Under the increasingly severe global heat threat, continuous high temperature has far-reaching effects on plant growth and development and become a major constraint to crop production. The development of heat-resistant varieties has become research hotspot in many fields, and it is also necessary to establish effective identification methods. In this study, twenty Brassica rapa varieties were selected to to investigate the physiological and biochemical characteristics under heat stress, explore the relationship between physiological response and the heat resistance mechanism, select some typical heat-resistant and heat-sensitive varieties. The effects of photosynthetic electron transfer and antioxidant pathway on heat resistance of Brassica rapa were identified. These findings will providing an important reference for the physiological regulation and identification method of high-temperature stress in plants.

Metamorphosis is a critical process for most anurans to transition from water to land. The appearance of air-breathing lungs occurs during the change in oxygen medium from water to air. Revealing the structural construction and molecular switches of lung organogenesis is essential to understand the realization of air-breathing function. In this study, histology and transcriptomics were combinedly conducted to explore these issues in Microhyla fissipes lungs during metamorphosis. During the pro-metamorphic phase, histological structure improving of the alveolar wall was accompanied by robust substrate metabolism and protein turnover. The lungs, at the metamorphic climax phase, are characterized by an increased number of cilia in the alveolar epithelial cells and collagenous fibers in the connective tissues, corresponding to the transcriptional upregulation of cilia and extracellular matrix-related genes. The post-metamorphic lungs strengthen the contracting function, as suggested by the thickened muscle layer and the upregulated expression of genes involved in muscle contraction. The blood–gas barrier is fully developed in adult lungs whose transcriptional features are tissue growth and differentiation regulation and immunity. Importantly, significant transcriptional switches of pulmonary surfactant protein and hemoglobin facilitate air-breathing. Our results illuminated four key steps of lung development for amphibians to transition from water to land.

General Linear Modelling (GLM) has been widely employed to estimate the hemodynamic changes evoked by cognitive processing, which are more likely to be nonlinear than linear. First, this study re-analyzed the fNIRS data (N = 38, Mage = 5.0 years, SD = 0.69 years, 17 girls) collected in the Mixed-Order Design Dimensional Change Card Sort (DCCS) task. The results indicated that the quadratic equation was better than GLM to model HbO changes in this task. Second, analysis of a new set of data indicated that the Habit-DisHabit design of DCCS was more effective in identifying the neural correlates of cognitive shifting than the Mixed-Order Design. Third, this study found that the Non-users were more attentive and engaged than the Heavy-users, with a slower but more steady increase of brain activation in BA8 and BA9.

This study aims to examine the impact of tablet use on preschoolers’ executive function during the Dimensional Change Card Sort Task (DCCS) task using the functional near-infrared spectroscopy (fNIRS). Altogether 38 Chinese preschoolers (Mage = 5.0 years, SD = 0.69 years, 17 girls) completed the tasks before the COVID-19 lockdown. Eight children never used tablets, while 16 children were diagnosed as the ‘heavy-user'. The results indicated that: (1) the 'Non-user' outperformed the 'Heavy-user' with a significantly higher correct rate in the DCCS task; (2) the two groups differed significantly in the activation of the prefrontal cortex (BA 9): the 'Non-user' pattern is normal and healthy, whereas the 'Heavy-user' pattern is not normal and needs further exploration.

DDX3 is an ATP-dependent RNA helicase involved in multiple cellular activities, including RNA metabolism and innate immunity. DDX3 is known to assist the replication of some viruses while restricting some others through direct interaction with the viral proteins. However, the role of DDX3 in the replication of the hepatitis E virus (HEV) is unknown. In this study, DDX3 is shown to interact with the HEV capsid protein and provide an indispensable role in HEV replication. The DDX3 C-terminal domain was demonstrated to interact with the capsid protein, which was previously demonstrated to inhibit the production of type I interferons. Knockdown of DDX3 compromised the capsid protein-mediated blockage of interferon induction. Notably, DDX3 silencing led to a significant reduction in HEV replication. Also, the ATPase activity of DDX3 is required for the HEV replication as an ATPase-null mutant DDX3 failed to rescue the viral replication in the DDX3-silenced cells. These results demonstrate a pro-viral role of DDX3 in HEV replication, providing further insights into the virus-cell interactions.

While over half of all spinal cord injuries (SCIs) occur in the cervical region, the majority of preclinical studies have focused on models of thoracic injury. However, these two levels are anatomically distinct—with the cervical region possessing a greater vascular supply, grey-white matter ratio and sympathetic outflow relative to the thoracic region. As such, there exists a significant knowledge gap in the secondary pathology at these levels following SCI. In this study, we characterized the systemic plasma markers of inflammation over time (1, 3, 7, 14, 56 days post-SCI) after moderate-severe, clip-compression cervical and thoracic SCI in the rat. Using high-throughput ELISA panels, we observed a clear level-specific difference in plasma levels of VEGF, leptin, IP10, IL18, GCSF, and fractalkine. Overall, cervical SCI had reduced expressions of both pro- and anti-inflammatory proteins relative to thoracic SCI, likely due to sympathetic dysregulation associated with higher level SCIs. However, contrary to the literature, we did not observe level-dependent splenic atrophy with our incomplete SCI model. This is the first study to compare the systemic plasma-level changes following cervical and thoracic SCI using level-matched and time-matched controls. The results of this study provide the first evidence in support of level-targeted intervention and also challenge the phenomenon of high SCI-induced splenic atrophy in incomplete SCI models.

This work describes the catalytic performances of attapulgite/ZSM-5 extrudate in comparison to conventional alumina-bound ZSM-5 extrudate in toluene methylation. The novel attapulgite/ZSM-5 extrudate is prepared by using natural clay attapulgite as binder which introduces mobile alkaline species and macropores to the extrudate. In contrast to alumina-bound extrudate, this novel extrudate shows significantly higher para-selectivity and stability. By using characterization techniques, including in-situ XRD, SEM, NH3 temperature programmed desorption (TPD), thermogravimetric analysis and n-hexane/cyclohexane physical adsorption, the catalytic performance improvement of attapulgite/ZSM-5 extrudate is correlated with the neutralization of Brønsted acid sites by mobile alkaline species during calcination and reaction process. Moreover, a higher para-selectivity was obtained over attapulgite-bound modified ZSM-5 extrudate. The strategy of extruding ZSM-5 catalysts with attapulgite as binder is facile and universal. Such method paves a new way for preparation of shaped toluene methylation catalyst with enhanced para-selectivity and stability.

Despite the allergen labeling of peanuts, reducing peanut allergenicity through material selection and breeding may provide an avenue to reduce the severity of allergy due to consumption of foods containing peanuts. This study’s objective is to select peanut lines (cultivar/variety) with lower potent allergenic peptides. One hundred and twenty-two peanut lines (harvested in 2015, New Mexico State, USA.), including 97 lines from the Core USDA- Griffin collections were used for SDS-PAGE analysis in order to find low allergen peanut lines. Eleven peanut lines (Coded MS-1~MS-11) were identified as having lower allergen (Ara h 1, Ara h 2 and Ara h 3) levels and were re-planted in 2016 for further analysis. One line named MS-7 was selected for lower Ara h 1 (8.5-9.5% of total protein) and Ara h 2 (4.2-6.6% of total protein) content in 2015 and 2016. Two-dimensional (2-D) gel electrophoresis (isoelectric focusing plus SDS-PAGE) was conducted to compare the protein (allergens) distributions of MS-7 and check line (MS-9). The 2-D results supported the SDS-PAGE analysis that MS-7 had lower quantities of Ara h 1 and Ara h 2, the two major peanut allergens. The identified peanut line (MS-7) has potential for processing into lower allergenic peanut food products.

(1) Background: Triple negative breast cancer (TNBC) is a distinct subgroup of breast cancer presenting high level of recurrence and neo-adjuvant chemotherapy is beneficial in its therapy management. Anti-PD-L1 immunotherapy improves effect of neo-adjuvant therapy in TNBC. (2) Methods: Immune-modulation and ferroptosis related R-packages were developed for integrative transcriptome to analyze transcriptome datasets: TNBC cells stimulated with ferroptosis inducers (GSE173905, GSE154425), breast tumors with clinical data (TCGA and METABRIC cohorts). Protein level validation was investigated through protein atlas proteome experiments. (3) Results: Erastin/RSL3 ferroptosis inducers up-regulate CD274 in TNBC cells (MDA-MB-231 and HCC38). In breast cancer, CD274 expression is associated to overall survival. Breast tumors presenting high expression of CD274 up-regulated some ferroptosis drivers associated to prognosis: IDO1, IFNG and TNFAIP3. CD274-ferroptosis-driver score computed on breast tumor transcriptome stratified patients on their prognosis: low score was observed in basal subgroup with higher level of recurrent risk scores: oncotypeDx, ggi and gene70 scores. In METABRIC cohort, CD274, IDO1, IFNG and TNFAIP3 were found overexpressed in TNBC subgroup. CD274-ferroptosis-driver score was found associated to overall survival independently of TNM classification and age diagnosis. Tumor expression of CD274, TNFAIP3, IFNG and IDO1 in biopsy of breast ductal carcinoma was confirmed at protein level (4) Conclusion: Ferroptosis inducers up-regulate PD-L1 in TNBC cells, known as effective target of immunotherapy in high risk early TNBC which received neo-adjuvant therapy. Basal and TNBC tumors highly expressed CD274 and ferroptosis drivers: IFNG, TNFAIP3 and IDO1. CD274-ferroptosis driver score is associated to prognosis and to the risk of recurrence in breast cancer. A potential synergy of ferroptosis inducers with anti-PD-L1 immunotherapy is suggested in recurrent TNBC.

The eco-efficiency of cultivated land use (ECLU) is an important indicator for the construction of ecological civilization in China. Exploring the spatiotemporal dynamic evolution of the ECLU is helpful for sustainable use of arable land, ensuring food security and ecological security. However, previous studies have mostly focused on the use of a slacks-based measure (SBM) model for ECLU measurement, ignoring the more accurate epsilon-based measure (EBM) model. Therefore, in this study, firstly, we explored the conceptual framework of ECLU, and then, based on the panel data of the counties in the region around Beijing and Tianjin from 2005 to 2020, we investigated the spatial and temporal evolution of ECLU by using the Super-EBM model, kernel density estimation method, and spatial Markov chain model. Results displayed: (1) From 2005 to 2020, the ECLU in the region around Beijing and Tianjin displayed an increasing state, but the average value was only 0.55. (2) The time evolution of the ECLU has gradually polarized, the internal gap has widened, but it tends to stabilize. (3) The ECLU in the region around Beijing-Tianjin was more inclined to keep it the same and there was a "club convergence" phenomenon, which was meaningfully affected by the background of neighboring areas. In the light of local conditions, the government should reasonably formulate the path to optimize the ECLU, strengthen the linkage with the surrounding cities, and bring into play the positive spillover effect.

Taste determination in small molecules is critical in food chemistry, but traditional experimental methods can be time-consuming. Consequently, computational techniques have emerged as val-uable tools for this task. In this study, we explore taste prediction using various molecular feature representations and assess the performance of different machine learning algorithms on a dataset comprising 2,601 molecules. The results reveal that GNN-based models outperform other ap-proaches in taste prediction. Moreover, consensus models that combine diverse molecular repre-sentations demonstrate improved performance. Among these, molecular fingerprints + GNN con-sensus model emerges as the top performer, highlighting the complementary strengths of GNNs and molecular fingerprints. These findings have significant implications for food chemistry research and related fields. By leveraging these computational approaches, taste prediction can be expedited, leading to advancements in understanding the relationship between molecular structure and taste perception in various food components and related compounds.

Bond Properties were performed on Ag-2.35Au-0.7Pd-0.2Pt-0.1Cu alloy wire with a diameter of 25 µm under different process parameters. Effects of electrical flaming off (EFO) current and EFO time on deformability of the free air ball (FAB) were investigated using scanning electron microscopy (SEM) as well as the effects of ultrasonic power and bonding force on the bond characteristic. The experimental results showed that, FAB grows from a preheated tip to a small ball, a regular ball and finally to a golf ball with increasing either the EFO current or the EFO time, and the FAB presented optimal shape at 25 mA and 650 μs. Moreover, a nonlinear relationship between FAB diameter and EFO time is obtained at the EFO current of 25 mA, which could be expressed by a cubic equation. Further, at a constant bonding force, as the ultrasonic power increased, the mashed ball diameter grew larger and larger, the capillary hole imprint became more and more obvious, and the tail width also increased larger and larger, and vice versa. The optimal ultrasonic power and bonding force are 70 mW and of 45 gf for ball bond and 90 mW and 75 gf for wedge bond, respectively. Finally, for all the bonded wire samples prepared under optimal process parameters, no ball and wedge bond lifts happened after destructive pull test, and full intermetallic compound coverage with perfect morphology occurred on the bond pad after ball shear test, which meant that the bonded wire samples have high bond strength, and hence improved the reliability of microelectronic products.

Airborne virus, such as COVID-19, caused pandemics all over the world. Virus-containing particles produced by infected individuals are suspended in the air for extended periods of time, actually results in viral aerosols and the spread of infectious diseases. Aerosol collection and detection devices are essential for limiting the spread of airborne virus diseases. This review provides an overview of the primary mechanisms and enhancement techniques for collecting and detecting airborne viruses. Indoor virus detection strategies for scenarios with varying ventilations are also summarized based on the excellent performance of existing advanced comprehensive devices. This review provides guidance for the development of future aerosol detection devices and aids in the control of airborne transmission diseases, such as COVID-19, monkeypox, and other airborne transmission viruses.

Quantum computers are invaluable tools to explore the properties of complex quantum systems. We show that dynamical localization of the quantum sawtooth map, a highly sensitive quantum coherent phenomenon, can be simulated on actual, small-scale quantum processors. Our results demonstrate that quantum computing of dynamical localization may become a convenient tool for evaluating advances in quantum hardware performances.

