Collagen type I production decreases with aging, leading to wrinkles and impaired skin function. Prostaglandin E2 (PGE2), a lipid-derived signaling molecule produced from arachidonic acid by cyclo-oxygenase, inhibits collagen production and induces matrix metallopeptidase 1 (MMP1) expression by fibroblasts in vitro. PGE2-induced collagen expression inhibition and MMP1 promotion are aging mechanisms. This study investigated the role of E-prostanoid 1 (EP1) in PGE2 signaling in normal human dermal fibroblasts (NHDFs). When EP1 expression was inhibited by EP1 small interfering RNA (siRNA), there were no significant changes in messenger RNA (mRNA) levels of collagen, type I, alpha 1 (COL1A1)/MMP1 between siRNA-transfected NHDFs and siRNA-transfected NHDFs with PGE2. This result showed that EP1 is a PGE2 receptor. Extracellular signal-regulated kinase 1/2 (ERK1/2) phosphorylation after PGE2 treatment significantly increased by ~2.5 times. In addition, PGE2 treatment increased the intracellular Ca²⁺ concentration in NHDFs. These results indicated that PGE2 is directly associated with EP1 pathway–regulated ERK1/2 and inositol trisphosphate (IP₃) signaling in NHDFs.

Type-2 fuzzy sets were introduced by L. Zadeh aiming at modelling some settings in which fuzzy sets (usually called type-1 fuzzy sets) are not sufficient to reflect certain uncertainty degrees - loosely speaking, they are fuzzy sets whose membership degrees are ordinary fuzzy sets. On the other hand, fiber bundles are topological entities of extreme importance in Mathematics itself and many other scientific areas, like Physics (General Relativity, Field Theory etc.), finance modelling, and statistical inference. The present work introduces a conceptual link between the two ideas and conjectures about the potential mutual benefits that can be obtained from this viewpoint.As an objective and usable product of the presented ideas, it is described a framework for defining type-2 fuzzy hedges, proper to operate on interval type-2 fuzzy sets.

Subversion of programmed cell death-based host defence systems is a prominent feature of infections by large DNA viruses. African swine fever virus (ASFV) is a large DNA virus and sole member of the Asfarviridae family that harbors the B-cell lymphoma 2 or Bcl-2 homolog A179L. A179L has been shown to bind to a range of cell death inducing host proteins including pro-apoptotic Bcl-2 proteins as well as the autophagy regulator Beclin. Here we report the crystal structure of A179L bound to the Beclin BH3 motif. A179L engages Beclin using the same canonical ligand binding groove that is utilized to bind to pro-apoptotic Bcl-2 proteins. The mode of binding of Beclin to A179L mirrors that of Beclin binding to human Bcl-2 and Bcl-xL as well as murine gamma-herpesvirus 68. Introduction of bulky hydrophobic residues into the A179L ligand binding groove via site directed mutagenesis ablates binding of Beclin to A179L, leading to a loss of ability of A179L to modulate autophagosome formation in Vero cells during starvation. Our findings provide a mechanistic understanding for the potent autophagy inhibitory activity of A179L and serve as a platform for more detailed investigations into the role of autophagy during ASFV infection.

Prostanoids modulate the pathogenesis of vascular diseases such as atherosclerosis, in which inflammation has an important role. It is well known that inducible Ciclooxygenase-2 (COX-2) is responsible for prostanoid production associated with inflammation. Angiotensin II may be implicated through the expression of COX-2 in the vascular wall. The purpose of this study was to examine in angiotensin II-stimulated adventitial fibroblasts the anti-inflammatory activity of different food peptides by inhibiting COX-2 expression, and the production of pro-inflammatory prostanoids. Fibroblasts from aorta of Sprague-Dawley rats were incubated with different food derived peptides followed by incubation with Angiotensin II. COX-2 expression was determined by western blot, transcriptional activity by luciferase assays and prostaglandin E2 by enzyme immunoassay. COX-2 expression was inhibited in the presence of Val-Pro-Pro (bovine β-casein 84–86), Arg-Asp-Ile-Leu-Asn-Gln (ovalbumin 84–89) and Tyr-Arg-Gly-Gly-Leu-Glu-Pro-Ile-Asn-Phe (ovalbumin 125–134). Angiotensin II-induced prostaglandin E2 production was also reduced by all the above-mentioned sequences. The incubation with ovalbumin-derived peptides displayed a significant reduction of COX-2 promoter activity compared to the stimuli with Angiotensin II in transiently transfected cells. These three sequences could potentially be used as functional food ingredients to reduce inflammation related to cardiovascular diseases.

Background: Methotrexate (MTX) displayed cytotoxic properties against some cancer cells. However, there is very limited data about the possible anti-tumoral potential of them in breast cancer (BC) cells. We aimed to determine the effects of MTX, which is widely used in clinical practice, on cell viability, Hypoxia-inducible factor (HIF) -1α, HIF-2α and prolyl 4-hydroxylase-transmembrane (P4H-TM) in BC cells (MCF-7) and health breast cell (HTERT-HME1) treated with MTX. Methods: Human healthy breast cells (HTERT-HME1) and BC cells (MCF-7) treated with MTX for 24 h, 48h, and 72 h, the effects of MTX on cell viability. Results: The cell viability and with half-maximal inhibitory concentration (IC50) values of of MTX treatment in healthy breast cells were determined to be higher than in MCF-7 cells. MTX showed higher cytotoxicity against MCF-7 cells. MTX significantly reduced cell viability values in HTERT-HME1 and MCF-7 cells. HIF-1α, HIF-2α, and P4H-TM levels was significantly higher in the MCF-7 group than the other groups. Morever, there was a moderate significant correlation between HIF-1α and HIF-2α levels and between HIF-1α and P4H-TM. Conclusions: MTX will show a further decrease in cell viability in long-term treatments of 48 and 72 hours, it is predicted that short-term use may be more appropriate. P4H-TM may be a novel regulator of hypoxia in BC cells. HIF-1α, a key protein responsible for the molecular mechanism of hypoxia in cells, is a key mediator between P4H-TM and hypoxia in MTX-treated cells. HIF-1α, HIF-2α, and P4H-TM values may be markers that can be used as a panel to differentiate BC from healthy women.

Mangifera indica (mango), a member of the Anacardiaceae family, is renowned for its diverse pharmacological properties, encompassing antidiabetic, antioxidant, antiviral, cardiotonic, hypotensive, and anti-inflammatory effects. The present study delves the insulin-releasing and glucose-lowering potential of the ethanolic extract of Mangifera indica (EEMI) leaves in streptozotocin (STZ)-induced type 2 diabetic rats, concurrently investigating its phytoconstituents. EEMI's effects on insulin secretion were measured using BRIN BD11 β-cells and isolated mouse islets. It’s enzymatic inhibitory properties on carbohydrate digestion, glucose absorption, and free radicals were investigated using starch digestion, glucose diffusion and DPPH assay methods. In-vivo parameters including lipid profile and liver glycogen content were assessed on streptozotocin-induced type 2 diabetic rats. EEMI exhibited a dose-dependent increase in insulin secretion from clonal pancreatic BRIN BD11 β-cells and isolated mouse islets. EEMI inhibited starch digestion, glucose diffusion over time and DPPH activity in vitro. In acute in vivo studies, EEMI improved food intake, oral glucose tolerance. Moreover, following 28 days of treatment with EEMI, a remarkable amelioration in body weight, fasting blood glucose, plasma insulin, liver glycogen content, total cholesterol, triglyceride, LDL, VLDL and HDL levels were observed. Further phytochemical analysis with EEMI identified the presence of alkaloids, tannins, saponins, steroids, glycosides, flavonoids, and reducing sugar. The synergistic effects of EEMI, potentially attributable to naturally occurring phytoconstituents, hold promise for the development of enriched antidiabetic therapies, offering a promising avenue for the management of type 2 diabetes.

Type 2 diabetes mellitus(T2DM) is an increasingly prevalent and serious health problem. Its onset is typically associated with metabolic disorders and disturbances in the gut microbiota. Previous studies have reported the anti-T2DM effects of Pueraria thomsonii Radix as a functional food. However, the mechanism of action is still unknown. In this study, the effects of Pueraria thomsonii Radix water extract(PTR) on db/db mice were evaluated by pharmacology, metabolomics, and 16S rRNA gene sequencing. The results showed that PTR could improve the body weight of mice, reduce fasting blood glucose(FBG), urinary glucose(UGLU), homeostasis model assessment insulin resistance(HOMA-IR), urinary albumin/creatinine ratio(UACR), and reduce pancreatic tissue damage. Metabolomics showed that the Model group produced 109 differential metabolites, of which 74 could be regulated by PTR. 16S rRNA sequencing was done in fecal samples and results showed that PTR could reduce the Firmicutes/Bacteroidetes ratio(F/B) associated with obesity and regulate 3 beneficial bacteria and 1 harmful bacteria. In conclusion, the results showed that PTR could ameliorate T2DM symptoms, metabolic disorder, and gut microbiota imbalance of db/db mice, and it was superior to metformin in some aspects. We suggested for the first time that γ-aminobutyric(GABA) may be involved in the regulation of the microbiota-gut-brain axis(MGB) and thus affect the metabolic disorders associated with T2DM. This study will provide a scientific basis for the development of functional food with PTR.

Connexin 43 (Cx43) is expressed in kidneys and constitutes a feedforward mechanism leading to inflammation in other tissues where they form hemichannels and gap junction channels. However, the possible functional relationship between these membrane channels and their role in damaged renal cells remains unknown. Here, analyses of ethidium uptake and thiobarbituric acid reactive species revealed that TNF-α plus IL-1β increase Cx43 hemichannel activity and oxidative stress in MES-13 cells, a cell line derived from mesangial cells. The latter also was accompanied by a reduction in gap junctional communication, whereas western blotting analysis showed a progressive increase of phosphorylated MYPT (a substrate of RhoA/ROCK) and Cx43 upon TNF-α/IL-1β treatment. Additionally, inhibition of RhoA/ROCK strongly diminished the TNF-α/IL-1β-induced activation of Cx43 hemichannels and reduction in gap junctional coupling. We propose that activation of Cx43 hemichannels and inhibition of cell coupling during pro-inflammatory conditions could contribute to oxidative stress and damage of mesangial cells via the RhoA/ROCK pathway.

Abstract: Abnormal growth of oligodendrocyte precursor cells (OPCs) importantly contributes to the progression of glioblastoma tumors. Hence, molecules that block OPC growth may be of therapeutic importance in treating gliomas. 2-methoxyestradiol (2ME), an endogenous tubulin interacting metabolite of estradiol is effective against multiple proliferative disorders. Based on its anti-carcinogenic and anti-angiogenic actions it is undergoing phase II clinical trials. We hy-pothesize that 2ME may prevent glioma growth by targeting OPC growth. Here we tested this hypothesis by assessing the impact of 2ME on growth of OPC cell line “Oli-neu” and dissected the underlying mechanism(s). Treatment with 2ME inhibited OPC growth in a concentra-tion-dependent manner and accompanied with significant upregulation in expression of p21 and p27, negative cell cycle regulators. Moreover, treatment with 2ME altered OPC morphology from multi-arm processes to rounded cells. At concentrations of 1uM and greater 2ME induced apoptosis with increased expression of caspase 3, PARP and caspase-7 fragments, externalized phosphatidylserine staining / apopercentage and increased mitochondrial activity. Flow-cytometry and microscopic analysis demonstrated that 2ME triggers endoreduplication in a concentration-dependent fashion. Importantly, 2ME induced cyclin E, JNK1/2 and p53 expres-sion as well as OPC cell fusion, key mechanisms driving endoreduplication or whole-genome duplication. Importantly, inhibition of p53 with pfithrin-α rescued 2ME-induced endoreduplica-tion. The pro-apoptotic and endoreduplication actions of 2ME were accompanied with upregula-tion of survivin, cyclin A, Cyclin B, Cyclin D2, ppRB. Taken together our findings provide evi-dence that 2ME not only inhibits OPC growth and triggers apoptosis, but also activates OPCs in a survival - fight or flight mode leading to endoreduplication. This inherent survival character-istic of OPCs may, in part be responsible for drug resistance in gliomas as observed for many tubulin interacting drugs. Importantly, the fate of OPCs after 2ME treatment may depend on cell-cycle status of the individual cells. Combining tubulin-interfering molecules with drugs, such as pfithrin-α, that inhibit endoreduplication may help inhibit OPC/glioma growth and lim-it drug resistance.

O26 enteropathogenic Escherichia coli (EPEC), possesses a unique pseudocapsule composed of polysaccharides identical to the O antigen in their lipopolysaccharide (LPS) membrane. Therefore, the impact of O26 polysaccharides on the immune evasion mechanisms of capsulated O26 EPEC was investigated. Our findings reveal that the concentration of GlcNAc, an immunodominant unit of O26 polysaccharides capable of activating the MBL (Mannose Biding Lecting) pathway of the complement system, was found to be lower in capsulated EPEC O26 compared to naked shiga toxin-producing E. coli (STEC) O26 strain. It was noted that, unlike the naked STEC strain, the capsulated EPEC O26 strain was protected against lysis by the alternative pathway of the com-plement system by inhibiting C3b adhesion to its bacterial surface. Capsulated EPEC O26 strains were also able to avoid phagocytosis by macrophages. However, the immune evasion provided by the capsule was overcome in the presence of anti-O26 polysaccharide antibodies. Additionally, these antibodies were able to recognize O26 EPEC in the presence of biofilm and inhibit their adhesion to human epithelial cells. Overall, the results indicate that the O26 polysaccharides can generate an effective humoral immune response, making them promising antigens for the de-velopment of a vaccine against capsulated O26 E. coli

Introduction: This study aims to investigate the activity of the remdesivir-nirmatrelvir combination against Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2) and to report a case of Coronavirus Disease 2019 (COVID-19) cured with this combination. Methods: A Vero E6 cell-based infection assay was used to investigate the in vitro activity of the remdesivir-nirmatrelvir combination. The SARS-CoV-2 strains tested were 20A.EU1, BA.1 and BA.5. After incubation, a viability assay was performed. The supernatants were collected and used for viral titration. The Highest Single Agent (HSA) reference model was calculated. An HSA score >10 is considered synergic. Results: Remdesivir and nirmatrelvir showed synergistic activity at 48 and 72 h with an HSA score of 52.8 and 28.6, respectively (p<0.0001). This data has been confirmed performing supernatant titration and against the omicron variants: the combination reduced the viral titer better than the more active compound alone. An immunocompromised patient with prolonged and critical COVID-19 was successfully treated with remdesivir, nirmatrelvir/ritonavir, tixagevimab/cilgavimab, and dexamethasone, with an excellent clinical-radiological response. However, she required further off-label prolonged therapy with nirmatrelvir/ritonavir up to the negativization. Conclusion: Remdesivir-nirmatrelvir combination has synergic activity in vitro. This combination may have a role in immunosuppressed patients with severe COVID-19 and prolonged viral shedding.

Neurological disorders have been reported in a large number of coronavirus disease 2019 (COVID-19) patients, suggesting that this disease may have long-term adverse neurological consequences. COVID-19 occurs from the infection by a positive-sense single-stranded RNA virus called severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The membrane fusion protein of SARS-CoV-2, the spike protein, binds to its human host receptor, angiotensin-converting enzyme 2 (ACE2), to initiate membrane fusion between the virus and host cell. The spike protein of SARS-CoV-2 contains the furin protease recognition site and its cleavage enhances the infectivity of this virus. The binding of SARS-CoV-2 to the ACE2 receptor has been shown to downregulate ACE2, thereby increasing the levels of pathogenic angiotensin II (Ang II). The furin protease cleaves between the S1 subunit of the spike protein with the binding domain toward ACE2 and the S2 subunit with the transmembrane domain that anchors to the viral membrane, and this activity releases the S1 subunit into the blood circulation. The released S1 subunit of the spike protein also binds to and downregulates ACE2, in turn, increasing the level of Ang II. Considering that a viral particle contains many spike protein molecules, furin-dependent cleavage would release many free S1 protein molecules each of which can downregulate ACE2, while the infection with a viral particle only affects one ACE2 molecule. Therefore, the furin-dependent release of S1 protein would dramatically amplify the ability to downregulate ACE2 and produce Ang II. We hypothesize that this amplification mechanism that the virus possesses, but not the infection per se, is the major driving force behind COVID-19 associated neurological disorders.

