An experiment was carried out at Nabogram Khamarbari, near the Manannogor, Sadar Upazila, Noakhali District, Noakhali-3814, Bangladesh during the period from 12th January 2018 to 17th April 2018, with two varieties of tomatillo (Physalis ixocarpa Brot.) SAU tomatillo-1 and SAU tomatillo-2. It was laid out in RCBD method having three replications and was conducted to observe the influence of staking and non-staking on tomatillo cultivation in coastal areas. For the study, growth indicating characters like no. of leaves plant^-1, size of leaf plant^-1, height of each plant, no. of branches plant^-1 and yield attributing parameters such as days to first flowering, days to 50% flowering, no. of fruits branch^-1, fruit weight and yield were obtained from the plants with the treatments of staking and non-staking. A wide variation was observed between two varieties of tomatillo with the effect of these treatments. According to the results highest no. of leaves branch^-1, maximum size of leaves branch^-1, tallest height of each plant, uppermost no. of branches plant^-1, highest no. of fruits branch^-1, maximum weight of each fruit and yield were obtained in the staking treatment over the non-staking treatment of SAU tomatillo-1 and in case of SAU tomatillo-2, with the same parameters the result indicated significantly upper in the staking treatment over non-staking treatment. Considering the two varieties of tomatillo, the outcome were significantly superior with staking treatment for the similar parameters. The findings of the experiment indicated that the best yield (21 tha¹) and highest financial benefit could be obtained by SAU tomatillo-1 and the best tomatillo production in saline soil of coastal areas is possible by cultivating SAU tomatillo-1.

Biofilm-mediated infection is a major cause of bone prosthesis failure. The lack of molecules able to act in biofilms has driven research aimed at identifying new anti-biofilm agents via chemical screens. However, to be able to accommodate a large number of compounds, the testing conditions of these screenings end up being typically far from the clinical scenario. In this study, we assess the potential applicability of three anti-biofilm compounds (based on natural compounds) as part of implanted medical devices by testing them on in vitro systems that more faithfully resemble the clinical scenario. To that end, we used a competition model based on the co-culture of SaOS-2 mammalian cells and Staphylococcus aureus (collection and clinical strains) on a titanium surface. Additionally, we studied whether these derivatives of natural compounds enhance the previously proven protective effect of pre-incubating the titanium surface with SaOS-2 cells. Out of the three tested leads, one showed the highest potential, and can be regarded as a promising agent for incorporation into bone implants. This study emphasizes and demonstrates the importance of using meaningful experimental models, where potential antimicrobials ought to be tested for protection of biomaterials in translational applications.

Indigenous forests cover 24% of New Zealand and provide valuable ecosystem services. However, a national map of forest types, that is, physiognomic types, which would benefit conservation management, does not currently exist at an appropriate level of detail. While traditional forest classification approaches from remote sensing data are based on spectral information alone, the joint use of space-based optical imagery and structural information from synthetic aperture radar (SAR) and canopy metrics from air-borne Light Detection and Ranging (LiDAR) facilitates more detailed and accurate classifications of forest structure. We present a support vector machine (SVM) classification using data from ESA’s Sentinel-1 and 2 missions, ALOS PALSAR, and airborne LiDAR to produce a regional map of physiognomic types of indigenous forest in New Zealand. A five-fold cross-validation of ground data showed that the highest classification accuracy of 80.9% is achieved for bands 2, 3, 4, 5, 8, 11, and 12 from Sentinel-2, the ratio of bands VH and VV from Sentinel-1, HH from PALSAR, and mean canopy height and 97th percentile canopy height from LiDAR. The classification based on the optical bands alone was 73.1% accurate and the addition of structural metrics from SAR and LiDAR increased accuracy by 7.8%. The classification accuracy is sufficient for many management applications for indigenous forest in New Zealand, including biodiversity management, carbon inventory, pest control, ungulate management, and disease management. National application of the method will be possible in several years, once national LiDAR coverage is achieved, and a national canopy height model is available.

Digital Elevation Models (DEMs) are essential in watershed delineation, but the sensitivity of simulated runoff to DEM resolution is poorly understood. This study investigates the impact of DEM resolution on topological attributes and simulated runoff in the Mahabad Dam watershed, Iran. To delineate the watershed, DEMs with 12.5 m, 30 m, and 90 m resolutions were acquired from the ALOS PALSAR, Space Shuttle Radar Topography Mission (SRTM), and ASTER global DEM data source, respectively. Watershed and streamlines were delineated in ArcGIS, with hydrologic analyses performed using the Soil and Water Assessment Tool (SWAT). Sensitivity analysis on parameters contributing to runoff was done using Sequential Uncertainties Fitting Ver-2 (SUFI-2) Algorithm, in SWAT Calibration and Uncertainty Procedures (SWAT-CUP) software. Results showed the watershed area, reach lengths, and elevations in the watershed varied due to DEM resolutions. Higher amounts of runoff were generated when DEMs with finer resolutions were implemented. The 12.5 m DEM generated 3.48% and 0.42% more runoff compared with 90 m and 30 m DEMs, respectively. SWAT-CUP results showed the sensitivity of parameters contributing to runoff changes under different DEM resolutions. Regardless of DEM resolution, surface properties, available water capacity, and moisture levels in the soil are the most sensitive parameters. As the distribution of slope changes in different DEM resolutions, surface parameters are most affected. The findings indicate to reduce computation time and speed up computation procedures, researchers may use DEMs with coarser resolutions at the expense of minor decreases in accuracy.

Home Security Systems are very important features of modern residential and office setups. This system is used to keep home safe from harmful gases, fire and intruders. It must be affordable, reliable and effective. In this paper, a GSM based home security system has been designed and implemented. The system consists of a GSM Module, MQ-2 smoke detector, Ultrasonic sonar sensor, LM35 temperature sensor, Arduino Uno and relay module. The MQ-2 smoke detector is used to detect harmful gases i.e. LPG, CH4, CO, Alcohol, Smoke or Propane. Any of the harmful gases stated above is detected it will warn the owner by activating the buzzer and displaying a warning message on the LCD display. It will also send a SMS to the owner. Our system can also measure temperate and if the temperature is increased above a certain range it will compensate it by activating Air Conditioner through the relay module. The system will also send a SMS to the owner. It can also detect intruders using Ultrasonic sensor and warn us through buzzer, SMS and displaying message on the LCD. Our system is reliable as it has very fast response and cost effective and it has been developed using our own technologies.

Home Security Systems are very important features of modern residential and office setups. This system is used to keep home safe from harmful gases, fire and intruders. It must be affordable, reliable and effective. In this paper, a GSM based home security system has been designed and implemented. The system consists of a GSM Module, MQ-2 smoke detector, Ultrasonic sonar sensor, LM35 temperature sensor, Arduino Uno and relay module. The MQ-2 smoke detector is used to detect harmful gases i.e. LPG, CH₄, CO, Alcohol, Smoke or Propane. Any of the harmful gases stated above is detected it will warn the owner by activating the buzzer and displaying a warning message on the LCD display. It will also send a SMS to the owner. Our system can also measure temperate and if the temperature is increased above a certain range it will compensate it by activating Air Conditioner through the relay module. The system will also send a SMS to the owner. It can also detect intruders using Ultrasonic sensor and warn us through buzzer, SMS and displaying message on the LCD. Our system is reliable as it has very fast response and cost effective and it has been developed using our own technologies.