Anhydrobiosis is the state of life when cells get into waterless conditions and gradually cease their metabolism. In this study, we determined the sequence of events in Saccharomyces cerevisiae energy metabolism during processes of dehydration and rehydration. The intensities of respiration and acidification of the medium, the amounts of Phenyldicarbaundecaborane (PCB-) bound to yeast membranes, and the capabilities of cells to accumulate K+ were assayed using electrochemical monitoring system, and intracellular content of ATP was measured using bioluminescence assay. Mesophilic, semi-resistant to desiccation S. cerevisiae strain 14 and thermotolerant, very resistant to desiccation S. cerevisiae strain 77 cells were compared. After 22 h of drying it was possible to restore the respiration activity of very resistant to desiccation strain 77 cells, especially when glucose was available. PCB- binding also indicated considerably higher metabolic activity of dehydrated S. cerevisiae strain 77 cells. Electrochemical K+ content and medium acidification assays indicated that permeabilization of the plasma membrane in cells of both strains started almost simultaneously, after 8-10 h of desiccation, but semi-resistant strain 14 cells were longer keeping K+ gradient and stronger acidifying the medium. For both cells, the fast rehydration in water was less efficient compared to reactivation in the growth medium, indicating the need for nutrients for the recovery. Higher viability of strain 77 cells after rehydration could be due to the higher stability of their mitochondria.

This paper addresses investigation of guided-wave excitation by angle-beam wedge piezoelectric transducers in multi-layered composite plate structure with orthotropic symmetry of the material. The aim of the present study is to determine the capability of such actuators to provide the controlled generation of an acoustic wave of a desirable type with the necessary wavelength, propagation distance and directivity. The studied CFRP panel is considered as homogenous with effective elastic moduli and anisotropic structural damping, whose parameters were determined experimentally. According to the results of dispersion analysis and taking into account the data of wave attenuation in a highly damping CFRP composite, the two types of propagating waves A0 and S0 were considered theoretically and experimentally in the frequency range 10 - 100 kHz. Using the results of a previous study, the structure of the wedge actuator was reconstructed to develop its finite element (FE) model, and a modal analysis was carried out, which revealed the most intense natural vibration modes and their eigenfrequencies within the used frequency range. Both experimental and numerical studies of the generation, propagation, directivity and attenuation of waves in the orthotropic composite panel under study revealed the influence of the angular orientation of the actuator on the formation of wave patterns and allowed to determine the capabilities of the wave's directivity control.

In recent 40 years, the quantity and spatial patterns of farmland in Western Jilin have changed dramatically, which had great impact on soybean production potential. This study used one of the most advanced crop production potential models, the Global Agro-cological Zones model, to calculate the soybean production potential in Western Jilin based on meteorological, terrain, soil and land use data, and analyzed impact of farmland change on soybean production potential during 1975-2013. The main conclusions were the following. First, the total soybean production potential in Western Jilin in 2013 was 89.22 thousand tons. The production potential of eastern area was higher than the other areas of Western Jilin. Second, farmland change led to a growth of 33.03 thousand tons in soybean production potential between 1975 and 2000, and a decrease of 10.30 thousand tons between 2000 and 2013. Third, taking account of two situations of farmland change, the conversion between dryland and other categories, and the change of irrigation percentage led to the total soybean production potential in Western Jilin increased by 23.13 and only 2.87 thousand tons respectively between 1975 and 2000, and increased by 1.13 and 2.81 thousand tons respectively between 2000 and 2013. In general, the increase of soybean potential production was mainly due to grassland and woodland reclamation. The results of this study would be a good reference for protecting safe baseline of farmland, managing land resources, and ensuring continuity and stability of soybean supply and food security.

Cholangiocarcinoma is the most common primary malignant tumor of the bile duct. The current standard first-line treatment for advanced or metastatic cholangiocarcinoma is gemcitabine and cisplatin. However, few effective treatment choices exist for refractory cholangiocarcinoma, and additional therapeutic drugs are urgently required. Our previous work demonstrated that the ALDH isoform 1A3 plays a vital role in the malignant behavior of cholangiocarcinoma and may serve as a new therapeutic target. In this study, we found a positive correlation between ALDH1A3 protein expression levels and cell migration abilities of three cholangiocarcinoma cell lines, which was verified using ALDH1A3-overexpressing and ALDH1A3-knockdown clones. We also used ALDH1A3-high and ALDH1A3-low populations of cholangiocarcinoma cell lines from the Library of Integrated Network-based Cellular Signatures (LINCS) program and assessed the effects of ruxolitinib, a commercially available JAK2 inhibitor. Ruxolitinib had a higher cytotoxic effect when combined with gemcitabine. Furthermore, the nuclear translocation STAT1 and STAT3 heterodimers were markedly diminished by ruxolitinib treatment, possibly resulting in decreased ALDH1A3 activation. Notably, ruxolitinib alone or combined with gemcitabine led to significantly reduced tumor size and weight. Collectively, our studies suggest that ruxolitinib might suppress the ALDH1A3 activation through the JAK2/STAT1/3 pathway in cholangiocarcinoma, and trials should be undertaken to evaluate its efficacy in clinical therapy.

Multi-threshold image segmentation is a relevant research field in further higher-level image preprocessing and computer vision. This paper adopts the Bayesian Forecasting Evolutionary Algorithm (BFEA) for natural scenery image segmentation using multilevel thresholding. An update method for the prediction vector is designed for image segmentation. The design idea of the BFEA algorithm for multilevel thresholding is based on the basic principle of Evolutionary Computation, the probability distribution of promising solutions, and the Bayesian theorem. BFEA could effectively solve the curse of dimensionality. Extensive experiments have demonstrated that the proposed algorithm dominated the state-of-the-art population-based thresholding method in term of the quality of image, function fitness value, optimal threshold value, SSIM value, PSNR value, computation time, dimensionality issue and convergence rate. The proposed method is very effective for color image segmentation.

Purpose: The purpose of this study was to evaluate the dosimetric impact of multiple channels compared to a single channel in high dose rate (HDR) vaginal cuff brachytherapy (VCBT). Methods and materials: Sample plans of HDR VCBT from both single and multiple channel cylinders at 2.5, 3.0 and 3.5 cm in diameter were created and analyzed. The doses were prescribed either at the 0.5 cm depth with 5.5 Gy for 4 fractions or at the cylinder surface with 8.8 Gy for 4 frac¬tions, in various treatment lengths ranging from 3 to 8 cm. A 0.5 cm ring target volume called PTV_Eval was contoured for each plan and served as the target volume for dosimetric evaluation. Mean doses and the doses covering 90% (D90), 10% (D10), and 5% (D5) of PTV_Eval were calculated and compared. The same treatment lengths, same prescription regimens, same target volume contouring and same plan evaluation methods were repeated for the similar size single channel and multiple channel cylinders. Results: The mean doses of both regimens with the multi-channel cases (6.3 to 7.1 Gy) were comparable to single channel ones (6.4 and 7.5 Gy). The ranges of D90, D10 and D5 were from 3.654 to 5.04 Gy, 8.44 to 10.08 Gy and 8.84 to 10.86 Gy in the multi-channel cases, but from 5.36 to 5.76 Gy, 7.40 to 9.97 Gy and 8.16 to 11.93 Gy in the single channel cases, respectively. Conclusion: The single channel and multiple-channel cylinder deliver a similar mean dose, but with marked heterogeneity in D90, D5 and D10 for the same prescription dose and target volume. Multi-channel cylinders adequately cover the target volume, but given the heterogeneity, increased treatment time and cost are best suited for asymmetric target volumes.

Increased mitotic activity is associated with the genesis and aggressiveness of many cancers. To assess the clinical value of mitotic activity as prognostic biomarker, we performed a pan-cancer study on the mitotic network activity index (MNAI) constructed based on 54-gene mitotic apparatus network. Our pan-cancer assessment on TCGA (33 tumor types, 10,061 patients) and validation on other publicly available cohorts (23 tumor types, 9,209 patients) confirmed the significant association of MNAI with overall survival, progression-free survival and other prognostic endpoints in multiple cancer types, including Lower-Grade Gliomas (LGG), Breast Invasive Carcinoma (BRCA) and many others. We also showed significant association of MNAI with genetic instability, which provides a biological explanation of its prognostic impact at pan-cancer landscape. Futhermore, we found that patients with high MNAI benefit more from anti-PD-1 and Anti-CTLA-4 treatment. In addition, we demonstrated on LGG and BRCA that the multimodal integration of MNAI and the AI-empowerd Cellular Morphometric Subtypes (CMS) significantly improved the predictive power of prognosis compared to MNAI and CMS alone. Our results suggest that MNAI can be used as a potential prognostic biomarker for different tumor types toward different clinical endpoints, and multimodal integration of MNAI and CMS exceeds individual biomarker for precision prognosis.

Increasing global concern over COVID-19 has recently brought greater attention to studies due to the ease of person-to-person transmission and the current lack of effective antiviral therapy. Here, we proposed the application of the adverse outcome pathway (AOP) framework to support re-search on the pathogenesis of viral disease. We first constructed adverse outcome pathways (AOPs) applicable to COVID-19 management to understand whether the infection causes severe acute respiratory distress. Based on the AOP framework where mechanistic elucidation of the pathway from the interaction of chemicals (or viruses) to apical endpoints is represented, our COVID-19 AOP indicated that the molecular initiating event (MIE) was angiotensin-converting enzyme 2 (ACE2) interaction, and the key events (KEs) were the increased pro-inflammatory cytokines in immune cells, with increased mortality as an apical adverse outcome (AO). However, there is still limited information on the toxicity mechanisms of AOPs in COVID-19; therefore, detailed KEs and AOs on toxicity mechanisms will be required to fill these gaps in the data. This study demonstrated that the COVID-19 AOP framework is a suitable tool to design new drugs and to integrate crowded-sourced information for the battle against the COVID-19 pandemic.

Autonomous unmanned aerial vehicles (UAVs) require highly reliable navigation information. Generally, navigation systems with the inertial navigation system (INS) and global navigation satellite system (GNSS) have been widely used. However, the GNSS is vulnerable to jamming and spoofing. The terrain referenced navigation (TRN) technique can be used to solve this problem. In this study, to obtain reliable navigation information even if a GNSS is not available or the degree of terrain roughness is not determined, we propose a federated filter based INS/GNSS/TRN integrated navigation system. we also introduce a TRN system that combines batch processing and an auxiliary particle filter to ensure stable flight of UAVs even in a long-term GNSS-denied environment. As an altimeter sensor for the TRN system, we use an interferometric radar altimeter (IRA) to obtain reliable navigation accuracy in high altitude flight. In addition, a parallel computing technique with general-purpose computing on graphics processing units (GPGPU) is applied to process a high resolution terrain database and a nonlinear filter in real time on board. Finally, we verify the performance of the proposed system through software-in-the-loop (SIL) tests and captive flight tests in a GNSS unavailable environment.

Investigations into the properties of generalized effective temperature are conducted across arbitrary dimensions. Maxwell-Boltzmann distribution is displayed for one, two, and three dimensions, with effective temperatures expressed for each dimension. The energy density of blackbody radiation is examined as a function of dimensionality. Effective temperatures for non-uniform temperature distributions in one, two, three, and higher dimensions are presented, with generalizations extended to arbitrary dimensions. Furthermore, the application of generalized effective temperature is explored not only for linearly non-uniform temperature distributions but also for scenarios involving the volume fraction of two distinct temperature distributions. Finally, the effective temperature is determined for a cryogenic system supplied with both liquid nitrogen and liquid helium.

Commuting is a vital travel channel for college students throughout their higher education career; nevertheless, excessive commute time negatively impacts students’ school satisfaction, academic achievement, health, and quality of life. Meanwhile, few studies have explored students’ commute time, covering a large population and scope. Therefore, this study analyzes the dwelling type that influences college and graduate students’ school commute times in the Seoul Metropolitan Area, using data from the 2016 Household Travel Diary Survey. This study uses spatial data on housing development to classify five dwelling types (i.e., new town, housing site development, Seoul, Incheon, and Gyeonggi-do). A multiple linear regression model empirically analyses students’ household and personal characteristics. The results reveal that dwelling type significantly affects students’ commute time. Specifically, Students living in Seoul have a shorter commute to school than those living in new towns. Socioeconomic characteristics have less effect on college and graduate students' school commute time. This study discusses the problem of excessive commuting of college and graduate students in new towns.

A medium-Mn steel was processed by a route involving twin-roll strip casting, hot-rolling and quenching and partitioning with different quenching temperatures. The effects of quenching temperature on the microstructure and mechanical properties were studied. It was found primary martensite and retained austenite (RA) were obtained at the quenching temperature of 140–180 °C, while primary martensite, RA and secondary martensite were obtained when the quenching temperature was 220–300 °C. With increase in quenching temperature from 140 to 260 and to 300 °C, RA fraction first increased from 15.4% to 31.8% and then decreased to 16.6%. The sample at quenching temperature of 220 °C yielded the mechanical properties with yield strength of 992 MPa, tensile strength of 1159 MPa and total elongation of 20.4%. The superior mechanical properties were achieved by an optimum combination of high RA fraction (26.5 vol%), appropriate mechanical stability of RA and a small amount of secondary martensite.

This study aims to explore the differences between loess and landslide deposits, focusing on as-pects such as particle distribution, consolidation characteristics, and dynamic shear modulus. Through a series of experiments, the research reveals the similarities and differences between these two entities, yielding several key findings. Firstly, the process of landsliding disrupts the original structure of the loess, resulting in a reduction in porosity and a densification of the soil. This alteration in structural properties leads to significant disparities in physical attributes be-tween landslide deposits and undisturbed loess. Additionally, the movement and sorting of par-ticles during landslides cause variations in particle size distribution across different sections of the landslide deposits. Secondly, the landslide process not only alters the soil's structure but also changes the particle sizes within the loess. Particle wear and sieving result in the transformation of larger particles into smaller ones, leading to a more uniform particle size distribution. This shift in structure and particle size directly impacts the consolidation characteristics of landslide deposits, resulting in a substantial reduction in compression coefficient. Despite undergoing consolidation for decades, the middle and lower sections of landslide deposits still exhibit un-der-consolidation. Although the differences in the maximum dynamic shear modulus between loess and landslide deposits at varying depths are relatively minor, differences in porosity and consolidation characteristics lead to faster decay rates of the dynamic shear modulus for the lat-ter. The study also highlights a reduction in the water sensitivity of the maximum dynamic shear modulus within landslide deposits. Based on experimental results, a predictive model is pro-posed, utilizing A and m values to estimate the maximum dynamic shear modulus of both loess and landslide deposits. In conclusion, this research uncovers the impact of landslide processes on the structure and properties of loess, providing insightful understanding into the disparities between these two entities.

