Objectives: In December 2019 a novel human-infecting coronavirus, SARS-CoV-2, has emerged. The WHO has stated the epidemic as a “public health emergency of international concern”. A drammatic situation has emerged with thousands of deaths, occurring mainly in the aged and very ill people. Epidemiological studies suggest that immune system function is impaired in elderly individuals and these subjects often present a severe deficiency in nutrients as fatsoluble and hydrosoluble vitamins. Design: In this first part of the review about Cov2 in aged people, we searched for reviews describing the characteristics of autoimmune diseases and the available therapeutic protocols for their treatment. We sed them as a paradigm with the purpose to retrieve pathogenetic mechanisms in common among these pathological conditions and SARS-CoV-2 infection, as well as the alteration induced in immune system function by this virus, or by its homologous SARS-CoV. Results: SARS-CoV-2 infection induces an important immune system dysfunction with the development of an exhuberant proinflammatory response in the host, and with the development of a life-threatening condition defined as Cytokine Release Syndrome (CRS). This leads to the Acute Respiratory Syndrome (ARDS), mainly in the aged people. High mortality and lethality rates have been observed in the elderly subjects with CoV-2-related infection. Conclusion: These diseases may serve as a paradigm for the study of CRS emerging in the course of SARS CoV-2 infection. This review discusses about the possible activity of Vitamin A, D, E and C in restoring normal antiviral Immune System function or the potential therapeutic role of these micronutrients as a part of a multi-treatment strategy against SARS- CoV-2 infection.

A mathematical model, composed of two non-linear differential equations that describe the population dynamics of CD4 T cells in the human immune system, as well as viral HIV particles, is proposed. The invariance region is determined, classical equilibria stability analysis is performed using the basic reproduction number, and numerical simulations are carried out, in order to illustrate stability results. Later, the model is modified with a delay term, which describes the time that cells require for immunological activation. This generates a two-dimensional integro-differential system, which is transformed into a system with three ordinary differential equations, via auxiliary variable use. For the new model, equilibrium points are determined, their local stability is examined, and results are studied by way of numerical simulation.

SARS-CoV-2 is a novel coronavirus that is the causative agent of Coronavirus infectious disease 2019 (COVD-19). As of the 17^th April 2020, it has infected 2 114 269 people resulting in 145 144 deaths. The timing, magnitude and longevity of humoral immunity is not yet understood for SARS-CoV-2. Nevertheless, understanding this is urgently required to inform the likely future dynamics of the pandemic, to guide strategies to allow relaxation of social distancing measures and to understand how to deploy limiting vaccine doses when they become available to achieve maximum impact. SARS-CoV-2 is the seventh human coronavirus to be described. Four human coronaviruses circulate seasonally and cause common colds. Two other coronaviruses, SARS and MERS, have crossed from animal sources into humans but have not become endemic. Here we review what is known about the human humoral immune response to epidemic SARS CoV and MERS CoV and to the seasonal, endemic coronaviruses. Then we summarize recent, mostly non-peer reviewed studies into SARS-CoV-2 serology and reinfection in humans and non-human primates and summarize current pressing research needs.

Antibiotics (ABs) are common medications used for treating infections. In cancer patients treated with immune checkpoint inhibitors (ICIs), concomitant exposure to ABs may impair the efficacy of ICIs and lead to a poorer outcome compared to AB non-users. We report here the results of a meta-analysis evaluating the effects of ABs on the outcome of patients with solid tumors treated with ICIs. PubMed, the Cochrane Library, and Embase were searched from inception until September 2019 for observational or prospective studies reporting prognosis of adult patients with cancer treated with ICIs and with or without ABs. Overall survival (OS) was the primary endpoint, and progression-free survival (PFS) was the secondary endpoint. The effect size was reported as hazard ratios (HRs) with a 95% confidence interval (CI), and an HR > 1 associated with a worse outcome in ABs users compared to no-ABs users. Fifteen publications were retrieved for a total of 2363 patients. In the main analysis (n = 15 studies reporting data), OS was reduced in patients exposed to ABs before or during treatment with ICIs (HR = 2.07, 95%CI 1.51–2.84; P<.01). Similarly, PFS was inferior in ABs users in n = 13 studies with data available (HR = 1.53, 95%CI 1.22–1.93; p<.01). In cancer patients treated with ICIs, AB use significantly reduces OS and PFS. Short duration/course of ABs may be considered in clinical situations in which they are strictly needed.

Background: CCL11 (eotaxin) is a chemokine with an important role in allergic conditions. Recent evidence indicates that CCL11 plays a role in brain disorders as well. Aims: This paper reviews the associations between CCL11 and aging, neurodegenerative, neuroinflammatory and neuropsychiatric disorders.Methods: Electronic databases were searched for original articles examining CCL11 in neuropsychiatric disorders.Results: CCL11 is rapidly transported from the blood to the brain through the brain-blood barrier. Age-related increases in CCL11 are associated with cognitive impairments in executive functions, episodic and semantic memory and, therefore, this chemokine was described as an “endogenous cognition deteriorating chemokine” (ECDC) or “accelerated brain-aging chemokine” (ABAC). In schizophrenia, increased CCL11 is not only associated with impairments in cognitive functions, but also with key symptoms including formal thought disorders. Some patients with mood disorders and premenstrual syndrome show increased plasma CCL11 levels. In diseases of old age, CCL11 is associated with lowered neurogenesis and neurodegenerative processes and, as a consequence, increased CCL11 increases risk towards Alzheimer's Disease. Polymorphisms in the CCL11 gene are associated with stroke. Increased CCL11 also plays a role in neuroinflammatory disease including multiple sclerosis. In animal models, neutralization of CCL11 may protect against nigrostriatal neurodegeneration. Increased production of CCL11 may be attenuated by glucocorticoids, minocycline, resveratrol and anti-CCL11 antibodies.Conclusion: Increased CCL11 production during inflammatory conditions may play a role in human disease including age-related cognitive decline, schizophrenia, mood disorders and neurodegenerative disorders. Increased CCL11 production is a new drug target in the treatment and prevention of those disorders.

Background: Schizophrenia and treatment-resistant schizophrenia (TRS) are associated with aberrations in immune-inflammatory pathways. Increased High Mobility Group Protein 1 (HMGB1), an inflammatory mediator, and Dickkopf-Related Protein (DKK1), a Wnt/β-catenin signaling antagonist, affect the blood-brain-barrier and induce neurotoxic effects and neurocognitive deficits.Aim of the study: The present study aims to examine HMGB1 and DDK1 in non-responders to treatments with antipsychotics (NRTT, n=60), partial RTT (PRTT, n=55) and healthy controls (n=43) in relation to established markers of schizophrenia including IL-6, IL-10 and CLL11 (eotaxin); and to delineate whether these proteins are associated with the schizophrenia symptom subdomains and neurocognitive impairments.Results: HMGB1, DKK1, IL-6 and CCL11 were significantly higher in schizophrenia patients than in controls. DKK1 and IL-6 were significantly higher in NRTT than in PRTT and controls while IL-10 was higher in NRTT than in controls. Binary logistic regression analysis showed that schizophrenia was best predicted by increased DDK1 and HMGB1 while NRTT (versus PRTT) was best predicted by increased IL-6 and CCL11 levels. A large part of the variance in psychosis, hostility, excitation, mannerism and negative (PHEMN) symptoms, and formal thought disorders was explained by HMGB1, IL-6, and CCL11 while most neurocognitive functions were predicted by HMGB1, DDK1 and CCL11. Conclusion: The neurotoxic effects of HMGB1, DKK1, IL-6 and CCL11 including effects on the blood-brain-barrier and the Wnt/β-catenin signaling pathway may cause impairments in executive functions, and working, episodic and semantic memory and explain, in part, PHEMN symptoms and a non-response to treatment with antipsychotic drugs.

Premenstrual syndrome (PMS) frequently occurs in women of childbearing age. There are different case definitions of PMS, one proposed by the American College of Obstetricians and Gynecologists (ACOG) and another based on the Daily Record of Severity of Problems (DRSP) scores. Here we review our recent papers indicating that the discovery of biomarkers of menstrual cycle-related symptoms is strongly dependent on the case definitions used and that the gold standard methods used to asses PMS, including the ACOG case definition, induce a high degree of false-negative findings. We propose a new case definition of the menstrual cycle-associated syndrome (MCAS), which is characterized by increased DRSP scores during the menstrual cycle and additionally by an exaggerated increase in symptoms the week prior to the menses. This case definition performed well and was externally validated by diverse biomarkers including plasma levels of progesterone and estradiol, chemokines (e.g. CCL2, CCL5 and CCL11), epidermal growth factor, hydroperoxides, paraoxonase 1 activity and complement C4. In conclusion, when evaluating menstrual cycle-related symptoms and their associations with biomarkers, we propose to assess daily measurements of the DRSP and based on those scores to a) use the diagnosis of MCAS as an indicant of menstrual cycle-related symptoms; and b) examine the associations of the time series in the DRSP and its subdomains (e.g. depression, physio-somatic, anxiety) and those in biomarkers including distributed lag models.

Beta-thalassemia major (β-TM) patients are treated with repeated blood transfusions, which may cause iron overload (IO), which in turn may induce immune aberrations. Patients with β-TM have an increased risk of major depressive disorder (MDD). The aims of the present study are to examine whether repeated blood transfusions, IO and immune-inflammatory responses are associated with MDD in children (6-12 years) with β-TM. The Children’s Depression Inventory (CDI), iron status (serum iron, ferritin, transferrin, TS%) and serum levels of CCL11, IL-1β, IL-10, and TNF-α were measured in β-TM with (n=54) and without (n=57) MDD and in healthy children (n=55). The results show that MDD in β-TM is associated with a greater number of blood transfusions, increased IO and IL-1β levels. Partial Least Squares path analysis shows that 68.8% of the variance in the CDI score is explained by the number of blood transfusions, IO, and increased levels of IL-1β and TNF-α. The latter two cytokines partly mediate the effects of IO on the CDI score, while the effects of blood transfusions on the CDI score are partly mediated by IO and the path from IO to immune activation. IO is also associated with increased IL-10 and lower CCL11 levels but these alterations are not significantly associated with MDD. In conclusion, blood transfusions may be causally related to MDD in β-TM children and their effects are in part mediated by increased IO and the consequent immune-inflammatory response. The results suggest that not only IO and its consequences including inflammation and ferroptosis, but also other factors related to the number of transfusions may cause MDD including psychosocial stressors. Current treatment modalities with folic acid and vitamin C are insufficient to attenuate IO and immune-inflammatory responses and to prevent MDD is children with β-TM undergoing blood transfusions.

Chronic fatigue and fibromyalgia symptoms frequently occur in major depressive disorder (MDD). The pathophysiology of these symptoms may in part, be ascribed to activated immune pathways, although it is unclear whether muscular factors play a role in their onset. The aim of the present study is to examine the role of muscle proteins in major depression in association with symptoms of chronic fatigue and fibromyalgia. We measured serum levels of agrin, talin-2, titin, and creatine phosphokinase (CPK) as well as the FibroFatigue (FF), the Hamilton Depression Rating Scale (HAM-D) and the Beck Depression Inventory (BDI-II) in 60 MDD patients and 30 healthy controls. The results show a significant increase in agrin and talin-2 in MDD patients as compared with controls. There were highly significant correlations between agrin and HAM-D, BDI-II and FF scores. Agrin, but not talin or titin, was significantly and positively associated with all 12 items of the FF scale. We found that a large part of the variance in HAM-D (47.4%), BDI-II (43.4%) and FF (43.5%) scores was explained by the regression on agrin, smoking, female sex (positively associated) and education (inversely associated). CPK was significantly and inversely associated with the total FF score and with muscle and gastro-intestinal symptoms, fatigue, a flu-like malaise, headache and memory, autonomic and sleep disturbances. These results suggest that aberrations in neuromuscular (NMJs) and myotendinous junctions may play a role in MDD and that the aberrations in NMJs coupled with lowered CPK may play a role in symptoms of chronic fatigue and fibromyalgia in MDD. Moreover, the increase of agrin in MDD probably functions as part of the compensatory immune-regulatory system (CIRS).