The X-ray induced spin crossover transition of an Fe(II) molecular thin film in the presence and absence of a magnetic field has been investigated. The thermal activation energy barrier in the soft X-ray activation of the spin crossover transition for [Fe{H2B(pz)2}2(bipy)] molecular thin films is reduced in the presence of an applied magnetic field, as measured through X-ray absorption spectroscopy at various temperatures. The influence of a 1.8 T magnetic field is sufficient to cause deviations from the expected exponential spin state transition behavior that is measured in the field free case. We find that orbital moment diminishes with increasing temperature, relative to the spin moment in the vicinity of room temperature.

The coronavirus disease 2019 (COVID-19) was officially declared a pandemic on the 11^th March 2020. It is caused by the novel severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), impacting the lower respiratory tract. International travel to Australia during the early stages of the pandemic prior to border closure provided avenues for this virus to spread into Australia. There is little understanding of the clonality of SARS-CoV-2 isolates in Australia, and where they originated. This study aimed to investigate the clonality and ancestral sources of SARS-CoV-2 isolates in Australia using in silico methods. We retrieved 1,346 complete genomes from Australia along with 153 genomes from other countries from the NCBI nucleotide database and Global Initiative On Sharing All Influenza Data (GISAID). We then constructed a representative population of 270 sequences for downstream phylogenetic analysis and ancestral area reconstruction. Overall, two major clusters, one stemming from Europe and another from Asia, especially East Asia, were observed, implying at least two major transmission events with subsequent clades confirming the multiclonality of Australian isolates. We also identified three potential dissemination routes of SARS-CoV-2 into Australia. This study supports the hypothesis of multiple clonality and dispersals of SARS-CoV-2 isolates into Australia.

A population-based seroepidemiological and molecular survey for detection of earlier and re-cent SARS-CoV-2 infection was done in children aged 14 years or less in Tehran between 19 September 2020 and 21 June 2021. Demographic data, COVID-19 symptoms and infection status were recorded and IgG antibodies and RNA of SARS-CoV-2 were detected in sera and nasopha-ryngeal swab samples, respectively. Out of 1517 participants, cardinal symptoms of COVID-19 (fever >38 oC and/or cough and/or diarrhea) were detected in 18% and serological history of SARS-CoV-2 infection and PCR positivity were confirmed in 33.2% and 10.7% of the weighted-population, respectively. SARS-CoV-2 infection was significantly higher among 10–14-year-old children. Active infection was significantly higher in symptomatic children and during autumn 2020 and spring 2021. The RT-qPCR positivity was related to contact with in-fected persons. RT-qPCR positivity was significantly higher among families with a lower socio-economic status, while no association between RT-qPCR- or seropositivity was determined with household size, underlying diseases, or gender. In conclusion, high SARS-CoV-2 infection prev-alence and seroprevalence was detected in children in Tehran in different seasons. The infection was significantly higher in older age children, and those with a positive-history of close contact with infected cases and/or lower socioeconomic status.

Abstract: Commercialization of extra virgin olive oil (EVOO) requires a best before date recom-mended at up to 24 months after bottling, stored under specific conditions. Thus, it is expected that the product retains its chemical properties and preserves its ‘extra virgin’ category. However, in-adequate storage conditions could alter the properties of EVOO. In this study, Arbequina EVOO was exposed to five storage conditions for up to one year to study the effects on the quality of the oil and the compounds responsible for flavor. Every 15 or 30 days, samples from each storage condition were analyzed determining physicochemical parameters, the profiles of phenols, volatile compounds, α-tocopherol and antioxidant capacity. Principal component analysis was utilized to better elucidate the relationships between composition of EVOOs and the storage conditions. EVOOs stored at -23 and 23 °C in darkness and 23 °C with light, differed from the oils stored at 30 and 40 °C in darkness. The former were associated with higher quantity of non-oxidized phenolic compounds and the latter with higher elenolic acid, oxidized oleuropein and ligstroside derivatives, which also increased with storage time. E-2-Nonenal (detected at trace levels in fresh oil) was selected as a marker of the degradation of Arbequina EVOO quality over time, with significant linear regressions identified for the storage conditions at 30 and 40 °C. Therefore, early oxidation in EVOO could be monitored by measuring E2-Nonenal levels.

INTRODUCTION: Achalasia is a pathology with an incidence of 1 in 100,000 inhabitants per year. There are very limited data on achalasia in the obese population, especially in those undergoing bariatric surgery. The approach of choice for cases of achalasia is fundoplication to correct the reflux; however, lacking a fundus due to a previous gastrectomy, an alternative that offers optimal results should be chosen. Here we present the surgical approach in a case of esophageal achalasia and a history of vertical sleeve gastrectomy, where we performed simultaneous Heller's cardiomyotomy and laparoscopic Roux-en-Y gastric bypass, as well as the results obtained. CASE PRESENTATION: 44-year-old woman with no chronic degenerative diseases, with a previous record of vertical sleeve gastrectomy 5 years ago, who started 1 year and 5 months earlier with dysphagia to liquids, then to solids, in addition to weight loss of 10 kilograms in 4 months. The BMI before vertical sleeve gastrectomy was 32 kg/m2, her BMI at the time of admission was 20 kg/m2; she also presented regurgitation and generalized weakness. After analyzing the surgical options, it was decided to perform a Heller cardiomyotomy and a Roux-en-Y gastric bypass. DISCUSSION AND CONCLUSIONS: The procedure turned out to be safe and successful in treating achalasia symptomatology, in addition to complete resolution of the reflux symptom.

We produced a recombinant eel luteinizing hormone (rec-eel LH) analog with high potency in Chinese hamster ovary DG44 (CHO DG44) cells. The eel LH mutant (LH-M), which had a linker comprising the equine chorionic gonadotropin (eCG) β-subunit carboxyl-terminal peptide (CTP) region (amino acids 115 to149), was inserted between the β-subunit and α-subunit of wild-type tethered eel LH (LH-wt). Monoclonal cells transfected with the eel LH-wt and eel LH-M plasmids were isolated from five and nine clones of CHO DG44 cells, respectively. The secreted quantities abruptly increased on day 3, with peak levels of 5,000–7,500 ng/mL on day 9. The molecular weight of eel LH-wt was 32–36 kDa while that of eel LH-M increased to approximately 38–44 kDa, indicating the detection of two bands. Treatment with peptide N-glycanase F decreased the molecular weight by approximately 8 kDa. The oligosaccharides at the eCG β-subunit O-linked glycosylation sites were appropriately modified post-translation. The EC50 value and maximal responsiveness of eel LH-M increased by approximately 2.90- and 1.29-fold, respectively, indicating that the mutant exhibited more potent biological activity than eel LH-wt. Phosphorylated extracellular regulated kinase (pERK1/2) activation resulted in a sharp peak 5 min after agonist treatment, with a rapid decrease thereafter. These results indicate that the new rec-eel LH analog which contains the eCG β-subunit CTP linker comprising O-linked glycosylation sites, had more potent activity than the wild-type in vitro. Taken together, this new eel LH analog can be produced in large quantities using a stable CHO DG44 cell system.

The study aimed to compare the cardiovascular benefits of Omega-3 Polyunsaturated Fatty Acids from fish oil versus krill oil in different forms and dosages. Following PRISMA 2015, data analysis with R software, and databases were searched from 1993 to 2023, (ID PROSPERO: CRD42024502338). Sixty high-quality studies were analyzed, covering various forms of fish oil and krill oil at different dosages (fish oil (ethyl ester-EE, triglyceride-TG, re-esterified triglycerides-rTG, capsules, emulsion-EM); krill oil (phospholipid/free fatty acid-PL/FFA, high concentration phospholipid-HPL, low concentration phospholipid-LPL)). Meta-analysis revealed that krill oil with phospholipid/free fatty acid at doses 2000-2900 mg effectively lowered triglycerides, while fish oil in ethyl ester form at doses above 3000 mg significantly reduced total cholesterol. Fish oil in triglyceride form at doses 2000-2900 mg and other variations positively impacted HDL-C levels. Fish oil in EE form above 3000 mg and triglyceride form below 2000 mg notably reduced LDL-C. However, there was limited effectiveness observed for other interventions. Analysis for LDL-C exhibited publication bias, while other parameters demonstrated reliability (Egger's test). In conclusion, krill oil - PL/FFA, Fish oil - EE above 3000 mg, Fish oil - TG 2000-3000 mg, and fish oil - rTAG 300-1900 mg effectively in reducing heart risk patients.

Objective: On March 11, 2020 the WHO declared that COVID-19 is pandemic. Among the risk factors for many infectious diseases, a role of the ABO blood group system is reported in the literature. We argue whether it is necessary to investigate the relationship between ABO blood groups and susceptibility to SARS-CoV-2 infection and if we should consider some blood groups as potential risk factors for COVID-19. Results: Based on the scientific evidence reported in this letter, we believe that further studies are needed to investigate how the ABO polymorphism influences the host susceptibility, individual response and clinical risk for SARS-CoV-2 infection.

In this paper we first provide a primer on SARS-CoV-2 and Covid-19 delineating the etiopathogenesis, epidemiology, clinical manifestations and the natural history of the disease. We then trace the evolution of the Covid-19 pandemic highlighting the characteristics of the epidemic in China where the pandemic originated, select countries of Europe which peaked during April, and Brazil, US and India where the pandemic has taken serious turns recently. We also project some possible trajectories for the mega cities of India based on the demographic characteristics of these cities in comparison to New York city. This is an updated version of the article from mid-April published online.

COVID-19 disease outbreak was started in the December, 2019 in the Wuhan city of China which is also known as the largest transportation hub of China. During the spring festival of China the situation become epidemic. Soon, the virus is imported to many regions including the low income countries. Till now, 234073 infected reported cases of the COVID-19 in the world with the total of 9840 deaths (March 20, 2020). The common symptoms of the COVID-19 are the cough, high fever, sore throat, fatigue and breathlessness. The disease is found to be mild in most of the people, some of cases reported to the pneumonia also with multi organ dysfunction and acute ARDS (acute respiratory distress syndrome). It is found that the incubation period for the infection is 2-14 days which is usually 4 days in maximum of cases. India has reported 283 cases of COVID-19 infections till now with 4 deaths. India is still at stage 2 on local transmission as per WHO report 60. WHO reported 60 clearly stated that there is no community transmission occurred in India yet which can be prevented by the avoiding mass gathering and proper screening of the people. Govt. of India has taken many initiatives to minimize the spread of COVID-19 infection in the country. The infection rate of the COVID-19 in India remains low related to population size of the country. It is because of fast government action to quarantine the suspected people and shut down all its borders. There is a great slowdown in the global economy due to COVID-19 attack which is likely to costs around $1 trillion. The spread of COVID-19 infection can be reduced by minimizing the H-H transmissions. Still there is need of Anti-n-CoV drug development which can replace the supporting therapies for the treatment of infection.

The combination of freeze-dried aronia, red ginseng, ultraviolet-irradiated shiitake mushroom and natokinase (AGM; 3.4: 4.1: 2.4: 0.1) was examined to evaluate its effects on insulin resistance, insulin secretion and gut microbiome in a non-obese type 2 diabetic animal model. Pancreatectomized (Px) rats were provided high fat diets supplemented with either of 1) 0.5 g AGM (AGM-L), 2) 1 g AGM (AGM-H), 3) 1 g dextrin (control), or 4) 1g dextrin with 120 mg metformin (positive-control) per kg body weight for 12 weeks. AGM (1 g) contained 6.22 mg cyanidin-3-galactose, 2.5 mg ginsenoside Rg3 and 0.6 mg β-glucan. Px rats had decreased bone mineral density in the lumbar spine and femur and lean body mass in the hip and leg compared to the normal-control and AGM-L and AGM-H prevented the decrease. Visceral fat mass was lower in the control group than the normal-control group and its decrease was smaller by AGM-L and AGM-H. HOMA-IR was lower in descending order of the control, positive-control, AGM-L, AGM-H and normal-control groups. Glucose tolerance was deteriorated in the control group and it was improved by AGM-L and AGM-H more than in the positive-control group. Glucose tolerance is associated with insulin resistance and insulin secretion. Insulin tolerance indicated insulin resistance was highly impaired in diabetic rats, but it was improved in the ascending order of the positive-control, AGM-L and AGM-H. Insulin secretion capacity, measured by hyperglycemic clamp, was much lower in the control group than the normal-control group and it was improved in the ascending order of the positive-control, AGM-L and AGM-H. Diabetes modulated the composition of gut microbiome and AMG prevented the modulation of gut microbiome. In conclusion, AGM improved glucose metabolism by potentiating insulin secretion and reducing insulin resistance in insulin deficient type 2 diabetic rats. The improvement of diabetic status alleviated body composition changes and prevented changes of gut microbiome composition.

Dysregulation of cartilage homeostasis and the changes in the density and the architecture of the subchondral bone were postulated as a potent mechanically pathological activity contributing to osteoarthritis (OA) pathogenesis. Extracorporeal shockwave therapy (ESWT) is a new, none invasive and effective method in the treatment of animal OA model. In the current study, we demonstrated that shockwave induced the expression of protein-disulfide isomerase-associated 3 (Pdia-3) which is a multifunctional protein hypothesized to be a significant mediator for 1α,25-Dihydroxyvitamin D3 (1α,25(OH)₂D₃) signaling pathway using two-dimensional electrophoresis. Histological analysis and quantitative polymerase chain reaction (qPCR) were verified and observed that the expression of Pdia-3 at 2 weeks was significantly higher than that of any other group at 4 weeks, 8 weeks, and 12 weeks post-shockwave treatment in early OA knee of rat. The other factors of the 1α,25(OH)₂D₃ rapid membrane signaling pathway including extracellular signal-regulated protein kinases 1 (ERK1), osteopontin (OPG), alkaline phosphatase (ALP), and matrix metallopeptidase 13 (MMP13) were measured and significantly increased by qPCR at 2 weeks post-shockwave treatment in early OA knee. Our proteomic data revealed significant Pdia-3 expression in microenvironments of joint tissue that could be actively responded to ESWT, which may potentially regulate biological function of chondrocytes and osteoblasts in the treatment of OA knee.

We report a small footprint cost-effective isothermal rapid DNA amplification system, with integrated microfluidics for automated sample analysis and detection of SARS-CoV-2 in human and environmental samples. Our system measures low-level fluorescent signal in real-time during amplification, while maintaining the desired assay temperature, on a low power, portable system footprint. A unique soft microfluidic chip design was implemented to mitigate thermocapillary effects and facilitate optical alignment for automated image capture and signal analysis. The system-on-board prototype coupled with the LAMP primers designed by BioCoS, is sensitive enough to detect viral loads of SARS-CoV-2 in a broad concentration range corresponding to a threshold cycle range of 16 to 39. Clinical specimens were tested at Kingston Health Sciences using a clinically validated PCR assay and variants were determined using whole genome sequencing.