Silicon photonics is emerging as a competitive platform for electronic-photonic integrated circuits (EPICs) at the 2 µm wavelength band where GeSn photodetectors (PDs) have proven to be efficient PDs. Here, we present a comprehensive theoretical study of GeSn vertical p-i-n homojunction waveguide photodetectors (WGPDs) that have a strain-free and defect-free GeSn active layer for 2-µm Si-based EPICs. The use of a narrow-gap GeSn alloy as the active layer can fully cover entire the 2 µm wavelength band. The waveguide structure allows for decoupling the photon-absorbing path and the carrier-collection path, thereby allowing for simultaneous achievement of high-responsivity and high-bandwidth (BW) operation at the 2-µm wavelength band. We present the theoretical models to calculate the carrier saturation velocities, optical absorption coefficient, responsivity, 3-dB bandwidth, zero-bias resistance, and detectivity, and optimize this device structure to achieve highest performance at the 2-µm wavelength band. The results indicate that the performance of the GeSn WGPD has strong dependence on the Sn composition and geometric parameters. The optimally designed GeSn WGPD with 10% Sn concentration can give responsivity of 1.55 A/W, detectivity of 6.12×1010 cmHz½W-1 at 2 µm wavelength, and ~97 GHz BW. Therefore, this optimally designed GeSn WGPD is a potential candidate for silicon photonic EPICs offering high-speed optical communications.

In spite of unique structural, spectroscopic and redox properties, the synthetic variants of the planar, antiaromatic hexaphyrin (1.0.1.0.1.0) derivatives 2, has been limited due to the low yields and difficulty in access to the starting material. A chemical modification of the meso-substituents could be good alternative overcoming the synthetic barrier. Herein, we report a regio-selective nucleophilic aromatic substitution (SNAr) of meso-pentafluorophenyl group in rosarrin 2 with catechol. The reaction afforded benzodioxane fused rosarrin 3 as single product with high yield. The intrinsic antiaromatic character of the starting rosarrin 2 retained throughout the reactions. Clean, two electron reduction was achieved by treatment of 3 with SnCl2•2H2O affording 26pi-electron aromatic rosarrin 4. The synthesized compounds exhibited noticeable changes in photophysical and redox properties compared with starting rosarrin 2. .

OBJECTIVE: Although 3D-printed anatomic models are not new to medicine, the high costs and lengthy production times entailed have limited their application. Our goal was developing a new and less costly 3D modeling method to depict organ-tumor relations at faster printing speeds. METHODS: We have devised a method of 3D modeling using DICOM images. Coordinates are extracted at a specified interval, connecting them to create mesh-work replicas. Adjacent constructs are depicted by density variations, showing anatomic targets (ie, tumors) in contrasting color. RESULTS: An array of organ solid-tumor models were printed via Fused Deposition Modeling 3D printer at significantly less cost ($0.05/cm3) and time expenditure (1.73 min/cm3; both, p<.001). Printed models helped promote visual appreciation of organ-tumor anatomy and adjacent tissues. Our mesh-work 3D thyroidal prototype reproduced glangular size/contour and tumor location, readily approximating the surgical specimen. CONCLUSIONS: This newly devised mesh-type 3D printing method may facilitate anatomic modeling for personalized care and improve patient awareness during informed surgical consent.

Soil microbial fuel cells (sMFC) are a novel technique that use organic matters in soils as an alternative energy source. External resistance (ER) is a key factor influencing sMFC performance and, furthermore, alters the soil’s biological and chemical reactions. However, little information is available on how the microbial community and soil component changes in sMFC with different ER. Therefore, the effects of anodes of sMFC at different ER (2000 Ω, 1000 Ω, 200 Ω, 80 Ω and 50 Ω) were examined by measuring organic matter (OM) removal efficiency, trace elements in porewater and bacterial community structure in contaminated paddy soil. The results indicated that ER has significant effects on sMFC power production, OM removal efficiency and bacterial beta diversity. Moreover ER influences iron, arsenic and nickel concentration as well in soil porewater. In particular, greater current densities were observed at lower ER (2.4mA, 50Ω) compared to a higher ER (0.3mA, 2000Ω). The removal efficiency of OM increased with decreasing ER whereas it decreased with soil distance away from the anode. Furthermore, principal coordinate analysis (PCoA) revealed that ER may shape the bacterial communities that develop in the anode vicinity but have minimal effect on that of the bulk soil. The current study illustrates that lower ER can be used to selectively enhance the relative abundance of electrogenic bacteria and lead to high OM removal.

Colorectal cancer is third most common malignancy. For metastasis of rectal cancer, metastasis to skeletal muscle tissue is rare. In this case report, we describe a 51-year-old male patient with rectal cancer with neoadjuvant concurrent radiotherapy and chemotherapy followed by transanal total mesorectal excision with ileostomy. However, he had deep venous thrombosis of left leg after operation and skeletal muscle metastasis was diagnosed via tissue proof. Therefore, less possibility of metastasis increased included brain, duodenum, bone, and nervous system. The prognosis of metastasis to skeletal muscle is poor in contrast to liver or lung metastasis.

In this paper, an extendable fuzzy robust speed controller suitable for induction motor drive system was proposed. Firstly, the two-degrees-of-freedom (2DOF) robust control technology with feedforward control and disturbance elimination method was adopted. Upon parameter variation and load disturbance, the motor drive system could utilize a robust controller to generate compensation signals and reduce the impact on controlling performance of the motor drive system. The magnitude of the compensation signal was adjusted via the weighting factor. However, should a fixed weighting factor be adopted, system instability might be generated easily when time delay and saturation of control force occur. Based on the above, the smart method of extendable fuzzy theory (EFT) was adopted in this paper to adjust adequate weighting factors, where the controlling performance of the induction motor drive system could be improved accordingly. The method divided the speed difference between motor speed command and actual speed of the induction motor, and the variation rate for such speed difference into 20 regional categories. The correlation degree between the speed difference of actual feedback, variation rate for speed difference and each regional category was then calculated, where more suitable weighting factor was selected. Therefore, the proposed extendable fuzzy robust 2DOF controller with variable weighting factor designed will allow better performance for response in speed tracking and load regulation. Lastly, the simulation software Matlab/Simulink was applied to simulate the utilization of the controlling method proposed for the induction motor drive system. For both the response in speed tracking and load regulation, the simulation results proved that the extendable fuzzy robust speed controller proposed provided better controlling performance than the conventional robust controller.

This study explores the public library service evaluation domain through user-generated content on Google Maps, highlighting digital feedback's significant yet underexplored potential in understanding public library patronage across Taiwan's six major cities. Utilizing a mixed-methods research design, this study integrates Google Maps review content analysis with Social Network Analysis to delineate public perceptions and identify areas for service enhancement in public libraries. It innovatively leverages personal experiences extracted from over 60,000 Google Maps reviews to evaluate public library services in cities such as Taipei, New Taipei, Taoyuan, Taichung, Tainan, and Kaohsiung. The research taps into the National Library of Taiwan's National Library Statistics System to provide a robust analysis of library performance and user satisfaction, offering a novel perspective by emphasizing user-centric feedback from Google Maps as a primary data source. This approach provides quantitative data on library usage and geographic distribution and enriches our understanding of the qualitative experiences of library users. In analyzing the keywords from Google Maps reviews of public libraries, we categorize and interpret these under the three core LibQUAL+ dimensions—Affect of Service, Information Control, and Library as Place. The findings expose variances in perceived service quality among the cities, with Kaohsiung and Taichung receiving the highest accolades for service satisfaction. Simultaneously, the study identifies potential areas for improvement, particularly in cities with lower satisfaction ratings like Taipei. This personalized feedback illustrates the intimate relationship between public libraries and their communities, offering invaluable insights for policymakers and library management to enhance service delivery and user experience.

In this paper we present the exploration of indoor positioning technologies for UAVs, and navigation techniques for path planning and obstacle avoidance. The objective is to perform warehouse inventory tasks using a drone to search for barcodes or markers to identify the objects. For the indoor positioning techniques, we employ Visual-Inertial Odometry (VIO), Ultra-Wideband (UWB), AprilTag fiducial markers, and Simultaneous Localization and Mapping (SLAM). These algorithms encompass global positioning, local positioning, and pre-mapping positioning, comparing the merits and drawbacks of various techniques and trajectories. In UAV navigation, we combine SLAM-based RTAB-Map indoor mapping and navigation path planning of the ROS for indoor environments. This system enables precise drone positioning indoors and utilizes global and local path planners to generate flight paths that avoid dynamic, static, unknown, and known obstacles, demonstrating high practicality and feasibility. To achieve the warehouse inventory inspection, a reinforcement learning approach is proposed to recognize the markers by adjusting the UAV's viewpoint. We address several main problems in inventory management, including efficiently planning paths while ensuring a certain level of detection rate. Two reinforcement learning techniques, AC (Actor-Critic) and PPO (Proximal Policy Optimization), are implemented based on AprilTag identification. Testing is performed in both simulated and real-world environments, and the effectiveness of the proposed method is validated.Code is available at https://github.com/kellen080/Navigation and https://github.com/kellen080/Indoor\_Positioning.

This study demonstrates the efficacy of structured pruning and architectural fine-tuning on the YOLOv7-tiny model for eye state detection, emphasizing optimization for real-time applications. Structured pruning significantly reduced the model's complexity and storage size while maintaining high detection accuracy, as evidenced by stable precision, recall, and [email protected] metrics across iterations. Further fine-tuning adjusted the model's width and depth, optimizing efficiency and processing speed without compromising performance. These optimizations yielded YOLOv7-tiny variants that are both computationally efficient and accurate, suitable for resource-constrained environments. The findings highlight the critical role of model optimization in deploying effective neural networks for specific detection tasks in real-time scenarios.

Ras homolog enriched in brain (Rheb1 and Rheb2), a small GTPase, regulates neuronal activity and has drawn attention for its implications in cancer development, especially breast cancer. This study explores the multifaceted role of Rheb1 in cancer, elucidating its involvement in crucial cel-lular processes such as proliferation, apoptosis resistance, migration, invasion, metastasis, and inflammatory responses. Despite these acknowledged connections, a comprehensive understanding of the intricate interplay between Rheb1 and cancer remains elusive. This review consolidates cur-rent knowledge on the impact of Rheb1 on cancer hallmarks and examines the potential of Rheb1 as a therapeutic target in cancer treatment. The review underscores the need for a more profound comprehension of the molecular mechanisms underlying Rheb1-mediated oncogenic processes. Furthermore, the review emphasizes the exploration of Rheb1 inhibitors as a promising avenue for cancer therapy. This study, by bringing to light the complex associations between Rheb1/Rheb2 and cancer, delivers valuable insights to the scientific community. These insights are instrumental in guiding the identification of novel targets and advancing the development of effective therapeu-tic strategies for treating cancer.

We used a metal-organic chemical vapor deposition technique to synthesize a boron-doped reduced graphene oxide (B-rGO) material with various electrical characteristics, dependent on simultaneous reduction and doping procedures. The effect of the doping level on the B bonding in the reduced graphene oxide (rGO) layer controlled by the annealing temperature was investigated using X-ray photoelectron spectroscopy (XPS). The XPS data indicated that the B-rGO layer had a higher B concentration and a considerable number of O-B bonds as a result of the appreciable annealing temperature, which resulted in a decreased work function and Schottky contact between B-rGO and n-type Si. Owing to the higher proportion of B-C and B-C3 bonding in the B-rGO device than that in the rGO/Si device, the lower Schottky barrier height of the B-rGO/n-Si vertical junction photodetector resulted in a higher responsivity. This work suggests a facile method of B doping to alter the electrical properties of graphene materials.

In this study, robust composite solid electrolytes were developed and employed them to enhance the performance of Li-metal batteries significantly. The robust composite solid electrolytes are composed of a soft polymer, poly(ethylene oxide), a Li salt, bis(trifluoromethanesulfonyl)imide (LiTFSI), and super ionic conductive ceramic fillers such as Li1.5Al0.5Ti1.5(PO4)3 (LATP), and Li6.4La3Zr1.4Ta0.6O12 (LLZTO). The main goal of this study is to enhance the electrochemical stability and ionic conductivity. The ionic conductivities of the composite solid electrolytes were found to be 2.08 × 10-4 and 1.64 × 10-4 S cm-1 with the introduction of LATP and LLZTO fillers, respectively. The results prove that the fabricated solid electrolyte was electrochemical stable at voltage exceeding 4.25 V vs. Li/Li+. The internal resistance of the solid electrolyte significantly reduced as compare to gel electrolyte. This reduction can be attributed owing to the alleviation of bulk electrolyte, charge-transfer, and interfacial electrolyte/electrode impedance. When LiFePO4 cathode sheets are coated with a composite solid electrolyte containing LATP powders, the resulting Li-metal battery displays high capacity at 5 C (with a capacity retention of 65.2% compared to the original capacity at 0.2 C) as well as superior cyclic stability and excellent Coulombic efficiency (&gt; 99.5%, over 200 cycles). These results confirm that the composite solid electrolyte acts as a protective layer which have ability to prevent the growth of Li dendrites. Consequently, the fabricated electrolyte configuration can be engineered to enable high energy/power density and electrochemical stable cyclability in Li-metal batteries.

Group IV alloys of GeSn have been extensively investigated as a competing material alternative in short-wave to mid-infrared photodetectors (PDs). The relatively large defect densities present in GeSn alloys are the major challenge in developing practical devices, owing to the low-temperature growth and lattice mismatch with Si or Ge substrates. In this paper, we comprehensively analyze the impact of defects on the performance of GeSn p-i-n homojunction PDs. We first present our theoretical models to calculate various contributing components of the dark current including minority carrier diffusion in p- and n-regions, carrier generation-recombination in the active intrinsic region, as well as the tunneling effect. We then analyze the effect of defect density in the GeSn active region on carrier mobilities, scattering times and the dark current. A higher defect density increases the dark current, resulting in reduction in detectivity of GeSn p-i-n PDs. In addition, at low Sn concentrations, defect-related dark current density is dominant, while the generation dark current becomes dominant at a higher Sn content. These results point to the importance of minimizing defect densities in the GeSn material growth and device processing, particularly for higher Sn compositions necessary to expand the cutoff wavelength to mid- and long-wave infrared regime. The study provides more of realistic expectations and guidelines for evaluating GeSn p-i-n PDs as a competitor to the III-V and II-VI-based infrared PDs currently on the commercial market.