Objective: To examine associations between IgA responses to Gram-negative gut-commensal bacteria and peri-menstrual symptoms and sex hormone levels during the menstrual cycle in women with and without premenstrual symptoms. Methods: Forty women aged 18-45 years completed the Daily Record of Severity of Problems (DRSP) during all 28 consecutive days of the menstrual cycle. We assayed, in plasma,, IgA responses to 6 Gram-negative bacteria, i.e. Hafnei alvei, Pseudomonas aeruginosa, Morganella morganii, Klebsiella pneumoniae, Pseudomonas putida and Citrobacter pylori, progesterone and oestradiol at days 7, 14, 21 and 28 of the menstrual cycle. Results: Significant changes in Δ (actual minus one week earlier) IgA to LPS of the 6 Gram-negative bacteria during the menstrual cycle were observed with peak IgA levels at T4 (day 28) and lows at T1 or T2 (day 7 or 14). The Δ IgA changes in H. alvei, M. Morganii, P. putida during the menstrual cycle were significantly and positively associated with changes in the total DRSP score, and severity of physio-somatic, anxiety and breast-craving, but not depressive, symptoms. The changes in IgA responses to LPS were largely predicted by changes in progesterone and steady-state levels of progesterone averaged over the luteal phase. Discussion: Menstrual cycle-associated changes in IgA directed against LPS and by inference bacterial translocation may be driven by effects of progesterone on transcellular, paracellular and vascular pathways thereby contributing to the severity of physio-somatic and anxiety symptoms as well as fatigue, breast swelling and food cravings.

Major depressive disorder (MDD) is associated with changes in the levels of the cations calcium (Ca) and magnesium (Mg) as well as circulating pro- and anti-inflammatory cytokines. The immune-inflammatory nature of MDD has encouraged researchers to use anti-inflammatory drugs as an adjuvant treatment for MDD. However, the effect of this treatment on cation levels has not been studied. The present study examined a) differences in both cations between drug-naïve MDD patients and controls, and b) the effects of a combination of sertraline and ketoprofen, an anti-inflammatory drug, on Ca and Mg (both total and ionized). In the same patients we also examined the associations between both cations and IL-1β, IL-4, IL-6, IL-18, IFN-γ, TGF-β1, zinc and indoleamine 2,3-dioxygenase (IDO). Clinical improvement was estimated using the Beck Depression Inventory-II (BDI-II) at baseline and after follow up for two months. Serum Ca and Mg (total and ionized) were significantly lower in MDD patients as compared with controls, while treatment significantly increased calcium but decreased magnesium levels. There were significant and inverse correlations between the BDI-II scores from baseline to endpoint and Ca (both total and ionized), but not Mg, levels. The effects of calcium on the BDI-II score remained significant after considering the effects of zinc, IDO and an immune activation z unit weighted composite score based on the sum of all cytokines. There was a significant and inverse association between this immune activation index and calcium levels from baseline to endpoint. In conclusion, reduced levels of both cations play a role in the pathophysiology of major depression. Increased calcium levels are coupled to the clinical efficacy of antidepressants and attenuation of immune activation. The suppressant effect of antidepressants on Mg levels may be a side effect of those drugs. New antidepressant treatments should be developed that increase the levels both Ca and Mg.

Background: First episode psychosis (FEP), schizophrenia and affective disorders are accompanied by activation of the immune inflammatory response system (IRS). The compensatory immune-regulatory reflex system (CIRS) is a regulatory immune response that is induced by the IRS but exerts negative feedback through, for example, increased levels of anti-inflammatory cytokines such as IL-4, IL-13 and IL-10. Different phenotypes of schizophrenia may exhibit distinct IRS and CIRS immune profiles.Aims: This study aims to examine the IRS and CIRS components, including macrophagic M1, T-helper (Th)-1, Th-2, Th-17 and T-regulatory (Treg) phenotypes, in antipsychotic-naïve FEP patients before and after risperidone treatment.Methods: We included 31 antipsychotic-naïve FEP patients who had measurements of IRS and CIRS biomarkers before and after treatment with risperidone for 10 weeks, and 22 healthy controls.Results: Antipsychotic-naive FEP patients showed interrelated increments in M1, Th-1, Th-2, Th-17 and Treg phenotypes and a relatively greater IRS response (especially granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin (IL)-6 and IL-12) as compared with the CIRS response (IL-4, IL-13, IL-5 and IL-10). Inflammatory markers, especially IL-6 and IL-8, were significantly correlated with negative, psychotic, affective and excitation symptom dimensions. Treatment with risperidone significantly suppressed the IRS and CIRS. Baseline levels of CIRS biomarkers, especially higher soluble tumor necrosis factor receptor-1 and IL-10 predicted clinical improvement during treatment.Discussion: Our findings indicate that FEP is characterized by robust IRS (M1 + Th-1 + Th-17) and CIRS responses, suggesting that monocytes, macrophages, Th-1, Th-2, Th-17 and Treg cells are activated. The findings indicate that a) FEP patients are prone to the detrimental effects of M1, Th-1, Th-17 and Th-2 cells, which may contribute to long-lasting abnormalities in brain circuitry; and b) in FEP, the CIRS may contribute to recovery from the acute phase of illness. Enhancing the CIRS is a new drug target to treat FEP.

Inflammatory bowel disease (IBD) has evoked a significant interest in human immunobiology given its tactical immune evasion methodologies resulting in acute immune destabilization. IBD comprising of Crohn’s disease and Ulcerative colitis manifest as chronic inflammation in the gut mucosa, leading to complexities involving immune dysregulation in the T helper lymphocyte arm effecting disease pathogenicity. The mucosa of the alimentary canal is constantly exposed to a myriad of food antigens and luminal microorganisms for which a consistent host-protective mechanism is operative in healthy people. Lowered mucosal immune expression which allows penetration of the epithelial barrier by infective pathogenic microbes, elicits both innate and adaptive immune responses in the gut culminating in aberrant intestinal inflammation. Interestingly, IBD leukocyte repertoire is significantly entwined with chemokine assisted chemotactic navigation into the sites of inflammation which is also thought to generate favourable immune suppressive responses. The functions of the cognate chemokine receptor, CCR6, which binds with its unique ligand CCL20, are expected to tilt the balance between upregulation of homeostatic tolerance and inflammatory pathophysiology. This review aims at critically examining the CCR6 driven immune pathways; T_H1/T_H2, T_H1/T_H17, T_H17/ T_reg, IL-23/IL-17, Akt/ERK-1 /2, ILC3 for systematic investigation of its underlying mechanisms in the future and to underpin its importance in resolving IBD aetiopathology. Thus, CCR6 occupies an exclusive position in gut immunology which renders it an invaluable therapeutic tool for the production of novel medicaments to treat IBD.

Autophagy is a highly conserved catabolic mechanism that mediates the degradation of damaged cellular components by inducing their fusion with lysosomes. This process provides cells with an alternative source of energy for the synthesis of new proteins and the maintenance of metabolic homeostasis in stressful environments. Numerous studies have demonstrated beneficial roles for the induction as well as the suppression of autophagy in cancer cells. Autophagy may induce either survival or death depending on the cell/tissue type. Radiation therapy is widely used therapeutic option to treat cancer, and it induces autophagy in human cancer cell line. Also, melatonin seems to affect cancer cell death via regulation of programmed cell death. In this review, we summarize the current understanding of autophagy and its regulation in cancer.

The traditional herbal medicine, Hochu-ekki-to, has been shown to have preventive effects on viral infection and stress. This study aimed to evaluate the clinical effects of Hochu-ekki-to on two stress-related rat models of polycystic ovarian syndrome. Female Sprague-Dawley rats were divided into control and treatment groups, the latter of which were subjected to stress induced by exposure to adrenocorticotropic hormone (ACTH) or cold temperatures. After these stress inductions, rats were orally treated with dissolved Hochu-ekki-to once per day for 7 days. Rats subjected to the two different stressors exhibited upregulation of steroid hormone receptors (in ovaries) and reproductive hormones (in blood), and consequent stimulation of abnormal follicle development accompanied by elevation of Hsp 90 expression (in ovaries). Treatment with Hochu-ekki-to for 7 days after stress induction increased immune functions, reduced the stress-induced activation of Hsp 90, and normalized the levels of the tested steroid hormone receptors and reproductive hormones. Our findings suggest that stress stimulations may promote the activation of Hsp 90 via the dysregulation of steroid hormone receptors and reproductive hormones, but that post-stress treatment with Hochu-ekki-to improves reproductive and immune functions in the ovaries of stressed rats.

This study investigated the relationship between fundamental movement skills (FMSs) and health-related fitness (HRF) among first and second graders in South Korean elementary schools. It aimed to provide foundational data for developing physical education programs tailored to the motor development stages and fitness levels of younger elementary school students. In October 2023, FMSs (jumping, running, hopping, static balance, dynamic balance, overhand throwing, and kicking) and HRF (muscular strength, cardiorespiratory endurance, and flexibility) were evaluated among 291 first and second graders. The collected data were analyzed through frequency and multiple regression analyses performed using the SPSS software. The results revealed that higher scores in jumping and hopping are associated with greater muscular strength, cardiorespiratory endurance, and flexibility. Running had no significant effect on HRF elements. Higher scores in static balance (single-leg stance) were associated with increased muscular strength, cardiorespiratory endurance, and flexibility, but dynamic balance (balance beam walking) did not have a significant effect. Higher scores in overhand throwing were associated with greater muscular strength and cardiorespiratory endurance, but kicking did not show a significant association. Overall, these findings emphasize the importance of prioritizing jumping and static balance in physical education for the well-rounded health development of first and second graders.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

OCTA is an imaging modality used in the assessment of the retinal vasculature. It operates on the principle of coherence tomography used in standard OCT with the addition of delineating the retinal vascular. This provides a modern non-invasive retinal vascular imaging method compared to conventional dye-based imaging. High quality depth resolution of the superficial and deep capillary networks is possible on OCTA whereas this was not possible prior. OCTA may be limited by image quality degradation from factors such as motion artefact or media opacities, and therefore may not be the investigation of choice for all patient groups. There are multiple potential clinical applications for OCTA in retinal and choroidal vascular disease. Ongoing research is necessary to substantiate the more widespread use of OCTA due to its significant cost burden compared to current modalities.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Overweight and obesity adversely affect health-related quality of life (HRQOL) through day-to-day impairments of both mental and physical functioning. It is assumed that polyphenols within the Mediterranean diet may contribute to improve HRQOL. This investigation aimed at studying the effects of a polyphenol-rich ingredient on HRQOL in overweight and obese but otherwise healthy individuals. A randomized, double-blind, placebo-controlled study including 72 volunteers was conducted. Subjects were randomly assigned to receive for a 16-week period either 900 mg/day of the supplement or a placebo. Dietary recommendations were individually determined, and intakes were recorded; daily physical mobility was monitored. Improvement of HRQOL was set as the primary outcome and assessed at baseline and at the end of the investigation, using the Short-Form 36 (SF-36) Health survey. Body composition was analyzed using dual-energy X-ray absorptiometry (DXA). Physical activity level was calculated using International Physical Activity Questionnaire (IPAQ). After 16 weeks, despite there was no adherence to the Mediterranean Diet Serving Score (MDSS), supplemented individuals experienced significant HRQOL improvement (+5.3%; P=0.001), including enhanced perceived physical (+11.2%; P=0.002) and mental health (+4.1%; P=0.021) components; bodily pain, vitality, and general health, being the greatest contributors. Besides, body fat mass significantly decreased (-1.2 kg; P=0.033), mainly within trunk area (-1.0 kg; P=0.002). Engagement in physical activity significantly increased (+1308 Met-min/week; P=0.050). Hence, chronic supplementation with a nutritional diversity and dose of a Mediterranean diet-inspired polyphenol-rich ingredient resulted in a significant amelioration in both perceived physical and mental health, concomitant with the improvement of body composition, in healthy subjects with excessive adiposity.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

Gastric cancer is a heterogeneous group of diseases with only a fraction of patients responds to immunotherapy. The relationships between tumor DNA damage response, the immune system and immunotherapy have recently attracted attention. Accumulating evidence indicate that DNA repair landscape is a significant factor in driving response to immune checkpoint blockade (ICB) therapy. In this study, to explore new prognostic and predictive biomarkers for gastric cancer patients who are sensitive and responsible to immunotherapy, we developed a novel 15-DNA repair gene signature (DRGS) and its related scoring system and evaluated the efficiency of DRGS in discriminating different molecular and immune characteristics and therapeutic outcomes of gastric adenocarcinoma. The results showed that DRGS high score patients showed significantly better therapeutic outcomes compared to DRGS low score patients (P < 0.001). Integrated analysis of multi-omics data demonstrated that the patients with high DRGS score were characteristic of high levels of anti-tumor lymphocytes infiltration, tumor mutation burden (TMB) and PD-L1 expression, and these patients exhibited a longer overall survival and may benefit more from ICB therapy, as compared to the low-score patients. Therefore, the DRGS and its scoring system may have implications in tailoring immunotherapy in gastric cancers.