Since the onset of the COVID‐19 pandemic, humanity has experienced the spread and circulation of several SARS-CoV-2 variants that differed in transmissibility, contagiousness, and the ability to escape from vaccine-induced neutralizing antibodies. However, issues related to the differences of variant-specific immune responses, remain insufficiently studied. The aim of this study was to compare the parameters of the humoral immune responses in two groups of patients with acute COVID-19 who were infected during the circulation period of the D614G and the Delta variants of SARS-CoV-2. Sera from 48 patients with acute COVID-19 were tested for SARS-CoV-2 binding and neutralizing antibodies using six assays. We found that serum samples from the D614G period demonstrated 3.9‐ and 1.6‐fold increase in RBD- and Spike‐specific IgG binding with Wild type antigens compared with Delta variant antigens (p &lt; 0.01). Cluster analysis showed the existence of two well-separated clusters. The first cluster mainly consisted of D614G period patients and the second cluster predominantly included patients from Delta period. The results thus obtained indicate that humoral immune responses in D614G- and Delta-specific infections can be characterized by variant-specific signatures. This can be taken into account when developing new variant-specific vaccines.

Biofilm-mediated infection is a major cause of bone prosthesis failure. The lack of molecules able to act in biofilms has driven research aimed at identifying new anti-biofilm agents via chemical screens. However, to be able to accommodate a large number of compounds, the testing conditions of these screenings end up being typically far from the clinical scenario. In this study, we assess the potential applicability of three anti-biofilm compounds (based on natural compounds) as part of implanted medical devices by testing them on in vitro systems that more faithfully resemble the clinical scenario. To that end, we used a competition model based on the co-culture of SaOS-2 mammalian cells and Staphylococcus aureus (collection and clinical strains) on a titanium surface. Additionally, we studied whether these derivatives of natural compounds enhance the previously proven protective effect of pre-incubating the titanium surface with SaOS-2 cells. Out of the three tested leads, one showed the highest potential, and can be regarded as a promising agent for incorporation into bone implants. This study emphasizes and demonstrates the importance of using meaningful experimental models, where potential antimicrobials ought to be tested for protection of biomaterials in translational applications.

Quaking aspen (Populus tremuloides Michx.) is an important deciduous species in western U.S. forests. Existing maps of aspen distribution are based on Landsat imagery and often miss small stands (&lt;0.09 ha or 30 m²), which rapidly regrow when managed or following disturbance. In this study, we present methods for deriving a new regional map of aspen forests using one year of Sentinel-1 (S1) and Sentinel-2 (S2) imagery in Google Earth Engine. We assessed the annual phenology of aspen in the Southern Rockies and leveraged the frequent temporal resolution of S1 and S2 to create ecologically relevant seasonal composites. Additionally, we derived spectral indices and radar textural features targeting the canopy structure, moisture, and chlorophyll content. Using spatial block cross-validation and Random Forests, we assessed the accuracy of different scenarios and selected the best performing set of features for classification. Comparisons were then made with existing landcover products across the study region. The resulting map improves on existing landcover products in both accuracy (average F1-score = 93.1%) and detection of smaller forest patches. These methods enable accurate mapping at spatial and temporal scales relevant to forest management for one of the most widely distributed tree species in North America.

Dysferlinopathies comprise a spectrum of muscular dystrophies characterized by progressive muscle weakness and degeneration due to mutations in the DYSF gene, which encodes the dysferlin protein critical for muscle membrane repair. This review delves into the clinical spectra of dysferlinopathies, their molecular mechanisms, and the spectrum of emerging therapeutic strategies. We explore the phenotypic heterogeneity of dysferlinopathies, highlight the incomplete understanding of genotype-phenotype correlations, and discuss the implications of various DYSF mutations. Furthermore, we examine the utility of animal models in elucidating disease mechanisms and the potential of symptomatic, pharmacological, molecular, and genetic therapies in mitigating the disease's progression. We also consider the roles of diet and metabolism in managing dysferlinopathies, as well as the impact of clinical trials on treatment paradigms. By culminating the complexities inherent in dysferlinopathies, this article emphasizes the need for multidisciplinary approaches, precision medicine, and extensive collaboration in research and clinical trial design to advance our understanding and treatment of these challenging disorders.

To stabilize the Earth’s climate a large-scale transition is needed to non-carbon emitting renewable energy technologies like wind and solar energy. Although these renewable energy sources are now lower-cost than fossil fuels, their inherent intermittency make them unable to supply a constant load without storage. To address these challenges rechargeable electric batteries are currently the most promising option; however, their high capital costs limit current deployment velocities. To both reduce the cost as well as improve performance 3D printing technology has emerged as a promising solution. This literature review provides the state-of-the-art enhancements of battery properties with 3D printing including efficiency, mechanical stability, energy and power density, customizability and sizing, production process efficiency, material conservation and environmental sustainability as well as the progress in solid-state batteries. The principles, advantages, limitations, and recent advancements associated with the most common types of 3D printing are reviewed focusing on their contributions to the battery field. 3D printing batteries offer design flexibility, material flexibility, reduces pack weight, minimizes material waste, increases the range of applications and has the potential to reduce costs. As 3D printing technologies become more accessible, the prospect of cost-effective production for customized batteries is extremely promising.

COVID-19 pandemic in first seven months has led to more than 15 million confirmed infected cases and 600,000 deaths. SARS-CoV-2, the causative agent for COVID-19 has proved a great challenge for its ability to spread in asymptomatic stages and a diverse disease spectrum it has generated. This has created a challenge of unimaginable magnitude not only affecting human health and life but also potentially generating a long-lasting socioeconomic impact. Both medical sciences and biomedical research have also been challenged consequently leading to a large number of clinical trials and vaccine initiatives. While known proteins of pathobiological importance are targets for these therapeutic approaches, it is imperative to explore other factors of viral significance. Accessory proteins are one such trait that have diverse roles in coronavirus pathobiology. Here we analyze certain genomic characteristics of SARS-CoV-2 accessory protein ORF8, predict upon its protein features and review current available literature regarding its function. We have also undertaken review of ORF8 homolog ORF8ab from SARS-CoV with a purpose of developing holistic understanding of these proteins for reason that coronaviruses have been infecting humans repeatedly and might continue to do so. Despite low nucleotide and protein identity and differentiating genome level characteristics, there appears to be significant structural integrity and functional proximity between these proteins pointing towards their high significance. There is further need for comprehensive genomics and structural-functional studies to lead towards definitive conclusions regarding their criticality and that can eventually define their relevance to therapeutics development.

Matrix metalloproteinases (MMPs) are critical enzymes involved in a variety of cellular processes. MMPs are well known for their ability to degrade the extracellular matrix (ECM) and their extracellular role in cell migration. Recently, more research has been conducted on investigating novel subcellular localizations of MMPs and their intracellular roles at the respective locations. In this review article, we focus on the subcellular localization and novel intracellular roles of two MMPs closely related: membrane-type-1 matrix metalloproteinase (MT1-MMP) and matrix metalloproteinase-2 (MMP-2). Although MT1-MMP is commonly known to localize on the cell surface, the protease also localizes to the cytoplasm, caveolae, Golgi, cytoskeleton, centrosome, and nucleus. At these subcellular locations, MT1-MMP functions in cell migration, macrophage metabolism, invadopodia development, spindle formation and genes expression, respectively. Similar to MT1-MMP, MMP-2 localizes to the caveolae, mitochondria, cytoskeleton, nucleus and nucleolus, and functions in calcium regulation, contractile dysfunction, genes expression and ribosomal RNA transcription. Our particular interest lies in the role MMP-2 and MT1-MMP serve within the nucleus, as it may provide critical insights into cancer epigenetics and tumor migration and invasion. We suggest that targeting nuclear MT1-MMP or MMP-2 to reduce or halt cell proliferation and migration may lead to the development of new therapies in cancer and other diseases.

This tutorial is organized into three major sections—viruses, vaccines and the race for a Covid-19 vaccine. The goal is to provide enough background on viruses, history of vaccines, and the science of vaccinology founded on the principles of immunity. The hope is that this will enable us to understand the challenges, methods and prospects for developing a safe and effective vaccine against SARS-CoV-2. Many important viruses such as smallpox, HIV, HCV and SARS-CoV-2 which is responsible for causing the Coronavirus disease 2019 (Covid-19) are presented in detail, which is then followed by a description of different vaccine development methods and strategies. The tutorial then discusses different candidate SARS-CoV-2 vaccines and provides specific details of many of the prospective vaccines on the leader-board which are undergoing clinical trials. The tutorial concludes with a realistic projection for a safe and effective vaccine against SARS-CoV-2 based on the historical scientific record.

It is proposed that both human creativity and human consciousness are (unintended) consequences of the human brain’s extraordinary energy efficiency. The topics of creativity and consciousness are treated separately, though have a common sub-structure. It is argued that creativity arises from a synergy between two cognitive modes of the human brain (which broadly coincide with Kahneman’s Systems 1 and 2). In the first, available energy is spread across a relatively large network of neurons. As such, the amount of energy per active neuron is so small that the operation of such neurons is susceptible to thermal (ultimately quantum decoherent) noise. In the second, available energy is focussed on a small enough subset of neurons to guarantee a deterministic operation. An illustration of how this synergy can lead to creativity with implications for computing in silicon are discussed. Starting with a discussion of the concept of free will, the notion of consciousness is defined in terms of an awareness of what are perceived to be nearby counterfactual worlds in state space. It is argued that such awareness arises from an interplay between our memories on the one hand, and quantum physical mechanisms (where, unlike in classical physics, nearby counterfactual worlds play an indispensable dynamical role) in the ion channels of neural networks. As with the brain’s susceptibility to noise, it is argued that in situations where quantum physics plays a role in the brain, it does so for reasons of energy efficiency. As an illustration of this definition of consciousness, a novel proposal is outlined as to why quantum entanglement appears so counter-intuitive.

Emerging viruses description have grown at an unprecedented rate since the beginning of the 21^st century. The emergence of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) and its related illness, Coronavirus Disease 2019 (COVID-19) has been reported as the third highly pathogenic coronavirus introducing itself into human population in the current era after the SARS-CoV and Middle East Respiratory Syndrome (MERS-CoV). Molecular and cellular studies considering the pathogenesis of this novel coronavirus are still in the early stages of research, however, regarding the similarity of SARS-CoV-2 and other coronaviruses, it could be hypothesized that the NF-κB, Cytokine regulation, ERK, and TNF-α signaling pathways are the more likely causes of inflammation upon onset of COVID-19. There are several drugs prescribed and used to alleviate the activity of these inflammatory cellular signaling pathways which might be beneficial for developing novel therapeutic modalities against COVID-19. In this review, we briefly summarized the alteration of cellular signaling pathways affected by coronavirus infection, particularly SARS-CoV and MERS-CoV and tabulated the current therapeutic agents approved for previous human diseases.

Bacteremia and fungemia are significant causes of morbidity and mortality which frequently occur as co-infections with viral respiratory infections including SARS-CoV-2. It was aimed to evaluate the microorganisms isolated from blood cultures of SARS-CoV-2 positive and negative patients and investigate their antimicrobial resistance patterns. A retrospective analysis was performed with the total number of 22,944 blood cultures sent to the laboratory between November 2020 and December 2021. Blood cultures were performed on the BD Bactec automated system. Identification was performed using conventional methods, VITEK-2 and MALDI-TOF MS. Antibacterial/antifungal susceptibility tests were performed according to EUCAST/CLSI recommendations. SARS-CoV-2 tests were performed with RT-PCR. It was detected 1,630 culture positivity belonging to 652 patients. Totally 633 of 652 patients were tested for SARS-CoV-2; 118 (18.6%) were positive and 515 (81.3%) were negative. The bacteria and fungi isolated at the high-est rate in SARS-CoV-2 positive patients were methicillin-resistant coagulase negative staphylococci (MR-CoNS) (21.5%), Escherichia coli (12.4%), Klebsiella pneumoniae (12.4%), Candida albicans (1.65%) and Candida glabrata complex (1.65%); while in negative patients, E. coli (21.3%), MR-CoNS (13.5%), K. pneumoniae (12.05%), C. albicans (2.1%), Candida parapsilosis (1.1%) and Candida tropicalis (0.9%). The fact that the most common isolate was MR-CoNS in SARS-CoV-2 positive patients (p = 0.028); the detection of Acinetobacter baumannii was more frequent (p = 0.001) and the isolation of carbapenem-resistant K. pneumoniae was at a higher rate than in SARS-CoV-2 negative patients; also, the increase in multidrug-resistant strains indicate that healthcare-associated infec-tions should not be disregarded while focusing on the outbreak.

Aim: Exposure to polycyclic aromatic hydrocarbons (PAHs) has been in the past associated with adverse effects on human health among which belong also respiratory diseases. Our study is focused on the evaluation of PAH exposure by measuring the concentrations of their monohydroxylated metabolites (OH-PAHs) in urine and comparing their concentrations with the incidence of respiratory diseases in 2-year-old children from two locations of the Czech Republic – a control locality Ceske Budejovice and a previously highly contaminated mining district Most. Methods: The total number of 248 participants were sampled for urine samples that were analysed for the presence of 11 OH-PAHs using liquid-liquid extraction with ethyl acetate and clean-up employing dispersive solid phase extraction with a sorbent Z-Sep. Separation, identification and quantification of the target compounds was achieved by ultra-high performance liquid chromatography coupled to tandem mass spectrometry. The incidence of respiratory diseases was evaluated according to the questionnaires provided by the paediatricians. Results and discussion: The concentrations of measured OH-PAHs were higher in the urine samples collected from 2-year-old children living in Most compared to 2-year-old children from Ceske Budejovice. The same trend was observed also when the urine samples were analysed when these children were studied as newborns in our previous study. From all of the monitored respiratory diseases, only influenza due to unidentified influenza virus showed a difference between tested locations where the 2-year-old children living in Most were more frequently diagnosed with this disease. Conclusion: Even though the air pollution and lifestyle in both cities is very similar, we have observed higher incidence of respiratory diseases as well as higher concentration of OH-PAHs in urine of the 2-year-old children from Most. Therefore, we hypothesize that the population living in this previously highly contaminated location (in 1970s and 1980s) can carry some long-term health burden.

The Coronavirus Disease 2019 (COVID-19) pandemic has resulted in a significant surge of critically ill patients and an unprecedented demand on intensive care services. The rapidly evolving understanding of pathogenesis, limited disease specific evidence and demand-resource imbalances have posed significant challenges for intensive care clinicians. COVID-19 is a complex multisystem inflammatory vasculopathy with a significant mortality implication for those admitted to intensive care. Institutional strategic preparation and meticulous intensive care support are essential to maximising outcomes during the pandemic. The significant mortality variation observed between institutions and internationally, despite a single aetiology and uniform presentation, highlights the potential influence of management strategies on outcome. Given that optimal organ support and adjunctive therapies for COVID-19 have not yet been well defined by trial-based outcomes, strategies are predicated on existing literature and experiential learning. This review outlines the relevant pathophysiology and management strategies for critically ill patients with COVID-19, and shares some of the collective learning accumulated in a high volume Severe Respiratory Failure centre in London.

Abstract. The COVID-19 has turned in to a global human tragedy and economic devastation. Governments have implemented lockdown measures, blocked international travel, and enforced other public containment measures to mitigate the virus morbidity and mortality. As of today, no drug has the power to fight the infection and bring normalcy to the utter chaos. This leaves us with only one choice namely an effective and safe vaccine that shall be manufactured as soon as possible and available to all countries and populations affected by the pandemic at an affordable price. There has been an unprecedented fast track path taken in R&D by the World community for developing an effective and safe vaccine. Platform technology has been exploited to develop candidate vaccines in a matter of days to weeks and as of now, 108 such vaccines are available. Six of these vaccines have entered clinical trials. As clinical trials are ‘rate-limiting’ and ‘time-consuming’, many innovative methods are in practice for a fast track. These include parallel phase I-II trials and obtaining efficacy data from phase IIb trials. Human ‘challenge experiments’ to confirm efficacy in humans is under serious consideration. The availability of the COVID-19 vaccine has become a race against time in the middle of death and devastation. There is an atmosphere of tremendous hype around the COVID-19 vaccine and developers are using every moment to make claims, which remain unverified. However, concerns are raised about a rush to deploy a COVID-19 vaccine. Applying ‘Quick fix’ and ‘short cuts’ can lead to errors with disastrous consequences.