In this paper, the quality change of scallop (Patinopecten yessoensis) in the process of anhydrous storage and transportation after cold-acclimation and induced dormancy was studied, and the regulation mechanism of quality degradation in the storage and transportation in the process of gradient chilling stress and drying exposure was further explored. The results show that while being transferred from anhydrous storage and transportation from hydrous storage and transportation, the breathing pattern of scallops were changed from aerobic to anaerobic. Their gill filaments were altered, and the apparent vitality was constantly declining, which was reflected by the edge shrinkage of pallium and the direct proportion between the edge reduction rate and the stimulus response period. After being in the anhydrous state for 4d, the AEC value dropped to 67.59%. At this time, if they were under hydration again, they would resume a nice growth state. By virtue of proteomics, it was revealed from the analysis that cold acclimation and dry exposure mainly led to changes in biological functions and pathways such as mitochondrial inner membrane and ATP hydrolysis activity. In addition, it can be seen from the functional annotation and enrichment analysis of the metabolite KEGG that cold acclimation promoted the purine metabolism of scallops, while dry exposure inhibited the metabolism of saturated fatty acids. Besides, in this study, the infrared sensing mode was used for the first time to record the heart rate changes of the scallops during circulation, which provides feasibility for the nondestructive vitality monitoring of Lamellibranchia.

A biocatalytic system that could produce bioactive resveratrol poly-glucosides using sucrose as a low-cost source of UDP-glucose donors and amylosucrase DgAS from Deinococcus geothermalis was developed in this study. This system boasts several advantages, including fast and direct conversion of substrates to products, thermostable, and regio-stereospecific, and effectiveness in vitro and in vivo at 40°C. With a success rate of around 97.0% in a short period in vitro and 95.0% in vivo, resveratrol-O-glucosides showed exciting outcomes in cosmetic activities, such as antioxidant, anti-inflammatory, anti-aging, and whitening effects when tested with Raw 264.7, B16, and HS68 cell lines. DgAS is recognized as an important biocatalyst due to its higher thermostability, effectiveness, and specificity among all known amylosucrases (ASases) in the production of poly-glucosides in a chain of polyphenols, like resveratrol, making it an ideal candidate for industrial use to cost-effective production of cosmetic items.

In this paper, we consider a reconfigurable intelligent surface (RIS)-assisted integrated satellite-high altitude platform-terrestrial networks (IS-HAP-TNs) that can improve network performance by exploiting HAP's stability and RIS's reflection. Specifically, the reflector RIS is installed on the side of HAP to reflect signals from the multiple ground user equipments (UEs) to the satellite. To aim at maximising system sum rate, we jointly optimize the transmit beamforming matrix at the ground UEs and RIS phase shift matrix. Due to the limitation of the unit modulus of the RIS reflective elements constraint, the combinatorial optimization problem is difficult to tackle it effectively by traditional solving methods. Based on this, this paper studies deep reinforcement learning (DRL) algorithm to achieve online decision making for this joint optimization problem. In addition, it is verified through simulation experiments that the proposed DRL algorithm outperforms the standard scheme in terms of system performance and execution time, and higher computing speed, making real-time decision making truly feasible。

The main goal of this paper is to present results of preliminary archaeological research on the south side of Lake Issyk-Kul in Kyrgyzstan. We test the hypothesis that agropastoral land use changed over four millennia from the Bronze Age through the ethnographic Kirghiz period due to economic, socio-political, and religious changes in the prehistoric and historic societies of this region. Our research objectives are to: (1) describe and analyze survey results from Lower Kizil Suu Valley; (2) discuss the results of radiometric and archaeobotanical samples taken from three stratigraphic profiles from three settlements from the Juuku Valley, including these chronological periods: the Wusun period (200 to 400 CE), the Qarakhanid period (1100 to 1200 CE), and the ethnographic Kirghiz period (1700 to 1900 CE); and (3) conduct preliminary GIS spatial analyses on the Iron Age mortuary remains (Saka and Wusun period). This research emerges out of the first archaeological surveys conducted in 2019 - 2021 and includes the Lower Kizil Suu alluvial fan; it is an initial step toward developing a model for agropastoral land use for upland valleys of the Inner Tian Shan Mountains.

Background: Gastric cancer (GC) is one of the leading malignancy diseases worldwide, especially in Asian. CAST is a potential oncogene in GC carcinogenesis process. The character of macrophage infiltration in GC microenvironment was also unaddressed. Methods: We first applied machine searching in gene candidate evaluation of GC. CAST expression was analyzed via the Human Protein Atlas (HPA) and Gene Expression Profiling Interactive Analysis 2 (GEPIA2) database. Protein-protein interaction (PPI) network was downloaded from STRING. We investigated the impact of CAST on clinical prognosis using Kaplan-Meier plotter. The correlations between CAST and Lgr5 and macrophage infiltration in GC was surveyed via TIMER 2.0. Finally, GeneMANIA was also used to evaluate the possible functional linkage between genes. Results: After machine-assisted searching, CAST expression was found signicant difference in the overall survival of GC patients. STRING revealed CAST related proteomics and transcriptomics associations, mainly about CAPN family. Moreover, CAST significantly impacts the prognosis of GC from other datasets validation. Notably, high CAST expression was correlated with worse overall survival in GC patients (hazard ratio = 1.59; logrank P = 9.4 x 10-8). CAST and Lgr5 expressions were both positively correlated with WNT 2 and WNT 2B. Among GC patients in several datasets, CAST and macrophage infiltration evaluated together showed no obvious trend toward poor clinical overall survival. Conclusion: CAST plays an important role in GC clinical prognosis and is associated with WNT 2/WNT 2B/Lgr5. Our study denmostrated that CAST in GC overall survival is regulated by macrophage infiltration.

This study aimed at the investigation of the effect of substrate preheating on residual stress in laser powder bed fusion using a physics-based analytical model. In this study, an analytical model is proposed to predict the residual stress through the calculation of preheating affected temperature profile and thermal stress. The effect of preheating is super-positioned with initial temperature in the modeling of temperature profile using a moving heat source approach; the resultant temperature gradient is then employed to predict the thermal stress from a point body load approach. If the thermal stress exceeds the yield strength of the material, then the residual stress under cyclic heating and cooling will be calculated based on the incremental plasticity and kinematic hardening behavior of metal. IN718 is used as a material example to pursue this investigation. To validate the predicted residual stress, experimental measurements are conducted using X-ray diffraction on IN718 samples manufactured via laser powder bed fusion under different process conditions. Results showed that preheating of the substrate could reduce the residual stress in an additively manufactured part due to the reduction in temperature gradient and resultant shrinkage stresses. However, the excessive preheating could have an opposite impact on residual stress accumulation. Moreover, the results confirm that the proposed model is a valuable tool for the prediction of residual stress- eliminating the costly experiments and time-consuming finite element simulations.

Rheumatoid arthritis (RA) is a complex disease triggered by the interaction between genetics and environment, especially through the shared epitope (SE) and cell surface calreticulin (CSC) theory. However, the available evidence shows that genetic diversity and environmental exposure cannot explain all the clinical characteristics and heterogeneity of RA. In contrast, recent studies demonstrate that epigenetics play important roles in the pathogenesis of RA, especially DNA methylation and histone modification. DNA methylation and histone methylation are involved in innate and adaptive immune cell differentiation, and migration, proliferation, apoptosis, and mesenchymal characteristics of fibroblast-like synoviocytes (FLS). Epigenetic-mediated regulation of immune-related genes and inflammation pathways explains the dynamic expression network of RA. In this review, we summarized the comprehensive evidence to show that methylation of DNA and histones is significantly involved in the pathogenesis of RA and could be applied as a promising biomarker in the disease progression and drug response prediction. We also explained the advantages and challenges of the current epigenetics research in RA. In summary, epigenetic modules provide a possible interface, through which genetic and environmental risk factors connect to contribute to the susceptibility and pathogenesis of RA. Additionally, epigenetic regulators provide promising drug targets to develop novel therapeutic drugs for RA. Finally, DNA methylation and histone modifications could be important features for providing a better RA subtype identification, to accelerate personalized treatment and precision medicine.

Wave energy converter (WEC) arrays deployed in coastal regions may create physical disturbances potentially resulting in environmental stresses. Presently, limited information is available on the nature of these physical disturbance or the resultant effects. A quantitative Spatial Environmental Assessment Tool (SEAT) for evaluating potential effects of wave energy converter (WEC) arrays on nearshore hydrodynamics and sediment transport is presented for the central Oregon coast (USA) through coupled numerical model simulations of an array of WECs. Derived climatological wave conditions were used as inputs to the model to allow for the calculation of risk metrics associated with various hydrodynamic and sediment transport variables such as maximum shear stress, bottom velocity, and change in bed elevation. The risk maps provided simple, quantitative, and spatially-resolved means of evaluating physical changes in the vicinity of a hypothetical WEC array in response to varying wave conditions. Near-field risk of sediment mobility was determined to be moderate in the lee of the densely spaced array, where the potential for increased sediment deposition could result in benthic habitat alteration. Modifications to the nearshore sediment deposition and erosion patterns were observed near headlands and topographic features, which could have implications for littoral sediment transport. The results illustrate the benefits of a risk evaluation tool for facilitating coastal resource management at early market marine renewable energy sites.

The development of printing technologies has enabled the realization of electric circuit fabrication on flexible substrate. However, the current technique remains restricted to single-layer patterning. In this paper, we demonstrate a fully solution-processable patterning approach for multi-layer circuits using a combined method of laser sintering and ablation. Selective laser sintering of silver (Ag) nanoparticle-based ink is applied to make conductive patterns on a heat-sensitive substrate and insulating layer. The laser beam path and irradiation fluence are controlled to create circuit patterns for flexible electronics. Microvia drilling using femtosecond laser through the polyvinylphenol-film insulating layer by laser ablation, as well as sequential coating of Ag ink and laser sintering, achieves an interlayer interconnection between multi-layer circuits. The dimension of microvia is determined by a sophisticated adjustment of laser focal position and intensity. Based on these methods, the flexible electronic circuit with chip-size-package light-emitting diodes was successfully fabricated and demonstrated with functional operations.

Background Successful treatment for patients with metastatic colorectal cancer who failed to response to first-line treatment has been a challenge due to their low response rate for later-line treatment and poor progression free survival and overall survival. The application of dendritic cell-cytokine-induced killer cells (DC-CIK) immunotherapy combined with conventional treat-ment, either surgical resection or chemotherapy, showed improvement in survivals in first-line treatment for metastatic colorectal cancer. In this retrospective study, we aimed to evaluate the benefit of dendritic cell-cytokine-induced killer cells (DC-CIK) immunotherapy for patient with refractory metastatic colorectal cancer. Methods A total of 20 patients with refractory metastatic colorectal cancer receiving cell-cytokine-induced killer cells (DC-CIK) immunotherapy were enrolled to this study. Among these patients, 11 patients responded to the treatment and the remaining 9 patients did not. All patients were followed for at least one years and the determination of treatment response was mainly based on image study at 6 months after the completion of treatment. Data were analyzed with Kaplan-Meier method and log-rank test. Results The treatment response rate of the study group is 55% (11/20). The median progression free sur-vival (PFS) and median overall survival (OS) of responsive patients was 7 months and 12 months, respectively. The median overall survival of irresponsive patients was 9.5 months. Four responsive patients received subsequent metastectomy or cytoreduction plus hyperthermic in-traperitoneal chemotherapy surgery (CRS + HIPEC). Conclusion DC-CIK cell-based immunotherapy may provide benefits for patients with refractory mCRC with improved response rate and progression free survival.

γδT have functions of innate and adaptive immunity, with the potential to induce durable responses while being well-tolerated, with limited adverse effects, making it attractive as a tool for immunotherapy. γδT faces challenges as a frontline tool in clinical oncology, with limited response rates due to difficulties in reaching tumor sites with consistent cytotoxic activity and strength. Modulated Electro-hyperthermia (mEHT) is a loco-regional treatment, whereby energy-transmission from an electromagnetic field selectively targets the plasma membrane of tumor cells, inducing apoptosis and activating immune cells. We hypothesized that mEHT could enhance therapeutic effects by drawing γδT to tumor cells, while also rendering tumor cells to be more susceptible to cytotoxic effects. In this study, NOD/SCID mice harboring subcutaneous human HepG2 tumors were treated with intravenous injections of γδT after mEHT treatment. This method increased infiltration of γδT into the tumor site, significantly inhibiting tumor growth as compared to monotherapy with either modality. These data suggest that γδT could mediate a potent anti-tumor effect when combined with mEHT, and provide a strong rationale for combining these modalities in clinical application for cancer treatment.

Cadmium(Cd) is a highly toxic and cumulative environmental pollutant. Siderophores are heavy metal chelators with high tolerance to heavy metals such as Cd. Furthermore, ryegrass (Lolium perenne L.) has potential remediation capacity for soils contaminated by heavy metals. Consequently, using ryegrass alongside beneficial soil microorganisms that produce siderophores may be an effective means to remediate soils contaminated with Cd. In this study, Bacillus strains WL1210 and CD303 that were previously isolated from the rhizospheres of Nitraria tangutorum in Wulan and Peganum harmala L in Dachaidan, respectively, both arid sandy environments, were evaluated for heavy metal pollution mitigation. The results indicate that both strains of Bacillus exhibit favorable biological characteristics and stress resistance, and they are both producers of siderophores, which promote the growth of ryegrass under Cd stress.