The comprehensive anabolic effects of insulin throughout the body, in addition to the control of glycemia, also include ensuring lipid homeostasis and anti-inflammatory modulation, especially in adipose tissue (AT). The prevalence of obesity, defined as a body mass index (BMI) ≥ 30 kg/m2, has been increasing worldwide on a pandemic scale with accompanying syndemic health problems, including glucose intolerance, insulin resistance (IR) and diabetes. Impaired tissue sensitivity to insulin or IR paradoxically leads to diseases with an inflammatory component despite hyperinsulinemia. Therefore, an excess of visceral AT in obesity initiates chronic low-grade inflammatory conditions that interfere with insulin signaling via insulin receptor (INSR). Moreover, in response to IR, hyperglycemia itself stimulates a primarily defensive inflammatory response associated with the subsequent release of numerous inflammatory cytokines and a real threat of organ function deterioration. In this review, all components of this vicious cycle are characterized with particular emphasis on the interplay between insulin signaling and both the innate and adaptive immune responses related to obesity. Increased visceral AT accumulation in obesity should be considered the main environmental factor responsible for the disruption in the epigenetic regulatory mechanisms in the immune system, resulting in autoimmunity and inflammation.

An emerging picture in cancer biology is that, paradoxically, chemotherapy can actively induce changes that favor cancer progression. These pro-cancer changes can be either inside (intrinsic) or outside (extrinsic) the cancer cells. In this review, we will discuss the extrinsic pro-cancer effect of chemotherapy; that is, the effect of chemotherapy on the non-cancer host cells to promote cancer progression. We will focus on metastasis, and will first discuss recent data from mouse models of breast cancer. Intriguingly, despite reducing the size of primary tumors, chemotherapy changes the tumor microenvironment, resulting in an increased escape of cancer cells into the blood stream. Furthermore, chemotherapry changes the tissue microenvironment at the distant sites, making it more hospitable to cancer cells upon their arrival. We will then discuss the idea and evidence that these devastating pro-metastatic effects of chemotherapy can be explained in the context of stress response. At the end, we will discuss the potential relevance of these mouse data to human breast cancer and their implication on chemotherapy in the clinic.

We analyze a time-delayed SIQR model that considers the transportation-related infections and entry-exit screening. This model aims to determine the measures for preventing and controlling major emergent infectious diseases and the associated costs. We calculate the basic reproduction number (R0), apply the linearization method, and construct an appropriate Lyapunov function to determine the stability of the disease-free equilibrium in the local and global. We collect COVID-19 infection data from two regions in the United States in 2020 for data fitting, obtain a set of optimal parameter values, and show that the model is suitable for simulating the outbreak and spread of emerging infectious diseases. We find that transportation-related infections increase the basic reproduction number, enhancing the impact on disease spread. Entry-exit screening effectively suppress the spread of disease by reducing the basic reproduction number. Furthermore, we investigate the influence of the incubation period on disease and find that a shorter incubation period results in a shorter duration but a larger scale of infection, and the peaks are reduced. We conduct a sensitivity analysis of the R0 and propose three measures to prevent the spread of new infectious diseases based on the most sensitive parameters: wearing masks, implementing urban closures, and administering medication to sick but not yet hospitalized patients promptly. In the case of COVID-19, we use Pontryagin’s minimum principle to get time-varying control measures to control the spread of the outbreak. Optimal control effectively controls the development and deterioration of the disease. Finally, several control measures are compared through cost-effectiveness analysis, and the results show that wearing masks is the most cost-effective measure. Our study provides some practical guidance for controlling the spread of major emerging infectious diseases.

Survival of Medulloblastoma (MB) depends on various factors, including the gene expression profiles of MB tumor tissues. In this study, we identified 967 MB survival related genes (SRBs) using the gene expression dataset of Cavalli et al. (2017) and the Cox proportional hazards regression model. Notably, the SRGs were over-represented on chromosomes 6 and 17, known for the abnormalities monosomy 6 and isochromosome 17 in MB. The most significant SRG was HMGA1 (high mobility group AT-hook 1), which is a known oncogene and a histone H1 competitor. High expression of HMGA1 was associated with worse survival, primarily in the Group 3γ subtype. The high expression of HMGA1 was unrelated to any known somatic copy number alteration. Most SRGs on chromosome 17p were associated with low expression in Group 4β, the MB subtype with 93% deletion of 17p and 98% copy gain of 17q. Pathway analysis showed that both chromosomes 6 and 17 included SRGs related to telomere maintenance and provide a rationale for testing telomerase inhibitors in Group 3 MBs. We conclude that HMGA1, along with other SRGs on chromosome 6 and 17 warrant further investigation as potential therapeutic targets in selected subgroups or subtypes of MB.

This study aimed to investigates obesity-related glomerulopathy (ORG) at cellular, structural, and transcriptomic levels. Thirty Wistar rats were randomized into two groups: control (n=15) and study groups (n=15) that were fed a standard (SD) and high-fat diet (HFD), respectively. After 10 weeks, the weight, kidney function, histological features, and transcriptomic changes were assessed. HFD group exhibited increased weight gain (55.8% vs 29.2%; P< 0.001) and albuminuria (10384.04 ng/ml vs 5845.45 ng/ml; P<0.001) compared to controls. The HFD group exhibited early stages of ORG lesions, with a predominance of mesangial matrix increase and podocyte hypertrophy (PH). These lesions correlated with differentially expressed (DE) genes and miRNAs. Functional analysis showed that four DE miRNAs in the kidneys of the HFD group negatively regulated the PTEN gene, which promotes podocyte endocytosis of lipids in ORG. Among these four miRNAs, miR-205 was upregulated in the urine of the HFD group. HFD-fed Wistar rats developed early stages of ORG, with a specific targetome of miRNAs and gene expression. The upregulation of miR-205 in the kidney and its isolation in urine are associated with lipid endocytosis in podocytes, which could become a plausible biomarker of the early stages of ORG and lead to future therapeutic research.

Objective To investigate nailfold capillary parameters in community-dwelling individuals aged over 60 years who have hypertension and do not exercise regularly. Furthermore, the study examined the correlations between capillary function and other health-related indicators. Design A single- center pilot trial Setting Faculty of Health, Tsukuba University of Technology, Japan Participants hypertensive community-dwelling elderly people Intervention Microcirculation was observed before and 1 min after arm-curl exercise by means microscopy of capillary with non-exercised limb. Additionally, we examined other health-related indicators. Outcome measures: Acute effects of reperfusion on nailfold density, flow, and diameters. Secondary outcomes included the correlations between microvascular parameters and other health-related indicators. We hypothesized that brief exercise could enhance microcirculation reperfusion and correlate with other health-related parameters.　 Results: There were 20 participants with a mean (SD) age of 67.1 (5.8) years. The capillary flow rate changed from 2.3±6.7 to 2.7±0.2 log µm/s (P

.Background: Negative outcomes associated with medications (NOM) and drug-related problems (DRP) significantly impact individuals with kidney replacement therapy (KRT) given the complexities of managing kidney disease and associated comorbidities. The present study aims to assess the frequency of NOMs/DRPs among KRT patients and identify contributing factors. Methods: A cross-sectional study was conducted at the Virgen de las Nieves University Hospital (Granada, Spain), involving 117 outpatient adults with KRT. Data were collected from February 2021 to July 2023 using electronic records, semi-structured interviews (Dáder Method), and discussions with nephrology specialists. NOMs/DRPs were identified following treatment guidelines. Binary logistic regression determined associated factors (p-value < 0.05). Results: Across 117 patients, 2,436 NOMs and 3,303 DRPs were identified, averaging 20.82 NOMs and 28.23 DRPs per patient. Prevalent NOMs included untreated conditions (58.95%), quantitative ineffectiveness (35.43%), and non-quantitative safety problems (5.13%). Dominant DRPs were undertreated conditions (37.63%), wrong dose/posology/length (33.00%), risk of adverse drug reactions (ADR) (16.14%), and non-adherence (6.87%). Patients with ADR, undertreated condi-tions, and anemia were associated with quantitative ineffectiveness. Risk of ADR and vitamin D deficiency/insufficiency correlated with non-quantitative safety problems. Conclusions: KRT pa-tients exhibited a substantial prevalence of NOMs/DRPs. Further research is needed to deepen our understanding of these complexities for improved patient care.

Background: Micronutrient deficiencies are common at the time of cancer diagnosis and are associated with worse prognosis. Little is known about them in cancer rehabilitation. Methods: Data from routine health related quality of life (HRQOL) were analyzed at an inpatient cancer rehabilitation center. Rehabilitation patients completed the EORTC QLQ-C30 questionnaire before and after multidisciplinary rehabilitation treatment, and three month after discharge. Selenium and zinc status was measured in whole blood at these three time points. In case of selenium deficiency up to 600 µg selenium per day as sodium selenite was supplemented. Results: A total of 271 patients (breast, colon, and pancreatic cancer) were included in the analysis. There was clinically meaningful improvement in many domains of the EORTC QLQ-C30 during rehabilitation. However, effect often waned in the three months after. Prevalence for selenium deficiency varied between 34 to 90 percent depending on cancer type (breast &lt; colon &lt; pancreas). In contrast, zinc deficiency was rare. Daily selenium supplementation of 600 µg was more efficient to correct selenium deficiency compared to 300 µg selenium per day. Rehabilitation and increasing selenium status after rehabilitation were associated with improved global quality of life, physical and emotional functioning, and fatigue. In cancer patients with decreasing selenium status, values of global quality of life, physical and emotional functioning, and fatigue were back to the values at the beginning of rehabilitation. Conclusions: Selenium deficiency is common in cancer patients admitted to a cancer rehabilitation clinic. Selenium supplementation during rehabilitation effectively corrected selenium deficiency in most cases. The positive effects of rehabilitation persisted longer, when selenium status did not decrease after rehabilitation.

: Molecular targeting strategies have been used for years to control cancer progression and are often based on targeting various enzymes involved in metabolic pathways. Keeping that in mind, it is essential to know the role of each enzyme in a particular metabolic pathway. In this review, we are providing in-depth knowledge of various enzymes such as ceramidase, sphingosine kinase, sphingomyelin synthase, dihydroceramide desaturase, and ceramide synthase, which are associated with multiple types of cancer that depend on ceramide metabolism. Focus has also been given to discussing physicochemical properties of well-studied inhibitors of natural products origin and their related structures for these enzymes. Targeting ceramide metabolism exhibited promise in mono and combination therapies at preclinical stages to prevent cancer progression and paved the way for the significance of sphingolipid metabolism in cancer treatments. Targeting ceramide metabolizing enzymes will help the medicinal chemist to design potent and selective small molecules for treating cancer progression at various levels.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

To date, the impact of COVID-19 vaccination on formerly menstruating women remains unknown. For this reason, a retrospective observational cross-sectional study was conducted (N= 548) using an online survey. General characteristics, medical history, and adverse events following COVID-19 vaccination were recorded. In comparison with the first dose, significantly higher percentages of respondents experienced menstrual-related disturbances (dose 1: 38.5% vs. dose 2: 44.8%; McNemar=9.15; mid P-value=0.002), as well as the simultaneous occurrence of two or more of these symptoms (dose 1: 11.2% vs. dose 2: 15.3%; McNemar=13.53; mid P-value=0.044) after receiving the second one. Among them, those related with the length and flow stand out, being of long-term nature in about 17-20% of cases. Interindividual factors influencing this unexpected event after receiving the dose 1 may include weight (AOR 1.02, CI 95% 1.01–1.03, P&lt;.001), perimenopause (AOR 2.28, CI 95% 1.37–3.77, P=.001), pre-existing diagnoses of non-autoimmune rheumatic/articular conditions (AOR 0.31, CI 95% 0.10–1.00, P=0.05), hormonal contraceptive use (AOR 0.25, CI 95% 0.07-0.82, P=0.02), suffering from other vaccine side effects − such as arm pain (AOR 0.61, CI 95% 0.39–0.95, P=0.03), headache (AOR 0.53, CI 95% 0.35 – 0.80, P=.003), swollen glands (AOR 0.29, CI 95% 0.15 – 0.60, P=.001) and nauseas (AOR 0.35, CI 95% 0.14 – 0.86, P=0.02) – and the number of previous pregnancies (AOR 2.70, CI 95% 1.54 – 4.76, P=.001). Formerly menstruating women may experience long-term menstrual-related disturbances following COVID-19 vaccination.