Background: Dental professions are at high risk of contracting novel corona virus (COVID-19) infections during the dental procedure due to the droplets and aerosols generated during various dental procedures on infected patients. To prevent and avoid the cross-infection of the infection to dental professionals or the patients attending the dental clinic, good knowledge of the infection and its prevention mechanisms is mandatory among the professionals. Until to date, there is no pooled estimate on the knowledge,attitude and practice (KAP) of dental professionals to COVID-19 in the globe. Hence, this study aimed to determine the pooled estimate of KAP of dental professionals in this pandemic disease. Methods: Article search was done electronically using Medline, Scopus, Web of Science, EMBASE, SciELO and Google Scholar from June 1, 2020 to August 20, 2020. All studies that assessed the KAP of dental professionals to COVID-19 were searched and included in this review after passing the inclusion criteria. The pooled analysis of their knowledge (sign and symptom, mode of transmission and prevention mechanisms), attitude (their concern, intention to treat suspected patients) and practice (face mask usage, hand washing and alcohol based hand rub usage, handshaking practice, deferred procedures and checkup of patients temperature) was computed using RevMan 5.3 and random effect model was used. The presence of publication bias was assessed using the funnel plot. Results: Twelve articles with a total of 5,362 study participants were included in this study. The pooled estimate revealed that 59.91% of the dental professionals had good knowledge of the signs and symptoms of COVID-19. Two-third of dental professionals know the prevention mechanisms of the infection, and 70.13% had enough knowledge of the transmission modalities of the infection. The professional attitude revealed that only 36.43% of the participants had intention to treat a patient with cough or suspected COVID-19 (36.43%, 95%CI: 8.57, 64.29). Moreover, 47.85% of the dentists were concerned about their life, and the fate of their profession due to this pandemic disease (47.85%, 95%CI: 26.74, 68.97). The pooled analysis showed only 50.86% (95%CI: 18.64, 83.09) of the study participants worn face mask and 52.63% (95%CI: 10.54, 94.71) had avoided handshaking practice during this pandemic period. Non-emergency dental procedures were canceled by 83.98%. Conclusion: The dental professional KAP is not optimal. Thus, dental professionals should be aware of the recently updated knowledge about COVID-19 and practice according to the standards of treatment guidelines, and the recommended infection control measures in dental settings. Moreover, as saliva and droplets are the major sources of infection, dentists should follow essential protocols to regulate droplet and aerosol contamination in the dental practice

Abstract: The purpose of this study was to understand the role of infection in the origin of chromosomal anomalies linked to neurodevelopmental disorders. In patients with neurodevelopmental disorders, DNA’s from viruses and bacteria including known teratogens were tested against chromosome anomalies known to cause the disorders. Results support a theory that parental infections disrupt elaborate multi-system gene coordination needed for neurodevelopment. Genes essential for neurons, lymphatic drainage, immunity, circulation, angiogenesis, barriers, structure, and chromatin activity were all found close together in polyfunctional clusters that were deleted in neurodevelopmental disorders. These deletions account for immune, circulatory, and structural deficits that accompany neurologic deficits. In deleted clusters, specific and repetitive human DNA matched infections and passed rigorous artifact tests. In some patients, epigenetic driver mutations were found and may be functionally equivalent to deleting a cluster or changing topologic chromatin interactions because they change access to large chromosome segments. In three families, deleted DNA sequences were associated with intellectual deficits and were not included in any database of genomic variants. These sequences were thousands of bp and unequivocally matched foreign DNAs. Analogous homologies were also found in chromosome anomalies of a recurrent neurodevelopmental disorder. Viral and bacterial DNAs that match repetitive or specific human DNA segments are thus proposed to interfere with highly active break repair during meiosis, and sometimes delete polyfunctional clusters, and disable epigenetic drivers. Mis-repaired gametes produce zygotes containing rare chromosome anomalies which cause neurologic disorders and accompanying non-neurologic signs. Neurodevelopmental disorders may be examples of assault on the human genome by foreign DNA with some infections more likely tolerated because they resemble human DNA segments. Further tests of this model await new technology.

The electronic structure and the participation of the simplest azomethine imine (AI) in [3+2] cycloaddition (32CA) reactions have been analysed within the Molecular Electron Density Theory (MEDT) using DFT calculations at the MPWB1K/6-311G(d) level. Electron localisation function (ELF) topological analysis reveals that AI has a pseudoradical structure, while the conceptual DFT reactivity indices characterise this TAC as a moderate electrophile and a good nucleophile. The non-polar 32CA reaction of AI with ethylene takes place through a one-step mechanism with low activation energy, 5.3 kcal/mol-1. A bonding evolution theory (BET) study indicates that this reaction takes place through a non-concerted [2n+2τ] mechanism in which the C–C bond formation is clearly anticipated prior to the C–N one. On the other hand, the polar 32CA reaction of AI with dicyanoethylene takes place through a two-stage one-step mechanism. Now, the more favourable regioisomeric transition state structure (TS) is located 8.5 kcal•mol⁻¹ below the reagents, in complete agreement with the high polar character of the TS. The current MEDT study makes it possible to extend Domingo’s classification of 32CA reactions to a new pra-type of reactivity.

Evidence-based medicine (EBM) is in crisis, in part due to bad methods, which are understood as misuse of statistics that is considered correct in itself. This article exposes two related common misconceptions in statistics, the effect size (ES) based on correlation (CBES) and a misconception of contingency tables (MCT). CBES is a fallacy based on misunderstanding of correlation and ES and confusion with 2 × 2 tables, which makes no distinction between gross crosstabs (GCTs) and contingency tables (CTs). This leads to misapplication of Pearson’s Phi, designed for CTs, to GCTs and confusion of the resulting gross Pearson Phi, or mean-square effect half-size, with the implied Pearson mean square contingency coefficient. Generalizing this binary fallacy to continuous data and the correlation in general (Pearson’s r) resulted in flawed equations directly expressing ES in terms of the correlation coefficient, which is impossible without including covariance, so these equations and the whole CBES concept are fundamentally wrong. MCT is a series of related misconceptions due to confusion with 2 × 2 tables and misapplication of related statistics. The misconceptions are threatening because most of the findings from contingency tables, including CBES-based meta-analyses, can be misleading. Problems arising from these fallacies are discussed and the necessary changes to the corpus of statistics are proposed resolving the problem of correlation and ES in paired binary data. Since exposing these fallacies casts doubt on the reliability of the statistical foundations of EBM in general, we urgently need to revise them.

This is a SARS-CoV-2 seroepidemiological study in pediatric population(0-16 years) during BA.5 Omicron predominance period in Athens metropolitan area. Serum samples were tested for SARS-CoV-2 nucleocapsid antibodies(Abs-N), representing natural infection during three sub-periods of BA.5 predominance: 01/05/2022-31/08/2022(period A), 01/09/2022-31/12/2022(period B) and July 2023(period C) and epidemiological data were collected. Additionally in period C Abs-N seronegative samples were tested for SARS-CoV-2 spike antibodies(Abs-S). A total of 878 children were tested (males:51.3%) with median age(IQR): 108(36-156) months and seropositivity during the 3 subperiods was: A:292/417(70%), B:288/356(80.9%), C:89/105(84.8%), P-value<0.001. SARS-CoV-2 seropositivity increased for from period A to C for 0-1-year (P-value: 0.044), 1-4 years (P-value: 0.028) and 6-12 years children (P-value: 0.003). Children 6-12y had the highest seroposi-tivity rates in all subperiods (A: 77.3%, B: 91.4% and C: 95.8%). A significant correlation of monthly SARS-CoV-2 median antibody titers with monthly seropositivity rates was detected (rs:0.812, P-value:0.008). During period C, an additional 12/105 (11.4%) Abs-S seropositive and Abs-N ser-onegative samples were detected and total seropositivity was estimated at 96.2% (101/105). The increased SARS-CoV-2 seropositivity detected in current seroepidemiology study illustrates a high exposure rate during BA.5 predominance period. These data could guide public health decisions regarding immunization strategies and protection measures.

COVID-19, the infectious disease caused by SARS-CoV-2, has spread on a pandemic scale. The virus infection can evolve asymptomatically or generate severe symptoms, influenced by the presence of comorbidities. Lymphopenia in patients affected with COVID-19 according to the severity of symptoms is frequent. However, the profile of CD4+ and CD8+ T-cells regarding cytotoxicity and antiviral factor expression has not yet been completely elucidated in acute SARS-CoV-2 infections. The purpose of this study is to evaluate the phenotypic and functional profile of T-lymphocytes in patients with moderate and severe/critical COVID-19. During this pandemic period, we analyzed a cohort of 62 confirmed patients with SARS-CoV-2 (22 moderate cases and 40 severe/critical cases). Albeit lymphopenia, we observed an increase in the expression of CD28, co-stimulator molecule, and activation markers (CD38 and HLA-DR) in T-lymphocytes as well as an increase in the frequency of CD4+ T-cells, CD8+ T-cells, and NK cells that express the immunological checkpoint protein, PD-1, in patients with severe/critical condition compared to healthy controls. Regarding the cytotoxic profile of peripheral blood mononuclear cells, an increase in the response of CD4+ T-cells already at baseline level was observed, scarcely changed upon PMA and Ionomycin stimulation. Meanwhile, CD8+ T-lymphocytes decreased cytotoxic response, evidencing a profile of exhaustion in patients with severe COVID-19. As observed in the t-SNE technique CD4+ T-cytotoxic and CD8+ T with low granzyme production evidencing their dysfunctionality in severe/critical conditions. In addition, purified CD8+ T-lymphocytes from patients with severe COVID-19 showed an increased constitutive expression of differentially expressed genes associated with the caspase pathway, inflammasome, and antiviral factors, and curiously, reduced expression of TNF-α. The cytotoxic profile, by CD4+ T-cells, may compensate for the dysfunction/exhaustion of TCD8+ in acute SARS-CoV-2 infection. These findings may provide an understanding of the interplay of cytotoxicity between CD4+ T-cells and CD8+ T-cells in the severity of acute COVID-19 infection.

Novel Coronavirus (2019-nCOV) causes inflammatory response with worsening symptoms. Classification of potential anti-viral and anti-inflammatory drugs in managing the symptoms of the COVID-19 and reducing morbidity is important. The objective of this study is to identify a group of drugs, best suited for COVID-19 treatment based on recent developments in clinical trials, FDA drug evaluation, directions and developments and from drug therapies globally. Online literature search was done on Medline, PubMed and google scholar databases for studies on various treatments and drug therapies for COVID-19 and relevant studies were identified and the identified drugs are described in detail as per their Pharmacological, pharmaceutical properties of the drugs, mechanism of action, current COVID-19 drug therapy, contraindications and drug-drug interactions Certain drugs can inhibit action against viral infection and protect lungs from severe inflammatory response. This article summarizes several drugs like Hydroxychloroquine, Chloroquine, Remdesivir, Favipiravir, Lopinavir, Ritonavir, Dexamethasone, Ivermectin, Baricitinib, Casirivimab / imdevimab, Bamlanivimab along with auxiliary treatment like convalescent plasma transfusion. Remdesivir is first drug approved by FDA. Hydroxychloroquine, dexamethasone and remdesivir are showing results against COVID-19 but it is important to test the efficacy and safety of such drugs though some drugs have shown remarkable results.

Coronavirus disease is the current cause of global concern. The massive outbreak of COVID-19 has led the World Health Organization (WHO) to declare this as a pandemic situation. The Severe Acute Respiratory Syndrome Coronavirus-2 (SARSCoV-2) is responsible for COVID-19 leading to acute respiratory distress and substantial mortality in humans. However, the first laboratory confirmation of SARS-CoV-2 in a pet dog in Hong Kong has shown the possibility of human-to-animal transmission (zooanthroponotic) of the virus. Thereafter, many animals including cat, tiger, lion and mink have also been reported to acquire the virus in several countries. In this situation the role of veterinarian assumes important in treating the animals, helping in food security, disease diagnosis, surveillance and boosting the economy of livestock stakeholders at the grassroot level. In the absence of any selective vaccine or drug against SARS-CoV-2, the world is anticipated to triumph over this pandemic with collaborative, multisectoral, and transdisciplinary approach linking human, animal and environmental health. This article gives an insight into the confirmed SARS-CoV-2 outbreaks in animals, including the factors behind the shuffling of the virus among variety of species and also emphasizes on the role of veterinarian in managing and safeguarding public health so as to pave the way for adopting one health approach in order to conserve biodiversity.

Background: In 80% of patients, COVID-19 presents as mild disease^1,2. 20% of cases develop severe (13%) or critical (6%) illness. More severe forms of COVID-19 present as clinical severe acute respiratory syndrome, but include a T-predominant lymphopenia³, high circulating levels of proinflammatory cytokines and chemokines, accumulation of neutrophils and macrophages in lungs, and immune dysregulation including immunosuppression⁴. Methods: All major SARS-CoV-2 proteins were characterized using an amino acid residue variation analysis method. Results predict that most SARS-CoV-2 proteins are evolutionary constrained, with the exception of the spike (S) protein extended outer surface. Results were interpreted based on known SARS-like coronavirus virology and pathophysiology, with a focus on medical countermeasure development implications. Findings: Non-neutralizing antibodies to variable S domains may enable an alternative infection pathway via Fc receptor-mediated uptake. This may be a gating event for the immune response dysregulation observed in more severe COVID-19 disease. Prior studies involving vaccine candidates for FCoV^5,6 SARS-CoV-1^7-10 and Middle East Respiratory Syndrome coronavirus (MERS-CoV) ¹¹ demonstrate vaccination-induced antibody-dependent enhancement of disease (ADE), including infection of phagocytic antigen presenting cells (APC). T effector cells are believed to play an important role in controlling coronavirus infection; pan-T depletion is present in severe COVID-19 disease³ and may be accelerated by APC infection. Sequence and structural conservation of S motifs suggests that SARS and MERS vaccine ADE risks may foreshadow SARS-CoV-2 S-based vaccine risks. Autophagy inhibitors may reduce APC infection and T-cell depletion^{12 13}. Amino acid residue variation analysis identifies multiple constrained domains suitable as T cell vaccine targets. Evolutionary constraints on proven antiviral drug targets present in SARS-CoV-1 and SARS-CoV-2 may reduce risk of developing antiviral drug escape mutants. Interpretation: Safety testing of COVID-19 S protein-based B cell vaccines in animal models is strongly encouraged prior to clinical trials to reduce risk of ADE upon virus exposure.

Rapid emergence of evasive SARS-CoV-2 variants is an on-going challenge for COVID-19 vaccinology. Traditional virus neutralization tests provide detailed datasets of neutralization titers against the viral variants. Such datasets are difficult to interpret and do not immediately inform on the sufficiency of the breadth of antibody response. Some of these issues could be tackled using the antigenic cartography approach. In this study, we created antigenic maps using neutralization titers of sera from donors who received Sputnik V booster vaccine after primary Sputnik V vaccination and compared them with the antigenic maps based on serum neutralization titers of Comirnaty-boosted donors. Traditional analysis of neutralization titers against WT, Alpha, Beta, Delta, Omicron BA.1 and BA.4/BA.5 showed a significant booster humoral response after both homologous (Sputnik V) and heterologous (Comirnaty) revaccinations against all the studied viral variants. However, despite this, a more in-depth analysis using antigenic cartography revealed that Omicron variants remain antigenically distant from WT, which is indicative of the formation of insufficient levels of cross-neutralizing antibodies. The implications of these findings may be significant when developing a new vaccine regimen.