The effects of chemical composition and solidification rate on the solidification behavior of high-Cr white irons were investigated through directional solidification. Increasing the solidi-fication rate in hypoeutectic alloys caused the finer dendrite arm spacing as expected. The eutec-tic structure which formed in the interdendritic region comprised of M7C3 and austenite, how-ever, secondary dendrite arms of hypoeutectic alloys contained a few M7C3 particles that solidi-fied prior to the eutectic structure. The transition from cellular to dendritic solidification oc-curred at a solidification rate between 50 µm/s and 100 µm/s in a near eutectic alloy. In the near eutectic alloy with cellular solidification, a directionally arrayed in-situ composite of M7C3/austenite formed within the cell. Speckle-like feature appeared in the intercellular region due to M23C6 carbide precipitation during subsequent cooling after freezing. Like dendrite arm spacing in hypoeutectic alloys, the inter-speckle spacing and the inter-fibre spacing became finer with increasing solidification rate in the cellular solidification range.

Blocking the interaction of the SARS-CoV-2 spike protein with the human angiotensin-converting enzyme II (hACE2) protein serves as a therapeutic strategy for treating COVID-19. Traditional Chinese medicine (TCM) treatments containing bioactive products could alleviate the symptoms of severe COVID-19. However, the emergence of SARS-CoV-2 variants has complicated the process of developing broad-spectrum drugs. As such, the aim in this study was to explore the efficacy of TCM treatments for SARS-CoV-2 variants through targeting the interaction of the viral spike protein with the hACE2 receptor. The antiviral activity was systematically evaluated using a pseudovirus system. Scutellaria baicalensis was found to be effective against SARS-CoV-2 infection through affecting the interaction of viral spike protein with the hACE2 protein. The active molecules of S. baicalensis were identified and analyzed. Baicalein and baicalin, a flavone and a flavone glycoside, respectively, found in S. baicalensis, exhibited strong inhibitory activities, targeting the viral spike protein or hACE2 protein, respectively. Under optimized conditions, virus infection was inhibited by 98% via baicalein-treated pseudovirus and baicalin-treated hACE2. In summary, we identified the potential SARS-CoV-2 inhibitors of the interaction of the Omicron spike protein and hACE2 receptor from S. baicalensis. Future studies on the therapeutic application of baicalein and baicalin against SARS-CoV-2 variants are needed.

The pollution caused by nitrogen dioxide is a major environmental problem in China. This study introduces a new type of atmospheric trace gas remote-sensing instrument, an airborne fiber imaging spectrometer. This spectrometer has a spectral range of 300–410 nm and works in push-broom mode with a 30° field of view on a flight path. Flight experiments were conducted on December 30, 2022 and January 5, 2023, covering heavily polluted areas of east of Beijing and Tangshan. This equipment obtained the density distribution of NO2 over the flight area. The results showed that pollution was mainly concentrated in the Caofeidian area and at the power station in the north, and the main source of pollution was anthropogenic. Satellite and airborne data near the pollution points were compared, and the two datasets showed a positive correlation with a correlation coefficient of 0.78 and 0.7, on the two days, respectively. This study demonstrates the capability of an airborne fiber imaging spectrometer for NO2 regional emission remote sensing and identifying the pollution points.

The utilization of smart IoT devices, commonly referred to as digital twins, is aimed at the digitalization of human knowledge within aquaculture processes. This involves the incorporation of cutting-edge technologies, including information-based management with big data and modeling, to automate machinery and gain comprehensive insights into the aquaculture environment and fish farm conditions. The ultimate objective is to empower farmers to make informed decisions, furnishing them with objective data to enhance their capacity in monitoring and controlling the various factors impacting fish production. As a result, farming decisions can be fine-tuned to enhance fish health and optimize farm output. In the context of large and modern aquaculture farms, technological innovation becomes imperative to automate processes, minimize labor requirements, and streamline fish feeding operations. Remarkably, the literature currently offers limited discussions on the digital transformation of aquaculture through the application of digital twin methodologies. A prior study underscores the critical influence of factors such as market prices and fish survival rates on the profitability of offshore caging culture. In this study, we embark on an analysis of the prerequisites for establishing a digital twin infrastructure tailored to intelligent fish feeding management. This infrastructure is designed to facilitate the integration of technology and data-driven decision-making, ultimately enhancing the efficiency of fish feeding processes. The proposed architecture for the fish feeding digital twin encompasses various digital twin components, encompassing water quality forecasting, fish population assessment, fish metrics estimation, fish feed prediction, and evaluation of fish feeding intensity. Furthermore, we optimize the daily fish feeding process through reinforcement learning algorithms. Finally, we implement a cloud-based AIoT system that provides the runtime environment for executing digital twins and controlling our intelligent fish feeding machinery. Experimental findings underscore the efficacy of the proposed digital twin system in significantly improving traditional fish feeding processes, notably in terms of reducing food costs and labor requirements.

The ZIPs (ZRT/IRT-like proteins) play critical roles in the absorption, transport, and intracellular balance of metal ions essential for various physiological processes in plants. However, little is known about the pan-genomic characteristics and properties of ZIP genes in cucumber (Cucumis sativus L.). In this study, we identified 10 CsZIP genes from the pan-genome of 13 C. sativus accessions. Among them, only CsZIP10 showed no variation in protein sequence length. We analyzed the gene structure, conserved domains, promoter cis-elements, and phylogenetic relationships of these 10 CsZIP genes derived from "9930". Based on phylogenetic analysis, the CsZIP genes were classified into three branches. Amino acid sequence comparison revealed the presence of conserved histidine residues in the ZIP proteins. Analysis of promoter cis-elements showed that most promoters contained elements responsive to plant hormones. Expression profiling in different tissues showed that most CsZIP genes were expressed at relatively low levels in C. sativus leave, stem, and tendril, and CsZIP7 and CsZIP10 were specifically expressed in root, indicating their potential involvement in the absorption and transport of metal ions. Transcriptomic data indicated that these 10 ZIP genes displayed responses to both downy mildew and powdery mildew, and CsZIP1 were significantly downregulated after both salt and heat treatments. In conclusion, this study deepens our understanding of the ZIP gene family and enhances our knowledge of the biological functions of CsZIP genes in C. sativus.

Many quantum dot light-emitting diodes (QLEDs) utilize ZnO nanoparticles (NPs) as an electron injection layer (EIL). However, the use of ZnO NP ETL material often results in charge imbalance within the quantum dot (QD) emitting layer (EML) and exciton quenching at the interface of QD EML and ZnO NP EIL. To overcome these challenges, we introduced an Arginine (Arg) interlayer (IL) onto the ZnO NP EIL. The Arg IL elevated the work function of ZnO NPs, thereby suppressing electron injection into the QD, leading to improved charge balance within the QDs, Additionally, the inherent insulating nature of the Arg IL prevented direct contact between QDs and ZnO NPs, reducing exciton quenching and consequently improving device efficiency. The inverted QLED (IQLED) utilizing a 20-nm-thick Arg IL on ZnO NP EIL exhibited a 2.22-fold increase in current efficiency and a 2.28-fold increase in EQE and compared to an IQLED without an IL. Likewise, the IQLED with a 20-nm-thick Arg IL on ZnO NP EIL demonstrated a 1.34-fold improvement in current efficiency and a 1.36-fold increase in EQE compared to IQLED with a 5-nm-thick PEI IL on ZnO NPs.

Background and objectives: TSC1 is a crucial component of the mTOR pathway, impacting cell growth, proliferation, and autophagy, while TSC2 is a tumor suppressor gene that regulates cell growth and is associated with the mTOR signaling pathway. In the present study, we analyzed TSC1 and TSC2 mRNA expression levels in rectal cancer, and evaluated the clinicopathological and prognostic characteristics of TSC1 and TSC2. Materials and Methods: TSC1 and TSC2 mRNA expression was examined in various cancer types. We further evaluated survival to determine the prognostic significance of TSC1 and TSC2 mRNA in CRC using The Cancer Genome Atlas (TCGA) data. Results: The study focused on rectal cancer, as it exhibited the most promising results. The patients were split into two subgroups, each comprising 50% of the total, based on the TSC gene expression levels. This division was made to assess the clinical characteristics associated with the expression of TSC1 and TSC2 genes. In the study, lower TSC1 expression was linked to venous invasion in rectal cancer patients, and there was also a related trend with lymphatic invasion, although it didn't reach statistical significance. Lower TSC2 expression was observed in younger patients and had some associations with sex and M stage, but these correlations were not statistically significant. When it came to survival analysis, TSC1 expression did not significantly impact overall survival, while higher TSC2 expression was associated with a poorer prognosis in rectal cancer. To enhance our comprehension, additional research, especially in larger case studies, is needed to explore the molecular mechanisms and clinical characteristics of TSC genes in colorectal cancer.

Background Acute kidney injury (AKI) is a common comorbidity in the intensive care unit (ICU), with higher mortality rate among those who receive continuous renal replacement therapy (CRRT). This study aimed to investigate the association of white blood cell (WBC) levels with all-cause mortality in AKI patients undergoing CRRT. Method We conducted a post hoc analysis of ICU patient data from multiple centers in Korea. First, the levels of WBCs were classified into four groups based on quartiles. Second, the relationship between different WBC levels and mortality was investigated with the Kaplan-Meier (K-M) survival curves, Cox proportional hazards model, and generalized additivity model (GAM). Finally, we used multiple imputation to avoid bias caused by non-randomized missing data. The endpoints were short-term (28 days) and long-term (90 days) mortality. Result In our analysis, a total of 1,100 ICU patients were included. Among them, 670 (60.90%) and 781 (71.00%) died within 28 and 90 days, respectively. K-M survival curves showed that patients with the lowest WBC levels had the highest risk of mortality for both outcomes. Adjusted multivariate Cox regression analysis confirmed that compared with the reference level (quartile 2), low WBC levels increased the risk of both 28-day mortality (quartile 1, HR = 1.43, 95% CI: 1.13–1.83, P = 0.004) and 90-day mortality (quartile 1: HR = 1.32; 95% CI: 1.05-1.66, P = 0.016). GAM analysis showed a non-linear, U-shaped relationship between pre-CRRT WBC levels and all-cause mortality (non-linear P < 0.05). Conclusion The baseline WBC level is an independent predictor of prognosis for ICU patients receiving CRRT. Patients in the lowest WBC quartile had the highest risk of all-cause mortality. These results provide further evidence that early observation and intervention may have a prognostic value for these high-risk patients.

Nickel is widely used in industrial processes and plays a crucial role in many applications. However, most of the nickel resource mainly exists as nickel oxide in laterite nickel ore with complex composition, resulting in difficulty in upgrading the nickel content using physical separation methods. In this study, high-grade ferronickel concentrates were obtained through a carbothermal reduction and magnetic separation using laterite nickel ore and anthracite as raw materials. The effects of different types of additives (CaF2, Na2SO4 and H3BO3), carbon ratio (nc/no in metal oxides) and grinding time on the recoveries and grades of ferronickel concentrates were experimentally investigated, along with the microstructure and chemical composition of the products. CaF2 was proved to be the primary active additive in the aggregation and growth of the ferronickel particles, and the improvement of the grade of the product. Under the optimal conditions of CaF2 addition of 12 wt.%, carbon ratio of 1.4, and grinding time of 240 s, high-grade magnetically separable ferronickel concentrate with nickel grade 8.93 wt.% and iron grade 63.96 wt.% was successfully prepared. This work presents a practical method for the highly efficient recovery and utilization of iron and nickel from low-grade laterite nickel ore, contributing to the development of strategies for the sustainable extraction and utilization of nickel resources.

Our image recognition system mainly judges whether the left upper limb in the image is the left upper limb or the right upper limb through our deep learning model in the image. The doctor then could give the correct surgical position. From the experimental results, it could be found that the precision rate and recall rate of the intelligent image recognition system proposed in this paper for preventing the upper limb dislocation surgery could reach 98% and 93%, respectively. It proved that our artificial intelligent image recognition system, AIIRS, could indeed assist orthopedic surgeons to prevent the occurrence of left and right dislocation in upper limb surgery. At the same time, this paper also completes the IRB application approval through the prototype experimental results and will conduct the second phase of human trials in the future. It showed that the research results of this paper will be of great benefit and research value to upper limb orthopedic surgery.

The E-learning system has achieved great development after the pandemic. In this work, we proposed three artificial intelligence-based enhancements to our linguistic interactive E-learning system from different aspects. Compared with the original phonetic transcription exam system, our enhancements include an MFCC+CNN-based disordered speech classification module, a Transformer-based Grapheme-to-Phoneme converter, and a Tacotron2-based IPA-to-Speech speech synthesis system. This work not only provides a better experience for the users of this system but also explores the utilization of artificial intelligence technologies in the E-learning field and linguistic field.

Our image recognition system mainly judges whether the left upper limb in the image is the left upper limb or the right upper limb through our deep learning model in the image. The doctor then could give the correct surgical position. From the experimental results, it could be found that the precision rate and recall rate of the intelligent image recognition system proposed in this paper for preventing the upper limb dislocation surgery could reach 98% and 93%, respectively. It proved that our intelligent image recognition system could indeed assist orthopedic surgeons to prevent the occurrence of left and right dislocation in upper limb surgery. At the same time, this paper also completes the IRB application approval through the prototype experimental results and will conduct the second phase of human trials in the future. It showed that the research results of this paper will be of great benefit and research value to upper limb orthopedic surgery.