This study analyses key aspects of the professional life of primary school teachers in a southern European context. In the social changes of last two decades profoundly impacted the well-being of teachers putting a strain on their ability to adapt to sometimes unfair working conditions. For this purpose twenty teachers (M = 38.85; DS = 9.17) were interviewed from different areas of Italy, data were analyzed using the Grounded Theory Method. Through data analysis were summa-rize and emphasize eight core themes. The results show the effects of a gradual impoverishment of the recognition of the role of teacher, highlighting the difficulty for teachers of renegotiating more flexible workload assessments and of reinforcing psycho-emotional skills for the development of a teaching methodology attentive to the psycho-emotional needs of pupils. Schools emerge as a rigid working context, in which a competent organizational function is often absent. Practical psychological implications are discussed.

Grapevine is one of the most relevant crops in the world being used for economically important products such as wine. Yet, relevant grapevine cultivars are heavily affected by diseases such as the downy mildew disease caused by Plasmopara viticola. Improvements on grapevine resistance are made mainly by breeding techniques where resistance traits are introgressed into cultivars with desired grape characteristics. However, there is still a lack of knowledge on how resistant or tolerant cultivars tackle the P. viticola pathogen. In this study, using a shotgun proteomics LC-MS/MS approach, we unravel the protein modulation of a highly tolerant grapevine cultivar, V. vinifera ‘Regent’, in the first hours post inoculation (hpi) with P. viticola. At 6 hpi, proteins related to defence and to response to stimuli are negatively modulated while at 12 hpi there is an accumulation of proteins belonging to both categories. The co-occurrence of effector-triggered susceptibility (ETS) and effector-triggered immunity (ETI) is detected at both time-points, showing that these defence processes present high plasticity. The results obtained in this study unravel the tolerant grapevine defence strategy towards P. viticola and may provide valuable insights on resistance associated candidates and mechanisms, which may play an important role in the definition of new strategies on breeding approaches.

The 2030 Agenda sets out seventeen Sustainable Development Goals (SDGs). The educational goal is to promote the education of citizens on sustainable development, among other things. Educating today's digital citizens on sustainability means training them for justice and social activism, commitment and political engagement. However, research into the subject shows a lack of consistency in the education of university students. This paper presents a study of students of Education, on education on sustainability through the practice of active and critical digital citizenship. A quasi-experimental method was used to learn about the behaviours of digital citizens, and intervention was carried out by means of an SDG-focused workshop and observation of the final level of commitment. The results show a positive level of commitment and digital activism around content related to sustainable development, which can be addressed from the university syllabus in a cross-curricular way.

Deregulation of cell growth and development lead to cancer, a severe condition that claims millions of lives worldwide. Targeted or selective approaches used during cancer treatment determine the efficacy and outcome of the therapy. In order to enhance specificity and targeting and better treatment options for cancer, novel and alternative modalities are currently under development. Photodynamic therapy has the potential to eradicate cancer and combination therapy would yield even greater outcomes. Nanomedicine-aided cancer therapy shows enhanced specificity for cancer cells and minimal side-effects coupled with effective cancer destruction both in vitro and in vivo. Nanocarriers used in drug-delivery systems are well able to penetrate cancer stem cell niche, simultaneously killing cancer cells and eradicate drug-resistant cancer stem cells, yielding therapeutic efficiency up to 100 fold against drug-resistant cancer in comparison with free drugs. Safety precautions should be considered when using Nano-mediated therapy as the effects of extended exposure to biological environments are still to be determined.

Important tumor biomarkers, therapeutic targets, and mechanisms of tumorigenesis were discovered in animal models. Mouse models of malignant gliomas were represented by transplantable, chemically-induced, and genetically-engineered cells. The aim of the study was to investigate the morphological, molecular, and immunological characteristics of two original glioblastoma (GB) strains, M2 and M6. These are new, chemically-induced, trans-plantable tissue models of malignant diffuse mouse glioma. Tissues from M2 GB and M6 GB were transplanted into immunocompetent C57BL/6 mice. The clinical manifestations of M2 GB and M6 GB growth in mice include motility disorders, cachexia, and priapism. Morphologically, M2 GB and M6 GB are characterized by diffuse proliferation, cellular and nuclear polymorphism, high mitotic activity, and pathological forms of mitosis due to the aggressive nature of these tumors. Flow cytometry showed that CD3+ T lymphocytes (~32%) and F4/80+ macrophages (~28-50%) highly infiltrated both tumors. M2 GB had higher levels of F4/80+ macrophages than M6 GB. Cdkn2a, S100b, Mki67, Pten, Vegfa, Hif1a, Sox2, Abcb1, and Gfap genes were overexpressed in both tumors. Cd133, Tp53, and Pdgfra expression was increased in M2 GB. High expression of Pi3k and Gdnf was observed in M6 GB. Expression of Cd44, Pi3k, Hif1a, Gdnf and Egfr was higher in the M6 GB tissues com-pared to M2 GB, while Cdkn2a, Tp53, Cd133 and Pdgfra were higher in the M2 GB tissue compared to M6 GB. The transplantable M2 GB and M6 GB tissue models have intratumor immune responses, clinical and morphological features similar to human GB, as well as gene expression patterns that are important for further studies on tumorigenesis. These models can be used to develop diagnostic and therapeutic procedures and study carcino-genesis.

Natural products are considered an essential source of chemical compounds with relevant biological activities. Important antibiotics, anti-virals, and anticancer agents within healthcare facilities have been isolated from them. In recent decades, the study of alkaloids and the modulation of the immune response has aroused interest. The survey of SAR alkaloids with immunomodulatory effects is of great importance since structural modifications impact the effectiveness of the immunomodulatory activity, thus promoting the rational design of more effective and specific drugs. This review exhibits the main alkaloids with an immunomodulatory effect and their relationship with SAR studies, particularly in activating leukocytes and secretion of molecules with critical inflammatory activities such as cytokines, chemokines, and nitric oxide. These studies optimize the properties of alkaloids and allow a deeper understanding of the mechanisms of action at a molecular level, which is fundamental for the innovation of immunological therapies.

Cardiovascular diseases are one of the most common causes of death in the United States of America and the sudden rise of patients having cancer are suffering from cardiovascular side effects of Chemotherapeutics drugs. Trastuzumab is a potent targeted agent for HER2-positive cancers though despite its excellent efficacy, the cardiotoxic effects of Trastuzumab restrict its usage globally. The most severe adverse effect is cardiotoxicity presents as contractile dysfunction that is reduction in left ventricular systolic function but the electrophysiological side effects are still not known. Due to these severe life-threatening side effects, it routinely results in the cessation of Trastuzumab. This review aims to provide a comprehensive overview of Trastuzumab-induced cardiomyopathy, offering insights into the mechanisms through which Trastuzumab exerts its cardiotoxic effects, clinical manifestations, diagnostic strategies, and potential cardioprotective interventions. By shedding light on the multifaceted aspects of this condition, we hope to emphasize the importance of early detection and effective management, while highlighting the urgent need for continued research to optimize the balance between oncological success and cardiovascular well-being. Cardiologists, oncologists, and researchers stand at the forefront of this critical intersection between oncology and cardiology, collectively striving to improve patient outcomes in the era of Trastuzumab therapy.

Type2 diabetes(T2D) is a pervasive modern disease, classified as a metabolic disorder marked by hyperglycemia, hyperinsulinemia, and life-long threatening cardiovascular morbidities. Subclinical inflammation stands as the primary pathogenetic factor propelling T2D progression, correlated with heightened levels of proinflammatory cytokines. Immune cells serve as the prominent sources of cytokine production, and under diabetic conditions, they tend toward a proinflammatory phenotype, fostering chronic inflammation. This review zeroes in on the disrupted homeostasis characteristic of diabetic conditions, encompassing cytokines, hormones, and their interplay with altered immune function, all contributing to the onset of diabetic cardiovascular complications.

Probiotics play an important role as immunostimulants in improving growth and health status in fish. However, little is known on the effects of probiotics when fish offered a low fish meal diet. This study evaluated the effects of three probiotic bacteria isolated from the fish intestine to replace antibiotics in a reduced fish meal diet fed to the juvenile olive flounder Paralichthys olivaceus. A basal diet without feed additives was used as a control (CON) and five other diets were formulated by supplementation with Bacillus subtilis WB60 (BSWB60) at 1×108 CFU/g, B. subtilis SJ10 (BSSJ10) at 1×108 CFU/g, Enterococcus faecium SH30 (EFSH30) at 1×107 CFU/g, amoxicillin (AMO) at 4 g/kg and oxytetracycline (OTC) at 4 g/kg of the basal diet. Triplicate groups of 25 fish averaging 12.1±0.09 g (mean±SD) were fed one of the six experimental diet groups for 8 weeks. Then, 45 fish from each group were intraperitoneally injected with the pathogenic bacteria, Edwardsiella tarda, and mortality was recorded for 14 days. At the end of the feeding trial, weight gain, specific growth rate and feed efficiency of fish fed the BSWB60 diet were significantly greater than those of fish fed the CON, OTC and AMO diets (P &lt; 0.05). Furthermore, feeding efficiency and protein efficiency ratio of fish fed the BSWB60 diet were significantly greater than those of fish fed the CON, OTC and AMO diets. However, there were no significant differences in survival, hepatosomatic indices, viscerosomatic indices and condition factors among the fish fed the experimental diets. The whole-body proximate composition of the fish was unaffected by the dietary treatments. The serum biochemistry parameters, such as aspartate aminotransferase levels were significantly greater in fish fed the BSSJ10 diet than in those fed the BSWB60 diet. However, serum alanine aminotransferase, glucose and total protein levels were not significantly affected by the experimental diets. The lysozyme activity of fish fed the BSSJ10, BSWB60 and EFSH30 diets was significantly greater than that of the CON, OTC and AMO diets. The myeloperoxidase activity of fish fed the BSWB60 diet was significantly greater than that of the fish fed the CON and AMO diets. The flounder growth hormone levels of fish fed the BSSJ10, BSWB60, EFSH30 and AMO diets were significantly greater than that of the fish fed the CON diet. The interleukin 1β (IL-1β) gene expression levels in fish fed the BSSJ10 and EFSH30 diets were significantly greater than those in fish fed the CON, OTC and AMO diets. The interleukin 10 (IL-10) gene expression levels in fish fed the BSSJ10, BSWB60, EFSH30 and OTC diets were significantly greater than those of fish fed the CON and AMO diets. Intestinal histology revealed that the average villus length of fish fed the BSSJ10, BSWB60, and EFSH30 diets was significantly greater than that of fish fed the CON, OTC and AMO diets. The cumulative survival rates of fish fed the EFSH30 and BSWB60 diets were significantly greater than those of fish fed the CON diet after the 15th day of the challenge test. Overall, the results of the present study demonstrated that the supplementation of autochthonous bacteria, B. subtilis (108 CFU/g diet) or E. faecium (107 CFU/g diet) in the diet could be ideal probiotics to replace antibiotics based on growth performance, the serum biochemical composition, immune responses and disease resistance in olive flounder fed a low fish meal diet..

Hypertensive disorders of pregnancy (HDP), including preeclampsia (PE) and gestational hypertension (GH), are major causes of maternal and fetal morbidity and mortality. This review elucidates the role of regulatory T cells (Tregs) in the immunological aspects of HDP and explores their therapeutic potential. Tregs, known for maintaining immune tolerance, are crucial in pregnancy to prevent immune-mediated rejection of the fetus. In HDP, Treg numbers and function imbalance are observed, correlating with disease severity. The review highlights that Tregs contribute to immunological adaptation in normal pregnancy, ensuring fetal acceptance and placental development. In contrast, HDP is associated with Treg dysfunction, marked by decreased numbers and impaired regulatory capacity, leading to inadequate immune tolerance and abnormal placental development. This dysfunction is particularly evident in PE, where Tregs fail to adequately modulate the maternal immune response against fetal antigens, contributing to the pathophysiology of the disorder. Therapeutic interventions aiming to modulate Treg activity represent a promising avenue for HDP management. Studies in animal models and limited clinical trials suggest that enhancing Treg functionality could mitigate HDP symptoms and improve pregnancy outcomes. However, the review acknowledges the complexity of translating these findings into effective clinical therapies, given the multifactorial nature of HDP and the intricate regulatory mechanisms of Tregs. In conclusion, while the precise role of Tregs in HDP is still being unravelled, their central role in immune regulation during pregnancy is indisputable. Further research is needed to fully understand the mechanisms by which Tregs contribute to HDP and to develop targeted therapies that can safely and effectively harness their regulatory potential for treating hypertensive diseases of pregnancy.

