy Motivation Index (AMI), which distinguishes behavioral, emotional and social apathy. Both patients and professional caregivers reported social apathy as most prominent symptom, compared to behavioral and emotional apathy. Apathy ratings did not differ across the three patient groups. Discrepancies between patient and caregiver ratings were observed in patients with KS and ALC, with more severe apathy reported by caregivers. Caregiver-reported behavioral and social, but not emotional, apathy was related to everyday functioning. These results show that apathy is present in a substantial proportion of patients with alcohol addiction with or without cognitive impairments.

Emotional dysfunction, including flat affect and emotional perception deficits, is a specific symptom of schizophrenia disorder. We used a modified multimodal odd-ball paradigm with fearful facial expressions accompanied by congruent and non-congruent sounds to investigate the impairment of emotional perception and reaction to other people's emotions. We analyzed subjective assessments and ERP data for emotionally charging congruent and non-congruent stimuli in patients with schizophrenia and healthy peers. The results showed the deficit of multimodal perception of fearful stimuli in patients with schizophrenia compared to healthy controls. The amplitude of N50 was significantly higher in subjects of the control group for non-congruent stimuli than congruent and did not differ in patients with schizophrenia. The dynamics of P100 and N200 components confirmed the impaired sensory gating in patients with schizophrenia. The lower amplitude of P3a could be associated with deficits in verbal memory and attention, less emotional arousal, or incorrect interpretation of emotional valence as specific features of patients. The difficulties in identifying the incoherence of facial and audial components of emotional expression could be significant in understanding the psychopathology of schizophrenia.

Daphne wolongensis described on the basis of a few known individuals was investigated in the wild, in Baoxing Valey, Sechuan. Its status of valid species was verified morphologically and genetically. Three newly found populations were compared to the closely related species Daphne retusa, D. tangutica, D. longilobata, D. acutiloba, D. sureil, to clones available in cultivation and selected cultivars. The high bootstrap values indicate a good level of genetic differentiation between each of the studied species. The hypothesis whether D. wolongensis is a hybridogenous species was rejected, it is a well-defined independent species. Based on morphological and genetic data, it seems likely that another species, D. limprichtii can be a mountain form of D. tangutica. Variability of populations in Wolong gives a good opportunity to select genotypes with a higher or better performance of combination of traits. From 51samples collected in Wolong it was possible to select the top ten different types as genetic resources for breeding. Daphne wolongensis, in the visited sites of Wolong area, occupies less than 1 km2. Together with isolated finds, the number of found individuals is less than 500 and the area is not larger than 10 km2, thus it falls to the IUCN category of “Critically Endangered” plants.

Introduction: Osteoarthritis (OA) and age-related degeneration (ARD) are stimulants for the development of the fabella in the knee joint. This meta-analysis updates previous studies and reviews on the prevalence of the fabella in OA or ARD knee joints. In addition, it provides a quantitative estimation of the fabellar prevalence in knees having OA and ARD. Methodology: Twenty studies comprising of data from 11,056 knee joints were included in the analysis, consisting of 6,819 Knees of OA subjects (including those with age more than 40 years) and 4,237 knees of non-OA subjects (including less than 40years) knees, respectively. 2,434 knees had fabellae present in OA subjects (including more than 40years), and 844 fabellae were present in non-OA subjects (including less than 40years). The Odds and Risk Ratios were calculated. Sensitivity analysis and cumulative analysis were conducted to assess the robustness of the findings. Results: Prevalence of fabella was found to be higher in OA knees, where the Risk Ratio of developing fabella was 2.50 (2.07-3.01). Compared with this, the Risk Ratio for the incidence of fabella in OA with ARD knee was 1.84 (1.66-2.03). The bilateral occurrence of fabella was more common than unilateral. The risk of developing fabella in individuals aged less than forty-year was 63% less than individuals aged more than forty years. Conclusion: OA and ARD would increase the prevalence of fabella by 84%, thus acting as stimulants and risk factors for ossified fabella.

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

The present study was conducted to evaluate the effects of dietary supplementation of tea polyphenol （TP） on serum hormone, serum enzyme activity, antioxidant-related and immune-related gene expression of laying hens under heat stress. A total of 288 Chinese yellow chicken (186 days old) were randomly distributed among two treatments, each of which included 6 replicates of 24 hens. Dietary treatments were that the basal diet was supplemented with 200 mg / kg tea polyphenol. The study lasted for 7 weeks, including 1 week of adaptation and 6 weeks of the formal test. The content of high-density lipoprotein cholesterol (HDL-C) and total protein (TP) in serum significantly decreased by dietary supplementation with tea polyphenol. Dietary tea polyphenol supplementation improved serum superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) enzyme activity and decreased serum malondialdehyde (MDA) content in treatments compared to the control. However, supplementation of tea polyphenol did not affect the activity of serum catalase (CAT). The results indicated that long-term feeding of tea polyphenols help to increase the amount of hormones (FSH, E2) associated with reproduction in laying hens and thus improve egg production. It also improved the immune function of laying hens in high temperature environments. Adding tea polyphenols to the diet can significantly increase the serum IgG, IgM content of the laying hens and can upregulate the IgA content. Dietary supplementation of tea polyphenols in the laying hens significantly increased the expression of antioxidant enzyme-related genes (SOD, CAT and GPX1) in the liver. Moreover, the addition of tea polyphenols significantly increased the expression of immune-related genes (Interferon-γ (INF-γ), Interleukin 2 (IL-2) and Interleukin 4 (IL-4)) in the spleen. It is concluded that addition of tea polyphenols has a positive effect on antioxidant activity and immune function of laying hens.

EZH2 overexpression is associated with tumor proliferation, metastasis, and poor prognosis. Targeting and inhibiting EZH2 may be an effective therapeutic strategy for head and neck squamous cell carcinoma (HNSCC). We previously analyzed EZH2 mRNA expression in a well-characterized dataset of 230 (110 original and 120 validation cohorts) human head and neck cancer samples. This study aimed to investigate the effects of inhibiting EZH2, either via RNA interference or via pharmacotherapy, on HNSCC growth. EZH2 upregulation was significantly correlated with recurrence (P < 0.001) and the methylation index of tumor suppressor genes (P < 0.05). DNMT3A was significantly upregulated upon EZH2 upregulation (P = 0.043). Univariate analysis revealed that EZH2 upregulation was associated with poor disease-free survival (log-rank test, P < 0.001). In multivariate analysis, EZH2 upregulation was evaluated as a significant independent prognostic factor of disease-free survival (hazard ratio: 2.085, 95% confidence interval: 1.390–3.127; P < 0.001). Cells treated with RNA interference and DZNep, an EZH2 inhibitor, showed the most dramatic changes in expression, accompanied with a reduction in the growth and survival of FaDu cells. These findings suggest that EZH2 upregulation is correlated with tumor aggressiveness and adverse patient outcomes in HNSCC. Evaluation of EZH2 expression might help predict the prognosis of HNSCC patients.

Recent evidence suggests the existence of shared neural resources for rhythm processing in language and music. Such overlaps could be the basis of the facilitating effect of regular musical rhythm on spoken word processing previously reported for typical children and adults, as well as adults with Parkinson’s disease and children with developmental language disorders. The present study builds upon these previous findings by examining whether musical rhythmic priming also influences visual word processing, and the extent to which such cross-modal priming effect of rhythm is related to individual differences in musical aptitude and reading skills. EEG was recorded while participants listened to a rhythmic tone prime, followed by a visual target word with a stress pattern that either matched or mismatched the rhythmic structure of the auditory prime. Participants were also administered standardized assessments of musical aptitude and reading achievement. ERPs elicited by target words with a mismatching stress pattern showed an increased fronto-central negativity. Additionally, the size of the negative effect correlated with individual differences in musical rhythm aptitude and reading comprehension skills. Results support the existence of shared neurocognitive resources for linguistic and musical rhythm processing, and have important implications for the use of rhythm-based activities for reading interventions.

Choroidal neovascularization (CNV) is a key pathological feature of several of the leading causes of vision loss including neovascular age-related macular degeneration. Here we show that a calreticulin anti-angiogenic domain (CAD)-like peptide 27, CAD27, inhibited in vitro angiogenic activities, including tube formation and migration of endothelial cells, and suppressed vascular sprouting from rat aortic ring explants. In rat model of laser-induced CNV, we demonstrate that intravitreal injection of CAD27 significantly attenuated the formation of CNV lesions as measured via fundus fluorescein angiography and choroid flat-mounts (19.5% and 22.4% reductions at 10μg and 20μg of CAD27 injected, respectively). Similarly, the reduction of CNV lesions was observed in the groups of rats that had received topical applications of CAD27 (choroid flat-mounts: 17.9% and 32.5% reductions at 10μg/mL and 20μg/mL of CAD27 installed, respectively). Retinal function was unaffected, as measured using electroretinography in both groups received interareal injection or topical applications of CAD27 at least for 9 days. These findings show that CAD27 can be used as a potential therapeutic alternative for targeting CNV in the diseases such as neovascular age-related macular degeneration.

Garment sector has crucial working field in Turkey.It has also very high risky occupational health conditions and safety.The objective of this study is to define level of job level, work-related stress’ symptoms, social support and coping mechanisms of garment workers and to determine any related factors.This study is descriptive and cross-sectional. The study population comprised garment workers in the 16-65 age range. The data was collected by Assessment Form, The Brief Stress Coping Profile and Brief Job Stress Questionnaire. The level of work-related stress was statistically higher among the workers who had chronic disease, low economic, education status and poor quality of sleep. Psychological and physical physiological reactions to stress were found higher among women workers and those with chronic disease.It also was seen that job stress scores had a meaningful relationship with “emotional expression involving others” (r =.20) and “Avoidance and suppression” coping profile (r =.16; p <.01).Psychological symptom scores were found to have a low level of meaningful relationship with “Seeking help for solution” (r =-.08), “changing point of view” (r=.13) and “emotional expression involving others” coping profiles (r=.21). Work-related stress causes many health and behavioral problems. Work related reasons and coping profiles have powerful effects on stress.