Andrographis paniculata leaves have been widely used in traditional medicine due to their rich content of phenolic compounds. In this study, we evaluated the total phenolic and flavonoid content of Andrographis paniculata leaf extracts (ALE), as well as its antioxidant activities against DPPH, ABTS, and hydrogen peroxide radicals. Additionally, we conducted cell viability assays, RT-PCR, and western blot analysis to investigate the biochemical effects of ALE on UVB-induced HaCaT cells. Our results revealed that ALE exhibited a high concentration of polyphenols and flavonoids, which were associated with potent abiotic antioxidant properties. Furthermore, ALE treatment effectively abrogated the damage caused by UVB radiation on key molecules such as hyaluronan synthase 1, Aquaporin 3, and loricrin in HaCaT cells. ALE also demonstrated the ability to reduce the overactivation of mitogen-activated protein kinases (MAPKs) and the expression of pro-inflammatory cytokines, including interleukin-6 and interleukin-1β in UVB-induced HaCaT cells. Additionally, ALE positively influenced the peroxisome proliferator-activated receptor alpha in these cells. Overall, our findings highlight the antioxidant and anti-inflammatory effects of ALE, as well as its significant role in modulating skin barrier functions. These results contribute to the growing body of evidence supporting the therapeutic potential of ALE in skincare and dermatological applications.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

In the context of digital empowerment, the digital literacy level of tea farmers has a significant impact on the intelligent development and transformation of the tea industry. This study extends the original model of UTAUT theory by introducing Personal innovativeness theory and Self-efficacy theory, and constructs a new model to explore the influencing factors of moderate scale tea farmers' digital literacy improvement behavior. There are a total of 22 research hypotheses. Using structural equation modeling and collecting questionnaire data for analysis, the following research results were obtained: (1) Performance expectancy, social influence, effort expectancy, personal innovativeness and self-efficacy all significantly positively affect the willingness of tea farmers to improve their digital literacy, and then according to the path coefficient, in descending order, social influence (0.226)>self-efficacy (0.224)>effort expectancy (0.178)>performance expectancy (0.157)> personal innovativeness (0.155); (2) Facilitating condition and willingness to improve digital literacy have a significant positive impact on tea farmers' digital literacy improvement behavior，and then from the size of the path coefficient, the willingness to improve (0.271)>facilitating condition (0.106); (3) The willingness of tea farmers to improve their digital literacy plays a complete mediating role between personal innovativeness and self-efficacy on their digital literacy improvement behavior, and partially mediates between performance expectancy, social influence, and effort expectancy on their digital literacy improvement behavior, and according to the proportion of indirect effects, the order is effort expectancy (27%), performance expectancy (47%), and social influence (49%); (4) The gender and age of tea farmers have a significant positive moderating effect on the impact of performance expectancy on the willingness to improve digital literacy; age and experience have a significant positive moderating effect on the impact of effort expectancy on the willingness to improve digital literacy; the age of tea farmers has a significant positive moderating effect on the improvement of digital literacy behavior through facilitating condition. This study extends the applicability of the UTAUT theoretical model and proposes strategies to improve the digital literacy of tea farmers, providing practical guidance for tea farmers to improve their digital literacy and providing reference for research related to farmers' digital literacy.

COVID-19 is a highly infectious respiratory illness caused by SARS-CoV-2, and acute lung injury (ALI) is the major cause of COVID-19. The challenge in studying SARS-CoV-2 pathogenicity is the limited availability of animal models. Therefore, it is necessary to establish animal models that can reproduce multiple characteristics of ALI to study therapeutic applications. The present study established a mouse model that has features of ALI that are similar to COVID-19 syndrome to investigate the role of ACE2 and the administration of the Chinese herbal prescription NRICM101 in ALI. Mice with genetic modifications, including overexpression of human ACE2 (K18-hACE2 TG) and absence of ACE2 (mACE2 KO), were intratracheally instillated with hydrochloric acid. The acid intratracheal instillation induced severe immune cell infiltration, cytokine storms, and pulmonary disease in mice. Compared with K18-hACE2 TG mice, mACE2 KO mice exhibited dramatically increased levels of multiple inflammatory cytokines (IL-6, TNF-α, and TGF-β1) in bronchoalveolar lavage fluid, histological evidence of lung injury, and dysregulation of MAPK and MMP activation. In mACE2 KO mice, NRICM101 could ameliorate the disease progression of acid-induced ALI. In conclusion, the established mouse model provided an effective platform for researchers to investigate pathological mechanisms and develop therapeutic strategies for ALI, including COVID-19-related ALI.

The development of high-performance sensing materials for detecting or removing SF₆ decomposition gases is crucial for gas-insulated switchgear (GIS). In this work, the adsorption characteristics of the pristine porphyrin (Pr) and Fe-doped porphyrin (FePr) monolayers towards SF₆ decomposition gases were investigated using the first-principles calculations. Additionally, the electronic properties and sensing-mechanism were also examined. The findings indicate that both Pr and FePr monolayers exhibit thermodynamic stability. The intrinsic Pr monolayer only exhibits a moderate affinity towards the SO₂ molecule, however, its poor sensitivity of the Pr monolayer renders it unsuitable as the sensing-material. In contrast, the FePr monolayer exhibits favorable adsorption strength towards all five toxic gases (H₂S, SO₂, SOF₂, SO₂F₂, HF). The FePr monolayer exhibits chemisorption towards SO₂/SOF₂ gases, Furthermore, the microscopic mechanism of gases-substrate interaction is elucidated through the analysis of charge density difference, charge transfer, and density of states. Moreover, the FePr has excellent sensitivity for H₂S, SO₂, SO₂F₂, SOF₂ and HF molecules owing to the significant variations of the band gap, electrical conductivity and work function. In addition, the τ of H₂S, SO₂, and SOF₂ is 12.6 μs, 18.5 s and 15.4 s at 298 K, respectively. Our calculated results can offer theoretical guidance for the practical application of FePr-based sensing materials to detect SF6 decompositions gases.

This paper presents a study aimed at enhancing the performance of quantum dot light-emitting didoes (QLEDs) by employing a solution-processed molybdenum oxide (MoO3) nanoparticle (NP) as a hole injection layer (HIL). The study investigates the impact of varying the concentrations of the MoO3 NP layer on device characteristics and explores the underlying mechanisms responsible for the observed enhancements. Experimental techniques such as an X-ray diffraction and field-emission transmission electron microscopy were employed to confirm the formation of MoO3 NPs during the synthesis process. Ultraviolet photoelectron spectroscopy is employed to analyze the electron structure of the QLEDs. The QLED with an 8 mg/mL concentration of MoO3 nanoparticles achieves remarkable improvements in device performance, with a maximum luminance of 69,240.7 cd/cm2, maximum current efficiency of 56.0 cd/A, and maximum external quantum efficiency (EQE) of 13.2%. The obtained results signify a notable progress in comparison to QLED without HIL and those utilizing the widely used poly(3,4-ethylenedioxythiophene):poly(styrene sulfonate) (PEDOT:PSS) HIL. They exhibit a remarkable enhancement of 59.5% and 26.4% in maximum current efficiency, respectively, as well as a significant improvement of 42.7% and 20.0% in maximum EQE, respectively. This study opens up new possibilities for the selection of HIL and the fabrication of solution-processed QLEDs, contributing to the potential commercialization of these devices in the future.

(1) Background: Proximal humerus fractures can be a debilitating condition if not properly treated. These fracture patterns are varied and differ in every patient. Functional outcomes may be determined by the integrity of the shoulder girdle involving the rotator cuff insertion. The post-operative resorption or malreduction of the greater tuberosity is an important factor contributing to the poor functional outcome of a patient. (2) Methods: A single-center retrospective comparative study was performed to evaluate the functional outcomes of patients undergoing operative fixation for this injury. A total of 387 consecutive cases treated operatively from 2019-2021 were included for analysis. (3) Results: 94 cases fulfilled our criteria for analysis. A matched-group comparison of 19 patients each was performed to compare demographics, post-operative fracture characteristics and functional outcomes. (4) Conclusions: The resorption or malreduction of the greater tuberosity contributes greatly to the prognostic outcome in patients treated with ORIF surgery. In our demographic study, obesity is another contributing factor affecting the parameters of post-operative reduction in proximal humerus fractures. Appropriate surgical planning and post-operative multidisciplinary care must be taken into consideration to attain a satisfactory prognostic outcome.

(1) Background: Breast cancer is the second leading cause of cancer death among women. The accurate prediction of survival intervals will help physicians make informed decisions on treatment strategies or the use of palliative care for patients; (2) Methods: The gene expression is predictive and correlates to patient prognosis. To establish a reliable prediction tool, we collected the RNA-seq data of breast cancer patients, a total of 1187 RNA-seq data (median age 58 years), in FPKM format from the TCGA database. Among them, 144 RNA-seq data with date of death information was selected to establish the SaBrcada-AD dataset. We first normalized the SaBrcada-AD dataset to transcripts per million (TPM) to build survival prediction model SaBrcada. After normalization and dimension raising, the differential gene expression data were used for testing eight different deep learning architectures. Among them, GoogLeNet performed the best. Considering the effect of age on prognosis, we examined all ages between the lower and upper quartiles of patient age for a stratified random sampling test; (3) Results: Stratifying by age based on a cut-off of 61 years of age improved the accuracy of SaBrcada compared to previous findings, resulting in an accuracy of 0.798. We also built a free website tool to provide 5 kinds of predicted survival period information for clinician reference; (4) Conclusions: We established a breast cancer survival analysis prediction model, SaBrcada, and a website tool with the same name. Through this highly reliable survival analysis model and website tool, information on survival intervals will be provided for clinicians as part of precision medicine.

Novel genetic and epigenetic factors involved in the development and prognosis of idiopathic pulmonary fibrosis (IPF) have been identified. We previously observed that EPB41L3 increased in the lung fibroblasts of IPF patients. Thus, we investigated the role of EPB41L3 in IPF by comparing EPB41L3 mRNA and protein expression of lung fibroblast between patients with IPF and controls. We also investigated the regulation of the epithelial-mesenchymal transition (EMT) in an epithelial cell line (A549), and the fibroblast-to-myofibroblast transition (FMT) in a fibroblast cell line (MRC5), by overexpressing and silencing EPB41L3. EPB41L3 mRNA and protein levels, as measured by RT-PCR, real-time PCR, and western blot, were significantly higher in fibroblasts derived from 14 IPF patients than in those from 10 controls. The mRNA and protein expression of EPB41L3 was upregulated during transforming growth factor-β-induced EMT and FMT. Overexpression of EPB41L3 in A549 cells using lenti-EPB41L3 transfection suppressed the mRNA and protein expression of N-cadherin and COL1A1. Treatment with EPB41L3 siRNA upregulated mRNA and protein expression of N-cadherin. Overexpression of EPB41L3 in MRC5 cells using lenti-EPB41L3 transfection suppressed mRNA and protein expression of fibronectin and α-SMA. Finally, treatment with EPB41L3 siRNA upregulated mRNA and protein expression of FN1, COL1A1, and VIM. Overall, these data strongly support an inhibitory effect of EPB41L3 on the process of fibrosis and suggest therapeutic potential of EPB41L3 as an anti-fibrotic mediator.

For the emerging autonomous swarm technology, from the perspective of systems science and systems engineering, there must be some novel elements and methods to aggregate multiple systems into a group, which distinguish with the general components with specific functions, and we expect to provide the presentation of their existence in the swarm development processes. The inspiration of our methodology origins from the integration of swarm ontology, multi-paradigm modeling, multi-agent system, cyber-physical system, etc. Therefore, we choose the model-driven technology as a framework to acquire an approach of model representation across the multiple levels of abstraction and composition. The autonomous strategic mechanism is defined and formed in parallel with ConOps analysis and systems design, so as to effectively solve the cognitive problem of emergence caused by the nonlinear causation among individual and whole behaviors. This approach highlights to use the MBSE processes and their artifacts to embed the meso mechanism to integrate the operational and the functional, and which means to connect the macro and micro aspects in formalism and so to become a whole with its expected goals, and then to verify and validate within a L-V-C simulation environment.

Blood glucose (BG) monitoring is an important issue for critically ill patients. Previous studies reported that poor sugar control was associated with increased mortality in admitted patients. However, repeated blood glucose monitoring can be resource-consuming and cause a healthcare burden in clinical practice. In this study, we aimed to develop a personalized machine-learning model to predict dysglycemia based on electrocardiogram (ECG) findings. The study included patients with more than 20 ECG records during single hospital admission in the Medical Information Mart for Intensive Care III database, focusing on the lead II recordings, along with the corresponding blood sugar data. We processed the data and used ECG features from each heartbeat as inputs to develop a one-class support vector machine (SVM) algorithm to predict dysglycemia. The model prediction for dysglycemia using a single heartbeat had an AUC level of 0.92 ± 0.09, with a sensitivity of 0.92 ± 0.10 and specificity of 0.84 ± 0.04. Based on 10 s majority voting, the model prediction for dysglycemia improved to an AUC of 0.97 ± 0.06. In this study, we found that a personalized machine-learning algorithm could accurately detect dysglycemia using a single-lead ECG.

Heavy metals contamination in groundwater often occurs in various industrial processes. Stud-ies have confirmed that polysulfide could reduce hexavalent chromium to trivalent chromium, achieving the effect of in-situ stabilization. For other heavy metals contamination in groundwa-ter, whether polysulfide also had a stabilizing ability to achieve in-situ remediation. This re-search focused on heavy metals except for chromium that often contaminated in groundwater, including lead, nickel, zinc, copper, and cadmium to explore the feasibility of using calcium polysulfide (CaSx) as an in-situ stabilization technology for these heavy metals contamination groundwater. Results showed that CaSx had a great removal efficiency for heavy metals lead, nickel, zinc, copper, and cadmium. However, for nickel, zinc, copper and cadmium, when CaSx was added excessively, complexes would be formed, causing the result of re-dissolve and this would also reduce the removal efficiency. Since it is difficult to accurately control the dosage of agents for in-situ groundwater remediation, the concentration of re-dissolved nickel, zinc, cop-per, and cadmium may not be able to meet the groundwater control standards. CaSx had high lead removal efficiency, and it would not cause re-dissolution due to excessive CaSx dosing. CaSx can be used as an in-situ stabilization technique for lead contaminated groundwater.

Patients with lean NAFLD make up an increasing subset of liver diseases. The association between lean NAFLD and feutin-A, which serves as a hepatokine and adipokine, has never been examined. Our study aimed to explore the association of serum fetuin-A among lean and nonlean patients. The study comprised 606 adults from the community, stratified into lean or nonlean (BMI </≥ 24 kg/m2) and NAFLD or non-NAFLD (scoring of ultrasonographic fatty liver indicator, US-FLI ≥ 2/<2). Multivariate logistic regression analyses were performed to estimate the odds ratio of having NAFLD among the tertiles of fetuin-A after adjustment. The least square means were computed by general linear models to estimate marginal means of the serum fetuin-A concentrations in relation to the NAFLD groups. The OR of having NAFLD for the highest versus the lowest tertile of fetuin-A was 2.62 (95% CI: 1.72-3.98; P for trend<0.001). Stratifying by BMI, the OR of having lean NAFLD for the highest versus the lowest tertile of fetuin-A was 2.09 (95% CI: 1.09-3.98; P for trend 0.026), while nonlean NAFLD had no significant association with the fetuin-A gradient after adjustments. Fetuin-A was positively associated with lean NAFLD after adjusting for central obesity and insulin resistance.