Fermented foods have long been known to have immunomodulatory capabilities and fermentates derived from the lactic acid bacteria of dairy products can modulate the immune system. We have used skimmed milk powder to generate novel fermentates using Lb. helveticus strains SC234 and SC232 and we demonstrate here that these fermentates can enhance key immune mechanisms that are critical to the immune response to viruses. We show that our novel fermentates SC234 and SC232 can positively impact on cytokine and chemokine secretion, nitric oxide (NO) production, cell surface marker expression, and phagocytosis in macrophage models. We demonstrate that fermentates SC234 and SC232 increase the secretion of cytokines IL-1β, IL-6, TNF-α, IL-27, and IL-10, promote an M1 proinflammatory phenotype for viral immunity via NO induction, decreases chemokine expression of Monocyte Chemoattractant Protein (MCP), increasing cell surface marker expression, and enhance phagocytosis in comparison to their starting material. These data suggest that these novel fermentates have potential as novel functional food ingredients for the treatment, management and control of viral infection.

Dengue virus (DENV) is spread by Aedes aegypti and causes significant global health risks. Alternative techniques are urgently needed because the current control mech-anisms are insufficient to reduce the transmission of DENV. Introducing Wolbachia pipientis into Ae. aegypti inhibits DENV transmission, however, the underlying mechanisms are still poorly understood. Innate immune effector upregulation, the regulation of autophagy, and intracellular competition between Wolbachia and DENV for lipids are among the theories for the mechanism of inhibition. Further-more, mainly three immune pathways Toll, IMD and JAK/STAT are involved in the host for the suppression of the virus. These pathways are activated by Wolbachia and DENV in the host and are responsible for the upregulation and downregulation of many genes in mosquitoes, which ultimately reduces the titer of the DENV in the host. The functioning of these immune pathways depends upon the Wolbachia, host and virus interaction. Here, we summarize the current understanding of DENV recognition by the Ae. aegypti’s immune system, aiming to create a comprehensive picture of our knowledge. Additionally, we investigated how Wolbachia regulates ac-tivation of multiple genes associated with the Toll and IMD pathway, for the reduc-tion of arboviruses.

Inflammation is widely acknowledged as a significant characteristic of cancer, playing a substantial function in both the initiation and advancement of cancers. In this research, we planned to investigate the comparison among pan-immune inflammation markers and other well-known markers (systemic immune inflammation index and neutrophil to lymphocyte ratio) to predict prognosis in individuals treated with radical cystectomy for bladder cancer. Methods: In this retrospective analysis, we focused on preoperative PIV, systemic immune inflammation index (SII), and neutrophil-lymphocyte ratio (NLR) in 193 individuals managed with radical cystectomy for bladder cancer between January 2016 and November 2022. Multivariable logistic regression assessments were perfomred to assess the predictive capabilities of PIV, SII, and NLR for infiltration of lymph nodes (N), aggressive tumor stage (pT3/pT4), and any non-organ limited disease at the time of RC. Multivariable Cox regression analyses were conducted to assess the predictive impact of PIV on Relapse-free survival (RFS), Cancer-specific survival (CSS), and Overall survival (OS). Results: Our individuals were divided into high PIV and low PIV cohorts using the optimal cut-off value (340.96 x 109/ L) based on receiver operating characteristic curve analysis for relapse-free survival. In multivariable preoperative logistic regression models, only SII and PIV correlated with the infiltration of lymph nodes, aggressive disease, and any non-organ confined disease. In multivariable Cox regression models considering presurgical clinicopathological variables, an higher PIV was associated with diminished RFS (p = 0.017) and OS (p = 0.029). In addition, in multivariable Cox regression models for postoperative outcomes, a high PIV correlated with both RFS ( p = 0.034) and OS ( p= 0.048). Conclusions: Our study suggests that PIV and SII are two very similar markers that may serve as an independent and significant predictor of aggressive disease and worse survival impacts on individuals undergoing radical cystectomy for bladder neoplasm.

Studies report variable effects of sex hormones on serious diseases. Severe disease and mortality rates in COVID-19 show marked gender differences that may be related to sex hormones. Sex hormones regulate the expression of the viral receptors ACE2 and TMPRSS2, which affect the extent of viral infection and consequently cause variable outcomes. In addition, sex hormones have complex regulatory mechanisms that affect the immune response to viruses. These hormones also affect metabolism through obesity, and severe disease can result from complications such as thrombosis. This review presents the latest research on the regulatory functions of hormones in viral receptors, immune responses, complications as well as their role in COVID-19 progression. It also discusses the therapeutical possibilities of these hormones by reviewing the recent findings of clinical and assay studies.

This research is aimed to investigate the effects of Lactoplantibacillus plantarum (L. plantarum) on growth performance, oxidation resistance, immunity, as well as cecal microbiota in broilers. This work classed three hundred and sixty 1-day-old broilers as three groups randomly, including control (CON, basal diet), antibiotic (ANT, 75 mg kg-1 chlortetracycline added into basal diet), or probiotic group (LP, 5×108 CFU kg-1 Lactoplantibacillus plantarum HJLP-1 contained within basal diet). Animal were then fed for 42 days, and each group consisted of 15 broilers for 8 replicates. Compared with CON, L. plantarum supplementation significantly improved the average weight daily gain (AWDG) (P < 0.05) while reducing feed-to-gain ratio over the entire supplemental period (P < 0.05). Birds fed L. plantarum had marked lower serum ammonia and xanthine oxidase levels (P < 0.05) than those in ANT and CON. Significant improvements (P < 0.05) of superoxide dismutase, catalase, serum IgM and IgY contents in broilers fed L. plantarum were also observed when compared those in CON and ANT groups. Both L. plantarum and antibiotics decreased the pro-inflammatory factor IL-1β level significantly (P < 0.05), while only L. plantarum promoted the anti-inflammatory factor IL-10 level dramatically in the serum (P < 0.05) compared with CON. The L. plantarum dramatically (P < 0.05) increased acetic acid and butyric acid concentrations in the cecal contents，when compared to those in CON and ANT. Among the differences revealed by 16S rRNA analysis, L. plantarum markedly improved the community richness of cecal microbiota. At the genus level, butyric acid-producing bacteria Ruminococcus and Lachnospiraceae were found in higher relative abundance in samples of L. plantarum treated birds. In conclusion, dietary L. plantarum supplementation promoted the growth and health of broilers, likely by inducing a shift in broiler gut microbiota toward short-chain fatty acid (SCFA)-producing bacteria. Therefore, L. plantarum has tremendous potential as an alternative for antibiotics in poultry breeding.

Insect meal as a protein source has been considered a sustainable way to feed animals. H. illucens and T. molitor larvae meal are considered high protein sources for poultry, also presenting considerable amounts of fatty acids, vitamins, and minerals. However, other potential components in insect meal and insect oil have been more studied nowadays. Chitin, lauric acid, and antimicrobial peptides can present antimicrobial and prebiotic functions, indicating that low inclusions of insect meal can beneficially affect broilers` health and immune responses. This systematic review was developed to study the impact of insect products on health parameters of broilers, and a metanalysis was conducted to evaluate the effects on performance. A database was obtained based on a selection of manuscripts from 2016 to January 2023, following the mentioned parameters. There were positive effects of both H. illucens and T. molitor meal or oil products on poultry health status, especially in microbiota population, immune responses, and antimicrobial properties. The average daily gain was greater in broilers fed T. molitor meal compared to H. illucens meal (p = 0.002). The results suggest that low levels of insect meal were suitable for broilers, without result in negative effects on performance, while the insect oil can totally replace soybean oil without negative impacts.

(1) Background: We comprehensively evaluated the expression of therapeutically targetable immune checkpoint molecules on celiac disease. We have focused on the alteration of the CD200/CD200R pathway and Elafin expression in celiac disease and discussed their roles in regulating the immune response. There are limited data related to the expression or function of these molecules in celiac disease. This finding could significantly contribute to the understanding of the clinical manifestation of celiac disease; (2) Methods: CD200, CD200R and Elafin distribution was determined by ELISA and immunohistochemistry analyses in serum and biopsies of CD patients. Analyses of Th1 and Th17 cytokines were determined. PCR amplification of a fragment of the PI3 gene was carried out using genomic DNA isolated from whole blood samples of the study subjects. Different aliquots of the PCR reaction product were subjected to RFLP analysis for SNP genotyping and detection; (3) Results: We characterized the expression and function of the CD200–CD200R axis and PI3 in celiac disease. A significantly higher level of soluble CD200, CD200R and lower expression of PI3 in serum of CD patients was observed compared to healthy controls. Consistent with our results, CD200 expression is regulated by IFN-gamma. Interaction of CD200/CD200R leads to production of type Th1 and Th17 cytokines. Regarding the PI3 genotype, the CT genotype proportion SNP rs1733103 and the GG genotype SNP rs41282752, were predominant in CD patients. SNP rs1733103 showed a significant association between the SNP variables and CD; (4) Conclusions: In celiac disease the immune checkpoint is compromised or dysregulated, which can contribute to inflammation and the autoimmunity process. The study of these checkpoint points will led to the development of targeted therapies aimed at restoring immunological balance in CD. Specific coding regions of the PI3 gene splice variants predispose the Elafin protein, both at the transcriptional and post-translational levels, to modify its expression and function, resulting in reduced differential functional protein levels in patients with active celiac disease.

High-temperature cooking process like frying, baking, smoking, or drying can induce chemical transformations in conventional food ingredients, causing deteriorative modifications. These reactions, including hydrolytic, oxidative, and thermal changes, are a common occurrence and can result in alterations to the food's chemical composition. In this study, a combination of sucrose and histidine (Su-Hi) was transformed through a process of charring or pyrolysis. The GC-MS profiling study showed that when sucrose and histidine (Su-Hi) are exposed to high temperatures (≈240°C), they produce carbonyl and aromatic compounds including beta-D-Glucopyranose, 1,6-anhydro (10.11 %), 2-Butanone, 4,4-dimethoxy- (12.89 %), 2(1H)-Quinolinone-hydrazine (5.73%), Benzenamine (6.35%), 2,5-Pyrrolidinedione, 1-[(3,4-dimethylbenzoyl)oxy]- (5.82%), Benzene-(1-ethyl-1-propenyl) (5.62%), and 4-Pyridinamine-2,6-dimethyl (5.52%). The compounds mentioned have the ability to permeate the cell membrane and contribute to the development of cell death by necrosis in human immune cells. The evidence available suggests that a specific set of pyrolytic compounds may pose a risk to immune cells. This investigation reveals the complex relationship between high-temperature cooking-induced transformations, compound permeation inside the cells, and downstream cellular responses, emphasizing the significance of considering the broader health implications of food chemical contaminants.

Background: We investigated the tumor immune response in gastric cancer patients receiving third line nivolumab monotherapy to identify immune-related biomarkers for better patient se-lection. Methods: Nineteen patients (10 males, median age 67 years) who received nivolumab as a third or later line therapy were enrolled. We analyzed the tumor immune response in durable clinical benefit (DCB) and non-DCB patients. Pre-treatment and early-on-treatment tumor transcriptomes were examined, and gene expression profiles, immunograms, and T cell receptor (TCR) repertoire were analyzed. Results: DCB was observed in 15.8% of patients, with comparable secondary endpoints (ORR, OS, PFS) to previous trials. Individual immunograms showed no significant changes before and ear-ly-on-treatment, nor consistent alterations among DCB cases. The intratumoral immune response was suppressed by previous treatments in most third or later line nivolumab recipients. TCR repertoire analysis revealed newly emerged clonotypes in on-treatment tumors, but clonal re-placement did not impact efficacy. High T cells/Tregs ratios and a low UV radiation response gene signature were linked to DCB and treatment response. Conclusions: This study emphasizes the tumor immune response's importance in nivolumab ef-ficacy for gastric cancer. High T cells/Tregs ratios and specific gene expression signatures show promise as potential biomarkers for treatment response. Larger cohort validation is crucial to optimize immune checkpoint inhibitors in gastric cancer treatment.