Two conundrums have puzzled COVID-19 investigators: 1) morbidity and mortality is rare among Infants and young children and 2) rates of morbidity and mortality exhibit very large variances across nations, locals and even within cities. These differences correlate with rates of Haemophilus influenzae type B (Hib) and pneumococcal vaccination, which are almost universal among infants and vary widely by geography among adults and the elderly. The higher the rate of vaccination, the lower the COVID-19 morbidity and mortality. Vaccination rates with other vaccines, including BCG and poliovirus, do not correlate with COVID-19 risks. Notably, both Hib and pneumoccoci are common co-infections with influenza and coronaviruses and are associated with more severe disease and risk of death. Whether the vaccines simply protect against COVID-19 complications, directly protect against COVID-19 infection by inducing cross-reactive immunity, or are markers for some other types of protection such as availability of better healthcare, is not yet known. What is known is that improving coverage rates of Hib and pneumococcal vaccination has significantly lowered severe morbidity and mortality in influenza epidemics and might have similar efficacy for mitigating coronavirus outbreaks. If infants and children are valid indicators, the beneficial effects might be very significant. The possibility that anti-viral proteins in milk (e.g., lactoferrin) protect against COVID-19 is also explored.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The devastating impact of the ongoing coronavirus disease 2019 (COVID-19) on public health, caused by the Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) has made fighting of the COVID-19 pandemic is a top priority in medical research and pharmaceutical development. Surveillance of SARS-CoV-2 mutations is essential for the comprehension of SARS-CoV-2 variant diversity and their impact on virulence and pathogenicity. The SARS-CoV-2 open reading frame 10 (ORF10) protein interacts with multiple human proteins CUL2, ELOB, ELOC, MAP7D1, PPT1, RBX1, THTPA, TIMM8B, and ZYG11B expressed in the lung tissues. Mutations and co-mutations in the emerging SARS-CoV-2 ORF10 variants are expected to impact the severity of the virus and its associated consequences. In this article, We highlight 128 single mutations and 35 co-mutations in the unique SARS-CoV-2 ORF10 variants in this article. The possible predicted effects of these mutations and co-mutations on the secondary structure of ORF10 variants and host protein interactomes are presented. The findings highlight the possible effects of mutations and co-mutations on the emerging 140 ORF10 unique variants from secondary structure and intrinsic protein disorder perspectives.

Dengue virus serotype 2 (DENV-2) is responsible for dengue epidemics on a global scale and is recognized for being associated with severe cases of the disease. This study conducted the phylogenetic investigation of DENV-2 in the Northern region of Brazil. DENV-2 isolates from 2017 to 2021, originating from Northern Brazilian states, were selected. Only one lineage (I) of the Asian-American genotype and one lineage (5) of the cosmopolitan genotype were observed. All sequences of the Asian-American genotype used in this study were segregated into a paraphyletic subgroup aligned with sequences from an American clade. These results indicate a probable geographic link starting from Puerto Rico. Additionally, sequences from Acre were identified and grouped into a monophyletic clade of the cosmopolitan genotype. These results indicate the cocirculation of two DENV-2 distinct lineages: Lineage 1, Asian-American genotype (probable origin from Puerto Rico); Lineage 5, cosmopolitan genotype (probable origin from Peru). Our results provide important data regarding the study of DENV genotypes and lineages distribution, as well as opening up possibilities for probable introduction and dissemination routes.

The enhancement of Fusarium head blight (FHB) resistance is one of the best options to reduce mycotoxin contamination in wheat. This study has aimed to verify that the genotypes with high tolerance to deoxynivalenol could guarantee an overall minimization of the sanitary risk, by evaluating the contamination of regulated, modified and emerging mycotoxins on durum wheat cvs with different degrees of FHB susceptibility, grown under different meteorological condi-tions, in 8 growing seasons in North-West Italy. The years which were characterized by frequent and heavy rainfall in spring, were also those with the highest contamination of deoxynivalenol, zearalenone, moniliformin and enniatins. The most FHB resistant genotypes resulted in the lowest contamination of all the mycotoxins but showed the highest deoxyniva-lenol-3-glucoside/deoxynivalenol ratio and moniliformin/deoxynivalenol ratio. An inverse re-lationship between the amount of deoxynivalenol and the deoxyniva-lenol-3-glucoside/deoxynivalenol ratio was recorded for all the cvs and all the years. Converse-ly, the enniatins/deoxynivalenol ratio had a less intense relationship with cv tolerance to FHB. In conclusion, even though the more tolerant cvs, showed higher relative relationships between modified/emerging mycotoxins and native/target mycotoxins than the susceptible ones, they showed lower absolute levels of contamination of both emerging and modified mycotoxins.

During the coronavirus disease 2019 (COVID-19) pandemic, individuals with immune-mediated inflammatory diseases (IMIDs), such as systemic lupus erythematosus and rheumatoid arthritis, face a heightened risk of infection and severe outcomes due to immunological alterations resulting from their underlying conditions and immunosuppressive treatments. Even as the pandemic has transitioned to an endemic state, it remains crucial to recognize that these patients continue to be at risk. In this narrative review, we analyzed existing literature to explore the impact of IMIDs, clinical risk factors, and the influence of immunosuppressive therapies on COVID-19-related risks and outcomes. Notably, certain disease-modifying antirheumatic drugs (DMARDs), like rituximab, are associated with worse COVID-19 outcomes, and rituximab-treated patients show impaired immune responses to COVID-19 vaccination. Additionally, we outline the diverse effects of glucocorticoids on COVID-19 outcomes and management. To highlight real-life challenges faced by clinicians caring for patients with IMIDs, we present an illustrative scenario that underscores the importance of effective vaccination, timely boosting, and additional mitigation strategies against COVID-19. Given the clinical heterogeneity and diverse disease states within IMIDs, it is crucial to understand the ongoing implications and risks associated with COVID-19 in these patients, to guide the implementation of appropriate measures and optimize care and outcomes in the current endemic era.

Primary systemic treatment (PST) downsizes the tumor and improves pathological response. The aim of this study is to analyze the feasibility and tolerance of primary concurrent radio-chemotherapy (PCRT) in breast cancer patients. Patients with localized TN/HER2+ tumors were enrolled in this prospective study. Radiation is delivered concomitantly during the first 3 weeks of chemotherapy, and it is based on a 15 fractions scheme (40.5Gy/2.7Gy per fraction to whole breast and nodal levels I-IV. Chemotherapy is based on Pertuzumab-Trastuzumab-Paclitaxel followed by anthracyclines in HER2+ and CBDCA-Paclitaxel followed by anthracyclines in TN breast cancers patients. 58 patients were enrolled, 25 patients (43%) were TN and 33 patients HER2+ (57%). With a median follow-up of 24.2 months, 56 patients completed PCRT and surgery. A total of 35 patients (87.5%) achieved &gt;90% loss of invasive carcinoma cell in the surgical specimen. The 70.8% and the 53.1% of patients with TN and HER-2+ subtype respectively achieved complete pathological response (pCR). This is the first study of concurrent neoadjuvant treatment in breast cancer in which three strategies are applied simultaneously: fractionation of RT in 15 sessions, adjustment of CT to tumor phenotype and local planning by PET. The pCR rates are encouraging.

Wheat is one of the global strategic crops and ranks third in terms of cereals production. Wheat crop is exposed to many fungal infections during the cultivation stages, some of which have the ability to secrete numbers of toxic secondary metabolites that threaten the quality of grains, consumer health, producer economics and global trade exchange. Fifty-four random samples were collected from wheat which originated from different countries. The samples included 14 of soft wheat to study the extent of their contamination with Deoxynivalenol (DON) and T-2 toxin by auto-ELISA technology and r-biopharm Microtiter plate. All samples were contaminated with DON toxin except one sample, and the contamination average ranged between 40.7 and 1018.8 µg kg-1. The highest contamination rates were in Lithuanian and the lowest in Indian wheat. Meanwhile the highest average level of T-2 toxin contamination was in Lithuanian wheat grains with a rate of 377.4µg kg-1 and the lowest in Polish wheat with an average of 115.3µg kg-1. GC-MS/MS and multiple reaction monitoring mode (MRM), was used to detect 15 triazole derivatives in collected samples, which may be used to combat fungal diseases on wheat during the growing season. Only 9 derivatives were found; Simeconazole, Penconazole, Hexaconazole, Cyproconazole, Diniconazole, Tebuconazole, Metconazole, Fenbuconazole and Difenoconazole. These derivatives varied according to the origin of wheat samples as well as their its concentration whereas, another 6 derivatives were not detected in all samples. A direct inverse relationship was found between the DON concentration in the samples and the residues of Simeconazole, Penconazole, Diniconazole, Tebuconazole, Metconazole, Fenbuconazole and Difenoconazole and the T-2 toxin showed the same relationship except for Tebuconazole. The safe and rational use of some triazole derivatives may be a new approach and a promising strategy not only to reduce plant diseases and their problems, but also to get rid of some mycotoxins as contaminates.

Globally, the COVID-19 pandemic has brought the world to a standstill with the infected cases surpassing millions. The causative agent of COVID-19, the SARS-CoV-2 is a novel coronavirus that emerged from the wet animal market in Wuhan, China in early December 2019. Soon after, human-to-human transmission increased the rate of infection making the disease widespread with new hotspots emerging around the world.The epidemiological reports based on clinical characteristics including age, gender, symptoms (both severe and non-severe), and the conditions requiring intensive medical care, along with case fatality revealed that people with co-existing health conditions like diabetes, hypertension, cigarette smoking, and others with cardiovascular and kidney diseases were more susceptible to COVID-19 infection with poor prognosis in cases related to the severity of symptoms and requiring ICU, medical ventilators with a high fatality rate. Even people with immunosuppressed conditions like HIV and cancer, alongwith old age and pregnant women are vulnerable to COVID-19 infection and can cause severe health complications.It is extremely important to have a comprehensive idea of the underlying pathophysiology related to these health conditions which makes them more susceptible to contract SARS-CoV-2 infection in correlation with the development of severe symptoms. This review will provide an extensive viewpoint related to COVID-19 patients having coexisting health conditions together with the association between the prognosis of the disease and the pathogenesis of the SARS-CoV-2 infection, based on the current information available.

Background: A new coronavirus (SARS-CoV-2) that emerged from Wuhan, Hubei Province, China, has spread throughout the world and is declared a pandemic by the World Health Organization (WHO). A lot remains to be understood of SARS-CoV-2 and the disease (COVID-19). SARS-CoV-2 has until recently been identified as responsible for both asymptomatic and serious life-threatening infections. The unavailability of specific therapeutic agents is a major hurdle in the treatment and management of COVID-19 patients. The present review attempts to evaluate the immunobiochemical aspects of the pathogenesis, diagnosis, and management of SARS-CoV-2 infection. Main Body: This review is a comprehensive evaluation of the data collected through various sources, including Google Scholar, PubMed, and Scopus. The articles were searched and selected using key words such as “Coronavirus disease (COVID-19)”, “Diagnosis of COVID-19”, Pathogenesis of Covid-19”, “management of COVID-19”, “Immunology of COVID-19”, and “Complications of COVID-19”. The study noted that the novel Coronavirus infection could result in an exaggerated immune response, causing a cytokine storm and damaging several organs of the body. The infected patients develop several complications, including immunological, hematological, and biochemical alterations. Consequently, COVID-19 patients may develop cardiovascular, liver, renal, and neurological complications, among others. Conclusion: An increased understanding of the immunobiochemical aspects of the disease may contribute to better management of SARS-CoV-2-infected persons, as evidenced from the available literature. A holistic approach to the management of COVID-19 patients taking into consideration the effect of COVID-19 infection on various organs of the body assumes increased significance in patient management.

A novel strategy is presented for reliable diagnosis and progression prediction of diseases with special attention to COVID-19 pandemy. A plan is presented for how the model can be implemented worldwide in healthcare and how novel treatments and targets can be detected. The idea is based on poikilosis, pervasive heterogeneity and variation at all levels, systems and mechanisms. Poikilosis in diseases can be taken account in pathogenicity model, which is based on distribution of three independent condition measures – extent, modulation and severity. Pathogenicity model is a population or cohort-based description of disease components. Evidence-based thresholds can be applied to the pathogenicity model and used for diagnosis as well as for early detection of patients in risk of developing the most severe forms of the disease. Analysis of patients with differential course of disease can help in detecting biomarkers of diagnostic and prognostic significance. A practical and feasible plan is presented how the concepts can be implemented in practice. Collaboration of many actors, including the World Health Organization and national health authorities, will be essential for success.

A harmful impact of climate change and global warming has concerned various sectors of the international community. Numerous energy policies aiming at climate change mitigation have been implemented on a national and global scale. Renewable Energy Technologies (RET) play a critical role in enhancing sustainable solutions that significantly limit greenhouse gases (GHG) emissions. Such innovative technologies can facilitate energy transition through providing e.g. energy security, sustainable development, or effective usage of indigenous resources. However, the commercialization of RET becomes extremely challenging. The barriers can be of a different nature, although in this study the focus has been put on socio-economic and regulatory issues. In fact, there is ample evidence that energy policies play a central role in supporting renewables adoption. It is also claimed that RET require the whole ecosystem to support their successful diffusion. In this study, we explore multifarious barriers for a widespread RET diffusion in two European Union countries: Finland and Poland, indicating the most common barriers existing in the literature as well as analyzing major bottlenecks in the viewpoint of renewable energy companies’ executives. We also present statistics of the most commonly used RET in these countries in order to express the diffusion issues more appropriately. The outcomes of this study provide useful insight for the researchers in the energy transition field as well as practical managerial and regulatory implications aimed at overcoming these challenges.

It is already well known that infants and children infected with COVID-19 develop mild to mod-erate forms of the disease, with fever and oropharyngeal congestion being the most common symptoms. Nevertheless, there are cases in which the patients accuse respiratory symptoms. These cases need lung evaluation, which can be done using lung ultrasound (LUS), because it is a non-irradiating and repeatable imaging technique. 19 children with COVID-19 pneumonia were eval-uated using LUS. The LUS score (LUSS) for each patient varied between 1 to 8 points from a max-imum of 36 points. The arithmetic mean was 4.47 ± 2.36 (S.D), while 95% CI for the Arithmetic mean was 3.33 to 5.61. The lung changes were correlated with their biomarkers, specifically in-flammatory markers. The correlation between LUSS and LDH, D-dimers and IL-6 was a strong positive one with r=0.66 (p=0.01, 95% CI 0.147 to 0.896) between the LUSS and LDH level at symptomatic infants and children (with cough present) and r=0.66 (p=0.01, 95% CI 0.140 to 0.895) between LUSS and D-dimers level at symptomatic infants and children (with cough pre-sent). The results suggest that LUS could be a good imaging technique that can be used both in ini-tial evaluation of children with respiratory diseases, and, also in their follow-up, correlated with symptoms and biomarkers.

It was the aim of this study to compare the ratio of salbutamol and its major metabolite salbutamol-4’-O-sulfate as well as the quantity excreted renally after oral and inhalative administration. Additionally, the excretion pattern after application of racemic salbutamol opposed to the pure enantiomer levosalbutamol was evaluated. For quantitation of the sulfonated metabolite of salbutamol, reference material was synthesized and characterized by NMR and HRMS. Urine samples were analyzed by ultrahigh performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS). Salbutamol is mainly metabolized by sulfotransferase 1A3 (SULT1A3), which is most abundantly found in the jejunum. A high first pass effect occurs upon oral administration, which leads to a higher amount of salbutamol-4’-O-sulfate in urine compared to unchanged salbutamol excreted within the first hour post administration. Thus, when administered orally, the proportion of metabolite to total salbutamol was higher than for inhalative administration in the early urinary excretion. Levosalbutamol is the favored enantiomer of SULT1A3 and therefore metabolized at a higher rate whereas racemic salbutamol shows a reduced proportion between metabolite and parent compound. The amount of sulfoconjugate was found higher than that of the parent compound for all urine samples except for those excreted in the first hour after inhalative administration.