A method of direction-of-arrival (DoA) estimation for FMCW radars is presented. In addition to MUSIC and ESPRIT, which are well-known high-resolution DoA estimation algorithms, deep learning has recently emerged as a very promising alternative. It is proposed in this paper to use a 3D convolutional neural network (CNN) for DoA estimation. The 3D-CNN extracts from the radar data cube spectrum features of the region of interest (RoI) centered on the potential positions of the targets, thereby capturing the spectrum phase shift information, which corresponds to DoA, along the antenna axis. Finally, the results of simulations and field experiments are provided to demonstrate the superior performance, as well as the limitations, of the proposed 3D-CNN.

The accuracy of wind field simulation and prediction is one of the most significant parameters in the field of atmospheric science and wind energy. Limited by the observation data, there are few researches on wind energy development. A 3D Doppler wind lidar (DWL) providing the high-vertical-resolution wind data over the urban complex underlying surface in February 2018 was employed to evaluated the accuracy of vertical wind field simulation systematically for the first time. 11 PBL schemes of the Weather Research and Forecasting Model (WRF) were employed in simulation. The model results were evaluated in groups separated by weather (sunny days, haze days and windy days), observation height layers, and various observation wind speeds. The test results presented that the vertical layer altitude of the observation point position was the most important factor. The simulation is fairly well at a height of 1000-2000m, as most of the relative mean bias of wind speed and wind direction are less than 20% and 6% respectively. Below 1000 m, the wind speed and direction biases are about 30%-150% m.s-1 and 6%-30% respectively. Moreover, when the observed wind speed was lower than 5 m.s-1, the bias were usually large, and the wind speed relative mean bias is up to 50-300%. In addition, the accuracy of simulated wind profile is better in 10-15m.s-1 than other speed ranges, and is better up 1000m than below 1000m in the boundary layer. We see that the WRF boundary layer schemes have different applicability to different weather conditions. The WRF boundary layer schemes have significant differences in wind field simulation with larger error under the complex topography. A PBL scheme is not likely to maintain its advantages in the long term under different conditions including altitude and weather conditions.

The CoDRIVE solution builds on R&amp;D in the development of connected and autonomous vehicles (CAVs). The mainstay of the system is a low-cost GNSS receiver integrated with a MEMS grade IMU powered with CoDRIVE algorithms and high precision data processing software. The solution integrates RFID (radio-frequency identification) localisation information derived from tags installed in the roads around the University of Nottingham. This aids the positioning solution by correcting the long-term drift of inertial navigation technology in the absence of GNSS. The solution is informed of obscuration of GNSS through city models of skyview and elevation masks derived from 360-degree photography. The results show that predictive intelligence of the denial of GNSS and RFID aiding realises significant benefits compared to the inertial only solution. According to the validation, inertial only solutions drift over time, with an overall RMS accuracy over a 300 metres section of GNSS outage of 10 to 20 metres. After deploying the RFID tags on the road, experiments show that the RFID aided algorithm is able to constrain the maximum error to within 3.76 metres, and with 93.9% of points constrained to 2 metres accuracy overall.

Since 2007, highly pathogenic clade 2.3.2 H5N1 avian influenza A [A(H5N1)] viruses have evolved to clade 2.3.2.1a, b and c, and currently only 2.3.2.1c A(H5N1) viruses circulate in wild birds and poultry. During antigenic evolution, clade 2.3.2.1a and c A(H5N1) viruses acquired both S144N and V223I mutations around the receptor binding site of hemagglutinin (HA), with S144N generating an N-glycosylation sequon. We introduced single or combined reverse mutations, N144S and/or I223V, into the HA gene of clade 2.3.2.1c A(H5N1) virus and generated PR8-derived, 2 + 6 recombinant A(H5N1) viruses. When we compared replication efficiency in embryonated chicken eggs, mammalian cells and mice, the recombinant virus containing both N144S and I223V mutations showed increased replication efficiency in avian and mammalian hosts and pathogenicity in mice. The N144S mutation significantly decreased avian receptor affinity and egg white inhibition, but not all mutations increased mammalian receptor affinity. Interestingly, the combined reverse mutations dramatically increased the thermostability of HA. Therefore, the adaptive mutations possibly acquired to evade avian immunity may decrease viral thermostability as well as mammalian pathogenicity.

Torenia Concolor Lindley var. formosama Yamazaki ethanolic extract (TCEE) is reported to have anti-inflammatory and anti-obesity properties. However, the effects of TCEE and its underlying mechanisms in the activation of endothelial nitric oxide synthase (eNOS) have not yet been investigated. Increasing the endothelium-derived nitric oxide (NO) production has been known to be beneficial against the development of cardiovascular diseases. In this study, we investigated the effect of TCEE on eNOS activation and NO-related endothelial function and inflammation by using in vitro system. In endothelial cells (ECs), TCEE increased NO production in a concentration-dependent a manner without affecting the expression of eNOS. In addition, TCEE increased the phosphorylation of eNOS at serine 635 residue (Ser635) and Ser1179, Akt at Ser473, calmodulin kinase II (CaMKII) at threonine residue 286 (Thr286) and AMP-activated protein kinase (AMPK) at Thr172. Moreover, TCEE-induced NO production, and EC proliferation, migration and tube formation were diminished by pretreatment with LY294002 (an Akt inhibitor), KN62 (a CaMKII inhibitor) and compound C (an AMPK inhibitor). Additionally, TCEE attenuated the tumor necrosis factor-α-induced inflammatory response as evidenced by the expression of adhesion molecules in ECs and monocyte adhesion onto ECs. These inflammatory effects of TCEE were abolished by L-NG-nitroarginine methyl ester (a NOS inhibitor). Collectively, our findings suggest that TCEE confers protection from endothelial dysfunction by activating the Akt/CaMKII/AMPK/eNOS/NO signaling pathway.

Monin-Obukhov similarity theory (MOST) overestimates wind shear in some atmospheric stable conditions, i.e. Richardson number $R_f<0.25$. The overestimated wind shear that leads to an under-predicted friction wind speed and a lower ambient turbulence intensity for a given hub-height reference wind speed and a given roughness length, could influence wake modeling of a wind turbine. This work investigates the side effects of the breakdown of MOST on wake modeling under stable conditions and makes some modifications to the flow similarity functions to eliminate these side effects. Based on a field measurement in a wind farm, we firstly show that MOST predicts a larger wind shear for the atmospheric stability parameter $\zeta>0.1$ and proposes new flow similarity functions without constraining $R_f$ to limit the overestimated wind shear by MOST. Next, different turbulence models based on MOST and a modified one based on the new similarity functions are investigated through numerical simulations. These turbulence models are combined with the actuator disk model (AD) and Reynolds-averaged Navier–Stokes equations (RANS) to model wind turbine wakes under stable conditions. As compared to measurements, numerical results show that turbulence models based on MOST result in larger wake deficits and slower wake recovery rate with a square root of the mean-squared-error (RSME) of wake deficit in the range of 0.07-0.18. This overestimated wake effect is improved by applying the new similarity functions and the RSME of wake deficit is averagely reduced by 0.05. Finally, we check the role of the under-predicted turbulence intensity playing in the larger wake deficit predicted by models based MOST. Additional numerical simulations using the modified turbulence model are carried out, in which the roughness length is reduced to impose a hub-height ambient turbulence intensity equivalent to the MOST case. Simulation results show that reducing turbulence intensity enhances wake effects, however, it cannot reproduce the large wake deficit predicted by models based on MOST, which suggests that the overestimated wake effect by MOST could be also related to the overestimated wind shear.

Atmospheric stability affects wind turbine wakes significantly. High-fidelity approaches such as large eddy simulations (LES) with the actuator line (AL) model which predicts detailed wake structures, fail to be applied in wind farm engineering applications due to its expensive cost. In order to make wind farm simulations computationally affordable, this paper proposes a new actuator disk model (AD) based on the blade element method (BEM) and combined with Reynolds-averaged Navier–Stokes equations (RANS) to model turbine wakes under different atmospheric stability conditions. In the proposed model, the upstream reference velocity is firstly estimated from the disk averaged velocity based on the one-dimensional momentum theory, and then is used to evaluate the rotor speed to calculate blade element forces. Flow similarity functions based on field measurement are applied to limit wind shear under strongly stable conditions, and turbulence source terms are added to take the buoyant-driven effects into consideration. Results from the new AD model are compared with field measurements and results from the AD model based on the thrust coefficient, the BEM-AD model with classical similarity functions and a high-fidelity LES approach. The results show that the proposed method is better in simulating wakes under various atmospheric stability conditions than the other AD models and has a similar performance to the high-fidelity LES approach however in much lower computational cost.

Background: Hypoalbuminemia is known to be associated with adverse outcome in critical illness. In this study, we attempted to identify if hypoalbuminemia on emergency department (ED) arrival a reliable predictor for in-hospital mortality in necrotizing fasciitis (NF). patients. Method: A retrospective cohort study of hospitalized patients with NF was conducted in a tertiary teaching hospital in Taiwan between March 2010 and March 2018. Blood samples were collected in the ED upon arrival, and serum albumin levels were determined. we evaluated the predictive value of serum albumin level at ED presentation for in-hospital mortality. All collected data were statistically analyzed. Result: Of the 707 NF patients, 40 (5.66%) died in the hospital. The mean serum albumin level was 3.1 ± 0.9 g/dL and serum albumin levels were significantly lower in the non-survivor group than in the survivor group (2.8± 0.7 g/dL vs. 3.5 ± 0.8 g/dL). In the multivariable logistic regression model, albumin was associated with in-hospital mortality significantly (odds ratio[OR] 0.92, 95% confidential interval (CI) 0.88–0.96, P <0.001). The area under-the-receiver-operating-characteristic curve (AUC) for in-hospital survival was 0.77 (95% CI 0.72–0.82) and corresponding sensitivity, specificity, positive predictive value, negative predictive value, positive and negative likelihood ratio were 66%, 74%, 33%, 88%, 2.25 and 0.48, respectively. High sensitivity (96%) was shown at albumin level of 4.0 g/dL and high specificity (91%) was shown at level of 2.5 g/dL. Conclusion: Initial serum albumin levels were independently associated with in-hospital mortality among adult patients with necrotizing fasciitis and demonstrated fair discriminative performance in the prediction of in-hospital mortality. NF patients with hypoalbuminemia on ED arrival should be closely monitored for signs of deterioration and consider early and aggressive intervention to prevent mortality.

Lung cancer has been the leading cause of cancer death in the world. In addition to smoking, estrogen is supposed to play an important role in the lung cancer development because women have a higher proportion of adenocarcinoma than men. In the environment, there are many metabolites and wastes that mimic human estrogen structurally and functionally. As an oral contraceptive, 17α-ethynylestradiol (EE2) is released to wastewater after being utilized. Moreover, 4-nonylphenol (NP) exiting in the petrochemical products and air pollutants has estrogenic activity. In our study, 17β-estradiol (E2), EE2, and NP are administered to stimulate A549 male lung adenocarcinoma cells and H1435 female lung adenocarcinoma cells. The results demonstrate that EE2 and NP stimulate A549 and H1435 cells proliferation in a dose- and time-dependent trend. Both estrogen receptor α and β are activated simultaneously during these processes. Up-regulation of epidermal growth factor receptor (EGFR) and ERK expression is involved in response to estrogens. In conclusion, we first time report that EE2 and NP exert biotoxic effect to stimulate the proliferation of both male and female lung cancer cells in a dose- and time- response manner. New challenges from environmental hormones to lung cancer deserved further investigation.

Three new secoiridoid constituents Gonocarin A-C (1-3) and a new derivative Gonocarin A monoacetate (4), along with two known lignins pinoresinol (5) and paulownin (6) were isolated from the seed of Gonocaryum calleryanum (Baill.) Becc. The structures of the new metabolites were determined on the basis of extensive spectroscopic analysis, particularly mass spectroscopy and 2D NMR (1H–1H COSY, HMQC, HMBC, and NOESY) spectroscopy. When mouse macrophages RAW264.7 were treated with compounds 1-6 together with LPS -stimulated, a concentration-dependent inhibition of nitric oxide (NO) and tumor necrosis factor (TNF-α) productions were detected. The results confirmed that the Gonocaryum calleryanumrrg could be a potential anti-inflammatory agent.

In manual maintenance inspections of large-scaled photovoltaic (PV) or rooftop PV systems, several days are required to survey the entire PV field. To improve reliability and shorten the amount of time involved, this study proposes an electrical examination based method for locating multiple faults in the PV array. The maximum power point tracking (MPPT) algorithm is used to estimate the maximum power of each PV panel; this is then compared with metering the output power of PV array. Power degradation indexes are parameterized to quantify the degradation between maximum power and metered output power. Bidirectional hetero-associative memory (BHAM) networks are then used to locate multiple faults within the entire PV field. For a rooftop PV system with two strings, as seen in Figure 1, experimental results demonstrate that the proposed model has computational efficiency for real-time applications and that its algorithm is easily implemented in a mobile intelligent vehicle.

Soil naturally contains fluorine, but concerns arise when its levels or bioavailability are increased by human activities or specific compounds. South Korea faces challenges in regulating soil fluorine pollution despite implementing stricter total fluorine standards than many developed countries. Moreover, these regulations can be economically unfeasible because of the naturally high background levels of fluorine in the soil in Korea. This review explores the global landscape of soil fluorine management strategies and examines potential solutions that reconcile environmental protection with economic concerns. We recommend a shift towards regulating specific and hazardous fluorine compounds rather than total content, and prioritizing remediation efforts based on assessments of bioavailable fluorine. This approach may help Korea establish a more effective and sustainable strategy for managing soil fluorine pollution.

The aim of this work is to study the phase transformations, microstructures and mechanical properties of the martensitic stainless steel (MSS) 410 deposits produced by laser powder-directed energy deposition (LP-DED) additive manufacturing. The LP-DED MSS 410 deposits underwent the post heat treatment in austenitizing at 980℃ for 3hrs and followed by different tempering treatment at the temperatures of 250, 600, and 750℃ for 5hrs, respectively. The analyses of phase transformations and microstructural evolutions of LP-DED MSS 410 were carried out using X-ray diffraction, SEM-EDS, and EBSD. Vickers hardness and tensile strength properties were also measured to analyze the effects of the different tempering heat treatments. It reveals that as-built MSS 410 has very fine lath martensite and high hardness of about 480HV1.0 and tensile strength of about 1280 MPa, but elongation was very lower than the post heat treated ones. Precipitations of chromium carbide (Cr23C6) were most commonly observed at the grain boundaries and the entire matrix at the tempering temperatures of 600℃ and 750℃. In general, the tensile strengths de-creased from 1381MPa to 688MPa as tempering temperatures increased up to 750℃ from 250℃. Additionally, as the tempering temperature increased, the chromium carbide and tempered mar-tensite structures became coarser.