The COVID-19 pandemic situation has created even more difficulties in the quick identification and screening of the COVID-19 patients for the medical specialists. Therefore, a significant study is necessary for detecting COVID-19 cases using an automated diagnosis method, which can aid in controlling the spreading of the virus. In this paper, the study suggests a Deep Convolutional Neural Network-based multi-classification approach (COV-MCNet) using eight different pre-trained architectures such as VGG16, VGG19, ResNet50V2, DenseNet201, InceptionV3, MobileNet, InceptionResNetV2, Xception which are trained and tested on the X-ray images of COVID-19, Normal, Viral Pneumonia, and Bacterial Pneumonia. The results from 3-class (Normal vs. COVID-19 vs. Viral Pneumonia) showed that only the ResNet50V2 model provides the highest classification performance (accuracy: 95.83%, precision: 96.12%, recall: 96.11%, F1-score: 96.11%, specificity: 97.84%) compared to rest of the models. The results from 4-class (Normal vs. COVID-19 vs. Viral Pneumonia vs. Bacterial Pneumonia) demonstrated that the pre-trained model DenseNet201 provides the highest classification performance (accuracy: 92.54%, precision: 93.05%, recall: 92.81%, F1-score: 92.83%, specificity: 97.47%). Notably, the ResNet50V2 (3-class) and DenseNet201 (4-class) models in the proposed COV-MCNet framework showed higher accuracy compared to the rest six models. This indicates that the designed system can produce promising results to detect the COVID-19 cases on the availability of more data. The proposed multi-classification network (COV-MCNet) significantly speeds up the existing radiology-based method, which will be helpful to the medical community and clinical specialists for early diagnosis of the COVID-19 cases during this pandemic.

The emergence of superhydrophobicity-based antibacterial materials represents a promising approach to upholding surface cleanliness and hygiene, effectively preventing bacterial adhesion. This research describes the synthesis of a superhydrophobic coating with antibacterial and bacteriostatic properties using silica nanoparticles (SiO2 NPs) modified with 1H,1H,2H,2H-Perfluorodecyltriethoxysilane (PFDTES). TEM, XRD, EDS, SEM, and FTIR analyses were conducted to study its morphology and surface characterization. Additionally, the coating was applied on glass substrates using the spray coating method, varying the number of layers to evaluate antibacterial and bacteriostatic properties through turbidimetry and inhibition halo measurement techniques. The durability of the coatings was also assessed by exposing them to outdoor conditions for 35 days. This study aimed to evaluate the antibacterial capacity of the superhydrophobic coating and its weather resistance. The results demonstrate that a superhydrophobic coating with a contact angle ≥150° and a sliding angle ≤10° was successfully synthesized using SiO2 NPs smaller than 10 nm modified with PFDTES. The coating exhibited the ability to inhibit bacterial growth by preventing the adhesion of bacteria such as Escherichia coli and Staphylococcus aureus; moreover, the number of layers correlated with enhanced antibacterial properties. The coating also showed good durability under outdoor conditions. These results support the potential application of superhydrophobic coatings to prevent these bacteria from adhering and growing in areas where they can be harmful.

Traditional photodynamic therapy (PDT) is often limited in its efficacy by insufficient light penetration, inefficient photosensitizer energy transfer, and inadequate target tissue oxygenation. X-ray activated PDT (XPDT), using nanoparticle (NPs) photosensitizers comprised of europium-doped yttrium oxide cores encased within silica shells (Y₂O₃:Eu@SiO₂), offers the potential of overcoming most of these limitations. Aimed at maximizing the generation of reactive oxygen species (ROS), this study reports methodologies for investigation of the effects of synthesis conditions on the characteristics of Y₂O₃:Eu@SiO₂ NP. Transmission electronic microscope (TEM) revealed that the NP core diameter was linearly, positively correlated with condensation time (R2 = 0.7357, p < 0.05) and linearly, negatively correlated with urea concentration (R2 = 0.958, p < 0.05). The addition of cetyltrimethylammonium bromide (CTAB) during core synthesis demonstrated enhanced particle dispersion. Silica coating via APTES-1 and TEOS-3 conditions resulted in Y₂O₃:Eu@SiO₂ NPs that generated the highest ROS, with 8.7-fold and 8.9-fold increase respectively in relative fluorescence intensity at 8 Gy irradiation compared to a 5.2-fold increase in PBS under the same condition. In vivo evaluation using 18F-fluorothymidine positron emission tomography (18F-FLT PET) of mouse xenografts of a human prototypical cancer (ovarian) revealed a 55% reduction in tumor proliferation of radiation-sensitive CAOV3 tumors treated with Y₂O₃:Eu@SiO₂ NPs compared to a 19% reduction in tumor proliferation of radiation-resistant SKOV3 tumors on the fourth day post-treatment. Taken together, these findings suggest Y₂O₃:Eu@SiO₂ NPs can serve as effective photosensitizers for XPDT and their performance characteristics can be optimized by selecting synthesis conditions and parameters to deliver the desirable therapeutic effects, offering novel approaches to circumventing many of the limitations of conventional PDT in the treatment of cancer.

Hydrogen sulfide is present in active or extinct volcanic areas (mofettas). The habitable premises in these areas are affected by the presence of hydrogen sulfide, which, even in low concentrations, gives off a bad to unbearable smell. If the living spaces considered are closed enclosures, then a system can be designed to reduce the concentration of hydrogen sulfide. This paper presents a membrane way to reduce the hydrogen sulfide concentration to acceptable limits using a cellulosic derivative-propylene hollow fiber based composite membrane module. The cellulosic derivatives considered were carboxymethyl–cellulose (NaCMC), cellulose acetate (CA), methyl 2–hydroxyethyl–cellulose (MHEC), and 2–hydroxyethyl–cellulose (HEC). In the permeation module, hydrogen sulfide is captured with a solution of cadmium that forms cadmium sulfide, usable as a luminescent substance. The composite membranes were characterized by SEM, EDAX, FTIR, FTIR 2D maps, thermal analysis (TG and DSC) and from the perspective of hydrogen sulfide air removal performance. To determine the process performances, the variables were: the nature of the cellulosic derivative–polypropylene hollow fiber composite membrane, the concentration of hydrogen sulfide in the polluted air, the flow rate of polluted air, and the pH of the cadmium nitrate solution. Pertraction efficiency was maximum for the sodium carboxymethyl–cellulose (NaCMC)-polypropylene hollow fiber membrane, a hydrogen sulfide concentration in the polluted air of 20 ppm, polluted air flow rate of 50 L/min, and a pH of 2 and 4.

This prospective cohort study aimed to evaluate the efficacy of COVID-19 vaccine schemes, ho-mologous versus heterologous vaccine strategies, and vaccine-induced anti-S-RBD-IgG antibody response in preventing COVID-19 among 942 healthcare workers one year after vaccination with the inactivated and/or mRNA vaccines. All participants received the first two primary doses of vaccines, 13.6% of them lacked the dose-3, 50.5% the dose-4, and 90.3% the dose-5. Antibody lev-els increased with the increase in number of vaccine doses and also in heterologous vaccine regi-mens. In both inactive and mRNA vaccines, infection rates were significantly higher in 2-dose-receivers, but lower in 4- or 5-dose receivers and increasing the total number of vaccine doses resulted in more protection against infection: the 3-dose regimen yielded 4.71 times more protection, the 4-dose 11.76 times and 5-dose 38.46 times more protection from COVID-19 infec-tion, compared to any 2-dose vaccination regimens. Antibody levels at the end of the first year of 4- or 5-dose-receivers were significantly higher than 2- or 3-dose-receivers. To conclude; increased number of total vaccine doses and anti-S-RBD antibody levels increased the protection from COVID-19 infection. Therefore, four or more doses are recommended in one year, for effective protection, especially in risk groups.

Most vulnerable individuals are particularly affected by the COVID-19 pandemic. This study takes place in a large city in France. The aim of this study is to describe the mobility of the homeless population at the begin-ning of the health crisis and to analyze its impact in terms of COVID-19 prevalence. From June to August 2020 and September to December 2020, 1272 homeless people were invited to be tested for SARS-CoV-2 antibodies and virus in and completed questionnaires. Our data show that homeless populations are sociologically dif-ferent depending on where they live. We show that people living on the street were most likely to be relocated to emergency shelters than other inhabitants. Some neighborhoods are points of attraction for homeless peo-ple in the city while others emptied during the health crisis, which had consequences for virus circulation. People with a greater number of different dwellings reported became more infected. This first study of the mo-bility and epidemiology of homeless people in time of pandemic provides unique information about mobility mapping, sociological factors of this mobility, mobility at different scales and epidemiological consequences. We suggest that homeless policies need to be radically transformed since actual model exposes people to infection in emergency.