Age-related diseases (ARDs) are the leading cause of death worldwide, and contribute to 90% of mortality in developed countries. Interestingly, the mortality rates of individual ARDs increase exponentially with age. Processes described by the exponential growth function typically involve a branching chain reaction or, more generally, a positive feedback loop. Here I propose that each ARD is mediated by one or several positive feedback loops (vicious cycles). I then identify critical vicious cycles in five major ARDs: atherosclerosis, hypertension, diabetes, Alzheimer’s and Parkinson’s. I also propose that the progression of ARDs can be halted by selectively interrupting the vicious cycles and suggest the most promising targets. An evolutionary perspective is also offered.

As the cost of conventional energy continues to rise, and concerns over the environment grow, there is a growing interest in sustainable energy. It is believed that conventional energy will only last for around 50 years, making it essential to find a renewable energy source that is safe and feasible to replace fossil fuels. Solar energy is a superior alternative to conventional energy, as it is renewable and produces green energy that can be used directly. The maritime industry has found itself at the forefront of an evolving environmental consciousness, driven by the imperative to mitigate the carbon footprint left in the wake of ships. In this journey towards sustainability, solar energy has emerged as a beacon of hope, harnessing the boundless energy of the sun to wean vessels off their dependence on fossil fuels. Technological advancements have made solar power more accessible, and we can now see the use of solar panels on large ships and small crafts to reduce fuel usage and emissions. Solar panels are also increasingly used to power homes and businesses, and many countries are implementing policies to encourage their use. Solar energy is a key solution in reducing our dependence on non-renewable energy sources and combating climate change. However, the adoption of solar energy is but a stepping stone towards maritime sustainability, as the integration of CO2 capture, utilization, and storage (CCUS) technologies promises to amplify the industry's environmental impact to unprecedented heights.

Energy imbalance gap (EIG) is defined as the average daily difference between energy intake (EI) and energy expenditure (EE). This study aimed to examine the associations between EIG and sociodemographic and anthropometric variables in the adolescent population of eight Latin American countries. A total of 680 adolescents aged 15 to 18 were included in this study. EI was estimated using two non-consecutive 24-hour dietary recalls. EE was predicted from Schofield equations using physical activity levels obtained through the long version of the International Physical Activity Questionnaire. Sociodemographic data and anthropometric measurements were also obtained. A descriptive analysis and multilevel linear regression models were used to examine associations between variables. The mean EI, EE, and EIG were 2091.3 kcal, 2067.8 kcal, and 23.5 kcal, respectively. Argentina and Colombia had the highest EI and EIG, whereas Chile and Costa Rica had the lowest EI and EIG. Males had a higher EI (2262.4 kcal) and EE (2172.2 kcal) than females (1930.1 kcal and 2084.5 kcal), respectively (p<0,05). Overweight subjects had a lower EIG than did underweight and normal-weight subjects (p<0,05). Subjects with high SES had a lower EE (2047.0 kcal) than those with low SES (1963.7 kcal) (p<0,05). Sex and BMI were associated with EIG in adolescents from Latin America.

Energy management, especially in communities, is attracting growing interest, but is often marred by confusion between the terms "Energy Information System" (EIS) and "Energy Man-agement System" (EMS). This ambiguity hinders understanding of their use and role in improv-ing energy performance. Our objective is to clarify these terms and their contribution to energy management. We used a mixed qualitative and quantitative approach to evaluate and compare the criteria of definition, objective, functionality, role, as well as correlated elements such as or-ganizational structure, responsibilities, planning and policy, according to the requirements of ISO 50001, in addition to criteria specific to the two systems. The study reveals differences in the roles of the EIS and the SME, with a complementarity of 40% between the two systems, depend-ing on the positioning of the EIS in relation to the elements of the SME process. The EIS plays a crucial role in facilitating the implementation of the EMS according to ISO 50001. This clarifica-tion contributes to a better understanding of the respective roles of these systems in energy management, thus helping communities to improve their energy performance in an effective manner.

A comprehensive Energy Audit of a Maintenance facility was performed to assess its energy performance and identify scope for improvement. The facility’s Energy Use Intensity (EUI) for 2022 was 404 kWh/m2 — more than double the Benchmark EUI for Maintenance facilities (151 kWh/m2) recommended by EnergyStar. Furthermore, the Load Factor for 2022 was 0.22, which is lower than the recommended minimum of 0.75 for an efficient building. The audit encompassed an in-depth evaluation of the building's structural and operational characteristics, comprising HVAC systems, lighting, building envelope, and energy-intensive machinery. An energy model of the building was developed to emulate the baseline building energy performance for 2022. Following the energy model's development and validation, an analysis was conducted to identify energy-intensive areas and opportunities for optimization. Energy Efficiency Measures were then formulated, focusing on improving energy efficiency while focusing on energy consumption reduction and GHG emission reduction. Results demonstrated the potential of Energy Audits and Modeling to enable significant reductions in energy consumption and promote sustainable building practices. Among the Energy Efficiency Measures considered, re-sizing and decarbonizing HVAC equipment contributed the most to energy savings, with a 100% decrease in natural gas and 37% decrease in electricity use annually.

The analysis presented is based on actual GHU energy demand. The special feature of this load is the existence of strong daily fluctuations in energy consumption, especially during the summer months. This study presents a methodology for managing such loads with the main objective of maximizing the operating efficiency of MG.

In the last 20 years, the share of renewable energy sources in the production of electricity in the European Union has doubled, from about 15% to almost 35%. The main driver of this development has been the increase in the share of wind energy and solar photovoltaic energy. The authors aim to analyze the influencing factors that affect the energy transition process applied to nautical tourism, from polluting energy to renewable solar energy. The authors' research approach consists in using the framework offered by the energy transition process from the perspective of the socio-technical and economic approach, by applying the qualitative research method with a deductive approach. The tool used to achieve the objective was the semi-structured interview. The research unitarily, holistically, and specifically approaches the problem of energy transition from polluting sources to renewable ones offered by solar energy, in the case of nautical tourism with direct implications on the specific industry in the Netherlands. The research results are structured in the fields of technology, governance, economics, and user preferences. This research has the potential to provide support to find optimal solutions that encourage users to accelerate the energy transition process by adopting sustainable solutions for nautical tourism.

Sustainability of current energy policies and known mid-term policies are analised in their multiple facets. First an overview is given about the trend of global energy demand and energy production, analysing the share of energy sources and the geographic distribution of demand, on the basis of statistics and projections published by major agencies. The issue of sustainability of the energy cycle is finally addressed, with specific reference to systems with high share of renewable energy and storage capability, highlighting some promising energy sources and storage approaches.

Since the requirements in terms of power of the electronic applications range wide, the developed Energy Harvesting (EH) systems limit their availability to the less power demanding applications. However, this paper focuses on increasing the energy levels collected in the EH system so that it can be included in more demanding applications in terms of power. Therefore, an electronic system capable of grouping many single harvesting channels into one single system is analyzed in this paper. This multi-harvester electronic system is able to manage efficiently the energy collected by multiple vibratory transducers. The paper includes a comparison of its performance against some of the State-of-the-Art EH energy management circuits that interface the transducers. The method employed to demonstrate the intrinsic efficiency of each of the electronic circuits tested was based on experimental tests, where the average power transferred from several identical and simultaneous electric sources to a single storage element was measured. It was found out that only one energy management circuit was able to increase the transferred energy in a linear way while new input electric sources were added.

The global energy transition is motivated largely by the need to combat climate change. Other reasons include limits to available fossil fuels, energy-related environmental impacts of many kinds, and societal goals such as equity and providing sustainable energy for the poor. This transition will significantly change the world both technically, economically and socially. It is taking shape with characteristics which prioritise certain types of policy, interventions and solutions, as well as certain actors and institutional forces. More fundamentally, it embodies underlying assumptions about what constitutes a desirable type of economy and society. Briefly stated, the energy transition is being geared to a conventional economic growth-focused type of development; including the not unchallenged concept of green growth. Not everyone, however, would agree on those priorities or the underlying assumptions. We point out various constraints and limitations which this approach places on the energy transition. Whilst much of the change being initiated is positive, we argue that different views, which lie closer to discourses such as strong sustainability (1), deep ecology (2) and ecological economics (3, 4) might prioritise differently and offer both necessary and desirable outcomes. Given the predominant focus on energy and climate, equally essential goals such as equity and eradication of poverty appear to be at particular risk of being missed. Building on examples and recent experience we argue that achieving global sustainable energy, not least the societal goals, remains unlikely within socio-political frameworks permeated by the imperatives of market-driven growth, the commodification of resources, and intense competitive dynamics. Technology and economics, the themes of this issue, have far-reaching societal implications and outcomes. We argue that it is essential that they be considered within the broad context discussed here.

The large-scale introduction of renewable energy, replacing fossil fuels, is presented as an essential part of the energy transition; this substitution is being observed in electrical systems, but it will also be necessary to introduce them in other sectors, such as transportation, either by incorporating renewable energy sources in the sector's facilities, including automotive service centers, or by electrifying transportation technology. The introduction of electromobility in a country is associated with a group of technologies that are required to make this introduction feasible. In Cuba, the introduction of electric vehicles, electric charging stations and charging points, including residential charging points, could increase the current demand by about 330 MW, based on the prospects for the introduction of electrification in the country's transportation system. Taking all of the above as a point of reference, this article addresses the basic elements of an energy transition proposal in the transportation sector, arriving at a proposed Roadmap to achieve the required synergy between energy transition and electromobility.