Postural orthostatic tachycardia syndrome (POTS) and its related symptoms have been identified as a possible complication of COVID-19 infection and vaccination and have recently gained attention. The diagnosis and management of POTS require great care and attention, even under normal circumstances, due to its complex nature. However, the COVID-19 pandemic and its complications have further complicated the diagnosis and management of this syndrome in COVID-19-related settings. The objective of this study is to enhance our comprehension of POTS and POTS-like symptoms in the context of COVID-19. To achieve this, we provide a concise overview of the POTS concept, its potential underlying mechanisms, available clinical reports of POTS following COVID-19 infection and vaccination, as well as the clinical manifestations of this syndrome in COVID-19-related scenarios with a brief overview of its management.

Recently, NOAA has included GNSS (Global Navigation Satellite System) Radio Occultation (RO) data as one of the crucial long-term observables for weather and climate applications. To include more GNSS RO data in the numerical weather prediction system, the NOAA Commercial Weather Data Pilot program (CWDP) started to explore the commercial RO data available on the market. After two rounds of pilot studies, the CDWP decided to award the first Indefinite Delivery Indefinite Quantity (IDIQ) contract to GeoOptics and Spire Incs. in 2020. This study examines the quality of Spire data products for weather and climate applications. Spire RO data are collected from commercial CubeSats through careful comparison with the data from Formosa Satellite Mission 7–Constellation Observing System for Meteorology, Ionosphere, and Climate-2 (COSMIC-2), ERA-5, and high-quality radiosonde data. The results demonstrated that although with lower Signal-Noise-Ratio (SNR) in general, the pattern of the lowest penetration height for Spire is similar to those for COSMIC-2. The Spire and COSMIC-2 penetrate heights are between 0.6 and 0.8 km altitude at the tropical oceans. Although using different GNSS RO receivers, the precision of Spire STRASP receivers is of the same quality as those of COSMIC-2 Global Positioning System - GPS, GALILEO, and GLObal NAvigation Satellite System – GLONASS (TGRS) receivers. The retrieval accuracy from Spire is very compatible with those from COSMIC-2. We validated Spire temperature and water vapor profiles by comparing them with collocated radiosonde data. Generally, over the height region between 8 km and 16.5 km, the Spire temperature profiles match those from RS41 RAOB very well with temperature biases &lt; 0.02 K. Over the height range from 17.8 to 26.4 km, the temperature differences are ~-0.034 K with RS41 RAOB being warmer. We also estimated the error covariance matrix for Spire, COSMIC-2, and KOMPSAT-5. Results showed that the COSMIC-2 estimated error covariance values are slightly more significant over the oceans at the mid-latitudes (45oN-30oN and 30oS-45oS), which may also be owing to COSMIC-2 SNR being lower at those latitudinal zones.

The disease COVID-19 is brought on by the acute respiratory syndrome coronavirus 2 (SARS-CoV-2) First appeared in China in December 2019 and quickly spread around the world after being declared a worldwide pandemic by the World Health Organization in March 2020. COVID-19, Medical Laboratory Professionals, SARS-COV-2, Diagnostic, Importance and difficulties for testing were the selected terms to search the databases of PubMed and Google Scholar for previously published material. Many diagnostic tests are applied in corona virus detection like Droplet Digital PCR (ddPCR), Multiplex PCR, Loop-mediated Isothermal Amplification (LAMP) and more. There is a lack of availability of molecular and serologic tests that have been clinically validated or authorized by national or international regulatory bodies. Clinical laboratory experts are tackling threats to our global defense and wellness, including infectious diseases. The opportunity to express gratitude to the unsung medical laboratory heroes and COVID0-19 pandemic allies is now greater than ever. Each year, Medical Laboratory Professionals Week should honors those who contribute key diagnostic data that help save lives. This review article explore overall summary on testing methods including Important and Difficult Tasks for Medical Laboratories which will provide good message for better public health matter.

Objective: To evaluate the effect of rectal Ozone (O3) in severe COVID-19 pneumonia in two different cohorts differing in location (Madrid vs Zilina), ethnicity (Slovakian vs Spanish cohorts) and age. Material and Methods: In a multicenter-study, 32 severe bilateral-COVID-19-pneumonia patients and (+) RT-PCR (reverse transcriptase polymerase chain reaction) SARS-CoV-2 were evaluated (16 from each cohort). Primary outcomes: a) clinical (O2-saturation); b) biochemical (Lymphocyte-count, Fibrinogen, D-Dimer, Urea, Ferritin, LDH [lactate dehydrigenase], IL-6 and CRP [c-reactive protein]); and c) radiological improvement. Secondary outcomes: a) days-of-hospitalization, b) mortality-rate before discharge. The Ozone-protocol consisted of 10 sessions of intra-rectal Ozone, total dose 5.25 mg (150 mL volume, 35 g/ml concentration). The Standard-of-care protocol included O2 supply, antivirals (Remdesivir / Isoprinosine), corticosteroids (Dexamethasone / Metilprednisolone), monoclonal antibodies (Anakinra / Tocilizumab), antibiotics (Azytromicine), anticoagulants (Enoxaparine / Fraxiparine). Protocol was approved by Health Care Ethics Committee (Report 15/4/2020) of our Hospital and by Ethics Committee for Medical Investigation of La Princesa’s Hospital (ACTA CEIm 12/20, 28/5/20, Registry 4146). Results: Patients in Slovakian cohort were younger (53.38 vs 84.69 years). Grade of severity was worse in Spanish-cohort (4.78 vs 3.30 points). Length of stay was superior in Spanish-cohort (27.38 vs 10.07 days). Both cohorts improved O2-saturation and Lymphocyte-count. Inflammation biomarkers (Fibrinogen, D-Dimer, Urea, Ferritin, LDH, CRP and IL-6) decreased in both cohorts. In Spanish-cohort, Urea and Ferritin improvement was not significant (p>0.05), while in Slovakian-cohort, Urea, Fibrinogen and LDH were not significant (p>0.05) Radiological signs of bilateral pneumonitis decreased on both cohorts. Mortality was similar (12.5%). Conclusion: After Standard of care protocol, Rectal Ozone improved O2-saturation, decreased inflammation biomarkers and improved Taylor’s radiological scale in both cohorts. Although age, grade of severity and days of hospitalization were inferior in Slovakian cohort, mortality was similar in both cohorts, but inferior if compared to an external control cohort.

It is known for decades that viruses from the Coronoviridae family can adapt to human-to-human transmission. In 2020, SARS-CoV-2 caused a global pandemic of unprecedented scale imposing the loss of millions of human lives and being at the heart of a global economic crisis. Thus, we overviewed key research advances generated from the identification of the etiological agent to a better understanding of its origin, evolution and factors underlying global spread. Furthermore, we analyze the scientific productivity using the PubMed database. We found that the total number of publications increased more than 8% in 2020 when compared with 2019 or the average publications per year in the previous quinquennial. Remarkably, 86,638 publications related with COVID-19 and SARS-CoV-2 were published in 2020. Furthermore, there was also an increase in 2020 of publications in other major infectious diseases, such as AIDS, tuberculosis, or malaria. This success is likely the result from the vigorous, international, collaborative, and multidisciplinary response by the research community. During 2020 it was demonstrated, that with adequate support, it is possible to boost the rate of scientific progress in infectious diseases. Sustained investment in science will be key to address existing and future pandemics as the human population increases.

Tissue resident memory T cells (TRM) were first described in 2009. While initially the major focus was on CD8 TRM, there has been recently an increased interest in defining the phenotype and the role of CD4 TRM in diseases. Circulating CD4 T cells seed tissue CD4 TRM, but there also appears to be an equilibrium between CD4 TRM and blood CD4 T cells. CD4 TRM are more mobile than CD8 TRM, usually localized deeper within the dermis/lamina propria and yet may exhibit synergy with CD8 TRM in disease control. This has been demonstrated in herpes simplex infections in mice. In human recurrent herpes infections, both CD4 and CD8 TRM persisting between lesions may control asymptomatic shedding through interferon gamma secretion, although this has been more clearly shown for CD8 T cells. The exact role of the CD4/CD8 TRM axis in the trigeminal ganglia and/or cornea in controlling recurrent herpetic keratitis is unknown. In HIV, CD4 TRM have now been shown to be a major target for productive and latent infection in cervix. In HSV and HIV co-infections, CD4 TRM persisting in the dermis support HIV replication. Further understanding of the role of CD4 TRM and their induction by vaccines may help control sexual transmission by both viruses.

Coronavirus is now a significant human pathogen with the emergence of SARS-CoV-2. Until now there has been no data to support a threat to agricultural industries. Using a comparative genomic protein analysis, this study examined the angiotensin-converting enzyme II (ACEII) gene of 17 animal species with an emphasis on agriculture. To determine viral vulnerability the 20 known SARS-CoV-2 receptor-binding domain (RBD)/ACEII receptor interaction sites were compared to determine their potential susceptibility to the SARS-CoV-2 virus. With the known bat host’s (XP_032963186) number of binding sites as a threshold, we note that ALL animal species examined in this study contained significant numbers (≥10) of SARS-CoV-2 binding sites and could be at risk for SARS-CoV-2 infection. The data from this study suggest SARS-CoV-2 imposes a grave threat to the safety and security of the agricultural industry. Urgent studies are needed to determine if infected animals can transmit SARS-CoV-2 before and/or after processing.

Shiga toxin (Stx) produced by Escherichia coli is the main pathogenic factor of diarrhea-associated hemolytic uremic syndrome (HUS), which is characterized by obstruction of renal microvasculature by platelet-fibrin thrombi. It is well known that the oxidative imbalance generated by Stx induces platelet activation, contributing to thrombus formation. Moreover, activated platelets release soluble CD40 ligand (sCD40L) which in turn contributes to oxidative imbalance, triggering the release of reactive oxidative species (ROS) on various cellular types. The aim of this work was to determine if the interaction between the oxidative response and platelet-derived sCD40L participates in the pathogenic mechanism during HUS. Activated human glomerular endothelial cells (HGEC) by Stx2 induced platelets to adhere to them. Although platelet adhesion did not contribute to endothelial damage, high levels of sCD40L were released to the medium. The release of sCD40L by activated platelets was inhibited by antioxidant treatment. Furthermore, we found increased levels of sCD40L in plasma from HUS patients, which were also able to trigger the respiratory burst in monocytes, in a sCD40L-dependent manner. Thus, we concluded that platelet-derived sCD40L and the oxidative response are reciprocally stimulated during Stx2-associated HUS. This process may contribute to the evolution of glomerular occlusion and the microangiopathic lesions.

Every intervention of planning, implementation, and monitoring of agricultural and agri-environmental policies requires assessment tools that should have the characteristics of relevance, completeness, interpretability, data quality, efficiency, and overlapping. Despite the extensive selection of bibliographies and numerous projects designed to develop agri-environmental indicators necessary for assessing the sustainability of new policies, it is difficult to have an integrated and updated set of indicators available, which can be an effective and practical application tool to assists policymakers, researchers, and actors in policy design, monitoring and impact assessment. Particularly, such need is pressing to face the new environmental challenges imposed by the upcoming European Union Green Deal on the Common Agricultural Policy (CAP) post 2023. This study, therefore, aims to fill this gap by proposing a selection methodology and different pools of agri-environmental indicators differentiated based on a scale approach (crop-farm-district-region). Furthermore, we have attempted to validate our approach by quantifying selected indicators for a specific evaluation necessity, represented in this case by an assessment of environmental impact of land use change induced by CAP greening requirements in the Northern Italy context. Results of this validation show original crops’ impacts comparison, but also highlight great knowledge gaps in the available literature.

Objective: The study aimed to characterize the changing landscape of circulating SARS-CoV-2 lineages in the local community of Hong Kong throughout 2022. We examined how adjustments to quarantine arrangements influenced the transmission pattern of Omicron variants in a city with relatively rigorous social distancing measures at that time. Methods: In 2022, a total of 4,684 local SARS-CoV-2 genomes were sequenced using the Oxford Nanopore GridION sequencer. SARS-CoV-2 consensus genomes were generated by MAFFT, and the maximum likelihood phylogeny of these genomes were determined using IQ-TREE. The dynamic changes in lineages were depicted in a time tree created by Nextstrain. Statistical analysis was conducted to assess the correlation between changes in the number of lineages and adjustments to quarantine arrangements. Results: By the end of 2022, a total of 83 SARS-CoV-2 lineages were identified in the community. The increase in the number of new lineages was significantly associated with the relaxation of quarantine arrangements (One-way ANOVA, F(5,47)=18.233, p&lt;0.001)). Over time, Omicron BA.5 sub-lineages replaced BA.2.2 and became the predominant Omicron variants in Hong Kong. The influx of new lineages reshaped the dynamics of Omicron variants in the community without fluctuating the death rate and hospitalization rate (One-way ANOVA, F(5,47)=2.037, p=0.091). Conclusion: The study revealed that even with an extended mandatory quarantine period for incoming travelers, it may not be feasible to completely prevent the introduction and subsequent community spread of highly contagious Omicron variants. Ongoing molecular surveillance of COVID-19 remains essential to monitor the emergence of new recombinant variants.

Coronavirus Disease 2019 (COVID-19), caused by SARS-CoV-2 (Severe Acute Respiratory Syndrome - Coronavirus-2) of the family Coronaviridae, appeared in Wuhan, Hubei province, China being its epicenter in December 2019. This disease was declared as posing Public Health International Emergency by World Health Organization on January 30, 2020, attained the status of a very high-risk category on February 29, and now having a pandemic status (March 11, 2020). COVID-19 has presently spread to more than 195 countries/territories while killing nearly 19,600 humans out of cumulative confirmed cases accounting to more than 430,000 within a short period of just a few weeks. The majority of deaths have been reported in Italy and China. Researchers worldwide are pacing with high efforts to counter the spread of this virus and to design effective vaccines and therapeutics/drugs. Few of the studies have shown the potential of animal-human interface and zoonotic links in the origin of SARS-CoV-2. Exploring the possible zoonosis and revealing the factors responsible for its initial transmission from animals to humans will pave ways to design and implement effective preventive and control strategies to counter COVID-19. The present review presents an overview of COVID-19 and the causative virus SARS-CoV-2, with particular emphasis on the role of animals and their jumping the cross-species barriers, experiences learned from SARS- and MERS-CoVs, zoonotic links, and spillover events, transmission to humans and rapid spread., highlighting in very brief the preventive and control measures along with a few of the recent research developments to counter this pandemic virus/disease.

Observational studies have linked vitamin D insufficiency to pediatric type 2 diabetes (T2D) , but evidence from vitamin D supplementation trials is sparse. Given the rising prevalence of pediatric T2D in all ethnicities, determining a protective role of vitamin D has significant public health importance. We tested whether serum 25-hydroxyvitamin D (25OHD) levels are causally linked to youth-onset T2D risk using Mendelian randomization (MR). We selected 54 single nucleotide polymorphisms (SNPs) associated with 25OHD in a European genome-wide association study (GWAS) on 443,734 individuals and obtained their effects on pediatric T2D from the multi-ethnic PRODIGY GWAS (3,006 cases/6,061 controls). We applied inverse variance weighted (IVW) MR, and a series of MR methods to control for pleiotropy. We undertook sensitivity analyses in ethnic sub-cohorts of PRODIGY, and using SNPs in core vitamin D genes or ancestry-informed 25OHD SNPs. Multivariable MR accounted for mediating effects of body mass index. We found that a standard deviation increase in 25OHD in the logarithmic scale did not affect youth-onset T2D risk (IVW MR odds ratio (OR) = 1.04, 95% CI=0.96-1.13, P=0.35) in the multi-ethnic analysis, and sensitivity, ancestry-specific and multivariable MR analyses showed consistent results. Our study had limited power to detect small/moderate effects of 25OHD (OR of pediatric T2D < 1.39 to 2.1). In conclusion, 25OHD levels are unlikely to have large effects on risk of youth-onset T2D across different ethnicities.