Biochar has a carbon-based porous structure that is advantageous for adsorbing air pollutants. The pore structure of biochar ranges from several tens to hundreds of m²/g depending on the production temperature. We compared the pore characteristics of biochar with its NOx and SOx adsorption performances to evaluate its adsorbing potential. Biochar was produced from cypress biomass via slow pyrolysis in a fixed-bed reactor and CO2 partial gasification. Slow pyrolysis experiments at 500–700°C were conducted to produce biochar, followed by yield, proximate, elemental, and surface area analyses. CO2 partial gasification activated the biochar produced by slow pyrolysis at the same temperature, and similar analyses were performed. NO and SO2 adsorption experiments were conducted separately and together for biochar produced under each condition. Biochar produced at 600°C showed the highest specific surface area. CO2 partial gasification increased the surface area at each temperature, reaching 680.3 m²/g at 700°C. In single adsorption experiments, N2 carbonized biochar showed NO and SO2 adsorption efficiencies of 84–90% and 88.2–91.4%, respectively, with similar trends in simultaneous adsorption experiments. CO2 activated biochar exhibited higher adsorption efficiencies due to its increased surface area, with NO and SO2 adsorption at 89.8–93.9% and 92–98.9%, respectively. Biochar activated at 700°C simultaneously adsorbed approximately 99% NO and SO2. The NO adsorption efficiency increased with increasing surface area of the small pores, whereas the SO2 adsorption efficiency improved with the development of both small and large pores.

In this work, non-ordered and ordered CeO2-based catalysts are proposed for the CO2 conversion to dimethyl carbonate (DMC). Particularly, a non-ordered mesoporous CeO2, consisting of small nanoparticles of about 8 nm, is compared with two highly porous (635-722 m2/g) ordered CeO2@SBA-15 nanocomposites obtained by two different impregnation strategies (a two-solvent impregnation (TS) and a self-combustion (SC) method), with a final CeO2 loading of 10 wt%. The Rietveld analyses on XRD data combined with TEM imaging evidence the influence of the impregnation strategy on the dispersion of the active phase: nanoparticles of 8 nm for the TS composite vs. 3 nm for the SC composite. The catalytic results show comparable activity for the mesoporous ceria and the CeO2@SBA-15_SC nanocomposite, while a lower DMC yield was found for the CeO2@SBA-15_TS nanocomposite. This finding is presumably ascribed to a partial obstruction of the pores by the CeO2 nanoparticles in the case of the TS composite, which leads to a reduced accessibility of the active phase. On the other hand, in the case of the SC composite, where the CeO2 particle size is much lower than the pore size, there is an improved accessibility of the active phase to the molecules of the reactants.

Growth factor receptor-bound protein 2 (GRB2) is a negative regulator of insulin signaling and positive regulator of angiogenesis. Its expression is increased in a mouse model of retinal neovascularization and in patients with type 2 diabetes mellitus (T2DM). This case-control study aimed to investigate the association between the rs9896052 polymorphism (A>C) upstream of GRB2 and proliferative diabetic retinopathy (PDR) in patients with T2DM from Southern Brazil, taking into consideration self-reported skin color (white or non-white) and the known duration of diabetes (< 10 years or ≥ 10 years). Genotypes were determined using real-time PCR in 838 patients with T2DM (284 cases with PDR and 554 controls without DR). In the total study group and in the analysis stratified by skin color, the genotype and allele frequencies were similar between the cases and controls. However, among patients with less than 10 years of diabetes, the C allele was more frequent in cases than in controls (63.3% versus 51.8%, p = 0.032), and the CC genotype was independently associated with an increased risk of PDR (adjusted OR = 2.82, 95% CI 1.17-6.75). In conclusion, our findings support the hypothesis that the rs9896052 polymorphism near GRB2 is associated with PDR in Brazilian patients with T2DM.

International law faces numerous challenges in the 21st century, ranging from the traditional issues of sovereignty to emerging threats like cyber warfare and climate change. This article explores the evolving landscape of international law, discussing both the challenges it faces and the prospects for its future. By examining the role of international organizations, the impact of technological advancements, and the growing influence of non-state actors, this article provides a comprehensive overview of the current state of international law and offers insights into how it can adapt to meet the demands of an increasingly interconnected world.

Businesses now formally enter the phase of "think power differentiation and gap" in response to the new economic climate. While AI, big data, empowerment via the internet, and other aspects of the digital economy help to improve technical capabilities and save operating costs, they also push businesses to innovate their strategies at a faster rate. Enterprises are strategically choosing to de-enterprise, moving from focusing on a single business functioning benefit to building an ecosystem of platform services that will give them a competitive edge. Additionally, the organization's structure is evolving continually from a vertical model to a curved working style, in order to achieve this, businesses must recognize the importance of data analysis in day-to-day management and operations, encourage the development of an organizational atmosphere that is driven by data, fully utilize digital technology, modularize areas or production links that perform related tasks, and encourage the reform of organizational structures. By streamlining the output of the product or service to the external community while also enhancing the company's financial performance model, switching from process-to result-oriented evaluation, and putting in place a customized authority and accountability framework. Replace outcome-focused evaluation with process-focused evaluation, and create a customized incentive scheme that balances power, accountability, and rewards.

The main purpose of this article is to consider the smoothness control of a weak solution after some moment if there is known solution regularity until this moment. The necessary tools can be varied. It is possible to control kinetic energy dissipation to fix moment or changing of velocity square or summability of acceleration square to fix at point time.

In this paper, the integrated performance of a modular biomass boiler with an existing industrial Rankine steam heat and power cycle and a supplementary supercritical-CO2 (sCO2) Brayton cycle is analyzed. The aim is to leverage the high efficiency supplementary sCO2 cycle to increase net generation and energy efficiency from the existing biomass boiler. Two sCO2 heater configurations situated within the flue gas flow path are investigated, namely a single convective-dominant heater, and a dual heater configuration with a radiative and a convective heater. A quasi-steady-state 1D model was developed to simulate the integrated cycle, including detailed component characteristics for the Rankine and Brayton cycles. The model solves the mass, energy, momentum, and species balance equations. The system is analyzed for three cases: (i) the existing Rankine cycle without the sCO2 integration, (ii) with the single convective-dominant sCO2 heater configuration, and (iii) the dual sCO2 heater configuration. The results show the required rate of overfiring for the sCO2 configurations, with a 15.3% increase in fuel flowrate resulting in an additional 21.2% in net power output. The model quantifies the impact of the sCO2 heaters, with reduced heat uptakes for downstream boiler heat exchangers. Furnace water wall heat uptake increased due to overfiring, offsetting the reduced heat uptakes at downstream evaporative heat exchangers. The dual configuration has more impact on Rankine cycle operation due to the radiative sCO2 heater placement in front of the second superheater, absorbing some of the direct radiation from the furnace.

In Tropical Monsoon climates, precipitation exceeds evapotranspiration, leading to increased surface runoff, especially in floodplain regions. The Bhagirathi-Hooghly River in India is the focus of the study, which analyses hydrology, sediment yield, and water balance in this floodplain area. This investigation employs the Soil and Water Assessment Tool (SWAT) model within the ArcGIS environment, using remote sensing data. The study area is divided into 4 sub-basins and 40 Hydrological Response Units (HRUs), with a focus on Land Use/Land Cover (LULC) parameters, soil attributes, and slope characteristics. Calibration (1998-2010) and validation (2011-2018) of river discharge and sediment yield are performed using the SUFI-2 algorithm within SWAT-CUP. The calibration process shows a strong correlation between observed and simulated data points, indicating the model's accuracy. The study reveals a pattern of early-year evapotranspiration followed by increasing rainfall during the monsoon season, leading to heightened surface runoff and sediment yield. Excessive rainfall, therefore, emerges as a pivotal driver of flood incidences within the floodplain. The insights derived from the SWAT model's floodplain data have the potential to inform flood control and sedimentation mitigation strategies. The assimilation of this data can empower local stakeholders and contribute to sustainable livelihoods and improved living conditions, offering guidance for future governmental policies.