Paper presents the energy policy of the Republic of Serbia with special attention to the energy situation on the government controlled territory. South Serbian autonomous province of Kosovo and Metohija is under UN jurisdiction since the 1999 according to UNSC Resolution 1244. Renewable energy sources are rarely used in Serbia with exception of energy from hydropower plants, but in this sector priorities in geothermal and energy coming from biomass recently increased. In natural gas sector, Serbia has the deal with Russia for construction of South Stream gas-line through Serbia and for construction of the first underground storage in depleted gas reservoir in Banatski Dvor. In 2008, Serbia also sold 51% of the government founded petroleum industry – NIS which has exclusive monopoly for exploitation of crude oil. Serbian government has complete monopoly in electric power sector. Electric power infrastructure became technologically obsolete, and operative efficiency is at very low level. Serbia has not yet decided whether Serbian Electric Power Industry – EPS will be privatized. District heating sector mostly natural gas fuelled is highly inefficient and it is in jurisdiction of local municipalities but also has social component dictated by central government.

The purpose of the evaluation of the Peruvian energy generation system is to project the electricity generation and demand until the year 2050. To achieve this, three alternative scenarios have been defined and analyzed using the LEAP (Long-range Energy Alternatives Planning) software. The scenarios are as follows: the first one, Business-as-Usual scenario, based on normal trends according to historical data and referencing projections made by Peruvian state entities; the second one is focused on Energy Efficiency, the highlighted characteristic is taking into consideration the efficient conditions in transmission and distribution of electric energy; and the third one, centered on Geothermal Energy, focused on the development of this type of energy source and prioritizing it. The primary purpose of this analysis is to identity advantages and disadvantages inherent in each scenario in order to get the best of each one. In this way, the intention is to propose solutions based on Peru’s national reality or possible uses of the country’s energy potential to supply its energy demand. Currently, Peru’s energy demand relies on fossil fuels, hydraulic, and thermal energy. However, there is the possibility of transforming this system into a sustainable one, by strengthening existing and growing energy sources such as solar and wind energy, and new technologies for hydraulic and thermal energy, in addition to considering geothermal energy as the main energy source in the third scenario. The new system mentioned satisfactorily indicate that the CO2 equivalent emissions decrease significantly in the third scenario, with a 15.8% reduction compared to the first scenario and a 9.7% reduction in comparison to the second. On the other hand, the second scenario shows a 5.6% decrease in CO2 emissions compared to the first, resulting from improvements in technology and energy efficiency without requiring significant modifications or considerable investments, as in the third scenario.

Fairness-related decision-making often involves a conflict between egoistic and prosocial motives. Previous research based on Terror Management Theory (TMT) indicates that mortality salience can promote both selfish and prosocial behaviors, leaving its effect on fairness-related decision-making uncertain. By integrating TMT with the strength model of self-control, we propose that managing death-related thoughts depletes self-control strength, thereby impairing individuals' ability to resist selfish impulses during fairness-related decision-making tasks. Additionally, this effect is moderated by dispositional self-control. We tested these hypotheses in two studies. Participants were primed with either mortality salience or negative affect and then asked to made a series of binary choices (equal allocation vs. unequal allocation favoring themselves) to distribute monetary resources. In both studies, mortality salience heightened selfish tendencies, leading allocate resources less equitably. Study 2 further revealed that this effect occurred among participants with low, but not high, self-control. These findings indicate that mortality salience promotes selfishness and inequitable resource allocation, but that self-control can buffer these effects.

Background/Objectives: Cardiovascular diseases are one of the leading causes of morbidity and mortality worldwide. Health-related quality of life is crucial to assess the impact of cardiovascular diseases and to guide therapeutic strategies. The Short Form 36 Health Survey and the RAND 36-Item Health Survey questionnaires are common tools for measuring health-related quality of life in patients with cardiovascular disease, but their reliability may vary according to the population studied. The aim of this study is to compare the reliability of the SF-36 and the RAND-36 in a population with cardiac pathology, addressing the question of which of these instruments offers a more consistent and useful measurement in this specific group. Methods: Cross-sectional observational study carried out at the University Hospital of Burgos (Spain). 413 patients with cardiovascular pathology referred to the Cardiac Rehabilitation Unit were included. Patients with incomplete data or who did not participate in the program were excluded. Internal consistency (Cronbach’s alpha), item-total correlation and reliability and a half-half analysis were performed. Results: Both questionnaires showed similar and adequate reliability for patients with cardiovascular pathology. Internal consistency, as measured by Cronbach’s alpha, was above 0.80 for most dimensions, supporting its robustness. Significant inter-item and inter-dimension correlations were found in both scales, except in some specific cases in the dimension ‘Physical Functioning’. The half-half analysis confirmed the good reliability of both scales. Conclusions: Both the SF-36 and the RAND-36 are highly reliable tools for assessing health-related quality of life in patients with cardiovascular disease. The results may have significant implications for clinical practice, helping in the selection of health-related quality of life monitoring instruments and in the evaluation of the efficacy of therapeutic interventions.

Background: Cancer therapies predispose survivors to a high symptom burden. This study utilized mobile health (mHealth) technology to assess the feasibility of collecting daily symptoms from adult survivors of childhood cancer and evaluate symptom fluctuation and associations with future health-related quality-of-life (HRQOL). Methods: A prospective study using an mHealth platform to distribute a 20-item cancer-related symptom survey (5 consecutive days each month) and an HRQOL survey (the day after symptom survey) over 3 consecutive months to participants from the Childhood Cancer Survivor Study. PROMIS-29 Profile and Neuro-QOL assessed HRQOL. Daily symptom burden was calculated by summing the severity (mild, moderate, or severe) of 20 symptoms. Univariate linear mixed-effects models analyzed total, person-to-person, day-to-day, and month-to-month variability for the burden of 20 individual symptoms. Multivariable linear regression analyzed the association between daily symptom burden in the first month and HRQOL in the third month, adjusting covariates. Results: Out of the 60 survivors invited, 41 participated in this study (68% enrollment rate); 83% reported their symptoms ≥3 times and 95% reported HRQOL, both in each week across 3 months. Variability of daily symptom burden differed from person-to-person (74%), day-to-day (18%), and month-to-month (8%). Higher first-month symptom burden was associated with poorer HRQOL related to anxiety (regression coefficient: 6.56; 95%CI: 4.10-9.02), depression (6.32; 95%CI: 3.18-9.47), fatigue (7.93; 95%CI: 5.11-10.80), sleep (6.07; 95%CI: 3.43-8.70), pain (5.16; 95%CI: 2.11-8.22), and cognitive function (-6.89; 95%CI: -10.00 to -3.79) in the third month. Conclusion: Daily assessment reveals fluctuations in symptomology, and higher symptom burden was associated with poorer HRQOL in the future. Utilizing mHealth technology for daily symptom assessment improves our understanding of symptom dynamics and sources of variability.

This study investigated the relationship between fundamental movement skills (FMSs) and health-related fitness (HRF) among first and second graders in South Korean elementary schools. It aimed to provide foundational data for developing physical education programs tailored to the motor development stages and fitness levels of younger elementary school students. In October 2023, FMSs (jumping, running, hopping, static balance, dynamic balance, overhand throwing, and kicking) and HRF (muscular strength, cardiorespiratory endurance, and flexibility) were evaluated among 291 first and second graders. The collected data were analyzed through frequency and multiple regression analyses performed using the SPSS software. The results revealed that higher scores in jumping and hopping are associated with greater muscular strength, cardiorespiratory endurance, and flexibility. Running had no significant effect on HRF elements. Higher scores in static balance (single-leg stance) were associated with increased muscular strength, cardiorespiratory endurance, and flexibility, but dynamic balance (balance beam walking) did not have a significant effect. Higher scores in overhand throwing were associated with greater muscular strength and cardiorespiratory endurance, but kicking did not show a significant association. Overall, these findings emphasize the importance of prioritizing jumping and static balance in physical education for the well-rounded health development of first and second graders.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

OCTA is an imaging modality used in the assessment of the retinal vasculature. It operates on the principle of coherence tomography used in standard OCT with the addition of delineating the retinal vascular. This provides a modern non-invasive retinal vascular imaging method compared to conventional dye-based imaging. High quality depth resolution of the superficial and deep capillary networks is possible on OCTA whereas this was not possible prior. OCTA may be limited by image quality degradation from factors such as motion artefact or media opacities, and therefore may not be the investigation of choice for all patient groups. There are multiple potential clinical applications for OCTA in retinal and choroidal vascular disease. Ongoing research is necessary to substantiate the more widespread use of OCTA due to its significant cost burden compared to current modalities.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Overweight and obesity adversely affect health-related quality of life (HRQOL) through day-to-day impairments of both mental and physical functioning. It is assumed that polyphenols within the Mediterranean diet may contribute to improve HRQOL. This investigation aimed at studying the effects of a polyphenol-rich ingredient on HRQOL in overweight and obese but otherwise healthy individuals. A randomized, double-blind, placebo-controlled study including 72 volunteers was conducted. Subjects were randomly assigned to receive for a 16-week period either 900 mg/day of the supplement or a placebo. Dietary recommendations were individually determined, and intakes were recorded; daily physical mobility was monitored. Improvement of HRQOL was set as the primary outcome and assessed at baseline and at the end of the investigation, using the Short-Form 36 (SF-36) Health survey. Body composition was analyzed using dual-energy X-ray absorptiometry (DXA). Physical activity level was calculated using International Physical Activity Questionnaire (IPAQ). After 16 weeks, despite there was no adherence to the Mediterranean Diet Serving Score (MDSS), supplemented individuals experienced significant HRQOL improvement (+5.3%; P=0.001), including enhanced perceived physical (+11.2%; P=0.002) and mental health (+4.1%; P=0.021) components; bodily pain, vitality, and general health, being the greatest contributors. Besides, body fat mass significantly decreased (-1.2 kg; P=0.033), mainly within trunk area (-1.0 kg; P=0.002). Engagement in physical activity significantly increased (+1308 Met-min/week; P=0.050). Hence, chronic supplementation with a nutritional diversity and dose of a Mediterranean diet-inspired polyphenol-rich ingredient resulted in a significant amelioration in both perceived physical and mental health, concomitant with the improvement of body composition, in healthy subjects with excessive adiposity.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

The integration of the increasing share of Renewable Energy Sources (RES) requires the availability of suitable energy storage systems to improve the grid flexibility, and Compressed Air Energy Storage (CAES) systems could be a promising option. In this study, a CO2-free Diabatic CAES system is proposed and analysed. The plant configuration is derived from a down-scaled version of the McIntosh diabatic CAES plant, where the natural gas is replaced with green hydrogen, produced on site by a Proton Exchange Membrane electrolyser powered by a Photovoltaic power plant. In this study, the components of the hydrogen production system are sized to maximize the Self-Consumption share of PV energy generation and the effect of the design parameters on the H2-CAES plant performance are analysed on a yearly basis. Moreover, a comparison between the use of natural gas and hydrogen in terms of energy consumption and CO2 emissions is discussed. The results show that the proposed hydrogen fuelled CAES can effectively match the generation profile and the yearly production of the natural gas fuelled plant by using all the PV energy production, while producing zero CO2 emissions.