The nephrite belt in Altun Mountain-Western Kunlun Mountain region spanning approximately 1300 km in Xinjiang, NW China, constituting the world's largest preeminent nephrite deposit. The Qiemo region in the Altun Mountain is a crucial nephrite-producing area in China with demonstrating substantial prospects for future explorationl. While extant research has extensively study on secondary deposits in the Karakash River and native black nephrite deposits in Guangxi Dahua, a lacuna exists in the comprehensive investigation of black nephrite from original deposits in Xinjiang. Margou nephrite represents a recent discovery of black-toned nephrite deposits in Qiemo County, Xinjiang, warranting a comprehensive investigation into this primary source of black nephrite within the region. This scholarly inquiry deploys a suite of sophisticated analytical techniques, encompassing Polarizing microscope, electric microprobe, Backscattered Electron Image, X-ray Fluorescence, Inductively Coupled Plasma Mass Spectrometry. The rigorous experimental test is dedicated to elucidating the chemical and mineralogical composition, and further clarify the type of its genetic types of black-black cyan nephrite from Margou deposit in Qiemo, Xinjiang. Results delineate the mainly composed of tremolite-actinolite, characterized by Mg/(Mg + Fe2+) ratios ranging from 0.86 to 1.0. Minor minerals include diopside, epidote, pargasite, apatite, zircon, pyrite and iron hydroxide. Bulk-rock rare earth element patterns exhibit distinctive features such as negative Eu anomalies (δEu=0.00~0.17), decreasing light rare earth elements, a relatively flat distribution of heavy rare earth elements, and low with total REE concentrations (1.64~38.9 μg/g), concurrently, the Cr (6~21 μg/g) and Ni (2.5~4.5 μg/g) contents are conspicuously low. The magmatic influence of granite emerges as pivotal factor in the genesis of magnesia skarn hosting the Margou nephrite. The distinctive black-black cyan colour is attributed to heightened iron content, mainly associated with FeO (0.08~6.29%). The discerned chemical composition characteristics posit the Margou nephrite as an exemplar of the magnesia skarn-type nephrite deposit.

Abstract: Background: The birthrate of Black preterm (BPT) infant is 65% higher than White preterm (WPT) infants with BPT mortality 2.3 times higher. The incidence of culture positive sepsis is as high as 41% in preterms. This study aimed to examine infections and mortality in BPTs and WPTs. Methods: We enrolled 362 preterms born < 32 weeks gestational age (GA) between 2019-2023 in 5 neonatal intensive care unit (NICU)s to study onset of infections, and dispositions; RedCap data were analyzed for descriptive statistics. Results: 226 BPTs (63.5%) and 107 WPTs (30.8%) enrolled, with 29 other than White or Black, 50.5% female, mean GA of 27.67 weeks and 986.74 grams birthweight. Of 426 suspected infections evaluated in enrolled infants, there were 7 infants with early onset sepsis (EOS) and 39 infants with late onset sepsis (LOS). The incidence of EOS was 1.9% overall, 2.2% in BPTs vs 0.9% in WPTs. LOS incidence was 10.8% overall, 11.9% in BPTs and 9.3% in WPTs. Both BPT and WPT infants had ~ 8% gram-positive LOS events and 3% gram-negative LOS events; however, 82% of all gram-negative LOS episodes occurred in BPTs. There were 27 urinary tract infections and 78% were in BPTs. Two cerebral spinal fluid cultures were positive in BPTs. Necrotizing enterocolitis was diagnosed in 5.8% of the sample, with an incidence of 6.1% in BPTs versus 4.7% in WPTs. Death occurred in 6.0% of the enrolled infants with the rate of death being slightly higher in BPTs (7.0%) versus WPTs (5.6%). Conclusions: BPTs had a higher rate of positive cultures, double the gram-negative infections, a much higher rate of urinary tract infec-tions and a higher rate of mortality than their WPT counterparts. This study emphasizes higher risk of morbidity and mortality for BPTs.

Graphene materials synthesized using direct laser writing (laser-induced graphene; LIG) are fa-vorable sensor materials because of their large surface area, ease of fabrication, and cost effec-tiveness. In particular, LIG decorated with metal nanoparticles (NPs) has been used in various sensors, including chemical sensors and electronic and electrochemical biosensors. However, the effect of metal decoration on LIG sensors remains controversial; hypotheses based on computa-tional simulations do not always match experimental results, and even experimental results re-ported by different researchers have not been consistent. In the present study, we explored the effects of metal decorations on LIG gas sensors, with NO2 and NH3 gases as representative oxi-dizing and reducing agents, respectively. To eliminate unwanted side effects arising from metal salt residues, metal NPs were directly deposited by vacuum evaporation. Although the gas sen-sitivities of the sensors deteriorate upon metal decoration irrespective of the metal work function in the case of NO2 gas, they improve upon metal decoration in the case of NH3 exposure. A careful investigation of the chemical structure and morphology of the metal NPs in the LIG sensors shows that the spontaneous oxidation of metal NPs with a low work function changes the be-havior of the LIG gas sensors and that the sensor behaviors under NO2 and NH3 gases follow different principles.

Sphingolipids are ubiquitous in eukaryotes and certain prokaryotes, where they serve as vital components of biological membranes and as bioactive molecules. Chloroplasts have complex membrane structures that play crucial roles in photosynthesis, but their specific sphingolipidome remains unreported. In this study, we used high-performance liquid chromatography-mass spectrometry (HPLC-MS/MS) to analyze the sphingolipidome of purified Arabidopsis thaliana chloroplasts. We detected 92 chloroplast sphingolipids. The chloroplast sphingolipidome differed from total leaf (TL) samples, having a higher content of free long-chain bases and hydroxyceramides, and a greater proportion of complex sphingolipids with 16C fatty acid (FA) forms. Notably, chloroplast glucosylceramides were predominantly the d18:1 h16:0 and t18:1 h16:0 forms, rather than the 24C FA form found in TL and other cellular structures. Comparing the sphingolipidomes of different cellular structures underscores the inhomogeneity of intracellular distribution of sphingolipids. This provides a robust reference for further elucidating the function of sphingolipids in plant cells.

Natural montane peatlands generally are not a significant source of nitrous oxide (N₂O) due to environment limitation including phosphorus (P) scarcity and temperature lowness. Phosphorus enrichment and warming caused by global change are altering this limitation, likely to increase the source function of N₂O. However, the combined effects of P addition and warming on N₂O fluxes and biotic/abiotic factor in peatlands are still uncertain. To address this, we investigated the long-term (12 yrs) effects of P addition (5 and 10 kg ha^-1 yr^-1) and its interaction with warming on N₂O fluxes in a peatland. The results showed that although long-term P addition did not significantly affect the source/sink function of N₂O in the peatland, it stimulated enzyme activities, promoted peat decomposition. However, warming amplified the effect of P addition to increase N₂O emissions by stimulating enzyme activities and changing soil stoichiometry, even turned the peatland into a significant source of N₂O with an emission of approximate 100 g m^-2 during the growing season. Our study suggests that P enrichment under the current background of global warming will enhance the possibility of strong N₂O emissions in montane peatlands, which may increase the risk to further aggravate global warming.

Hydrothermal carbonization of cellulose was examined at 240 ℃ for 1 h. Ammonium sulfate and thiourea were selected as the doping sources of inorganic nitrogen and organic nitrogen for the preparation of supercapacitor carbon. The effect of boric acid on the properties of the resulting hydrochar after KOH activation was examined. The results showed that the proportion of functional groups and the specific surface area of the activated hydrochar would be reduced after the addition of boric acid, and the pore-forming process of the micropores would be inhibited. The hydrochar obtained from the reaction of cellulose and organic nitrogen compounds had better pore size distribution and electrochemical properties after activation. The largest specific surface area (952.27 m2 g-1) was obtained when only thiourea was used as the only doping source. In the three-electrode system, the specific capacitance resulting activated hydrochar reached 236.25 F g-1 at a current density of 1 A g-1. After 20,000 cycles of charging and discharging at a current density of 10 A g-1, the capacitance retention rate reached 99.96%. Therefore, this study proves that the supercapacitor carbon with good electrochemical properties could be obtained by the direct reaction of cellulose with organic nitrogen compounds.

(1) Background: Breast cancer is a frequent heterogeneous disorder diagnosed in woman and is a high cause of mortality of them in reason to rapid metastasis and disease recurrence. Ferroptosis can inhibit breast cancer cell growth, improve the sensitivity of chemotherapy and radiotherapy and inhibit distant metastases so potentially acts on tumor micro-environment; (2) Methods: Ferroptosis/Extracellular matrix remodeling literature text-mining results were integrated in breast cancer transcriptome cohort according their distant relapse free survival (DRFS) under adjuvant therapy (anthracyclin+taxanes) and also in MDA-MB-231 transcriptome functional experiments with ferroptosis activations (GSE173905); (3) Results: Ferroptosis/Extracellular matrix remodeling text-mining identified 910 associated genes in at list 10 articles. Univariate Cox analyses censored on breast cancer (GSE25066) selected 252 individual significant genes and 171 of them found with an adverse expression. Functional enrichment of these 171 adverse genes predicted basal breast cancer signatures. By text-mining some ferroptosis significant adverse selected genes shared citations in domain of ECM remodeling such as: TNF, IL6, SET, CDKN2A, EGFR, HMGB1, KRAS, MET, LCN2, HIF1A, TLR4. A molecular score based on expression the eleven genes was found predictive of worst prognosis breast cancer at univariate level: basal subtype, short DRFS, high grade values 3 and 4, estrogen and progesterone receptors negative and nodal stages 2 and 3. This eleven gene signature was validated as regulated by ferroptosis inductors (erastin and RSL3) in triple negative breast cancer cellular model MDA-MB-231.; (4) Conclusions: Crosstalk between ECM remodeling-Ferroptosis functionalities allowed to define a molecular score which have been characterized as an independent adverse parameter in prognosis of breast cancer patients. Gene signature of this molecular score have been validated to be regulated by erastin/RSL3 ferroptosis activators. This molecular score could be promising to evaluate ECM impact of ferroptosis target therapies in breast cancer.

Bright morning light (BML) entrains the body clock, modulates circadian rhythm, and improves sleep-wake disturbances. However, its impact on the autonomic nervous system (ANS) at night remains unclear. Hence, we investigated the effects of BML exposure on activities of the parasympathetic nervous system (PSNS) and sympathetic nervous system (SNS) at night. This non-randomized controlled pilot study included participants ≥60 years, diagnosed with a type of dementia or cognitive disorder. We excluded participants with pacemakers. The treatment group received 2500 lx BML, whereas the control group received approximately 200 lx of general lighting. We measured the heart rate variability to quantify ANS activity. The treatment group displayed significantly increased high-frequency (HF) power (Roy's largest root=2.44; P<.01) and insignificantly decreased normalized low-frequency (LF%) power. The corresponding low-frequency/high-frequency ratio (LF/HF), insignificant decrease, and cognitive function were correlated with PSNS activity (Roy's largest root=3.92; P<.01), which is effective for moderate dementia. BML exposure reduced SNS activity and enhanced PSNS activity at night, which consequently affected cognitive function. Furthermore, the light washout intervention markedly increased SNS activity at night. BML therapy may be a useful clinical tool for alleviating the deterioration of cognitive function.

In response to the increasing energy demand in Taiwan and the global trend of renewable energy development, Kuroshio energy is a potential energy source. How to extract this invaluable natural resource has then become an intriguing and important question in engineering practices. This study conducted a study for a nozzle-diffuser duct (NDD) as the Kuroshio currents energy harvester. The computational fluid dynamics (CFD) software ANSYS Fluent was employed to calculate the drag and added mass coefficients of the duct anchored to the seabed. Those coefficients were further imported into Orcaflex to simulate the motion of the duct under normal and storm wave conditions. Results showed that the duct was stable 25 m below the sea surface under normal wave condition. When the wave condition changed to storm waves, the duct needed to dive into at least 90 m below the sea surface to regain its stability and obtain high power take-off (PTO). An optimal design nozzle-diffuser-duct was reported and a PTO peak of 15 kW was expectable in the Kuroshio currents. Once a suitable offshore platform can be developed with sixty-six NDDs, a Megawatt Kuroshio ocean current power generation system is feasible in the near future.

ABSTRACT Introduction: Traditional penile venous surgery and enhancement have been controversial. Based on De Novo penile fibrovascular assembly, we report on penile venous stripping (PVS) and factual penile girth enhancement (FPGE). Methods: From 2013 to 2023, 18 men underwent PVS and FPGE, all confirmed with veno-occlusive dysfunction (VOD). PVS involves the stripping of erection-related veins. FPGE was performed along the tunica albuginea bilaterally; then, the two tunic defects were repaired with a 70.0x30.0 mm venous stripe and covered with either autologous venous walls (AVW, n=10) or Surgiform (SF, n=8). The penile girth was measured, and radio-opaque contrast was used. The abridged 5-item version of the International Index of Erectile Function (IIEF-5) score and the Erection Hardness Scale (EHS) were used yearly during follow-up via the Internet. Results: The follow-up period was 5.3±1.5 years. Radiopacity was consistently enhanced. Although there was indifference between AVW and SF, there was a significant improvement (both P＜0.01) in IIEF-5 and EHS scores (9.7±2.8 vs. 20.8±2.3; 1.7±0.6 vs. 3.2±0.2, respectively). Both the diameters of the glans and penile shaft increased (28.0±2.3mm and 28.3±2.1mm vs 35.3±2.2mm and 36.3±2.1mm respectively). The satisfaction rate was 81.3% (13/16). Conclusions: This novel combination of PVS and FPGE is promising, although a larger sample size is needed for further validation.