Lifestyle interventions halt the progression of prediabetes to frank type 2 diabetes (T2D). However, the feasibility of a diabetes prevention program promoting tailored interventions on a national scale and conducted by primary care physicians is unclear. To explore this issue, general practitioners dislocated in ten different regions throughout Italy enrolled random subjects without known metabolic diseases to identify individuals with prediabetes and prescribe them an intervention based on physical activity. Using a simple stepwise approach, people referring to their primary care physician for any reason were screened for their diabetes risk with a web-based app of the Findrisc questionnaire. Those at risk for T2D, i.e. with a Findrisc score > 9, were invited to come back after overnight fasting to measure fasting glycaemia (FG). Those with 100 ≤ FG < 126 mg/dL were considered as people with prediabetes and compiled the Physical Activity Readiness Questionnaire (PAR-Q) to then receive a personalized prescription of physical activity. Overall, 5928 people were enrolled and compiled the questionnaire. Of these, 2895 (48.8 %) were at risk for T2D. Among these, FG was measured in 2168 subjects (participation rate 75%). The numbers of individuals with undetected prediabetes and T2D according to FG were 755 and 79 (34.8% and 3.6% of those assessing FG), respectively. Of the 755 subjects in the prediabetes range, 739 compiled the PAR-Q and started a personalized program of physical activity (participation rate 97%). Physicians involved in the study reported a mean of 6 minutes to perform the screening. Overall, these data suggest the feasibility of a national diabetes prevention program developed by general practitioners using a simple stepwise approach starting from a web-app to intercept individuals with prediabetes.

Introduction. This retrospective study aimed to compare the risk factors for vascular calcification (VC) between pre-hemodialysis (HD) and prevalent HD adult patients while investigating associations with calcification biomarkers. Methods. Baseline data from 30 pre-HD and 85 HD patients were analyzed, including iPTH, vitamin D, FGF23, fetuinA, sclerostin, and VC scores (Adragao method). Multivariable linear regression identified VC predictors. Results: The prevalence of VC was similar in both groups, but HD patients had more pronounced VC scores ≥6. Pre-HD patients were older, with higher prevalence of Balkan endemic nephropathy, hypertension, and less frequent use of calcium phosphate binders. Both groups exhibited similar patterns of hyperphosphatemia, low vitamin D, and iPTH levels. In HD group normal phosphate was significantly common in patients with VC, whereas hyperphosphatemia was significantly common in patients without VC. Fetuin-A levels were higher in pre-HD patients, while FGF23 was elevated in HD patients. In pre-HD patients, male gender was associated with reduced VC risk, while in HD patients, malignancies and serum phosphate levels were negative VC predictors. Conclusion: Effective monitoring and tailored treatment of VC in CKD are still focused on phosphate regulation. Besides, mineral disturbances, hormones and biomarkers regulation, and patient-specific variables need to be considered.

This study is to explore the feasibility using neural network (NN) and deep learning to diagnose three common respiratory diseases with only few symptom words. These three diseases are nasopharyngitis, upper respiratory infection, and bronchitis/bronchiolitis. Through natural language processing, the symptom word vectors are encoded by GPT-2 and classified by the last linear layer of the NN. The experimental results are promising, showing that this model achieves a high performance in predicting all these three diseases. They reach 90% in accuracy, which suggests the implications of the developed model, highlighting its potential use in assisting patients understanding their conditions via a remote diagnosis. Unlike previous studies that focus on extracting various categories of information from medical records, this study directly extracts sequential features from unstructured text data, reducing the effort required for data pre-process.

(1) Background: Some evidence suggests that cannabidiol (CBD) has potential to help alleviate HIV symptoms due to its antioxidant and anti-inflammatory properties. Here we examined acute CBD effects on various behaviors and the endocannabinoid system in HIV Tat transgenic mice. (2) Methods: Tat transgenic mice (female/male) were injected with CBD (3,10,30 mg/kg) and assessed for antinociception, activity, coordination, anxiety, and recognition memory. Brains were taken to quantify endocannabinoids and related lipids. Additionally, CBD and metabolite 7-hydroxy-CBD were quantified in the plasma and cortex. (3) Results: Tat decreased striatal-related nociception and locomotion, with some sex-dependent effects on coordination. CBD had no effect on nociception and coordination, but increased locomotor activity. For anxiety, differential CBD effects were noted for sex, with decreasing anxiety-like behavior in males only. In the striatum and spinal cord, male sex was associated with lower 2-arachidonoylglycerol and with elevated concentrations of its proinflammatory metabolite arachidonic acid. CBD metabolism was altered by sex and Tat. (4) Conclusion: Findings indicate that acute CBD effects are not altered by HIV Tat, and CBD has minimal effects on behavior and the endocannabinoid system. Interestingly, sex-dependent alterations were noted for endocannabinoids and related lipids, which may be of relevance in view of potential CBD-based treatment options for people living with HIV.

In this paper, we give all non splitting bi-unitary superperfect polynomials divisible by one or two irreducible polynomials over the prime field of two elements. We prove the nonexistence of odd bi-unitary superperfect polynomials over F2.

Selenoproteins are a group of proteins containing selenium in the form of selenocysteine (Sec, U) as the 21st amino acid coded in the genetic code. Their synthesis is dependent on dietary selenium uptake and a common set of cofactors. Selenoproteins accomplish diverse roles in the body and cell processes by acting, for example, as antioxidants, modulators of the immune function, detoxification agents for heavy metals, and other xenobiotics, key compounds in thyroid hormone metabolism. Although the functions of all this protein family are still unknown, several disorders in their structure, activity or expression have been described by researchers. They concluded that selenium or cofactors deficiency, on one hand, or the polymorphism in selenoproteins genes and synthesis, on the other hand, are involved in a large variety of pathological conditions, including type 2 diabetes, cardiovascular, muscular, oncological, hepatic, endocrine, immuno-inflammatory, neurodegenerative diseases. This review is focused on specific roles in medicine only of selenoproteins that are each named after an alphabet letter, less known than the rest of them, regarding their implications in patho-logical processes of several prevalent diseases and also in disease prevention.

Preterm birth (PB) is a leading cause of perinatal morbidity and mortality. PB prediction is per-formed by measuring cervical length, with a detection rate of around 70%. Although it is known that a cytokine-mediated inflammatory process is involved in the pathophysiology of PB, no screening method implemented in clinical practice includes cytokine levels as a predictor varia-ble. Here, we quantified cytokines in cervical-vaginal mucus of pregnant women (18-23.6 weeks of gestation) with high- or low-risk for PB determined by cervical length, collecting relevant obstetric information. IL-2, IL-6, IFN-γ, IL-4, and IL-10 were significantly higher in the high-risk group, while IL-1ra was lower. Two different models for PB prediction were created using the Random Forest machine-learning algorithm: the full model with 12 clinical variables and cyto-kine values, and the adjusted model, including the most significant variables -maternal age, IL-2, and cervical length- (detection rate 66 vs 87%, false positive rate 12 vs 3.33%, false negative rate 28 vs 6.66%, and area under the curve 0.722 vs 0.875, respectively). The adjusted model integrat-ing cytokines showed a detection rate 8 points higher than the gold standard calculator, which may allow us to identify PB risk more accurately and implement strategies for preventive in-terventions

The synthesis, anticancer and antioxidant activity of a series of indole-derived hybrid chalcones are reported here. First, using well known Claisen-Schmidt condensation method a set of 29 chalcones has been designed, synthesized, and consequently characterized. Subsequently, screening for the antiproliferative activity of the synthesized hybrid chalcones was performed on the on five cancer (HCT116, HeLa, Jurkat, MDA-MB-231 and MCF7) and two non-cancer (MCF-10A and Bj-5ta) cell lines. Chalcone 18c bearing 1-methoxyindole and catechol structural features, exhibited selective activity against cancer cell lines with IC50 values of 8.0 ± 1.4 µM (Jurkat) and 18.2 ± 2.9 µM (HCT116) and showed no toxicity to non-cancer cells. Furthermore, antioxidant activity was evaluated using tree different methods. The in vitro studies of radical scavenging activity utilizing DPPH radicals, as well as FRAP method, demonstrated the strong activity of catechol derivatives 18a-c. According to the ABTS radical scavenging assay, the 3-methoxy-4-hydroxy substituted chalcones 19a–c were slightly more favorable. In general, a series of 3,4-dihydroxychalcone derivatives showed properties as a lead compound for both antioxidant and anticancer activity.