This research focuses on optimization of coupled solar production and battery storage system to achieve Nearly Zero-Energy Building (nZEBs) based on building load behavior patterns. Moni-toring data from an office building with 120kW peak and 40kW average load consumption equipped with a 160kW solar photovoltaic (PV) system and a 50kW-45kWh energy storage system (ESS). The primary objective is to the primary objective is to analyze collected data from existing system and setup guideline to optimize ESS capacity to maximize clean energy consumption and thus minimize excess production losses, progressing the building toward Nearly ZEB Level 1 status (87.5%-100% energy usage). The study outcome has identified parameter impacts and demonstrates additional optimized cases with various PV and ESS installed capacity. Further analysis is performed based on working day load profile and appliance patterns. This ap-proach aims to learn the usage HVAC, lighting, and electronics, enabling the optimization scheme to be applied to buildings with different load patterns. Additionally, the analysis predicts other building behavior patterns and optimized clean energy system. The findings are then validated against actual data and the results demonstrate good model accuracy, especially daytime predic-tion. These insights also provide guidelines and strategies for further interventions on HVAC operations and adjusting concerned schedules to achieve desired ZEB level.

The modern era has numerous issues associated with power generation, especially with old fashioned combustion power plants. Since fossil fuels are primarily responsible for the emission of greenhouse gasses, there is a desperate need for adaptation and sustainability. Looking at those challenges, geothermal energy which civilization had a long time ago becomes the desirable solution. This paper aims at establishing the feasibility of geothermal power plants in meeting the challenges of energy intensity and environmental conservation. This study also illustrates that the categories of geothermal energy systems which include the dry steam, flash steam and the binary cycle power plants are capable of achieving high capacity factors, initiating feasibility studies, and have relatively low impacts on the environment. While it is likely to cost more in the initial stages of construction, geothermal power plants provide more long-term cost benefits and significantly fewer toxic emissions relative to the fossil fuel plants. Switching to geothermal energy not only means that the world will have new sources of energy in the near future but also that it will be clean and environmentally friendly. Through incremental steps, geothermal power plants may well open the door to a full energy source infrastructure for subsequent generations.

The implementation of sustainable practices, such as the use of renewable sources and efficient technologies, is crucial for reducing climate change. Energy efficiency is highly important on a global scale due to its relationship with climate change, aiming to minimize environmental impact. In Spain, renewable energy policies have increased self-sufficiency and reduced the use of fossil fuels. Optimizing energy consumption in residences, buildings, and industries is essential for improving efficiency. This was taken into consideration for conducting this study, focusing on the residential sector. The desire to understand the level of energy efficiency in Extremadura drove this project, which focuses on collecting and analyzing data on a set of homes located in the au-tonomous community of Extremadura, with the purpose of evaluating their energy efficiency. To achieve this, a computer tool will be employed to provide a detailed view of the different levels of energy efficiency present in the community. In addition to data collection and analysis, research will be conducted to identify areas for improvement. This will allow proposing a series of specific measures that users can implement to optimize energy efficiency in their homes, adapting them to the particular characteristics of each residence.

“Energy” is probably the most important term in science and technology. The reason is energy can be converted while it is overall conserved, and thereby correlates changes of a wide variety. Despite its successful use in many areas over more than a century, an analysis of current literature shows that definitions of what energy is and explanations why it is conserved are inconsistent. With regard to energy forms not even a definition was found, and examples given are often wrong. Looking at two interacting objects in the most simple situations, with energy conservation but without conversion, a consistent understanding of energy and its conservation can be derived. Based on it, the systematic set of energy forms with a clear definition of each is then presented.

In this paper, solar irradiance and wind speed forecasts were performed considering time horizons ranging from 10 min to 60 min, under a 10 min time-step. Global horizontal irradiance (GHI) and wind speed were computed using four forecasting models (Random Forest, k-Nearest Neighbours, Support Vector Regression, and Elastic Net) to compare their performance against two alternative dynamic ensemble methods (windowing and arbitrating). Forecasting models and dynamic forecasting ensembles were implemented in Python for performance evaluation. The performance comparison between the prediction models and the dynamic ensemble methods was carried out by evaluating the RMSE, MAE, R² and MAPE, to evaluate whether the dynamic ensemble forecasting method obtained greater. According to the results obtained windowing dynamic ensemble method was the most efficient among the tested. For the wind speed data, by varying its parameter λ (from 1 to 100), a variable performance profile was obtained, where from λ =1 to λ = 74, windowing proved to be the most efficient, reaching maximum efficiency for λ = 19. Windowing was the best method for the GHI analysis, reaching its best performance for λ = 1. The efficiency gain using windowing was 0.56% when using the wind speed model and 1.96% for GHI.

A Life Cycle Analysis was performed considering three existing power plants of comparable size operating with different sources of renewable energy: geothermal, solar and wind. Primary data were used for building the life cycle inventories. The geothermal power plant includes emissions treatment for removal of hydrogen sulfide and mercury. The scenario about the substitution of natural emissions from geothermal energy, with specific reference to the greenhouse effect, is also investigated performing a sensitivity analysis. The results are characterized employing a wide portfolio of environmental indicators employing the Recipe 2016 and the ILCD 2011 Midpoint+ methods; normalization and weighting are also applied using the Recipe 2016 method at endpoint level. The results demonstrate a good eco-profile of geothermal power plant with respect to other renewable energy systems and allow for a critical analysis to support potential improvements of the environmental performances.

In the Kingdom of Saudi Arabia (KSA), residential buildings’ energy consumption accounts for almost 50% of the building stock electricity consumption. The electricity generation consumes over one-third of the daily oil production. KSA was ranked as one of the highest countries in fossil fuel consumption per capita in 2014. Moreover, the KSA’s economy heavily relies on fossil fuel sources, namely oil reservoirs, whereby depletion will negatively affect the future development of the country. The total electricity consumption is annually growing by approximately 5-8%, which would lead to identical oil consumption to oil production in 2035. Currently, the KSA government is concerned to generate more renewable energy using large renewable energy plants. The government is investing in energy generation through renewable sources, by financing large scale photovoltaic farms to stop an economic crisis that may occur in 2035. The existing building stock consumes around 80% of the total current Saudi electricity that is generated. According to the Saudi energy efficiency report, the primary energy consumption per capita is over three times higher than the world average. Therefore, the residential buildings need further assessment as to their current energy consumption. This research used a survey to explore current user behaviour in residential buildings energy performance in the city of Jeddah, KSA. The findings of the survey showed: • The buildings thermal properties were found to be poorly designed • The majority of users within the buildings prefer a room temperature of below 24 °C, which requires a massive amount of cooling • Due to the climate conditions and the cultural aspects of KSA, housing units are occupied for more than 18 hours per day • An increase in user awareness has helped to slightly improve residential buildings energy efficiency Knowing the current high energy consumption sources and causes and being able to define available opportunities for further developments on building thermal properties enhancements and how to increase user awareness to reach self-sustaining buildings is essential.

An energy diagnosis is a tool used to seek the improvement of energy saving measures, environmental conservation and energy efficiency, making relevant its implementation in any kind of buildings. For this article, an energy diagnosis of third level was carried out in buildings of the Instituto de Energías Renovables (IER) from Universidad Nacional Autónoma de México (UNAM) through survey and census of the 36 buildings in the IER, in order to characterize current patterns of energy consumption and demand, and generating specific strategies towards savings and energy efficiency, such as indicators and corrective proposals within and non-financial investment.

In the face of escalating climate concerns and the push for sustainable development, the global shift towards renewable and decentralized energy systems presents new challenges and opportunities. This study investigates integrating decentralized energy production, particularly photovoltaic (PV) systems, into national energy planning, aiming to optimize energy strategies that balance local production and consumption with national objectives. By analyzing the Swiss energy model, the research employs the EnergyScope and REHO models to assess the strategic implications of decentralized versus centralized energy systems. Results show that a decentralized approach can significantly reduce PV installation needs to 35 GW, about 23% of potential capacity, and decrease annual system costs by 10% to CHF 1230 per capita. This strategy emphasizes local consumption, minimizes grid reinforcement demands, and leverages economic advantages while addressing overproduction challenges through effective energy storage and grid management. Conclusions underline the strategic value of combining centralized and decentralized methods for resilient and sustainable energy planning. The study contributes to the discourse on energy policy and infrastructure planning, advocating for a hybrid model that accommodates both local conditions and broader energy objectives, urging further research into climate impacts and technology integration for a comprehensive energy future.

Energy efficiency is, in principle, a simple idea: an output of human value, for example, vehicle-km traveled, divided by the needed input energy. Efficiency improvements are regarded by many as an important means of mitigating not only climate change, but also other environmental problems. Accordingly, many countries have efficiency ratings for appliances and efficiency standards for road vehicles. Despite the vast number of articles published on energy efficiency, few question whether it is a useful or accurate measure in its present form. This review addresses this lack, by a critical review of the literature, not only in energy efficiency, but in other areas of research, such as ‘energy services’, that can help broaden the scope of this idea, both geographically and conceptually. These shortcomings are illustrated in case studies of road passenger transport and buildings. The main findings are that energy efficiency inevitably has an ethical dimension, that feedbacks are more widespread than generally considered, and that conventional efficiency measures omit important energy input items, particularly those concerned with mining of the materials needed for renewable energy plants. Finally, the key results of this review are summarized, and its limitations are discussed, as is the future research needed to overcome these shortcomings.