Over a year into the COVID-19 pandemic, there is growing evidence that SARS-CoV-2 infections among dogs are more common than previously thought. In this study, the prevalence of SARS-CoV-2 antibodies was investigated in two dog population. The first group was comprised of 1069 dogs admitted to the Veterinary Teaching Hospital for any given reason. The second group included dogs that shared households with confirmed COVID-19 cases in humans. This study group numbered 78 dogs. In COVID-19 infected households, 43.9% tested ELISA positive, and neutralisation antibodies were detected in 25.64% of dogs. Those data are comparable with the secondary attack rate in the human population. With 14.69% of dogs in the general population testing ELISA positive, there was a surge of SARS-CoV-2 infections within the dog population amid the second wave of the pandemic. Noticeably seroprevalence of SARS-CoV-2 in the dog and the human population did not differ at the end of the study period. Male sex, breed and age were identified as significant risk factors. This study gives strong evidence that while acute dog infections are mostly asymptomatic, they can pose a significant risk to dog health. Seropositive dogs had a 1.97 times greater risk for developing central nervous symptoms.

Type-2 diabetes mellitus (T2DM) have been strongly associated with single nucleotide polymorphisms (SNPs) in the TCF7L2 gene. This study investigated the association between rs12255372, rs7903146 and T2DM in a Ghanaian population. A case-control study design was used for this study. A total of 106 T2DM patients and 110 control participants were selected. Basic data collected included body mass index, blood pressure and socio-demographics. Fasting blood samples were collected and used for serum lipid analysis, HbA1c, plasma glucose estimation and DNA extraction. Common and allele-specific primers were designed for genotyping using the Modified Tetra-Primer Amplification assay. Associations were evaluated using logistic regression models. The rs7903146 risk variant was significantly associated with 2.16 vs 4.06 increased odds for T2DM in patients <60 years vs ≥60 years. Both rs7903146 and rs12255372 are significantly associated with increased odds of T2DM in women, overweight/obese; T2DM negative family history (T2DM-NFH) and low-HDL-C. In a multivariate model, rs7903146 but not rs12255372 was significantly associated with 2.18, 5.01 and 2.25 increased odds of T2DM, under the codominant, recessive and additive model, respectively (p<0.05). The association between rs7903146 and rs12255372 with T2DM is more highly associated in a subgroup- women and those with T2DM-NFH, yet have cardiometabolic risk.

RaTG13 (a bat derived SARS-like CoV) is the closest relative sequence of SARS-CoV-2 reported till date. The sample from which RaTG13 was sequenced was a bat fecal swab collected in 2013 from Tongguan, Mojiang, Yunnan province, China. The Illumina based sequence of RaTG13, MN996532.1, was deposited on 27^th Jan 2020 and the raw data (Illumina), https://www.ncbi.nlm.nih.gov/sra/SRX7724752[accn]. There are discrepancies in dates about when the metagenome sequencing of RaTG13 sample was done (2018 or 2020), both stated by the same corresponding author. Comparison of the RNA Seq data of RaTG13 fecal swab to the corresponding data from the bat fecal swabs deposited by the same working group using the same methods indicated that the RaTG13 raw data seemed to be different in various aspects. The fecal swab sample showed abnormally less read of bacterial reads in the swab was exceptionally low, i.e. 0.7%, compared to the 20-90% abundance in other fecal swabs from bats processed by similar methods. Also, another raw data in the form of amplicon sequences was deposited in May 2020; however, the dates mentioned on the files of the sequenced amplicons were older (2017, 2018). The genome assembly of RaTG13 could not be done de-novo and the average coverage of the genome ~8%. Also, literature indicates that RaTG13 RBD cannot bind to Rhinolophus ACE-2 receptors. Collectively, the anomalies in the raw data of RaTG13 and other issues pose an important question about the overall authenticity of the RaTG13 genome sequence.

COVID-19 patients can recover with a median SARS-CoV-2 clearance of 20 days post initial symptoms (PIS). However, we observed some COVID-19 patients with existing SARS-CoV-2 for more than 50 days PIS. This study aimed to investigate the cause of viral clearance delay and the infectivity in these patients. Demographic data and clinical characteristics of 22 long-term COVID-19 patients were collected. SARS-CoV-2 nucleic acid, peripheral lymphocyte count, and functionality were assessed. SARS-CoV-2-specific and neutralization antibodies were detected, followed by virus isolation and genome sequencing. The median age of the studied cohort was 59.83±12.94 years. All patients were clinically cured after long-term SARS-CoV-2 infection ranging from 53 to 112 days PIS. Peripheral lymphocytes counts were normal. Interferon gamma (IFN-ƴ)-generated CD4+ and CD8+ cells were normal as 24.68±9.60% and 66.41±14.87%. However, the number of IFN-ƴ-generated NK cells diminished (58.03±11.78%). All patients presented detectable IgG, which positively correlated with mild neutralizing activity (ID50=157.2, P=0.05). SARS-CoV-2 was not isolated, and a cytopathic effect was lacking. Only three synonymous variants were identified in spike protein coding regions. In conclusion, decreased IFN-γ production by NK cells and low neutralizing antibodies might favor SARS-CoV-2 long-term existence. Further, low viral load and weak viral pathogenicity was observed in COVID-19 patients with long-term SARS-CoV-2 infection.

Water-soluble and cytocompatible polymers were investigated to enhance a transporting efficiency of biomolecules into cells in vitro. The polymers composed of 2-methacryloyloxyethyl phosphorylcholine (MPC) unit, a hydrophobic monomer unit, and a cationic monomer unit bearing an amino group were synthesized for complexation with model biomolecules, siRNA. The cationic MPC polymer was shown to interact with both siRNA and the cell membrane and was successively transported siRNA into cells. When introducing 20 − 50 mol% hydrophobic units into the cationic MPC polymer, transport of siRNA into cells. The MPC units (10 − 20 mol%) in the cationic MPC polymer were able to impart cytocompatibility, while maintaining interaction with siRNA and the cell membrane. The level of gene suppression of the siRNA/MPC polymer complex was evaluated in vitro and it was as the same level as that of a conventional siRNA transfection reagent, whereas its cytotoxicity was significantly lower. We concluded that these cytocompatible MPC polymers may be promising complexation reagent for introducing biomolecules into cells, with the potential to contribute to future fields of biotechnology, such as in vitro evaluation of gene functionality, and the production of engineered cells with biological functions.

The coronavirus disease 2019 (COVID-19) is now a global pandemic caused by the new severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Unlike other known coronaviruses, such as the Middle East respiratory syndrome coronavirus (MERS-CoV), SARS-CoV-2 reveals new clinical, immunological, and pathologic features. The lymphocyte depletion, macrophage and neutrophil hyperactivation, cytokine dysregulation, thrombophilia, delayed antiviral response, and immune exhaustion are key immunological findings linked to the clinical progression of this disease. Understanding and identifying the underlying immunological basis of COVID-19 is crucial to designing effective therapies. Here, we provide an overview of immunopathogenesis driven by SARS-CoV-2 after its interactions with the immune system.

Less aligned emphasis has been given to the COVID-19 infodemic coordinating with the COVID-19 outbreak. Global profusion of tangled monikers and hashtags has found their ways in daily communication and contributed to backlash against Chinese. Official naming efforts against infodemic should be meet with a fair share of identification. Based on brief critical reviews on previous multifarious naming practices, we punctuate heuristic introspection in scientific conventions and sociocultural paradigms. Infodemiological analysis promises to articulate that people around the globe are divided in their favor stigmatized monikers in the public and scientific communities because of perceptual bias. There is no positive correlation between the degree of infection in their territories and collective perceptual bias to COVID-19. The official portfolio “COVID-19” and “SARS-CoV-2” has not become de facto standard usages, but full-fledged official names are excepted to duly contribute to the resilience of negative perceptual bias and collective behavioral propensities.

Background: The rise of new SARS-CoV-2 mutations brought challenges and progress in the global fight against COVID-19. Mutations in spike and accessory genes affect transmission, vaccine efficacy, treatments, testing, and public health strategies. Monitoring emerging variants is crucial to halt virus spread. Methods: 44 nasopharyngeal/oropharyngeal swabs from Kenyan patients were sequenced with the Illumina platform. Galaxy's bioinformatic tools were used for genomic analysis. SARS-CoV-2 genome classification was done using PANGOLIN and mutation annotation with the COVID-19 Annotator tool. Results: The study showed 5 clades to be circulating in the region. 38(86%) were BA.1.1; 2(5%) were BA.1.1.1; 1(2%) was BA.1; 1(2%) was BA.1.14 and 2(5%) were AY.46. These clades had a cumulative of 173 mutations among them with 50 novel mutations. Forty-eight of these novel mutations occurred in a low frequency of 2.3% of the sequences tested while the other two, S:R214R, and NSP2:A555A, were for 43.2% and 18.2% of the cases respectively. Conclusions: The high-frequency novel mutations were synonymous mutations, a phenomenon that was previously viewed as phenotypically silent but recent studies indicate they can affect viral fitness with potential functional associations. These findings add to the understanding of the SARS-CoV-2 virus future evolutionary and immunological dynamics in the region

Chronic diseases, such as type 2 diabetes (T2D), are difficult to manage because they demand continuous therapeutic review and monitoring. Beyond achieving the target HbA1c, new guidelines for the therapy of T2D have been introduced with the new groups of antidiabetics (GLP-1ra and SGLT2-in). Despite new guidelines, clinical inertia, that can be caused by physicians, patients or healthcare system, results in T2D not being effectively managed. This opinion paper explores the shift in T2D treatment, challenging assumptions and evidence-based recommendations, particularly for family physicians, considering the patient's overall situation in decision-making. We looked for the possible reasons of clinical inertia and poor application of guidelines in the management of T2D. Guidelines for antidiabetic drugs should be more precise, providing case studies and clinical examples to define clinical contexts and contraindications. Knowledge communication can improve confidence and should include clear statements on areas of decision-making not supported by evidence. Precision medicine initiative in diabetes aims to identify subcategories of T2D patients (including frail patients) using clustering techniques from data science applications, focusing on CV and poor treatment outcomes. Clear, unconditional recommendations for personalized T2D management may encourage drug prescription, especially for family physicians dealing with diverse patient contexts and clinical settings.

Categorical data analysis of 2 x 2 contingency tables is extremely common, not least because they provide odds and risk ratio statistics in medical research. The χ2 test is most often used, although some researchers use the likelihood ratio test (LRT). Does it matter which test is used? This paper argues that the LRT rather than the χ2 test should be used when we are interested in testing whether two variables are independent, as is typically the case. In contrast, the χ2 test should be reserved for where the data appear to match too closely a particular hypothesis (e.g. the null hypothesis), as may occur in the investigation of data integrity. Finally, it is argued that the evidential approach provides a consistent and coherent way in which tests can be made for each of these situations.

(1) Background: Artificial Intelligence (AI) models have shown potential in various educational contexts. However, their utility in explaining complex biological phenomena, such as Intrinsically Disordered Proteins (IDPs), requires further exploration. This study empirically evaluated the performance of various Large Language Models (LLMs) in the educational domain of IDPs. (2) Methods: Four LLMs, GPT-3.5, GPT-4, GPT-4 with Browsing, and Google Bard (PaLM 2), were assessed using a set of IDP-related questions. An expert evaluated their responses across five categories: accuracy, relevance, depth of understanding, clarity, and overall quality. Descriptive statistics, ANOVA, and Tukey's honesty significant difference tests were utilized for analysis. (3) Results: The GPT-4 model consistently outperformed the others across all evaluation categories. Although GPT-4 and GPT-3.5 were not statistically significantly different in performance (p&gt;0.05), GPT-4 was preferred as the best response in 13 out of 15 instances. The AI models with browsing capabilities, GPT-4 with Browsing and Google Bard (PaLM 2) displayed lower performance metrics across the board with statistically significant differences (p&lt;0.0001). (4) Conclusion: Our findings underscore the potential of AI models, particularly LLMs such as GPT-4, in enhancing scientific education, especially in complex domains such as IDPs. Continued innovation and collaboration among AI developers, educators, and researchers are essential to fully harness the potential of AI for enriching scientific education.

Type 2 Diabetes Mellitus (T2DM) is associated with a high risk of atherosclerotic cardiovascular (CV) disease. Contributing pathophysiologic factors include endothelial dysfunction caused by excessive production of reactive oxygen species (ROS), increased activity of nuclear factor kB (NFkB), altered macrophage polarization, and reduced synthesis of endothelial progenitor cells (EPC). Consequently, there can be a potentially rapid progression of the atherosclerotic disease with a higher propensity to unstable plaque, leading to increased cardiovascular mortality. Management is aimed at prevention, early diagnosis, and treatment of hyperglycemia and vascular complications. Innovative therapeutic approaches for T2DM seek to customize the antidiabetic treatment to each patient in order to optimize glucose-lowering effects, minimize hypoglycemia and adverse effects, and prevent cardiovascular events. The newer drugs (Glucagon Like Peptide-1 Receptor Agonists, GLP-1 RAs; Sodium GLucose coTransporter-2 inhibitors, SGLT2is; DiPeptidyl Peptidase-4 inhibitors, DPP4is) impact body weight, lipid parameters, and blood pressure, as well as endothelial function, inflammatory markers, markers of oxidative stress, and subclinical atherosclerosis. The present review summarizes the results of trials that evaluated the cardiovascular safety of these drugs and found them to be safe from the CV standpoint.

We investigated 328 SARS-CoV-2 cases in Barwon South West Victoria, Australia, in the 2020 pre-vaccination period, comparing infections with symptoms to those that remained asymptomatic. De-identified self-reported data from three sequential questionnaires on case characteristics and symptom progression were examined. Multivariable logistic regression were used to model associations between demographic profile and symptoms. Asymptomatic cases were more than three times as likely to be from ethnic minority groups [OR 3.2, 95% CI 1.5 – 6.7, p&lt;0.01], and approximately seven times more likely to be seniors (≥ 65 years) [OR 7.3, 95% CI 1.0 – 50.1] after adjusting for sex and occupation. The overrepresentation of ethnic minority groups among asymptomatic infections is suggestive of genetic haplotype variability by ethnic group, conferring greater cross protection from other coronaviruses in the early stages of the COVID-19 pandemic. This research should be repeated post-vaccination to reassess symptom expression according to ethnicity, and better comprehend case ascertainment impacts of cultural biases in testing and infection reporting, and the reliance on symptoms to trigger testing. These findings may in part reflect differences in testing patterns by ethnicity and true differences in disease expression, both important for appropriate transmission prevention strategies, and tailoring testing messaging towards ethnic minority communities.