Recently, NOAA has included GNSS (Global Navigation Satellite System) Radio Occultation (RO) data as one of the crucial long-term observables for weather and climate applications. To include more GNSS RO data in the numerical weather prediction system, the NOAA Commercial Weather Data Pilot program (CWDP) started to explore the commercial RO data available on the market. After two rounds of pilot studies, the CDWP decided to award the first Indefinite Delivery Indefinite Quantity (IDIQ) contract to GeoOptics and Spire Incs. in 2020. This study examines the quality of Spire data products for weather and climate applications. Spire RO data are collected from commercial CubeSats through careful comparison with the data from Formosa Satellite Mission 7–Constellation Observing System for Meteorology, Ionosphere, and Climate-2 (COSMIC-2), ERA-5, and high-quality radiosonde data. The results demonstrated that although with lower Signal-Noise-Ratio (SNR) in general, the pattern of the lowest penetration height for Spire is similar to those for COSMIC-2. The Spire and COSMIC-2 penetrate heights are between 0.6 and 0.8 km altitude at the tropical oceans. Although using different GNSS RO receivers, the precision of Spire STRASP receivers is of the same quality as those of COSMIC-2 Global Positioning System - GPS, GALILEO, and GLObal NAvigation Satellite System – GLONASS (TGRS) receivers. The retrieval accuracy from Spire is very compatible with those from COSMIC-2. We validated Spire temperature and water vapor profiles by comparing them with collocated radiosonde data. Generally, over the height region between 8 km and 16.5 km, the Spire temperature profiles match those from RS41 RAOB very well with temperature biases &lt; 0.02 K. Over the height range from 17.8 to 26.4 km, the temperature differences are ~-0.034 K with RS41 RAOB being warmer. We also estimated the error covariance matrix for Spire, COSMIC-2, and KOMPSAT-5. Results showed that the COSMIC-2 estimated error covariance values are slightly more significant over the oceans at the mid-latitudes (45oN-30oN and 30oS-45oS), which may also be owing to COSMIC-2 SNR being lower at those latitudinal zones.

The altimeter-derived ocean currents have been sparsely evaluated against in situ measurements in the Arctic, particularly for extended time periods. This study uses the extensive mooring array situated in the Fram Strait, representing one of the longest ocean current records, to investigate the relationship between in situ and satellite-derived currents in the region. The primary objective of this research is to analyze the vertical structure of the West Spitsbergen Current (WSC), its spatio-temporal coherence, and its association with surface geostrophic currents during the period of 1997-2012. To assess the vertical structure of the WSC, we utilized the Empirical Orthogonal Functions (EOF) and cross-correlation analysis between neighboring moorings. Remarkably, both velocity components exhibited robust vertical coherence, particularly within the waters of the North Atlantic Inflow, at depths exceeding 800 m. These findings underscore the potential for surface measurements to effectively complement data gaps and facilitate the reconstruction of deeper currents with a monthly temporal resolution. Notably, the surface measurements explain approximately 67% of the variance in the top 800 m of the water column.This comprehensive investigation advances our understanding of the West Spitsbergen Current and its vertical characteristics in the Arctic. Moreover, our findings highlight the valuable synergy between in situ and satellite-derived data, providing critical insights for future ocean current studies in this ecologically sensitive region.

The Shisa family is a type of single-transmembrane adaptor proteins containing an N-terminal cysteine-rich domain and a proline-rich C-terminal region. Nine Shisa subfamily genes have been proposed in most vertebrates; however, some of them might be species-specific. The number of Shisa genes present in zebrafish remains unclear. The purpose of this study was to investigate the evolutionary relationships among Shisa family genes in zebrafish (TU strain) using phylogenetic and syntenic analyses. The function of shisa-2 was preliminarily examined via CRISPR/Cas13d-mediated knockdown. Following identification in zebrafish,10 Shisa family genes, namely shisa-1, 2, 3, 4, 5, 6, 7, 8, 9a, and 9b, were classified into three main clades and six subclades. Their encoding proteins contained a cysteine-rich N-terminal domain and a proline-rich C-terminal region containing different motifs. A specific syntenic block containing atp8a2 and shisa-2 was observed to be conserved across all species. Furthermore, all these genes were found to be expressed during embryogenesis. shisa-2 was expressed in the presomitic mesoderm, somites, and so on. shisa-2 was identified as a regulator of the expression of the somite formation marker mesp-ab. Overall, our study provides new insights into the evolution of Shisa family genes and the control of shisa-2 over the convergent extension cells of somatic precursors in zebrafish.

Periodontitis is a widely spread chronic inflammatory disease caused by a changed oral microbiome. Although multiple species and risk factors have been associated with periodontitis, Porphyromonas gingivalis undoubtedly stands in the center as a keystone pathogen. The immune-modulatory function of P. gingivalis has been well characterized, but the mechanism by which peptidyl arginine deiminase (PPAD), a citrullinating enzyme, contributes to the infinite loop of inflammation is not fully understood. To determine the functional role of hypercitrullination in the context of periodontitis, we performed a comparative analysis on neutrophils stimulated by the wild type and the PPAD mutant strain that lacks an active enzyme. Our flow cytometric analysis revealed that PPAD contributes to the prolonged neutrophil survival upon bacteria stimulation, which was accompanied by aberrant IL-6 and TNF-α secretion in the experimental environment. To further elaborate on the complex mechanism by which citrullination sustains the chronic inflammatory state, we assessed the ROS production and phagocytic activity of neutrophils. Flow cytometry and colony formation assay demonstrated that PPAD obstructs the resolution of inflammation by promoting neutrophil survival and the release of pro-inflammatory cytokines while making the bacteria itself more resilient to phagocytosis.

Crataegus Oxyacantha is used in the treatment of cardiovascular diseases. In related to your biosafety, only in vitro and in vivo genotoxicity of the fruit and the leaf is described, however, the teratogenic potential is unknown. The aim this study was evaluating the transplacental genotoxicity effect of aqueous and hydroalcoholic extract of leaves C. oxyacantha in a rat model and the quantification of malondialdehyde (MDA) in liver. Three different doses of the aqueous and hydroalcoholic extracts of the C. oxyacantha leaf were administered orally (500, 1000 and 2000 mg/kg) to Wistar rats during 5 days through the pregnancy term (16-21 days), sampling in rats were every 24 h during the last 6 days of gestation and only one sample was taken in neonates at birth. A sample of the mother's and neonate's liver was taken for the determination of MDA. The results show that, at the hepatic level, the evaluated doses of extracts C. oxyacantha in pregnant rats and their pups did not show cytotoxicity. However, the aqueous and hydroalcoholic extract generated cytotoxic and genotoxic damage in the short term. On the other hand, only the aqueous extract showed a teratogenic effect. Based on these results, the aqueous and hydroalcoholic extracts of the C. oxyacantha leaf should not be administered during pregnancy.