In this study, we propose a module-type triboelectric nanogenerator (TENG) capable of harvesting power from a variety of mechanical energy sources. The potential energy and kinetic energy of water are used for the rotational motion of the generator module, and electricity is generated by the contact/separation generation mode between the two triboelectric surfaces inside the rotating TENG. Through the parametric design of the internal friction surface structure and mass ball, we optimized the output of the proposed structure. To magnify the power, experiments were conducted to optimize the electrical output of the series of TENG units. The electrical signal generated by the module-type TENG can be used as a sensor to recognize the strength and direction of various physical quantities, such as wind or earthquake vibrations.

Energy poverty in the Global South generally focuses on the lack of basic access to modern fuels and energy carriers. Impoverished people rely primarily on traditional biomass as a source of energy. This situation of basic resource deprivation, in which almost one third of the world's population lives, masks other relevant features of the problem. Current assessments of energy poverty in impoverished areas and the mitigation strategies being implemented derive from the development agenda and, with variations in detail and scope, highlight electricity connections and access to clean cooking fuels as guarantors of progress. However, a comprehensive understanding of energy poverty requires going beyond basic access, building on the interactions between the supply of energy sources and carriers, the provision of energy services and its impact on decent living conditions. Several studies in the last decade have attempted to construct an assessment framework centered on energy services to deal with these interactions. This work discusses the relevant dimensions in the framework (supply, services and impact in wellbeing), reviews the multidisciplinary work available in each aspect, presents a range of proposed taxonomies, and discusses the different issues. A detailed framework is proposed for the integrated assessment of the supply of energy carriers and energy equipment, the provision of relevant energy services, and the improvements obtained in living conditions.

The paper examines the evolution and crucial role of energy communities in the context of the transition to renewable energy sources. Such communities are presented as an innovative and resilient response to the challenges posed by climate change. Their importance emerges from their ability to decentralise energy production, increasing local security and reducing dependence on non-renewable energy sources and external suppliers. However, despite the obvious benefits, the contribution highlights several challenges, such as the need for significant upfront investment and the presence of regulatory barriers that may hinder the integration of these solutions into existing energy systems. A detailed bibliometric analysis is used, focusing on specific research areas and using tools to map the most relevant keywords and emerging trends. The results of the bibliometric analysis highlight how energy communities are emerging as key players in the sustainability landscape, capable of addressing and overcoming contemporary environmental challenges. The research reaffirms the transformative potential of energy communities in promoting a more sustainable and resilient future.

This study explores the crucial roles of energy literacy, transition, and justice in addressing the global climate crisis. Through a systematic bibliometric survey and thematic analysis of existing literature, we identify a scarcity in research (<0.1%, n = 17,773) concurrently integrating the three crucial terms: energy literacy; energy transition; and energy justice. This study emphasizes the importance of energy literacy in empowering societies to make informed decisions, which is essential for facilitating equitable energy transitions and achieving sustainability goals. We delve into the interconnections between energy literacy and energy justice, proposing the integration of these concepts into educational systems, including social media platforms to foster an understanding of energy systems, their environmental impacts, and socio-economic implications. Emphasizing the strategic use of social media, the study also introduces the ‘COMPEL Justice’ framework—Communities Prepared for Energy Literacy and Justice—which aims to enhance public engagement and participation in energy transition initiatives. By analyzing publications from various academic and governmental sources, we provide insights into the challenges and opportunities that lie in promoting energy literacy and justice, particularly in the context of global efforts to mitigate climate change and enhance energy equity. Finally, exemplary application and implications associated with the adoption of the proposed framework within the context of oil-producing regions (e.g., Louisiana in the United States) are presented.

Solar photovoltaic (PV) technology is a cornerstone of the global effort to transition towards cleaner and more sustainable energy systems. This paper explores the pivotal role of PV technology in re-ducing greenhouse gas emissions and combatting the pressing issue of climate change. At the heart of its efficacy lies the efficiency of PV materials, which dictates the extent to which sunlight is transformed into electricity. Over the last decade, substantial advancements in PV efficiency have propelled the widespread adoption of solar PV technology on a global scale. The efficiency of PV materials is a critical factor, determining how effectively sunlight is transformed into electricity. Enhanced efficiency, achieved through a decade of progress, has driven the global expansion of solar PV. Multi-junction photovoltaic materials have now exceeded 40% efficiency in lab tests. China leads the world in solar PV installations, boasting over 253 GW of installed capacity by the end of 2021. Other prominent countries in this sector are the United States, Japan, Germany, and India. Supportive policies like feed-in tariffs, net metering, tax incentives, and cost reductions in PV modules have made solar PV increasingly competitive against fossil fuel-based power generation. Solar PV technology holds immense potential for creating a cleaner, reliable, scalable, and cost-effective electricity system. To expedite its deployment and foster a more sustainable energy future, continued investment in research and development, along with supportive policies and market mechanisms, is essential. This paper underscores the pivotal role of solar PV technology in the global energy transition and advocates for a concerted effort to unlock its full potential in achieving a more sustainable and resilient energy future.

The quickest and easiest way to avoid greenhouse gas (GHG) emissions is to purchase renewable electricity and offset the remaining emissions. However, the industrial sector’s electricity needs already exceed renewable electricity generation. Moreover, electricity accounts for only one third of the industry’s energy needs. Simultaneously, the advance of sectoral coupling and the decarbonisation of industrial processes, as well as the desire to rapidly decrease dependence on fossil fuels, are creating significant additional demand for renewable energy. Neither existing nor planned generation and transmission infrastructure will suffice to meet the expected short-term demand. Based on survey data from the German Industry Energy Efficiency Index, this article therefore examines the share of GHG savings that companies intend to achieve on- and off-site. Understanding how much additional generation and transmission capacity is needed by the industry to decarbonise and by when is crucial to identify and address the extent of excess demand. On average, companies plan to avoid 22 % of their 2019 emissions by 2025 and 27 % by 2030, primarily through on-site measures. In combination with the extrapolation of the entire industry’s needs for off-site capacity, the data calls for a rapid expansion of planning authority and green generation capacities.

This article has been developed to assess the economic feasibility of a roof-top photovoltaic installation of industrial self-consumption. Numerical models that enable an interested person to obtain the main expected parameters will be generated. To do this, a calculation methodology will be generated through which the reader, knowing the location of the facility and dimensions of the roof, will be able to calculate the maximum installable power, the main parameters related to production, the cost of the installation, and the LCOE of the plant. The use of actual costs will be facilitated in case they are known, but it will remain possible to apply the costs of the major equipment (modules, inverter, and structure) considered throughout the article. This developed calculation methodology will also allow a quick comparison of the forecasts of production, CAPEX, and LCOE of plants designed with different inclinations and different types of modules. Consequently, it will be especially useful for decision-making before developing the plant's basic engineering. Moreover, the calculations used for modeling the LCOE will be analyzed in depth. This analysis will allow evaluating how the different technical variables affect the profitability of a photovoltaic installation, such as the selected tilt, the location, the module's technology, or the available area.

The building sector accounts for nearly 40% of total primary energy consumption in the U.S. and E.U. and 20% of worldwide delivered energy consumption. Climate projections predict an increase of average annual temperatures between 1.1-5.4°C by 2100. As urbanization is expected to continue increasing at a rapid pace, the energy consumption of buildings is likely to play a pivotal role in the overall energy budget. In this study we used EnergyPlus building energy models to estimate the future energy demands of commercial buildings in Salt Lake County, Utah, USA, using locally-derived climate projections. We found significant variability in the energy demand profiles when simulating the study buildings under different climate scenarios, based on the energy standard the building was designed to meet, with reductions ranging from 10% to 60% in natural gas consumption for heating and increases ranging from 10% to 30% in electricity consumption for cooling. A case study, using projected 2040 building stock, showed a weighted average decrease in heating energy of 25% and an increase of 15% in cooling energy. We also found that building standards between ASHRAE 90.1-2004 and 90.1-2016 play a comparatively smaller role than variation in climate scenarios on the energy demand variability within building types. Our findings underscore the large range of potential future building energy consumption which depend on climatic conditions, as well as building types and standards.

The conceptual reconstruction of Neiwan powerhouse is one of the key activities under the current ongoing mapping project of Taiwanese hydropower plants that mainly took place between 2013 and 2015 and is now focused on micro, pico, and historical power plants. Judging from the fact that the oldest hydropower plant in Taiwan named Guishan starts its operation in 1905, Neiwan powerhouse was among the very first powerhouses that were built across the island to support the electrification of Taiwan. However, the main function of the single turbine equipped Neiwan micro powerhouse was to support mainly the military needs and protect the territories occupied by Japanese troops. Since the powerhouse was built in 1909 and operates only something about 10 year there are very little physical materials or evidence along with contemporaries. Therefore the further reconstruction is based mainly on physical observation of the remains located at the site, old photographs, related articles, treatises and typology of mechanical and civil constructions of other hydropower plant cases in Taiwan hence this paper´s main intention is to pitch a concept reconstruction rather than definite conclusion.

This research paper is part of the wider project concerning the very first detailed mapping of the overall Taiwanese hydro-power plants that took place from 2013 up to 2015 and it is currently in evaluation and finalization stage. The case of Shanping hydro-power plant has been carefully studied, photographed, documented and mapped in situ. It was one of the isolated hydro-power plant projects originally built to supply the remote area with the specific designation. Shanping hydro-power plant, as well as the other units from the early hydro-power generation era in Taiwan, are considered to be the technological heritage of civil and mechanical engineering that reflects later in all the further projects up to nowadays modern Taiwanese hydro-power plants. Unfortunately, most of the hydro-power houses from the older periods were severely damaged or destroyed by natural causes which were also the case of Shanping unit. The research is trying to reconstruct the original location of the powerhouse and its supporting structures based on available historical documents, previous studies, comparative methodology, and the current on-site observation.