(1) Background: We previously reported the development of a recombinant protein SARS-CoV-2 vaccine, consisting of the Receptor-Binding Domain (RBD) of the SARS-CoV-2 spike protein, adjuvanted with aluminum hydroxide (alum) and CpG oligonucleotides. In mice and non-human primates, our wild-type (WT) RBD vaccine induced high neutralizing antibody titers against the WT isolate of the virus, and, with partners in India and Indonesia it was later developed into two closely resembling human vaccines, Corbevax and Indovac. Here, we describe the development and characterization of a next-generation vaccine adapted to the recently emerging XBB variants of SARS-CoV-2. (2) Methods: We conducted preclinical studies in mice using a novel yeast-produced SARS-CoV-2 XBB.1.5 RBD subunit vaccine candidate formulated with alum and CpG. We examined the neutralization profile of sera obtained from mice vaccinated twice intramuscularly at a 21-day interval with the XBB.1.5-based RBD vaccine, against WT, Beta, Delta, BA.4, BQ.1.1, BA.2.75.2, XBB.1.16, XBB.1.5 and EG.5.1 SARS-CoV-2 pseudoviruses. (3) Results: The XBB.1.5 RBD/CpG/alum vaccine elicited a robust antibody response in mice. Furthermore, serum from vaccinated mice demonstrated potent neutralization against the XBB.1.5 pseudovirus as well as several other Omicron pseudoviruses. However, regardless of high antibody cross-reactivity by ELISA, the anti-XBB.1.5 RBD antigen serum showed low neutralizing titers against the WT and Delta virus variants. (4) Conclusions: Whereas we observed modest cross-neutralization against Omicron subvariants by sera from mice vaccinated with the WT RBD/CpG/Alum vaccine or with the BA.4/5-based vaccine, sera raised against the XBB.1.5 RBD showed robust cross-neutralization. These findings underscore the imminent opportunity for an updated vaccine formulation utilizing the XBB.1.5 RBD antigen.

Primary immune thrombocytopenia (ITP) is a complex autoimmune disease whose hallmark is a deregulation of cellular and humoral immunity leading to an increased destruction and a reduced production of platelets. The heterogeneity of presentation and clinical course hampers personalized approaches for diagnosis and management. In 2021, the Spanish ITP Group (GEPTI) of the Spanish Society of Hematology and Hemotherapy (SEHH) updated a consensus document which had been launched in 2011. The updated guidelines have been the reference for diagnosis and management of primary ITP in Spain ever since. Nevertheless, the emergence of new tools and strategies makes it advisable to review them again. For this reason, we have properly updated the main recommendations. Our aim is to provide a practical tool to enable the integral management of all the aspects concerning primary ITP management.

Syphilis continues to be a significant global health concern, and understanding the latest advancements in immunology and pharmacological treatment is crucial for effective disease management. This review article provides an in-depth exploration of these advancements, aiming to contribute to the growing body of knowledge on syphilis research. The epidemiology of syphilis sets the stage for this review, highlighting the persistent burden of the disease worldwide. Current trends and challenges in disease control are discussed, shedding light on the need for comprehensive prevention strategies and improved surveillance systems. The immunological aspects of syphilis are the focus of this review. The intricate interplay between the host immune response and the evasive strategies employed by Treponema pallidum, the causative agent of syphilis, are explored. These include the mechanisms of immune evasion, the role of adaptive and innate immunity, and the development of immune-mediated tissue damage. The article also highlights advancements in diagnostic methods, with emphasis on the importance of accurate and timely detection. From traditional serological tests to the emergence of novel molecular and point-of-care assays, these developments have significantly improved the efficiency and accuracy of syphilis diagnosis. In terms of pharmacological treatment, the review covers the current recommendations and emerging strategies for managing syphilis infections. The challenges posed by antimicrobial resistance are addressed, emphasizing the importance of appropriate treatment regimens and close monitoring of therapeutic efficacy. Looking to the future, this review highlights the potential of vaccine development as a preventive measure against syphilis. Promising vaccine candidates and ongoing research efforts are discussed, offering hope for an effective means of disease prevention. In conclusion, this comprehensive review explores the advancements in syphilis research, from the understanding of immunological complexities to the development of innovative treatment strategies. By collectively advancing our knowledge, we can strive towards better disease management and minimize the impact of syphilis on global public health.

SARS-CoV-2, the virus that causes theCOVID-19 disease, has been demonstrated to cause immune suppression in certain individuals. This can manifest as a reduced ability for the host's immune system to effectively control the infection. Studies have reported that patients with COVID-19 can exhibit a decline in white blood cell counts, including natural killer cells and T cells, which are integral components of the immune system's response to viral pathogens. These cells play critical roles in the immune response to viral infections, and their depletion can make it harder for the body to mount an effective defense against the virus. Additionally, the virus can also directly infect immune cells, further compromising their ability to function. Some individuals with severe COVID-19 pneumonia may develop a "cytokine storm," an overactive immune response that may result in tissue damage and organ malfunction. The underlying mechanisms of immune suppression in SARS-CoV-2 are not entirely comprehended at this time, and ongoing research is being conducted to gain a more comprehensive understanding. Research has shown that severe SARS-CoV-2 infection promotes the synthesis of IgG4 antibodies. In this work, we propose the hypothesis that the IgG4 antibody produced by B cells in response to infection by SARS-CoV2 generates immunological tolerance that prevents its elimination, and leads to persistence and chronic infection. In sum, we believe that this constitutes another immune evasion mechanism that bears striking similarities to that developed by cancer cells to evade immune surveillance.

High mobility group box 1 (HMGB1) is secreted from activated immune cells, necrotic cells, and certain cancers. Previous studies have reported that different patterns of post-translational modification, particularly acetylation and oxidation, mediate HMGB1 release and confer distinct extracellular HMGB1 signaling activity. Here we report that cisplatin but not carboplatin induces secretion of HMGB1 from human A549 non-small cell lung cancer (NSCLC) cells. Cisplatin-mediated HMGB1 secretion was dose-dependent and was regulated by nuclear exportin 1 (XPO1) also known as chromosomal maintenance 1 (CRM1) rather than adenosine diphosphate (ADP)-ribosylation, acetylation, or oxidation. HMGB1, as well as lysine acetylation and cysteine disulfide oxidation of secreted HMGB1, were monitored by sensitive and specific assays using immunoprecipitation, stable isotope dilution, differential alkylation, and nano liquid chromatography parallel reaction monitoring/high-resolution mass spectrometry (nano-LC-PRM/HRMS). A major fraction of the HMGB1 secreted by low dose cisplatin treatment of A549 NSCLC cells was found to be in the fully reduced form. In contrast, mainly oxidized forms of HMGB1 were secreted by dimethyl sulfoxide (DMSO)-mediated apoptosis. These findings suggest that inhibition of XPO1 could potentiate the anti-tumor activity of cisplatin by increasing the nuclear accumulation of HMGB1 protein, an inhibitor of cisplatin DNA-adduct repair. Furthermore, low-dose cisplatin therapy could modulate the immune response in NSCLC through the established chemokine activity of extracellular reduced HMGB1. This could potentially enhance the efficacy of subsequent immunotherapy treatment.

Background Enfortumab vedotin shows promise as a targeted therapy for advanced urothelial carcinoma, particularly in patients who previously received platinum-based chemotherapy and immune checkpoint inhibitors. The EV-301 phase III trial demonstrated a significantly improved overall survival and response rates compared with standard chemotherapy. However, more data, especially from larger real-world studies, are needed to assess its effectiveness in Japanese patients. Methods A total of 6,007 urothelial cancer patients treated with pembrolizumab as second-line treatment were analyzed. Among them, 619 patients received enfortumab vedotin after pembrolizumab, while 394 received docetaxel or paclitaxel after pembrolizumab. Results The enfortumab vedotin group showed a longer overall survival than the paclitaxel/docetaxel group (p=0.013, hazard ratio: 0.71). In the multivariate analysis, enfortumab vedotin induction was an independent risk factor for the overall survival (p=0.013, hazard ratio: 0.70). There were no significant differences in the cancer-specific survival. Conclusions Enfortumab vedotin prolonged the overall survival in Japanese patients with advanced or metastatic urothelial carcinoma compared with paclitaxel or docetaxel after pembrolizumab treatment.

Tributyltin (TBT) is an environmental contaminant present on all continents, including Antarctica, with a potent biocidal action. Its use began to be intensified during the 1970s, being effectively banned in 2003, but remaining in the environment to this day due to several factors that increase its half-life and misuse despite the bans. In addition to the endocrine disrupting effect of TBT, that may lead to imposex induction in some invertebrate species, there are several studies that demonstrated that TBT also has an immunotoxic effect. The immunotoxic effects that have been observed experimentally in vertebrates using in vitro and in vivo models involve different mechanisms, but mainly alterations in the expression and/or secretion of cytokines. In this review, we summarize and update the literature on the impacts of TBT on the immune system, as well as discuss what still needs to be done to fill the knowledge gaps regarding the impact of this endocrine disrupting-chemical on immune system homeostasis.

A number of agents, including immune checkpoint inhibitors, have become available for the treatment of hepatocellular carcinoma (HCC). However, the objective response rate of these drugs is currently only 30% to 40%, with a high incidence of side effects. There are also no prac-tical biomarkers to predict their therapeutic effects. Most of the systemic therapies for HCC are performed in general hospitals without research facilities. Such hospitals can perform imaging tests, like CT and MRI, as well as pathological diagnosis using tumor tissue sampling and im-munohistochemical staining. However, analyzing tumor genomic or transcriptomic profiles is difficult because of limitations in facilities, personnel, and cost. Therefore, in this review, we provide an overview of the wide range of research that has been conducted on HCC biomarkers from blood, tissue, or imaging information that can be used practically in general hospitals for predicting the therapeutic effect of systemic therapies before treatment begins. For general hos-pitals that treat HCC patients, we recommend conducting treatment after assessing the state within the tumor tissue as much as possible by collecting blood and tissue samples and per-forming pre- treatment MRI image evaluations.

The 2019 COVID-19 pandemic caused by SARS-CoV-2 has resulted in many fatalities worldwide. Despite various types of supportive care, mortality rates for patients with comorbidities remain high. To explore alternative treatment options, interferons (IFNs) have emerged as promising therapeutic drugs for SARS-CoV-2. This review aims to investigate the potential of IFNs as a drug with details on their mechanisms of action, and available data on their use with ongoing clinical trials, results, potential limitations, and challenges. Recently published research articles, which were systematically searched through online databases, have been selected and found that IFNs have colossal potential in treating SARS-CoV-2 infection by modulating the host's immune response and inhibiting viral replication and decreasing the severity of disease and hospitalization (p = 0.03, ±0.05) and (p = 0.04, ±0.05) respectively. However, due to less available data, more controlled and randomized trials are needed to confirm the efficacy and safety of IFN therapy. The optimal dosing and duration of IFN therapy also remain to be determined. Although further research is needed the wait for ongoing clinical trial results under investigation is also important for a better understanding of IFN therapy.

Background: Pneumocystis pneumonia (PCP) commonly affects immunocompromised individuals, whereas in immunocompetent persons, it occurs relatively rarely, and in most cases the Pneumocystis infection is detected as an asymptomatic colonization. The present study aimed to establish the prevalence of Pneumocystis jirovecii infection in human hosts with different immune status (immunocompromised and immunocompetent), using molecular diagnostic methods, and to compare their diagnostic value with that of classical staining methods. Methods: We used the collected to this moment data from a prospective study on the prevalence of pneumocystosis among the Bulgarian population. Clinical specimens (including throat secretion, induced sputum, tracheal aspirate, and bronchoalveolar lavage collected from 220 patients suspected of PCP (153 immunocompetent and 67 immunocompromised patients) were examined with staining microscopic methods and real-time PCR for detection of P. jirovecii. Results: DNA of the pathogen was detected in 38 (17%) specimens (32 immunocompromised patients and 6 immunocompetent subjects). From all 220 clinical samples examined by staining methods, only in five (2%) P. jirovecii cysts were detected by the Gomori's stain. All patients with PCP were treated with trimethoprim-sulfamethoxazole, but in ten of them (HIV- positive patients) the disease was with fatal outcome. Conclusions: This study is the first for the country including the main available laboratory methods for diagnosis of human pneumocystosis in Bulgaria. Regarding the etiological diagnosis of PCP, in our study the sensitivity of real-time PCR was higher compared to the staining methods. The choice of a method for sample collection and examination has an important role in the efficiency of the laboratory diagnostics.