A land cover map of two arctic catchments, nearby the Abisko Scientific Research Station, was obtained from a classification of a Sentinel-2 satellite image and a ground survey performed in July 2022. The two contiguous catchments, Miellajokka and Stordalen, are covered by various ecotypes, from boreal forest to alpine tundra and peatland. The Random Forest algorithm correctly identified 83% of polygon pixels reserved for testing. The developed workflow relied solely on open source software and acquired ground observations. Space organization was directed by the altitude as shown by the intersection of the land cover with the topography. Comparison between this new land cover map and previous ones based on data acquired between 2008 and 2011 demonstrates some trends of vegetation cover evolution in response to climate change in the considered area. The potential applications in terms of permafrost modeling (hiperborea.omp.eu) are finally discussed.

Aim: Exposure to polycyclic aromatic hydrocarbons (PAHs) has been in the past associated with adverse effects on human health among which belong also respiratory diseases. Our study is focused on the evaluation of PAH exposure by measuring the concentrations of their monohydroxylated metabolites (OH-PAHs) in urine and comparing their concentrations with the incidence of respiratory diseases in 2-year-old children from two locations of the Czech Republic – a control locality Ceske Budejovice and a previously highly contaminated mining district Most. Methods: The total number of 248 participants were sampled for urine samples that were analysed for the presence of 11 OH-PAHs using liquid-liquid extraction with ethyl acetate and clean-up employing dispersive solid phase extraction with a sorbent Z-Sep. Separation, identification and quantification of the target compounds was achieved by ultra-high performance liquid chromatography coupled to tandem mass spectrometry. The incidence of respiratory diseases was evaluated according to the questionnaires provided by the paediatricians. Results and discussion: The concentrations of measured OH-PAHs were higher in the urine samples collected from 2-year-old children living in Most compared to 2-year-old children from Ceske Budejovice. The same trend was observed also when the urine samples were analysed when these children were studied as newborns in our previous study. From all of the monitored respiratory diseases, only influenza due to unidentified influenza virus showed a difference between tested locations where the 2-year-old children living in Most were more frequently diagnosed with this disease. Conclusion: Even though the air pollution and lifestyle in both cities is very similar, we have observed higher incidence of respiratory diseases as well as higher concentration of OH-PAHs in urine of the 2-year-old children from Most. Therefore, we hypothesize that the population living in this previously highly contaminated location (in 1970s and 1980s) can carry some long-term health burden.

The detection of waste plastics in the marine and terrestrial environment using satellite Earth Observation data offers the possibility of large-scale mapping, and reducing on-the-ground manual investigation. In addition, costs are kept to a minimum by utilizing free-to-access Copernicus data. A Machine Learning based classifier was developed to run on Sentinel-1 and -2 data. In support of the training and validation, a dataset was created with terrestrial and aquatic cases by manually digitizing varying landcover classes alongside plastics under the sub-categories of greenhouses, plastic, tyres and waste sites. The trained classifier, including an Artificial Neural Network and post-processing decision tree, was verified using five locations encompassing these different forms of plastic. Although exact matchups are challenging to digitize, the performance has generated high accuracy statistics, and the resulting land cover classifications have been used to map the occurrence of plastic waste in aquatic and terrestrial environments.

Minigastrin (MG) analogs for therapy of CCK2R-expressing malignancies are limited by low stability in vivo or excessive accumulation in non-target organs. By modifying the C-terminal receptor-binding sequence, metabolization could be prevented and tumor targeting significantly improved. In this work, N-terminal changes of the peptide length were evaluated. Based on the amino acid sequence of DOTA-MGS5 (DOTA-DGlu-Ala-Tyr-Gly-Trp-(N-Me)Nle-Asp-1Nal-NH₂), two new MG analogs were synthesized, by either introduction of a penta-DGlu moiety or depletion of the four N-terminal amino acids and introduction of a non-charged hydrophilic linker. Two CCK2R-expressing cell lines were used to demonstrate receptor interaction. Stability of the ¹⁷⁷Lu-labeled peptide analogs was evaluated in human serum up to 24 h after incubation and in BALB/c mice up to 30 min after injection. The biodistribution profile and tumor targeting potential was evaluated in xenografted BALB/c nude mice. For both new MG analogs, the combination of strong receptor-specific cell interaction, high stability and enhanced tumor targeting could be demonstrated. Shortening of the peptide sequence lowered the absorption in the dose-limiting organs, whereas elongation increased uptake in renal tissue.

Primary systemic treatment (PST) downsizes the tumor and improves pathological response. The aim of this study is to analyze the feasibility and tolerance of primary concurrent radio-chemotherapy (PCRT) in breast cancer patients. Patients with localized TN/HER2+ tumors were enrolled in this prospective study. Radiation is delivered concomitantly during the first 3 weeks of chemotherapy, and it is based on a 15 fractions scheme (40.5Gy/2.7Gy per fraction to whole breast and nodal levels I-IV. Chemotherapy is based on Pertuzumab-Trastuzumab-Paclitaxel followed by anthracyclines in HER2+ and CBDCA-Paclitaxel followed by anthracyclines in TN breast cancers patients. 58 patients were enrolled, 25 patients (43%) were TN and 33 patients HER2+ (57%). With a median follow-up of 24.2 months, 56 patients completed PCRT and surgery. A total of 35 patients (87.5%) achieved &gt;90% loss of invasive carcinoma cell in the surgical specimen. The 70.8% and the 53.1% of patients with TN and HER-2+ subtype respectively achieved complete pathological response (pCR). This is the first study of concurrent neoadjuvant treatment in breast cancer in which three strategies are applied simultaneously: fractionation of RT in 15 sessions, adjustment of CT to tumor phenotype and local planning by PET. The pCR rates are encouraging.

G‐quadruplexes (G4) are structures formed at the ends of the telomere, these are rich in guanines and were stabilized by molecules that bind to specific sites. TMPyP4 and Thymoquinone (TQ) are small molecules that bind to the G4, they have drawn attention because of their role as telomerase inhibitors. The aim of this study was to evaluate the effects of telomerase inhibitors on cellular proliferation, senescence, and death. Two cell lines LC‐HK2 (NSCLC) and RPE‐1 were treated with TMPyP4 (5μM) and TQ (10μM). Both inhibitors were effective in decreasing telomerase activity. TMPyP4 increased the percentage of cells with membrane damage associated with cell death and decreased the frequency of cells in the S‐phase. TMPyP4 changed the cell adhesion ability and modified the pattern of focal adhesion. TQ acted in a dose‐dependent manner, increasing the frequency of senescent cells, and inducing cell cycle arrest in the G1. In conclusion, the effects of both drugs on LC-HK2 and RPE-1 cell lines were different although both are telomerase inhibitors, because TMPyP4 decreased proteins of cell adhesion and TQ induces a decrease in cell viability.

Crop-type mapping is an important intermediate step for cost-effective crop management at the field level, as an overview of all fields with a particular crop type can be used for monitoring or yield forecasting, for instance. Our study used a data set with 2400 fields and corresponding satellite observations from the federal state of Bavaria, Germany. The study classified corn, winter wheat, winter barley, sugar beet, potato, and winter rapeseed as the main crops grown in Upper Bavaria. We additionally experimented with a rejection class "Other", which summarised further crop types. Corresponding Sentinel-2 data included the normalised difference vegetation index (NDVI) and raw bands from 2016 to 2018 for each selected field. The influence of raw bands compared to NDVI was analysed and the classification algorithms, i.e. support vector machine (SVM) and random forest (RF), were compared. The study showed that the use of an index should be critically questioned and that raw bands provided a wider spectral bandwidth, which significantly improved the mapping of crop types. The results underline the use of RF with raw bands and achieved overall accuracies (OA) of up to 92%. We also predicted crop types in an unknown year with significantly different weather conditions and several months before the end of the growing season. Thus, the influence of climate anomalies and the accuracy depending on the time of prediction were assessed. The crop types of a test site and year without labels could be determined with an OA of up to 86%. The results demonstrate the usefulness of the proof-of-concept and its readiness for use in real applications.