The current energy policy recommends the idea of energy efficiency over fossil energy as a primary matter for the coming years. The kingdom of Morocco requires restructuring of its power equipment by increasing the percentage of renewable energy supplies, optimizing their systems and power storage. Therefore, increasing energy efficiency is an as important obligation as reducing the overall energy consumption. The purpose of this research is to present the energy transition in Morocco towards renewable energies and to assess the diversity of available marine natural resources. Recent research in conversion of ocean thermal energy, wave energy, tidal energy, offshore wind energy, and osmotic energy into power supply has started to encourage different technologies. This research has led to commercial deployment in some cases such as our 550 km long Mediterranean coast and 3000 km long Atlantic. This does not only result in fossil energies independency but also provides advantages like less cost and no pollution.

Many research work has demonstrated that taken the Combined Cooling Heating and Power system (CCHP) as the core equipment, the integrated energy system (IES) can bring obvious benefit to energy efficiency, CO2 emission reduction and operation economy in urban areas. Compared with isolated IES, integrated energy micro-grid (IEMG) which is formed by connecting multiple regions IES together, through distribution and thermal network, can further improve the reliability, flexibility, cleanliness and economy of regional energy supply. Based on the existing IES model, this paper describes the basic structure of IEMG and built a IEMG planning model. The planning based on the mixed integer linear programming, and economically construction planning scheme are calculated by using known electricity, heating and cooling loads information and the given multiple equipment selection schemes. At last, the model is validated by a case study. The results show that the application of IEMG can effectively improve the economy of regional energy supply.

This study investigates the energy profile of a regional hospital in North America using an ASHRAE Level 2 Energy Audit. The audit aimed to assess the efficiency of existing systems, identify areas for improvement, and recommend cost-effective measures to reduce energy consumption and environmental impact. The analysis revealed a well-maintained heating system with efficient boilers. However, a critical concern emerged regarding operational risks due to the lack of redundancy in the cooling system. To address this vulnerability, the study recommends installing an air-cooled chiller for increased operational resilience. The economic feasibility of proposed improvements was evaluated, highlighting the balance between initial investment and long-term savings in energy costs and reduced greenhouse gas emissions. The findings contribute to the discourse on sustainable healthcare practices, emphasizing the importance of energy audits, strategic planning, and redundancy measures for optimized performance and environmental responsibility in hospitals.

While being a workaholic supervisor may be viewed as admirable due to their commitment to work, existing findings on its effects on subordinates are mixed. Drawing upon the principle learning perspective and activation theory, we propose a curvilinear relationship between supervisor workaholism and subordinate job performance and investigate the moderating role of subordinate social-related social media usage. Specifically, we suggest that subordinate job performance increases (decreases) as supervisor workaholism increases from low (moderate) to moderate (high) levels and that this inverted U-shaped relationship becomes flatter when subordinates have higher social-related social media usage. The results, based on a multi-source survey collected from 321 supervisor-subordinate dyads, support the predictions. Our research moves beyond linear thinking and suggests that there exists an optimal level of supervisor workaholism that maximizes subordinate job performance. We also provide insights into the ongoing debate and potential ethical concerns surrounding whether employees should use social media at work. Implications for practice and future research are discussed.

This study aimed to explore the genetic information about the yield traits in perennial Chinese rice "Shendao3^#" and provide a series of theoretical bases for the innovative utilization of perennial Chinese rice germplasm. The F₂ population derived from the cross between perennial Chinese rice "Shendao3^#" and one annual rice "XiqingzaoB" was developed to identify QTLs’ underlying yield-related traits. Fifteen yield traits including plant height, panicle plant^-1, and thousand-grain weight were measured for the QTL mapping. The software packages Excel 2010, GraphpadPrism 5.0, and QTLIciMapping 4.10 were used to perform the phenotypic data analysis, construction of molecular map, and QTL mapping, respectively. Results indicated 15 yield-related traits displaying normal distribution and belonging to quantitative trait inheritance. A total of 25 QTLs associated with the yield-related traits and 26 epistatic QTLs were detected on the whole genome except for the 6th and 12th chromosomes. This finding explained phenotypic variance with ranging from 4.21% to 27.30% and 1.15% to 19.30%, respectively. Six pleiotropic QTL (chromosomal regions) underlying two or more yield-related traits were detected on the 1st , 4th, 7th, 8th, and 11th chromosomes, respectively. Among 25 QTLs underlying a single yield-related trait, 11 were primarily identified in the perennial Chinese rice "Shendao3^#". All QTLs underlying 15 yield-related traits followed the genetic model of additive, dominant, and digenic epistatic of additive by additive, additive by dominant, dominant by additive, and dominant by dominant. This work can serve as a good foundation for yield-related gene mining and its utilization in breeding the perennial Chinese rice "Shendao3^#".

Background: Cancer-Related Fatigue (CRF) is a prevalent and debilitating symptom in breast cancer patients, significantly impacting their quality of life and potentially affecting postoperative outcomes. Despite advances in breast cancer treatment, the long-term implications of CRF on prognosis remain unclear. Methods: This retrospective cohort study included 310 postoperative breast cancer patients from two large comprehensive hospitals. We systematically collected demographic, medical history, lifestyle, psychological status, and CRF data. Univariate and multivariate Cox regression analyses were performed to identify independent prognostic factors. Random forest survival analysis, propensity score matching, Kaplan-Meier survival analysis, and restricted cubic spline analysis were utilized to comprehensively evaluate the relationship between CRF and postoperative prognosis. Results: Higher CRF scores were associated with worse postoperative outcomes (HR = 1.07, 95% CI: 1.03-1.10, P < 0.001). Other independent prognostic factors included higher HADS scores (HR = 1.09, 95% CI: 1.01-1.17, P = 0.032), not undergoing breast-conserving surgery (HR = 0.43, 95% CI: 0.20-0.89, P = 0.024), and not receiving endocrine therapy (HR = 7.13, 95% CI: 2.64-19.22, P < 0.001). Random forest survival analysis highlighted CRF as the most critical variable impacting prognosis. Propensity score matching effectively balanced baseline characteristics, and Kaplan-Meier survival curves demonstrated significantly lower survival rates in high-CRF patients both before and after matching (P < 0.05). Restricted cubic spline analysis revealed a nonlinear relationship between CRF scores and disease progression risk, with significant risk increases beyond specific thresholds. Conclusions: CRF is a crucial predictor of disease progression in postoperative breast cancer patients. Higher CRF and HADS scores, non-breast-conserving surgery, and lack of endocrine therapy are associated with poorer prognosis. These findings underscore the importance of comprehensive postoperative care, including effective management of fatigue and psychological health, to improve patient outcomes. Future research should focus on prospective studies and targeted interventions for CRF to validate these findings and enhance clinical practices.

Little is known about skeletal muscle thickness, echogenicity, and muscle quality (handgrip strength /muscle thickness) in breast cancer-related lymphedema (BCRL). Using B-mode ultrasound, we recorded the raw radiofrequency data of the affected (AA) and unaffected (UA) arms of women (n=20) with BCRL, and in 20 control women with no lymphedema (CA). The data were converted into images and measurements of skin, subcutaneous fat and muscle thickness were obtained. Within a designated region of interest, muscle echo-intensity was assessed using computer graded grey scale and muscle thickness was measured using ImageJ2. Handgrip strength was measured using standard dynamometry. We found that forearm muscle thickness was similar among AA, UA, and CA. When compared to the unaffected and control arms, the affected arm had a significantly higher (p 0.013) muscle echo-intensity. When compared to the AA, handgrip strength was similar to UA (p 0.401) but lower than CA (p 0.05). We conclude that the use of B-mode ultrasound is a reliable method to assess muscle thickness and EI in BCRL. When comparing AA to UA, the elevated levels of muscle EI in AA did not influence strength or muscle quality. The elevated EI in AA is a marker of abnormal health that needs to be further explored.

Pancreatic cancer is a refractory cancer with limited treatment options. Various cancer types are resistant to the tumor necrosis factor-related apoptosis-inducing ligand (TRAIL). Eugenol, the main component of clove oil, exhibits anticancer, anti-inflammatory, and antioxidant effects. However, no studies have reported that eugenol increases TRAIL sensitivity by upregulating death receptor (DR) expression. Here, we aimed to investigate eugenol as a potent TRAIL sensitizer. Increased apoptosis and inhibition of cell proliferation was observed in pancreatic cancer cells treated with eugenol and TRAIL compared with those treated with eugenol alone. Eugenol upregulated the expression of DR5, inhibited FLICE-inhibitory protein (FLIP), an anti-apoptotic protein, and increased p53, a tumor suppressor protein. In addition, eugenol induced the generation of reactive oxygen species (ROS) and caused endoplasmic reticulum (ER) stress. C/EBP-homologous protein (CHOP) knockdown using siRNA decreased the expression of DR5 and reduced the combined effects of eugenol and TRAIL. These results demonstrate that eugenol enhances TRAIL-induced apoptosis by upregulating DR5 through the ROS-mediated ER stress-CHOP pathway, enhancing ER stress by inducing p53 and downregulating FLIP expression. This suggests that eugenol has the potential to treat pancreatic cancer by increasing cell sensitivity to TRAIL.