Silk is a globally renowned abundant biopolymer obtained from various sources of the Lepidoptera family, among which the most commonly used and researched are spider silk and silk worm silk. All varieties of silk have beneficial characteristics such as high tensile strength, biocompatibility, producing a reduced immune response in a biological system, biodegradability, and the ability to withstand environmental stresses as well. These features make silk suitable for a number of applications as a biomaterial. The vast potential of silk and its proteins in cosmetics, oncology, tissue engineering, TOC screenings, for preserving food, cosmetic product as a silk gel and bioremediation makes it a well-sought biopolymer among researchers. Experiments over the years have revealed that biomaterials constituting silk are very potent but are yet to be scaled up for commercial uses, but the various advantageous properties of silk biomaterial far overshadows the impeding problems of production.

Background: Migraine is the commonest complex neurological disorder affecting over a billion people worldwide. Neuroinflammation has long been considered to play an important role in the pathophysiology of migraine. The main aim of this single-centre, proof of concept, retrospective study was to determine the possible clinical utility of systemic immune-inflammatory response in migraine with and without aura in a hospitalized cohort. We measured the role of universally available serial white blood cell counts to calculate the serial systemic immune-inflammatory indices (SSIIi) and the potential association between aura and SSIIi changes in a cohort of migraine patients admitted to tertiary care center in Melbourne Australia.Main body: We retrospectively assessed patients' medical records presenting to Western Health with migraine over an 18 month period. Patients were classified as either having migraine with aura (MA) or without aura (MO) based on ICHD-3 criteria. Baseline demographics and brain imaging findings in each group were evaluated. Patients with two sets of white blood cell counts during the admission were included in the analysis. SSIIi were calculated as, neutrophil counts x platelet counts / lymphocyte counts. Correlation between SSIIi and MA and MO were assessed using SPSS27.Conclusion: SSIIi were elevated in MA and MO followed by a downward trend in both groups, with MA being statistically significant. This proof-of-concept study suggests the potential role of systemic inflammation in pathobiology of migraine. SSIIi appear to show clinical utility. Further comprehensive ,controlled , multicenter studies are required to clarify the exact role of systemic inflammatory response and the clinical utility of SSIIi in a subset of migraine in the Emergency department setting.

Background: The Ibizan Hound is a canine breed native to the Mediterranean region, where leishmaniasis is an endemic zoonosis. Several studies indicate a low prevalence of this disease in dogs, whereas other canine breeds present a high prevalence. However, the molecular underlaying mechanisms yet remains unknown. Methods: In this study, we analyze the haplotypes of genes encode cytokines related to immune response of Leishmania infantum infection in twenty-four Boxer and twenty-four Ibizan hound apparently healthy using CanineHD DNA Analysis BeadChip including 165,480 mapped positions. Results: The results show that several haplotypes of genes encoding Interleukin 6 (IL6) and Interferon gamma (IFNG) are related to Interferon gamma (IFN-γ), and Interleukins (IL) 2 and 18 serum levels. Our results indicate that the regulation of immune response is different in the two canine breeds analyzed and are related to the haplotype compositions of the genes encoding these cytokines. Conclusions: Future studies are needed to elucidate whether these differences and haplotypes are related to different phenotypes in immune response and expression gene regulation to L. infantum infection in dogs.

Ankylosing spondylitis (AS) is a chronic inflammatory disorder with unknown etiology and hard to early diagnose. It’s imperative to investigate the changes in AS patients’ peripheral blood, which may contribute to the diagnosis and further understanding of AS. Common differential expressed genes between normal and AS patients in GSE73754 and GSE25101 were screened by machine learning algorithms. IL2RB and ZDHHC18 were hubgenes screened and a diagnostic model was established. C-indexes and calibration analyses suggested high prediction accuracy of the model in training and validation cohorts. The AUC values of the model in GSE73754, GSE25101, GSE18781 and GSE11886 were 0.86, 0.84, 0.85 and 0.89 respectively. Decision curve analyses suggested high net benefit by the model. Functional analysis of the differential expressed genes indicated that they were mainly clustered in processes related to immune response. Immune microenvironment analysis revealed that neutrophils were expanded and activated in AS, while some T cells were decreased. IL2RB and ZDHHC18 were potential blood biomarkers for AS and might be used for early diagnosis and a supplementary diagnostic tool to the existing methods. Our study deepened the insight into the pathogenesis of AS.

The objective of this study was to identify key transcription factors involved in lipid metabolism and immune response related to the differentially expressed genes (DEG) from the liver samples of 35 pig model for metabolic diseases fed diets containing either 1.5 or 3.0% soybean oil (SOY1.5 or SOY3.0). A total of 281 DEG between SOY1.5 and SOY3.0 diets (log2fold-change ≥ 1 or ≤ −1; FDR-corrected p-value &lt; 0.1) were identified, in which 129 were down-regulated and 152 were up-regulated in SOY1.5 group. The functional annotation analysis detected transcription factors linked to lipid homeostasis and immune response, such as RXRA, EGFR, and SREBP2 precursor. These findings demonstrated that key transcription factors related to lipid metabolism could be modulated by dietary inclusion of soybean oil. It could contribute to nutrigenomics research field that aims to elucidate dietary interventions in animal and human health, as well as to drive the food technology and science.

This study aims to systematically review and meta-analyze the nitro-oxidative stress (O&NS)/antioxidant (ANTIOX) ratio in the peripheral blood of people with mild cognitive impairment (MCI). We searched PubMed, Scopus, Google Scholar, and Web of Science for articles published from inception until July 31, 2021. Forty-six studies on 3.798 MCI individuals and 6.063 healthy controls were included. The O&NS/ANTIOX ratio was significantly higher in MCI than in controls with a Standardized Mean Difference (SMD)=0.378 (95% CI: 0.250; 0.506). MCI individuals showed increased lipid peroxidation (SMD=0.774, 95%CI: 4.416; 1.132) and O&NS-associated toxicity (SMD=0.621, CI: 0.377; 0.865) and reduced glutathione (GSH) defenses (SMD=0.725, 95%CI: 0.269; 1.182) as compared with controls. MCI was also accompanied by significantly increased homocysteine (SMD=0.320, CI: 0.059; 0.581), but not protein oxidation, and lowered non-vitamin (SMD=0.347, CI: 0.168; 0.527) and vitamin (SMD=0.564, CI: 0.129; 0.999) antioxidant defenses. The results show that MCI is at least in part due to increased neuro-oxidative toxicity and suggest that treatments targeting lipid peroxidation and the GSH system may be used to treat or prevent MCI.

Coronavirus disease 2019 (COVID-19) is a global pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). To contain the virus, numerous preventive measures have been taken including isolation of patients, careful infection control, social distancing, and taking vaccine. So far, new confirmed and death cases are still increasing. SARS-CoV-2 invades cells by using the angiotensin converting enzyme 2 (ACE2). ACE2 is an essential enzyme of the renin-angiotensin system (RAS) which converts angiotensin II (Ang II) to angiotensin (1-7). ACE2 is expressed in different organs, including lung, heart, and kidney. A high number of COVID-19 patients developed kidney injury has been reported. Renal impairment and acute injury are associated with mortality of COVID-19, which is 14-16 times higher than other general patients. Acute Kidney Injury has been occured in 2.9 up to 43% of intensive care unit patients. The increasing evidence show that the components of RAS can activate the complement cascade, and cytokines production. Kidney injury caused by SARS-CoV-2 is related mainly to systemic and local inflammation. Moreover, the uncontrolled immune responses mediated by SARS-CoV-2 including hypercytokinaemia, secondary hemophagocytic lymphohistiocytosis, antibody dependent enhancement, complement system, and phagocytic cells activation can contribute in the virus pathogenesis leading to associated renal dysfunction. However, the role and crosstalk between of RAS components and immune response in mediating kidney injury remain undefined. In this review, we focus on the recent studies to provide the pathogenesis of SARS-CoV-2 interacting with RAS and immune responses to mediate kidney injury.

Cell-penetrating peptides (CPPs) have been evaluated as enhancers in drug delivery, their addition in medical formulations favors absorption allowing obtaining the pharmacological effect with lower drug doses. In vaccine formulations their inclusion has been also explored with interesting results. Currently mucosal vaccination constitutes a promising alternative with the main advantage of inducing both systemic and mucosal immune responses, which are crucial for control tumors and infections at mucosal tissues. The known CPP Penetratin was recently evaluated in vaccine formulations designed for nasal administration. The authors demonstrated that this non-covalent linked CPP could improve the antigen-specific systemic and mucosal antibody responses. In the present work we evaluate in Balb/C mice the nasal immune-enhancing effect of four CPPs. Animals were intranasally immunized with CPP and the recombinant hepatitis B surface protein (HBsAg) as model antigen. The IgG antibody response in sera and the mucosal IgA response were measured by ELISA. The IFN-g secretion response at spleen was also evaluated by ELISPOT and ELISA. Among the CPPs studied one novel peptide stand out by its ability to potentiate the humoral and cellular immune response against the co-administered antigen. Considering that the use of mucosal routes is a promising strategy in vaccination against infectious diseases and cancer, which are gaining special relevance nowadays in the development of novel candidates against SARS-CoV-2 and other potential emerging respiratory virus, the searching and development of safe mucosal adjuvants constitute a current need.

Chronic inflammation, the activation of immune cells and their cross-talk with cardiomyocytes in the pathogenesis and progression of heart diseases has long been overlooked. However, with the latest research developments, it is increasingly accepted that a vicious cycle exists where cardiomyocytes release cardiocrine signaling molecules that spirals down to immune cell activation and chronic state of low‐level inflammation. For example, cardiocrine molecules released from injured or stressed cardiomyocytes can stimulate macrophages, dendritic cells, neutrophils and even T-cells, which then subsequently increase cardiac inflammation by co-stimulation and positive feedback-loops. One of the key proteins involved in stress-mediated cardiomyocyte signal transduction is a small GTPase RhoA. Importantly, the regulation of RhoA activation is critical for effective immune cell response and is being considered as one of the potential therapeutic targets in many immune-cell-mediated inflammatory diseases. In this review we provide an update on the role of RhoA at the juncture of immune cell activation, inflammation and cardiac disease.

An immune-inflammatory response is accompanied by increased nitro-oxidative stress. The aims of this mechanistic review are to review: a) the role of redox sensitive transcription factors and enzymes, ROS/RNS production and the activity of cellular antioxidants on the activation and performance of macrophages, dendritic cells, neutrophils, T cells, B cells and natural killer cells; b) the involvement of high-density lipoprotein (HDL), apolipoprotein (Apo)A1, paraoxonase (PON)-1, and oxidized phospholipids in the regulation of the immune response; and c) the detrimental effects of hypernitrosylation and chronic nitro-oxidative stress on the immune response. The redox changes during immune-inflammatory responses are orchestrated by the actions of nuclear factor (NF)-κB, HIF1alpha, the mechanistic target of rapamycin (mTor), the phosphatidylinositol 3‑kinase (PI3K) / protein kinase B (AKT) signalling pathway, mitogen-activated protein (MAP) kinases, 5' AMP-activated protein kinase (AMPK), and peroxisome proliferator-activated receptor (PPAR). The performance and survival of individual immune cells is under redox control and sensitive to intracellular and extracellular levels of ROS/RNS and is heavily influenced by cellular anti-oxidants including the glutathione and thioredoxin systems, nuclear factor erythroid 2-related factor 2 (Nrf-2), and the HDL complex. Chronic nitro-oxidative stress and hypernitrosylation inhibit the activity of those antioxidant systems, the tricarboxylic acid cycle, mitochondrial functions, and the metabolism of immune cells. In conclusion, those redox-associated mechanisms modulate metabolic reprogramming of immune cells, macrophage and T helper cell polarization, phagocytosis, production of pro- versus anti-inflammatory cytokines, immune training and tolerance, chemotaxis, pathogen sensing, antiviral and antibacterial effects, Toll-like receptor activity, and endotoxin tolerance.