The KRAS mutant population has been undruggable for 40 years. G12C inhibitors and immunotherapy are the beginning of success. It is necessary to summarize the successful experience of the existing treatment model and explore the direction of the next treatment. In this review, we discuss the latest developments in targeted therapy and immunotherapy for KRAS-mutation NSCLC, aiming to provide direction or enlightenment for future treatment strategies.

Abstract: Commercialization of extra virgin olive oil (EVOO) requires a best before date recom-mended at up to 24 months after bottling, stored under specific conditions. Thus, it is expected that the product retains its chemical properties and preserves its ‘extra virgin’ category. However, in-adequate storage conditions could alter the properties of EVOO. In this study, Arbequina EVOO was exposed to five storage conditions for up to one year to study the effects on the quality of the oil and the compounds responsible for flavor. Every 15 or 30 days, samples from each storage condition were analyzed determining physicochemical parameters, the profiles of phenols, volatile compounds, α-tocopherol and antioxidant capacity. Principal component analysis was utilized to better elucidate the relationships between composition of EVOOs and the storage conditions. EVOOs stored at -23 and 23 °C in darkness and 23 °C with light, differed from the oils stored at 30 and 40 °C in darkness. The former were associated with higher quantity of non-oxidized phenolic compounds and the latter with higher elenolic acid, oxidized oleuropein and ligstroside derivatives, which also increased with storage time. E-2-Nonenal (detected at trace levels in fresh oil) was selected as a marker of the degradation of Arbequina EVOO quality over time, with significant linear regressions identified for the storage conditions at 30 and 40 °C. Therefore, early oxidation in EVOO could be monitored by measuring E2-Nonenal levels.

Bone marrow derived adult human mesenchymal stem cells (hMSCs) possess therapeutic qualities that enable them to enhance wound repair. However, the mechanisms by which this occurs remains poorly understood. Basic mechanisms may include the directed migration of delivered cells to target sites and/or the production and release of soluble factors that act at a distance. Allogeneic and even xenogeneic cells may effectively participate in wound repair. Labeled hMSCs were delivered to full-thickness skin wounds that were created in immunologically competent mice. The delivery occurred on day 3 post-wounding using two different carriers; one which released cells and one which retained cells. The fates of the delivered cells were tracked for up to 25 days. During this period, released cells migrated as a tight cohort deep into the wound to reach the subdermal vascular plexus. Simultaneously, enhanced formation of granulation tissue was evident. This migration of hMSCs was not essential in that enhanced granulation tissue formation and wound contraction occurred when cells were retained in the carrier matrix. This provided further evidence for the release of therapeutic factors by hMSCs to sites of injury.

Wheat is one of the global strategic crops and ranks third in terms of cereals production. Wheat crop is exposed to many fungal infections during the cultivation stages, some of which have the ability to secrete numbers of toxic secondary metabolites that threaten the quality of grains, consumer health, producer economics and global trade exchange. Fifty-four random samples were collected from wheat which originated from different countries. The samples included 14 of soft wheat to study the extent of their contamination with Deoxynivalenol (DON) and T-2 toxin by auto-ELISA technology and r-biopharm Microtiter plate. All samples were contaminated with DON toxin except one sample, and the contamination average ranged between 40.7 and 1018.8 µg kg-1. The highest contamination rates were in Lithuanian and the lowest in Indian wheat. Meanwhile the highest average level of T-2 toxin contamination was in Lithuanian wheat grains with a rate of 377.4µg kg-1 and the lowest in Polish wheat with an average of 115.3µg kg-1. GC-MS/MS and multiple reaction monitoring mode (MRM), was used to detect 15 triazole derivatives in collected samples, which may be used to combat fungal diseases on wheat during the growing season. Only 9 derivatives were found; Simeconazole, Penconazole, Hexaconazole, Cyproconazole, Diniconazole, Tebuconazole, Metconazole, Fenbuconazole and Difenoconazole. These derivatives varied according to the origin of wheat samples as well as their its concentration whereas, another 6 derivatives were not detected in all samples. A direct inverse relationship was found between the DON concentration in the samples and the residues of Simeconazole, Penconazole, Diniconazole, Tebuconazole, Metconazole, Fenbuconazole and Difenoconazole and the T-2 toxin showed the same relationship except for Tebuconazole. The safe and rational use of some triazole derivatives may be a new approach and a promising strategy not only to reduce plant diseases and their problems, but also to get rid of some mycotoxins as contaminates.

Tissue resident memory T cells (TRM) were first described in 2009. While initially the major focus was on CD8 TRM, there has been recently an increased interest in defining the phenotype and the role of CD4 TRM in diseases. Circulating CD4 T cells seed tissue CD4 TRM, but there also appears to be an equilibrium between CD4 TRM and blood CD4 T cells. CD4 TRM are more mobile than CD8 TRM, usually localized deeper within the dermis/lamina propria and yet may exhibit synergy with CD8 TRM in disease control. This has been demonstrated in herpes simplex infections in mice. In human recurrent herpes infections, both CD4 and CD8 TRM persisting between lesions may control asymptomatic shedding through interferon gamma secretion, although this has been more clearly shown for CD8 T cells. The exact role of the CD4/CD8 TRM axis in the trigeminal ganglia and/or cornea in controlling recurrent herpetic keratitis is unknown. In HIV, CD4 TRM have now been shown to be a major target for productive and latent infection in cervix. In HSV and HIV co-infections, CD4 TRM persisting in the dermis support HIV replication. Further understanding of the role of CD4 TRM and their induction by vaccines may help control sexual transmission by both viruses.

Although RNA modifications were discovered decades ago, the identification of enzymes that write, read, and erase RNA modifications enabled their functional study and spawned the field of epitranscriptomics. Coupling that knowledge to new methods has enabled the precise pinpointing of epitranscriptomic modifications across the transcriptome plus the elucidation of their functional consequences. PCIF1 (Phosphorylated CTD Interacting Factor 1) was shown to add N6, 2’-O-dimethyladenosine (m⁶Am) marks at the first nucleotide after the 5’ N7-methylguanosine (m⁷G) cap. In this review, we discuss the epitranscriptomic regulation of mRNA in general, and focus on m⁷G cap-adjacent m⁶Am in particular. m⁶Am positions can now be distinguished from N6-methyladenosine (m⁶A) using new techniques leveraging PCIF1-knockout cells. Although m⁶Am modification sites can be detected precisely, conflicting data have been published regarding how cap-adjacent m⁶Am marks affect their host mRNA. Discrepancies in the data mean that the effects of cap-adjacent m⁶Am on mRNA stability, decapping, and translation continue to be debated. Finally, while PCIF1 is predominantly nuclear, a subset of results suggest a possible cytoplasmic role as well. Taken together, these contradictory results which employed different methodologies and cell lines means that further experiments are required to determine the ultimate biological function(s) of m⁷G cap-adjacent m⁶Am.

Hepatic encephalopathy (HE) is a form of brain dysfunction that is specifically caused by liver insufficiency and/or portal-systemic shunt. The exact nature of HE is debated, so that conflicting uses of the term HE may cause inconsistencies in its detection and, in turn, issues with its management. This review highlights the meaning of the term HE on the basis of both its historical origins and current consensus. It also provides criteria for the diagnosis of the condition, on the basis of its phenotypes and the risk factors for its occurrence. The procedure for differential diagnosis from other conditions which result in similar phenotypes is considered, together with precipitants and confounders. Finally, the current multidimensional approach for the correct clinical recording of HE episodes is discussed.