We analyze a time-delayed SIQR model that considers the transportation-related infections and entry-exit screening. This model aims to determine the measures for preventing and controlling major emergent infectious diseases and the associated costs. We calculate the basic reproduction number (R0), apply the linearization method, and construct an appropriate Lyapunov function to determine the stability of the disease-free equilibrium in the local and global. We collect COVID-19 infection data from two regions in the United States in 2020 for data fitting, obtain a set of optimal parameter values, and show that the model is suitable for simulating the outbreak and spread of emerging infectious diseases. We find that transportation-related infections increase the basic reproduction number, enhancing the impact on disease spread. Entry-exit screening effectively suppress the spread of disease by reducing the basic reproduction number. Furthermore, we investigate the influence of the incubation period on disease and find that a shorter incubation period results in a shorter duration but a larger scale of infection, and the peaks are reduced. We conduct a sensitivity analysis of the R0 and propose three measures to prevent the spread of new infectious diseases based on the most sensitive parameters: wearing masks, implementing urban closures, and administering medication to sick but not yet hospitalized patients promptly. In the case of COVID-19, we use Pontryagin’s minimum principle to get time-varying control measures to control the spread of the outbreak. Optimal control effectively controls the development and deterioration of the disease. Finally, several control measures are compared through cost-effectiveness analysis, and the results show that wearing masks is the most cost-effective measure. Our study provides some practical guidance for controlling the spread of major emerging infectious diseases.

Survival of Medulloblastoma (MB) depends on various factors, including the gene expression profiles of MB tumor tissues. In this study, we identified 967 MB survival related genes (SRBs) using the gene expression dataset of Cavalli et al. (2017) and the Cox proportional hazards regression model. Notably, the SRGs were over-represented on chromosomes 6 and 17, known for the abnormalities monosomy 6 and isochromosome 17 in MB. The most significant SRG was HMGA1 (high mobility group AT-hook 1), which is a known oncogene and a histone H1 competitor. High expression of HMGA1 was associated with worse survival, primarily in the Group 3γ subtype. The high expression of HMGA1 was unrelated to any known somatic copy number alteration. Most SRGs on chromosome 17p were associated with low expression in Group 4β, the MB subtype with 93% deletion of 17p and 98% copy gain of 17q. Pathway analysis showed that both chromosomes 6 and 17 included SRGs related to telomere maintenance and provide a rationale for testing telomerase inhibitors in Group 3 MBs. We conclude that HMGA1, along with other SRGs on chromosome 6 and 17 warrant further investigation as potential therapeutic targets in selected subgroups or subtypes of MB.

This study aimed to investigates obesity-related glomerulopathy (ORG) at cellular, structural, and transcriptomic levels. Thirty Wistar rats were randomized into two groups: control (n=15) and study groups (n=15) that were fed a standard (SD) and high-fat diet (HFD), respectively. After 10 weeks, the weight, kidney function, histological features, and transcriptomic changes were assessed. HFD group exhibited increased weight gain (55.8% vs 29.2%; P< 0.001) and albuminuria (10384.04 ng/ml vs 5845.45 ng/ml; P<0.001) compared to controls. The HFD group exhibited early stages of ORG lesions, with a predominance of mesangial matrix increase and podocyte hypertrophy (PH). These lesions correlated with differentially expressed (DE) genes and miRNAs. Functional analysis showed that four DE miRNAs in the kidneys of the HFD group negatively regulated the PTEN gene, which promotes podocyte endocytosis of lipids in ORG. Among these four miRNAs, miR-205 was upregulated in the urine of the HFD group. HFD-fed Wistar rats developed early stages of ORG, with a specific targetome of miRNAs and gene expression. The upregulation of miR-205 in the kidney and its isolation in urine are associated with lipid endocytosis in podocytes, which could become a plausible biomarker of the early stages of ORG and lead to future therapeutic research.

Objective To investigate nailfold capillary parameters in community-dwelling individuals aged over 60 years who have hypertension and do not exercise regularly. Furthermore, the study examined the correlations between capillary function and other health-related indicators. Design A single- center pilot trial Setting Faculty of Health, Tsukuba University of Technology, Japan Participants hypertensive community-dwelling elderly people Intervention Microcirculation was observed before and 1 min after arm-curl exercise by means microscopy of capillary with non-exercised limb. Additionally, we examined other health-related indicators. Outcome measures: Acute effects of reperfusion on nailfold density, flow, and diameters. Secondary outcomes included the correlations between microvascular parameters and other health-related indicators. We hypothesized that brief exercise could enhance microcirculation reperfusion and correlate with other health-related parameters.　 Results: There were 20 participants with a mean (SD) age of 67.1 (5.8) years. The capillary flow rate changed from 2.3±6.7 to 2.7±0.2 log µm/s (P

.Background: Negative outcomes associated with medications (NOM) and drug-related problems (DRP) significantly impact individuals with kidney replacement therapy (KRT) given the complexities of managing kidney disease and associated comorbidities. The present study aims to assess the frequency of NOMs/DRPs among KRT patients and identify contributing factors. Methods: A cross-sectional study was conducted at the Virgen de las Nieves University Hospital (Granada, Spain), involving 117 outpatient adults with KRT. Data were collected from February 2021 to July 2023 using electronic records, semi-structured interviews (Dáder Method), and discussions with nephrology specialists. NOMs/DRPs were identified following treatment guidelines. Binary logistic regression determined associated factors (p-value < 0.05). Results: Across 117 patients, 2,436 NOMs and 3,303 DRPs were identified, averaging 20.82 NOMs and 28.23 DRPs per patient. Prevalent NOMs included untreated conditions (58.95%), quantitative ineffectiveness (35.43%), and non-quantitative safety problems (5.13%). Dominant DRPs were undertreated conditions (37.63%), wrong dose/posology/length (33.00%), risk of adverse drug reactions (ADR) (16.14%), and non-adherence (6.87%). Patients with ADR, undertreated condi-tions, and anemia were associated with quantitative ineffectiveness. Risk of ADR and vitamin D deficiency/insufficiency correlated with non-quantitative safety problems. Conclusions: KRT pa-tients exhibited a substantial prevalence of NOMs/DRPs. Further research is needed to deepen our understanding of these complexities for improved patient care.

Background: Micronutrient deficiencies are common at the time of cancer diagnosis and are associated with worse prognosis. Little is known about them in cancer rehabilitation. Methods: Data from routine health related quality of life (HRQOL) were analyzed at an inpatient cancer rehabilitation center. Rehabilitation patients completed the EORTC QLQ-C30 questionnaire before and after multidisciplinary rehabilitation treatment, and three month after discharge. Selenium and zinc status was measured in whole blood at these three time points. In case of selenium deficiency up to 600 µg selenium per day as sodium selenite was supplemented. Results: A total of 271 patients (breast, colon, and pancreatic cancer) were included in the analysis. There was clinically meaningful improvement in many domains of the EORTC QLQ-C30 during rehabilitation. However, effect often waned in the three months after. Prevalence for selenium deficiency varied between 34 to 90 percent depending on cancer type (breast &lt; colon &lt; pancreas). In contrast, zinc deficiency was rare. Daily selenium supplementation of 600 µg was more efficient to correct selenium deficiency compared to 300 µg selenium per day. Rehabilitation and increasing selenium status after rehabilitation were associated with improved global quality of life, physical and emotional functioning, and fatigue. In cancer patients with decreasing selenium status, values of global quality of life, physical and emotional functioning, and fatigue were back to the values at the beginning of rehabilitation. Conclusions: Selenium deficiency is common in cancer patients admitted to a cancer rehabilitation clinic. Selenium supplementation during rehabilitation effectively corrected selenium deficiency in most cases. The positive effects of rehabilitation persisted longer, when selenium status did not decrease after rehabilitation.

: Molecular targeting strategies have been used for years to control cancer progression and are often based on targeting various enzymes involved in metabolic pathways. Keeping that in mind, it is essential to know the role of each enzyme in a particular metabolic pathway. In this review, we are providing in-depth knowledge of various enzymes such as ceramidase, sphingosine kinase, sphingomyelin synthase, dihydroceramide desaturase, and ceramide synthase, which are associated with multiple types of cancer that depend on ceramide metabolism. Focus has also been given to discussing physicochemical properties of well-studied inhibitors of natural products origin and their related structures for these enzymes. Targeting ceramide metabolism exhibited promise in mono and combination therapies at preclinical stages to prevent cancer progression and paved the way for the significance of sphingolipid metabolism in cancer treatments. Targeting ceramide metabolizing enzymes will help the medicinal chemist to design potent and selective small molecules for treating cancer progression at various levels.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

To date, the impact of COVID-19 vaccination on formerly menstruating women remains unknown. For this reason, a retrospective observational cross-sectional study was conducted (N= 548) using an online survey. General characteristics, medical history, and adverse events following COVID-19 vaccination were recorded. In comparison with the first dose, significantly higher percentages of respondents experienced menstrual-related disturbances (dose 1: 38.5% vs. dose 2: 44.8%; McNemar=9.15; mid P-value=0.002), as well as the simultaneous occurrence of two or more of these symptoms (dose 1: 11.2% vs. dose 2: 15.3%; McNemar=13.53; mid P-value=0.044) after receiving the second one. Among them, those related with the length and flow stand out, being of long-term nature in about 17-20% of cases. Interindividual factors influencing this unexpected event after receiving the dose 1 may include weight (AOR 1.02, CI 95% 1.01–1.03, P&lt;.001), perimenopause (AOR 2.28, CI 95% 1.37–3.77, P=.001), pre-existing diagnoses of non-autoimmune rheumatic/articular conditions (AOR 0.31, CI 95% 0.10–1.00, P=0.05), hormonal contraceptive use (AOR 0.25, CI 95% 0.07-0.82, P=0.02), suffering from other vaccine side effects − such as arm pain (AOR 0.61, CI 95% 0.39–0.95, P=0.03), headache (AOR 0.53, CI 95% 0.35 – 0.80, P=.003), swollen glands (AOR 0.29, CI 95% 0.15 – 0.60, P=.001) and nauseas (AOR 0.35, CI 95% 0.14 – 0.86, P=0.02) – and the number of previous pregnancies (AOR 2.70, CI 95% 1.54 – 4.76, P=.001). Formerly menstruating women may experience long-term menstrual-related disturbances following COVID-19 vaccination.