Viral respiratory infections are recognized risk factors for the loss of control of allergic asthma and the induction of exacerbations, both in adults and children. Severe asthma is more susceptible to virus-induced asthma exacerbations, especially in the presence of high IgE levels. In the course of immune responses to viruses, an initial activation of innate immunity typically occurs and the production of type I and III interferons is essential in the control of viral spread. However, the Th2 inflammatory environment still appears to be protective against viral infections in general and in severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infections as well. As for now, literature data, although very limited and preliminary, show that severe asthma patients treated with biologics don’t have an increased risk of SARS-CoV-2 infection or progression to severe forms compared to the non-asthmatic population. Omalizumab, an anti-IgE monoclonal antibody, exerts a profound cellular effect, which is able to stabilize the effector cells becoming much more efficient from the point of view of innate immunity in contrasting respiratory viral infections. In addition to the antiviral effect, clinical efficacy and safety of this biological allows a great improvement in the management of asthma.

The heterogeneity of tumor infiltrating lymphocytes is not well characterized in brain metastasis. To address this, we performed a targeted analysis of immune cell subsets in brain metastasis tissues to test which immunosuppressive routes are involved in brain metastasis. We performed multiplex immunofluorescence (mIF), using commercially available validated antibodies on twenty formalin-fixed paraffin embedded whole sections. We quantitated the subsets of immune cells utilizing a targeted panel of proteins including PanCK, CD8, CD4, VISTA and Iba1, and analyzed an average of 15000 cells per sample. We classified tumours as either high (>30%) or low (<30%) tumour infiltrating lymphocytes (TILs) and found that increased TILs density correlated with survival. We next sought out to phenotype these TILs using mIF. The tumours with low TILs (n=9) had significantly higher expression of the immune-checkpoint molecule VISTA in tumor cells (p<0.01) as well as in their microenvironment (p<0.001). Contrastingly, the brain metastatic tumours with high TILs (n=8) displayed higher levels of activated microglia, as measured by Iba1 expression. Low TILs-tumours displayed CD8+ T-cells that co-express VISTA (p<0.01) significantly more compared to high TILs group, where CD8+ T-cells significantly co-express Iba1 (p<0.05). Interestingly, no definite phenotypes of CD4+ subsets were observed. These results were supported by RNA analysis of a publicly available, independent cohort. In conclusion, our work contributes to a growing understanding of the immune surveillance escape routes active in brain metastasis.

Background. The aim of this study is to examine whether biomarkers of the immune-inflammatory response (IRS) and endogenous opioid (EOS) systems are associated with affective symptoms in schizophrenia. Methods. We recruited 115 schizophrenia patients and 43 healthy controls and assessed the Hamilton Depression (HDRS) and Anxiety (HAM-A) rating Scale scores as well as serum levels of interleukin (IL)-6, IL-10, eotaxin (CCL11), high mobility group box 1 (HMGB1), Dickkopf-related protein 1 (DKK1), and mu (MOR) and kappa (KOR) opioid receptors.Results. The HDRS and HAM-A scores are significantly and positively correlated with a) psychosis, hostility, excitation, mannerism, negative symptoms, psychomotor retardation, and formal thought disorders; and b) lowered scores on semantic and episodic memory, executive functions, and attention tests as measured with the Brief Assessment of Cognition in Psychiatry. Both HDRS and HAM-A are significantly increased in non-responders to treatment as compared with partial responders. Both affective scores are strongly associated with latent vectors extracted from all symptoms, reflecting overall severity of psychosis (OSOS), and neurocognitive test scores, reflecting a generalized cognitive decline (G-CoDe). The HDRS score was strongly and positively associated with IL-6, HMGB1, KOR, and MOR levels, and the HAM-A score with IL-6, IL-10, CCL11, HMGB1, KOR, and MOR levels. A single latent trait may be extracted from OSOS, G-CoDe, and the HDRS and HAMA scores, and this latent vector score is strongly predicted by HMGB1, MOR, and DKK1.Conclusion. Immune-inflammatory and EOS pathways contribute to the phenome of schizophrenia, which comprises OSOS, affective, and physiosomatic symptoms, and G-CoDe.

Covid-19 disease is caused by SARS Cov-2 virus. Despite its high transmissibility, the CFR (Case Fatality Rate) of COVID-19 seems to be lower than the SARS (9,5%) and MERS (34,4%) ones⁹³ , but higher than the influenza one (0-1%)^94,95 . The disease is asymptomatic or paucisymptomatic in most of the patients, although in few cases it can be characterized by serious complications. The main causes of hospitalization in intensive care are represented by ALI (Acute Lung Injury), ARDS (Acute Respiratory Distress Syndrome), cardiovascular problems and coagulopathies (diffuse thrombosis, microthrombosis, embolisms, myocarditis, arrhytmias, heart failure, stroke)^96-98, acute nephropathy^99,100 and encephalopathies¹⁰¹. The virus presence in the vascular wall can cause endotheliitis, which triggers the process of diffuse coagulation that can lead to a worsening of the systemic inflammation. The exaggerated inflammatory response seems to be connected with the development of ARDS, MOF (Multiple Organ Failure) and coagulopathies^102-107.

Objective: The purpose of this study was to determine if Porphyra tenera extract (PTE) has immune-enhancing effects and is safe in healthy adults. Methods: Subjects (3x10³ ≤ peripheral blood leukocyte levels < 8x10³ cells/μl) who met the inclusion criteria were recruited for this study. Enrolled subjects (n=120) were randomly assigned to either the PTE group (n=60) who were given 2.5 g/day of PTE (as Porphyra tenera extract) in capsule form or the placebo group (n=60) who were given crystal cellulose capsules with the identical appearance, weight, and flavor as the PTE capsules for 8 weeks. Outcomes were assessed by measuring natural killer cell (NK-cell) activity, cytokines, and upper respiratory infection (URI), and safety parameters were assessed at baseline and 8 weeks. Results: Compared to baseline, NK cell activity (%) increased for all effector cell to target cell ratios in the PTE group after 8 weeks, but there were no changes in the placebo group (p<0.1). Subgroup analysis of 101 subjects without an URI revealed that NK-cell activity in the PTE group tended to be increased for all E:T ratios (E:T=12.5:1 p=0.068; E:T=25:1 p=0.036; E:T=50:1 p=0.081) compared to the placebo group. There was a significant difference between these two groups for the E:T=25:1 ratio, which increased from 20.3±12.0% at baseline to 23.2±12.4% after 8 weeks in the PTE group (p=0.036). There was no significant difference in levels of cytokines between these two groups. Conclusions: PTE supplementation appears to enhance immune function by improving NK-cell activity without adverse effects in healthy adults.

Neutrophils play an important role as the first line of innate immune defense. One function of neutrophils, called neutrophil extracellular traps (NETs), has been discovered recently. NETs are extensive fibrous structures released extracellularly from activated neutrophils in response to infection. They are composed of cytosolic protein assembled on a scaffold of released chromatin. These structures suppress the dissemination of micro-organisms in blood by trapping them mechanically, and by exploiting coagulant function to segregate them within the circulation. In addition, NET components (DNA, histone, and granule proteins) also contribute to the triggering of an inflammatory process. NET function, however, can be regarded as a double-edged sword. On one hand, NET formation is an efficient strategy for neutralizing invading micro-organisms. On the other hand, NET can be harmful to the host, as its exposed by-products that are toxic to endothelial cells and parenchymal tissue. We present here the analogous biological and physiological features of the harmful positive amplification loop between inflammation and tissue damage induced by NETosis dysregulation and Coronavirus Disease-2019 (COVID-19) pathogenesis. Considering the rapid evolution of this disease symptoms and its lethality, we hypothesize that COVID-19 progresses under an amplifier loop, leading to an massive, uncontrolled inflammation process. We also describe the correlations of COVID-19 symptoms and biological features with those consecutive to uncontrolled NET formation causing various sterile or infectious diseases. General clinical conditions, and numerous pathological and biological features, are analogous with NETs deleterious effects. We postulate that Severe Acute Respiratory Syndrome-Coronavirus 2 (SARS-CoV2) induces a disproportionate virus-induced NET release, and that this plays a key role in COVID-19 pathogenesis. While neutrophils are the principal starting point for extracellular and circulating DNA release, targeting NETs rather than neutrophils themselves may stand for an effective strategy. This paper offers an in-depth review of NET formation, function and pathogenic dysregulation, as well as of current and future therapies to control NET unbalance. As such, it enables us also to suggest new therapeutic strategies to fight COVID-19. In combination with or independent of the latest tested approaches, we propose that, in the short term, deoxyribonuclease I (DNase-1) treatment should be evaluated; we also advocate a significant increase in research on the development of toll-like receptors (TLR) and C-type Lectin like receptors (CLEC) inhibitors, and on anti-IL26 therapies.

The coronavirus COVID-19 epidemic has wreaked havoc on inhabitants of earth killing thousands of humans from more than 150 countries. The epidemic has put a number of countries under complete lockdown and the deadly situation is still prevailing around the globe. Vaccines have been long known as the most effective means of preventing viral infections. However, the lack of vaccines against COVID-19 has further worsened the situation. In this time of health crisis, it is the duty of scientific research community to provide alternative, effective and affordable strategies to vaccinate human bodies against viral infections-COVID-19 based on focused experimental approaches. Growing evidence suggests that certain natural foods and lifestyle changes have potential to optimize immune functions against viral infections including improving defense function, resistance towards invading pathogens, while maintaining self-tolerance. Boosting immune system gives an edge in fending off viruses and staying healthy. This review presents the six smart steps to add to your to-do list which let the inner work of immunity take place against viral infections-COVID-19 by dissolving the powers of disease and illness. Many of these factors are associated in their functions to improve or properly maintain the immune function such as promoting anti-inflammatory functions, inhibiting pro-inflammatory mediators, modulating cell-mediated immunity, altering the antigen-presenting cellular functions as well as promoting communication between the innate and adaptive immune responses. Thus, a scientific illustration of boosting the immune system by proper sleep, moderate exercise, avoiding stress, utilizing vitamins enriched foods, intake of more water and use of fruits and vegetables will hopefully help the community to deal with the coronavirus by vaccinating the human systems naturally.

The outbreak of the 2019 Novel Coronavirus (2019-nCoV) has rapidly spread from Wuhan, China to multiple countries, causing staggering number of infections and deaths. A systematic profiling of the immune vulnerability landscape of 2019-nCoV is lacking, which can bring critical insights into the immune clearance mechanism, peptide vaccine development, and antiviral antibody development. In this study, we predicted the potential of all the 2019-nCoV viral proteins to induce class I and II MHC presentation and form linear antibody epitopes. We showed that the enrichment for T cell and B cell epitopes is not uniform on the viral genome, with several focused regions that generate abundant epitopes and may be more targetable. We showed that genetic variations in 2019-nCoV, though fewer for the moment, already follow the pattern of mutations in related coronaviruses, and could alter the immune vulnerability landscape of this virus, which should be considered in the development of therapies. We create an online database to broadly share our research outcome. Overall, we present an immunological resource for 2019-nCoV that could significantly promote both therapeutic development and mechanistic research.

Accumulating evidence suggests that TNF-α-mediated immune-neurotoxicity contributes to cognitive impairments and the overall severity of schizophrenia (OSOS). There are no data whether peripheral IL-6 and IL-4 may affect the phenome of schizophrenia above and beyond the effects of TNF-α and whether those cytokines are regulated by lowered natural IgM to malondialdehyde (MDA) and paraoxonase 1 enzyme activity. We assessed the aforementioned biomarkers in schizophrenia patients with (n=40) and without (n=40) deficit schizophrenia and 40 healthy controls. Deficit schizophrenia was best predicted by a combination of increased IL-6 and PON1 status (QQ genotype and lowered CMPAase activity) and lowered IgM to MDA. Partial Least Squares bootstrapping shows that 41.0% of the variance in negative symptoms, psychosis, hostility, excitation, mannerism, psychomotor retardation, and formal thought disorders was explained by increased TNF-α and PON1 status (QQ genotype and lowered CMPAase activity), lowered IL-4 and IgM to MDA as well as male sex and lowered education. We found that 47.9% of the variance in verbal fluency, word list memory, true recall, Mini-Mental State Examination, and executive functions was predicted by increased TNF-α and lowered IL-4, IgM to MDA and education. In addition, both TNF-α and IL-4 levels were significantly associated with lowered IgM to MDA, while TNF-α was correlated with PON1 status. These data provide evidence that the symptomatic (both the deficit subtype and OSOS) and cognitive impairments in schizophrenia are to a large extent mediated by the effects of immune-mediated neurotoxicity as well as lowered regulation by the innate immune system.