The 2-Acetyl-1-pyrroline (2-AP) is the most important volatile in determining the aroma of fragrant rice, however, the transcriptional regulation mechanism of 2-AP biosynthesis in fragrant rice is still unclear. In this study, the Osp5cs1 knockout mutant lines and OsP5CS1 over-expression lines were constructed by genetic transformation of indica rice cultivar i.e., ‘Zhonghua11’, which was knocked out OsBADH2 to produce fragrance in aromatic rice. The OsP5CS1 gene was also identified as a key gene in the 2-AP biosynthesis pathway of aromatic rice. The OsP5CS1 promoter was used as bait, and the transcription factor OsbZIP60-like was screened by yeast one-hybrid assays. The transcription factor OsbZIP60-like specifically bound to the OsP5CS1 gene. The dual luciferase reporting system found that OsbZIP60-like transcription factor promoted the transcriptional activation of OsP5CS1. Compared with the wild type, the OsP5CS1 gene expression was significantly down-regulated in Osbzip60-like mutant, and resulted in substantial reduction in 2-AP biosynthesis. Moreover, the OsP5CS1 gene expression was significantly up-regulated in OsbZIP60-like over-expressed plants, and the 2-AP concentrations were also increased whereas the Osbzip60-like mutants were found to be sensitive to Zn deficiency. Overall, the OsbZIP60-like transcription factor promoted the 2-AP accumulation. This study provides a theoretical basis for the transcriptional regulation mechanism of 2-AP biosynthesis and explores the function of OsbZIP transcription factor in fragrant rice.

Minigastrin (MG) analogs for therapy of CCK2R-expressing malignancies are limited by low stability in vivo or excessive accumulation in non-target organs. By modifying the C-terminal receptor-binding sequence, metabolization could be prevented and tumor targeting significantly improved. In this work, N-terminal changes of the peptide length were evaluated. Based on the amino acid sequence of DOTA-MGS5 (DOTA-DGlu-Ala-Tyr-Gly-Trp-(N-Me)Nle-Asp-1Nal-NH₂), two new MG analogs were synthesized, by either introduction of a penta-DGlu moiety or depletion of the four N-terminal amino acids and introduction of a non-charged hydrophilic linker. Two CCK2R-expressing cell lines were used to demonstrate receptor interaction. Stability of the ¹⁷⁷Lu-labeled peptide analogs was evaluated in human serum up to 24 h after incubation and in BALB/c mice up to 30 min after injection. The biodistribution profile and tumor targeting potential was evaluated in xenografted BALB/c nude mice. For both new MG analogs, the combination of strong receptor-specific cell interaction, high stability and enhanced tumor targeting could be demonstrated. Shortening of the peptide sequence lowered the absorption in the dose-limiting organs, whereas elongation increased uptake in renal tissue.

Some of the lineages of SARS-CoV-2, the new coronavirus responsible for COVID-19, exhibit higher transmissibility or partial resistance to antibody mediated neutralization and were des-ignated by WHO as Variants of Interests (VOIs) or Concern (VOCs). The aim of this study was to monitor the dissemination of VOIs and VOCs in Venezuela during a year. A 614 nt genomic fragment was sequenced for the detection of some relevant mutations of these variants. Their presence was confirmed by complete genome sequencing, with a correlation higher than 99% between both methodologies. After the previously reported introduction of the Gamma VOC since the beginning of the year 2021, the variants Alpha VOC and Lambda VOI were detected as early as March 2021, at a very low frequency. In contrast, the Mu VOI, detected in May 2021, was able to circulate throughout the country. After the detection of Delta VOC in June 2021, it be-came the predominant circulating variant. With the arrival of the Omicron VOC in December, this variant was able to displace the Delta one in less than one month. This succession of variants was accompanied by a reduction in the Cycle threshold (Ct) values, in agreement with the in-crease in transmissibility described for these variants.

In the 21st century, three highly pathogenic betacoronaviruses have emerged, with an alarming rate of human morbidity and case fatality. Genomic information has been widely used to understand the pathogenesis, animal origin and mode of transmission of betacoronaviruses in the aftermath of the 2002-03 severe acute respiratory syndrome (SARS) and 2012 Middle East respiratory syndrome (MERS) outbreaks. Furthermore, genome sequencing and bioinformatic analysis have had an unprecedented relevance in the battle against the 2019-20 coronavirus disease 2019 (COVID-19) pandemic, the newest and most devastating outbreak caused by a coronavirus in the history of mankind, allowing the follow up of disease spread and transmission dynamics in near real time. Here, we review how genomic information has been used to tackle outbreaks caused by emerging, highly pathogenic, betacoronavirus strains, emphasizing on SARS-CoV, MERS-CoV and SARS-CoV-2.

When working with the novel coronavirus SARS-CoV-2 during a pandemic response, having a rapid, reproducible and reliable assay for infectious virus quantitation and utilization for evaluation of potential therapeutics is critical. Compared to traditional agarose overlay plaques visualized with neutral red, assays performed with Avicel R RC-591 semi-solid overlay provide a simplified format for rapid and easy detection and neutralization testing. The method is easily modified for higher throughput using dispensers or automated processing. Fixation using formalin provides flexibility when dealing with pathogenic agents such as SARS-CoV-2 where tissue culture plates might be removed from biocontainment for staining. Although plaque assays are considered straightforward in principle, having an easily reproducible, consistent plaque assay is an invaluable tool.

This work addresses the problem of automatic head pose estimation and its application in 3D gaze estimation using low quality RGB--D sensors without any subject cooperation or manual intervention. The previous works on 3D head pose estimation using RGB--D sensors require either an offline step for supervised learning or 3D head model construction which may require manual intervention or subject cooperation for complete head model reconstruction. In this paper, we propose a 3D pose estimator based on low quality depth data, which is not limited by any of the aforementioned steps. Instead, the proposed technique relies on modeling the subject's face in 3--D rather than the complete head, which in turn, relaxes all of the constraints with the previous works. The proposed method is robust, highly accurate and fully automatic. Moreover, it does not need any offline step. Unlike some of the previous works, the method only uses depth data for pose estimation. The experimental results on the Biwi head pose database confirm the efficiency of our algorithm in handling large pose variations and partial occlusion. We also evaluate the performance of our algorithm on IDIAP database for 3D head pose and eye gaze estimation.

The effects of rare earth Y content on the microstructure and high-temperature oxidation properties of 47Fe-36Ni-15Cr-1.5Mn alloy at 1000°C were investigated. The results show that 47Fe-36Ni-15Cr-1.5Mn alloy oxidizes at 1000°C under laboratory atmospheric pressure to form an oxide film layer dominated by Cr2O3 and (Fe, Ni, Mn) Cr2O4 spinel, and the oxidation curve of the alloy follows the parabolic law. After the addition of rare earth Y, rare earth phases precipitated along the grain boundaries in the alloy, and the more Y content, the more precipitated phases in the grain boundaries. The alloy with added rare earths was oxidized at a high temperature of 1000 °C for 2160 min, the oxidation law still followed the parabolic law, while the rare earth phase at the grain boundary reacted with the oxygen atoms infiltrated from the outside to generate a rare earth Y-rich oxide residing at the boundary between the grain boundary and the precipitated phase of the alloy. Add 0.5 wt.% rare earth Y 47Fe-36Ni-15Cr-1.5Mn-0.5Y alloy 1000 ° C high temperature oxidation of the formation of spinel oxide crystalline particles, dense and complete oxide film layer, the surface of the addition of a small amount of (0.5 wt.%) rare earth Y after the refinement of the oxide particles, and in the alloy grain boundaries in the form of oxides reside in the alloy to inhibit the cations in the matrix and the oxygen negative ions. and oxygen-negative ions in the alloy matrix, improving the antioxidant performance of the alloy. With the further increase of rare earth Y, during the oxidation of the alloy at high temperature, the precipitation phase at the grain boundary promotes the inward diffusion of oxygen, resulting in the deterioration of the antioxidant property of the alloy.

There are various approaches to managing polyethylene terephthalate waste, including methods for recycling PET. However, at present, only the cleanest wastes that can already be efficiently recycled using known methods are considered in the scientific literature. The study aims to look at other forms of polyethylene terephthalate waste that pose a challenge: low quality PET flakes, polyester tire cord, PET dust and prepolymer waste. The waste was characterized by FTIR spectroscopy, viscosimetry, differential scanning calorimetry, laser diffraction and sieve analysis. The findings describe the composition and properties of various forms of polyethylene terephthalate waste. Low quality PET flake waste and polyethylene terephthalate dust have been shown to be suitable for all chemical recycling methods. When recycling waste polyester tire cord, it is difficult to completely separate the rubber, so its presence in the final product must be taken into account. The most promising way to process a prepolymer is its depolymerization by hydrolysis, alcoholysis or glycolysis to produce monomers for the synthesis of PET, similar in properties to the primary one.

The emergence of SARS-CoV-2 mutations pose significant challenges to diagnostic tests as these mutations can reduce the sensitivity of commonly used RT-PCR assays. Therefore, there is a need to design diagnostic assays with multiple targets to enhance sensitivity. In this study, we identified a novel diagnostic target, nsp10 gene, using nanopore sequencing. Firstly, we determined the analytical sensitivity and specificity of our COVID-19-nsp10 assay. The COVID-19-nsp10 assay had the limit of detection of 74 copies/mL (95% confidence interval: 48-299 copies/mL) and did not show cross-reactivity with other respiratory viruses. Next, we determined the diagnostic performance of the COVID-19-nsp10 assay using 261 respiratory specimens, including 147 SARS-CoV-2-positive specimens belonging to ancestral strain and Alpha, Beta, Gamma, Delta, Mu, Eta, Kappa, Theta and Omicron lineages. Using the LightMix E-gene RT-PCR assay as the reference method, the diagnostic sensitivity and specificity of the COVID-19-nsp10 assay were 100%. The median Cp values for the LightMix E-gene RT-PCR and our COVID-19-nsp10 RT-PCR were 22.48 (range: 12.95-36.60) and 25.94 (range 16.37-36.87), respectively. The Cp values of the COVID-19-nsp10 RT-PCR assay correlated well with those of the LightMix E-gene RT-PCR assay (Spearman’s ρ = 0.968; P&lt;0.0001). In conclusion, nsp10 is a suitable target for SARS-CoV-2 RT-PCR assay.

Background: Severe Acute Respiratory Syndrome Corona Virus 2 (SARS-CoV-2) affects human respiratory function causing COVID-19 disease. Safe natural products with potential antiviral phytochemicals with benefits to control high-altitude sickness could be adopted as adjunct therapy for COVID-19. The red petals of Rhododendron arboreum, commonly available and consumed in the Himalayan region may have phytochemicals with potential antiviral properties against COVID-19 targets.Purpose: This study was aimed to profile the secondary metabolites of R. arboreum petals, to assess their absorption, distribution, metabolism and elimination (ADME) properties and evaluate their antiviral potential by docking against COVID-19 targets such as SARS-CoV-2 main protease (M^pro PDB ID: 6LU7) and Human Angiotensin Converting Enzyme 2 (ACE2) receptor (PDB ID: 1R4L) that mediates the viral replication and entry into the host respectively.Methods: The phytochemicals of R. arboreum petals were mainly profiled using Gas Chromatography-Mass Spectroscopy (GC-MS) and ¹H-NMR. In addition, the phytochemicals reported from the literature were tabulated. The ADME properties of the phytochemicals were predicted using SwissADME tool. Molecular docking simulation of the phytochemicals against SARS-CoV-2 main protease (M^pro PDB ID: 6LU7) and Human Angiotensin converting enzyme 2 (ACE2) receptor (PDB ID: 1R4L) were carried out using PyRx.Results: R. arboreum petals were found to be rich in appreciable proportions of secondary metabolites such as Quinic acid, 3-Caffeoyl-quinic acid, 5-O-Coumaroyl-D-quinic acid, 5-O-Feruloylquinic acid, 2,4-Quinolinediamine, Coumaric acid, Caffeic acid, Epicatechin, Catechin, 3-Hydroxybenzoic acid, Shikimic acid, Protocatechuic acid, Epicatechin gallate, Quercetin, Quercetin-O-pentoside, Quercetin-O-rhamnoside, Kaempferol-O-pentoside and Kaempferol. Several of these phytochemicals were reported to exhibit inhibitory activities against a range of viruses. From the molecular docking studies, 5-O-Feruloylquinic acid, 3-Caffeoyl-quinic acid, 5-O-Coumaroyl-D-quinic acid, Epicatechin and Catechin showed strong binding affinity with SARS-CoV-2 M^pro and human ACE2 receptor.Conclusion: This report showed that R. arboreum petals are rich in several antiviral phytochemicals that also docked against SARS-CoV-2 M^Pro and Human ACE2 receptor. This is the first report highlighting R. arboreum petals as a reservoir of antiviral phytochemicals with potential for synergetic activities. The outcomes merit further in vitro, in vivo and clinical studies on R. arboreum phytochemicals to develop natural formulations against COVID-19 disease for therapeutic benefits.

Coronavirus disease 2019 (COVID-19) fatal outcomes have been associated with multiple cardiovascular risk factors. In new epidemic areas, such as Latin America, there is a lack of studies about this. Here, we evaluated those factors in a retrospective cohort of patients in a national reference hospital of Lima, Peru. Design. A retrospective cohort observational study was done. For this study, information was obtained from clinical records of the hospital for the cases that were laboratory-diagnosed and related, during March 6^th and April 30^th, 2020. rRT-PCR was used for the detection of the RNA of SARS-CoV-2 following the protocol Charité, Berlin, Germany, from nasopharyngeal swabs at the National Institute of Health. Calculation of the odds ratio (OR) with the respective 95% confidence interval (95% CI) was done, also logistic regression for adjusted OR (multivariate) was done. Values of p < 0.05 were considered significant for all analyses. Results. One hundred six hospitalized patients were evaluated. The mean age of patients was 61.58 years (SD 16.81). Cardiovascular risk factors among them were hypertension (46.2%), diabetes (28.3%), and obesity (28.3%), among others. Fifty-six patients died (52.8%). Mortality associated factors at the multivariate analysis were arterial hypertension (OR=1.343, 95% 1.089-1.667), myocardial injury (OR=1.303, 95% 1.031-1.642), and mechanical ventilation (OR 1.262, 95% 1.034-1.665), as associated factors. Conclusion. As observed in other regions of the world, cardiovascular risk factors represent a significant and independent threat to be considered in patients with COVID-19. Further studies and interventions in Peru and Latin America are expected.

In agriculture, soil-borne fungal pathogens, especially Fusarium oxysporum strains, are posing a serious threat to efforts to achieve global food security. In the search for safer agrochemicals, silica nanoparticles (SiO2NPs) have recently been proposed as a new tool to alleviate pathogen damage including Fusarium wilt. Hollow mesoporous silica nanoparticles (HMSNs), a unique class of SiO2NPs, have been widely accepted as a desired pesticide carrier. However, their role in enhancing the disease resistance and the specific mechanism remain unknown. In this study, three sizes of HMSNs (19, 96 and 406 nm as HMSNs–19, HMSNs–96 and HMSNs–406, respectively) were synthesized and characterized to determine their effects on seed germination, seedling growth, and Fusarium oxysporum f. sp. phaseolus (FOP) suppression in cowpea roots by foliar spray using phenotypes, fresh biomass and disease progression as indicators. The results revealed that three HMSNs exhibited no adverse impacts on seed germination and tended to improve plant growth. Also, they exert their FOP suppression with a size- and concentration-dependent manner. HMSNs–406 possessed the best control effect at a concentration of 1000 mg/L showing an upto 40.00% decline in the disease severity. The Si(OH)4 control was also effective on FOP suppression at a lower concentration of 100 mg/L, whereas its higher concentrations exhibited obviously adverse impacts on FOP control, seed germination and plant growth. Moreover, we conformed that HMSNs posed their Fusarium wilt suppression in cowpea plant by activating SA (salicylic acid)-dependent SAR (systemic acquired resistance) responses rather than directly suppressing FOP. A higher level of SA content and elevated expression of its maker genes of PR-1 and PR-5 in HMSNs–406 treated cowpea roots provided substantial evidences of this mode of action. Other resistance-related genes, as well as defense-responsive enzymes, were also involved in the HMSNs-activated SAR pathway. Overall, for the first time, our results extended a new role of HMSNs as a potent elicitor to serve as a versatile alternative for plant disease protection of low cost, highly efficiency and sustainability.