This study analyses key aspects of the professional life of primary school teachers in a southern European context. In the social changes of last two decades profoundly impacted the well-being of teachers putting a strain on their ability to adapt to sometimes unfair working conditions. For this purpose twenty teachers (M = 38.85; DS = 9.17) were interviewed from different areas of Italy, data were analyzed using the Grounded Theory Method. Through data analysis were summa-rize and emphasize eight core themes. The results show the effects of a gradual impoverishment of the recognition of the role of teacher, highlighting the difficulty for teachers of renegotiating more flexible workload assessments and of reinforcing psycho-emotional skills for the development of a teaching methodology attentive to the psycho-emotional needs of pupils. Schools emerge as a rigid working context, in which a competent organizational function is often absent. Practical psychological implications are discussed.

Tyrosine kinase inhibitors (TKI) and immune checkpoint inhibitors (ICI) significantly improve the outcomes of patients with advanced clear cell renal cell carcinoma (ccRCC), but high-grade toxicities can occur, particularly during combination therapy. Herein, we report a patient with advanced metastatic ccRCC, who developed grade 4 cholestasis during combined therapy with nivolumab and cabozantinib. After the exclusion of common disorders associated with choles-tasis and a failure of corticosteroids (CS), a liver biopsy was performed that demonstrated severe ductopenia. Consequently, a diagnosis of vanishing bile duct syndrome related to TKI and ICI administration was made, resulting in CS discontinuation and ursodeoxycholic acid administra-tion. After a 7-months follow-up, liver tests had returned to normal values. Immunological studies revealed that our patient had developed robust T-cells and macrophages infiltrates in his lung metastasis, as well as in skin and liver tissues at the onset of toxicities. At the same time, peripheral blood immunophenotyping revealed significant changes in T-cell subsets suggesting their potential role in the pathophysiology of the disease.

Grapevine is one of the most relevant crops in the world being used for economically important products such as wine. Yet, relevant grapevine cultivars are heavily affected by diseases such as the downy mildew disease caused by Plasmopara viticola. Improvements on grapevine resistance are made mainly by breeding techniques where resistance traits are introgressed into cultivars with desired grape characteristics. However, there is still a lack of knowledge on how resistant or tolerant cultivars tackle the P. viticola pathogen. In this study, using a shotgun proteomics LC-MS/MS approach, we unravel the protein modulation of a highly tolerant grapevine cultivar, V. vinifera ‘Regent’, in the first hours post inoculation (hpi) with P. viticola. At 6 hpi, proteins related to defence and to response to stimuli are negatively modulated while at 12 hpi there is an accumulation of proteins belonging to both categories. The co-occurrence of effector-triggered susceptibility (ETS) and effector-triggered immunity (ETI) is detected at both time-points, showing that these defence processes present high plasticity. The results obtained in this study unravel the tolerant grapevine defence strategy towards P. viticola and may provide valuable insights on resistance associated candidates and mechanisms, which may play an important role in the definition of new strategies on breeding approaches.

The 2030 Agenda sets out seventeen Sustainable Development Goals (SDGs). The educational goal is to promote the education of citizens on sustainable development, among other things. Educating today's digital citizens on sustainability means training them for justice and social activism, commitment and political engagement. However, research into the subject shows a lack of consistency in the education of university students. This paper presents a study of students of Education, on education on sustainability through the practice of active and critical digital citizenship. A quasi-experimental method was used to learn about the behaviours of digital citizens, and intervention was carried out by means of an SDG-focused workshop and observation of the final level of commitment. The results show a positive level of commitment and digital activism around content related to sustainable development, which can be addressed from the university syllabus in a cross-curricular way.

Deregulation of cell growth and development lead to cancer, a severe condition that claims millions of lives worldwide. Targeted or selective approaches used during cancer treatment determine the efficacy and outcome of the therapy. In order to enhance specificity and targeting and better treatment options for cancer, novel and alternative modalities are currently under development. Photodynamic therapy has the potential to eradicate cancer and combination therapy would yield even greater outcomes. Nanomedicine-aided cancer therapy shows enhanced specificity for cancer cells and minimal side-effects coupled with effective cancer destruction both in vitro and in vivo. Nanocarriers used in drug-delivery systems are well able to penetrate cancer stem cell niche, simultaneously killing cancer cells and eradicate drug-resistant cancer stem cells, yielding therapeutic efficiency up to 100 fold against drug-resistant cancer in comparison with free drugs. Safety precautions should be considered when using Nano-mediated therapy as the effects of extended exposure to biological environments are still to be determined.

This paper focuses on designing and assessing Pumped Hydroelectric Energy Storage Systems (PHES), connected to the grid and PV system for self-consumption structured at Mutah university in an area of high solar potential. In focusing on PHES and PV literature was made to have data on the field, based on the grid code needed in Jordan. Next, a prospection to find the proper location for the installation was done. Afterward, a load profile was inserted to know the energy demand of the university. Then The productivity of the solar power plant of Mutah University was included. Finally, MATLAB software was used to realize the amount of energy to be stored, this data was used to implement the system which was chosen and sized. PHES layout was created to find the most accurate values for parameters to optimize the system performance, and to investigate the loss analysis. The system attains 9230.89 MWh/year. An annual load yields 4430 MWh/year, which covers the Mutah university demand with an estimated saving of 2039773 JD.

This brief commentary challenges the use of the term "energy deficiency" in nutrition and metabolism, providing a critical examination of its scientific and philosophical aspects. It emphasizes the need to consider rare diseases associated with actual energy deficiency, which extend beyond the scope of everyday tiredness or fatigue. By analyzing energy balance and its complexities, this critique underscores the oversimplification associated with the term and its potential for misleading implications. It highlights the dynamic nature of energy metabolism and the intricate mechanisms involved in maintaining energy equilibrium, including the impact of rare genetic and physiological abnormalities. In addition to the discussion on energy balance, this commentary explores the manifestation of rare diseases that disrupt energy production, utilization, or hormonal regulation. Conditions such as mitochondrial diseases, glycogen storage diseases, adrenal insufficiency, and Prader-Willi syndrome are examined, shedding light on their profound impact on individuals' energy levels and overall health. The distinct time courses, underlying mechanisms, and clinical implications of protein deficiency, energy deficiency, and vitamin C deficiency are also compared, further emphasizing the complexity of energy metabolism and its relationship with various nutrient deficiencies. To foster a more comprehensive understanding of energy metabolism and enhance clarity in communication within the field, the commentary proposes the adoption of alternative terminology, such as "energy flux," to capture the multifaceted nature of energy balance more accurately. By reevaluating the terminology employed, researchers and healthcare professionals can better convey the intricate dynamics of energy metabolism and address the unique challenges faced by individuals with rare diseases causing actual energy deficiency. In conclusion, this commentary serves as a thought-provoking exploration of the concept of energy deficiency in nutrition and metabolism. It highlights the limitations of the term in capturing the complexities of energy balance, particularly in the context of rare diseases. By broadening the discussion to include these rare conditions, it encourages a more comprehensive understanding of energy metabolism and calls for precise and nuanced terminology to facilitate effective communication and advancements in the field.

In 2015, Romania was the first country in Europe that achieved EU targets regarding the share of renewables in the generation mix, far ahead of the 2020 deadline. Starting with the energy structure in Romania, the paper: (1) analyses the evolution of the main indicators in the renewable energy sector, (2) discloses the perspectives of renewable energy in Romania synthesizing the main trends of development in the field and (3) analyses the challenges facing with the development of renewable energy in Romania. Based on analyzing the exploratory data, the paper makes a preliminary prediction of the development of the sector for the future decades and proposes targeted countermeasures and suggestions. Romania still has unexploited potential concerning renewable energy sources. Because Romania registered a continuous economic growth, the demand for electricity is steadily growing, and this trend is expected to continue. Also, Romania could introduce a support mechanism for developing the potential of unexploited potential. The results of the present study may be useful for further research regarding public policies for the development of renewable energy. Also, it can represent a useful analysis in order to identify the future trends of renewable energy in Romania.

Owing to the large ratio of consumption in the building sector, energy saving strategies are required. Energy feedback is an energy-saving strategy that consumers to change their energy-consumption behaviors. The strategy has been principally focused on providing energy-consumption information. However, realization of energy savings using only consumption information remains limited. In this paper, a building-energy three-dimensional (3D) visualization solution is thus proposed. This solution includes the process of diagnosing a building and providing prediction of energy requirements if a building improvement is undertaken. Accurate diagnostic information is provided by real-time measurement data from sensors and building models using a close-range photogrammetry (CRP) method without depending on blueprints. The information is provided by employing visualization effects to increase the energy-feedback efficiency. The proposed strategy is implemented on two testbeds, and building diagnostics are performed accordingly. For the first testbed, the predicted energy improvement amount resulting from the facility upgrade is provided. The second testbed is provided with a 3D visualization of the energy information. The aim is to determine if the building manager will replace the facility after our recommendation is given to improve the building energy efficiency driven from the energy information. Unlike existing systems, which provide only ambiguous data that lack quantitative information, this study is meaningful because it provides energy information with the aid of visualization effects before and after building improvements.

Energy conversion and distribution (heat and electricity) is characterized by long planning horizons, investment periods and depreciation times, and it is thus difficult to plan and tell the technology that optimally fits for decades. Uncertainties include future energy prices, applicable subsidies, regulation, and even the evolution of market designs. To achieve higher adaptability to arbitrary transition paths, a technical concept based on integrated energy systems is envisioned and described. The problem of intermediate steps of evolution is tackled by introducing a novel paradigm in urban infrastructure design.It builds on standardization, modularization and economies of scale for underlying conversion units. Building on conceptual arguments for such a platform, it is then argued how actors like (among others) municipalities and district heating system operators can use this as a practical starting point for a manageable and smooth transition towards more environmental friendly supply technologies, and to commit to their own pace of transition (bearable investment/risk). environmental friendly supply technologies. Merits are not only supported by technical arguments but also by strategical and societal prospects like technology neutrality and availability of real options.