IIAEK (Ile-Ile-Ala-Glu-Lys, lactostatin) is a novel pentapeptide from bovine milk β-lactoglobulin which lowers cholesterol levels. However, the molecular mechanisms underlying the suppression of intestinal cholesterol absorption by IIAEK are unknown. Therefore, we evaluated the effects of IIAEK on intestinal cholesterol metabolism in Caco-2 cells in a human intestinal model. We found that IIAEK significantly reduced the expression of intestinal cholesterol metabolism-associated genes, particularly that of the ATP-binding cassette transporter A1 (ABCA1) protein. Subsequently, we chemically synthesized a novel molecular probe, IIXEK, which can visualize a complex of target proteins interacting with photoaffinity-labeled IIAEK by fluorescent substances. Photoaffinity labeling and MS analysis with IIXEK for the rat small intestinal mucosa and intestinal lipid raft fractions of Caco-2 cells, we identified intestinal alkaline phosphatase (IAP) as a specific molecule interacting with IIAEK and discovered IIAEK common binding amino acid sequence, GFYLFVEGGR. Transfection of IAP siRNA counteracted the decrease in ABCA1 mRNA levels in Caco-2 cells. IIAEK significantly increased IAP mRNA and protein levels, and significantly decreased ABCA1 mRNA and protein levels in Caco-2 cells. In conclusion, we found that IIAEK targets IAP to improve cholesterol metabolism via a novel signaling pathway with a specific activation of IAP and down-regulation of intestinal ABCA1.

This paper presents the super-twisting algorithm (STA) direct power control (DPC) scheme for the control of active and reactive powers of grid-connected DFIG. Simulations of 5 KW DFIG has been presented to validate the effectiveness and robustness of the proposed approach in the presence of uncertainties with respect to vector control (VC). The proposed controller schemes with fixed gains are effective in reducing the ripple of active and reactive powers, effectively suppress sliding-mode chattering and the effects of parametric uncertainties not affecting system performance.

Water-soluble and cytocompatible polymers were investigated to enhance a transporting efficiency of biomolecules into cells in vitro. The polymers composed of 2-methacryloyloxyethyl phosphorylcholine (MPC) unit, a hydrophobic monomer unit, and a cationic monomer unit bearing an amino group were synthesized for complexation with model biomolecules, siRNA. The cationic MPC polymer was shown to interact with both siRNA and the cell membrane and was successively transported siRNA into cells. When introducing 20 − 50 mol% hydrophobic units into the cationic MPC polymer, transport of siRNA into cells. The MPC units (10 − 20 mol%) in the cationic MPC polymer were able to impart cytocompatibility, while maintaining interaction with siRNA and the cell membrane. The level of gene suppression of the siRNA/MPC polymer complex was evaluated in vitro and it was as the same level as that of a conventional siRNA transfection reagent, whereas its cytotoxicity was significantly lower. We concluded that these cytocompatible MPC polymers may be promising complexation reagent for introducing biomolecules into cells, with the potential to contribute to future fields of biotechnology, such as in vitro evaluation of gene functionality, and the production of engineered cells with biological functions.

Inflammation plays a key role in the development and progression of type-2 diabetes (T2D), a disease characterised by peripheral insulin resistance and systemic glucolipotoxicity. Visceral adipose tissue (AT) is the main source of inflammation early in disease course. Macrophages are innate immune cells that populate all peripheral tissues, including AT. Dysregulated AT macrophage (ATM) responses to microenvironmental changes are at the root of aberrant inflammation and development of insulin resistance, locally and systemically. The inflammatory activation of macrophages is regulated at multiple levels: cell surface receptor stimulation, intracellular signalling, transcriptionally and metabolically. This review will cover the main mechanisms involved in AT inflammation and insulin resistance in T2D. First, we will describe the physiological and pathological changes in AT that lead to inflammation and insu- lin resistance. We will next focus on the transcriptional and metabolic mechanisms described that lead to the activation of ATMs. We will discuss more novel metabolic mechanisms that influence macrophage polarisation in other disease or tissues contexts that may be relevant to future work in insulin resistance and T2D.

It is proposed that both human creativity and human consciousness are (unintended) consequences of the human brain’s extraordinary energy efficiency. The topics of creativity and consciousness are treated separately, though have a common sub-structure. It is argued that creativity arises from a synergy between two cognitive modes of the human brain (which broadly coincide with Kahneman’s Systems 1 and 2). In the first, available energy is spread across a relatively large network of neurons. As such, the amount of energy per active neuron is so small that the operation of such neurons is susceptible to thermal (ultimately quantum decoherent) noise. In the second, available energy is focussed on a small enough subset of neurons to guarantee a deterministic operation. An illustration of how this synergy can lead to creativity with implications for computing in silicon are discussed. Starting with a discussion of the concept of free will, the notion of consciousness is defined in terms of an awareness of what are perceived to be nearby counterfactual worlds in state space. It is argued that such awareness arises from an interplay between our memories on the one hand, and quantum physical mechanisms (where, unlike in classical physics, nearby counterfactual worlds play an indispensable dynamical role) in the ion channels of neural networks. As with the brain’s susceptibility to noise, it is argued that in situations where quantum physics plays a role in the brain, it does so for reasons of energy efficiency. As an illustration of this definition of consciousness, a novel proposal is outlined as to why quantum entanglement appears so counter-intuitive.

In this review, we discuss the insulin resistance (IR) and its development in the insulin target tissues that leads to diabetes. Also, we highlight the use of induced pluripotent stem cells (iPSCs) to understand the mechanisms underlying the development of IR. IR is associated with several metabolic disorders, including type 2 diabetes (T2D). The development of IR in insulin target tissues involves genetic and acquired factors. Persons at genetic risk for T2D tend to develop IR several years before glucose intolerance. Although there are currently several mouse models for both IR and T2D that had provided a lot of information about the disease, these models cannot recapitulate all the aspects of this complex disease as seen in each individual. Patient-specific iPSCs can overcome the hurdles faced with the classical mouse models for studying IR. iPSC technology can generate cells genetically identical to IR individuals, which can help in distinguishing between genetic and acquired defects in insulin sensitivity. Combining the technologies of the genome editing and iPSCs may provide important information about the inherited factors underlying the development of different forms of IR. Further studies are required to fill the gaps in understanding the pathogenesis of IR and diabetes.

A pattern of NK cell heterogeneity in each individual determines proliferative and functional responses of NK cells to activating stimuli. Obtaining the progeny of a single cell by cloning original population is one of the ways to study the NK cell heterogeneity. In this work, we used single cell sorting into a plate and stimulation by IL-2 and gene-modified K562 feeder cells expressing membrane-bound IL-21 (K562-mbIL21) that led to generation of phenotypically confirmed and functionally active NK cell clones. We applied two models of clone cultivation, which differently affected their phenotype, lifespan and functional activity. The first model, which included weekly restimulation of clones with K562-mbIL21 and IL-2, resulted in the generation of relatively short-lived (5-7 weeks) clones of highly activated NK cells. HLA-DR expression in the expanded NK cells correlated strongly with IFN-γ production. The second model, in which NK cells were restimulated mainly with IL-2 alone, produced long-lived clones (8-14 weeks) that expanded up to 10⁷ cells with lower ability to produce IFN-γ. Our method is applicable for studying variability in phenotype, proliferative and functional activity of the certain NK cell progeny in response to the stimulation, which may help in selecting NK cells best suited for clinical use.

The peripheral lymphatic system plays a crucial role in the recovery mechanisms after many pathological changes, such as infection, trauma, vascular, or metabolic diseases. The lymphatic clearance of different tissues from waste products, viruses, bacteria and toxic proteins significantly contributes to the correspondent recovery processes. However, understanding of the meningeal lymphatics functions is a challenging problem. The exploration of mechanisms of lymphatic communication with brain fluids as well as the role of the lymphatic system in the brain drainage, clearance and recovery are still in its infancy. Here we review novel concepts on the anatomy and physiology of the lymphatics in the brain, which warrant a substantial revision of our knowledge about the role of lymphatics in the rehabilitation of the brain functions after neural pathologies. We discuss a new vision on how to recruit the meningeal lymphatics by the opening of blood-brain barrier as a trigger mechanism of activation of the meningeal lymphatic drainage. This leads to innovative strategies in neurorehabilitation therapy.

Production of energy is a main task of cancer cells metabolism, since costs of duplicating are enormous. Although energy is derived in cells by dismantling carbon to carbon bonds of any macronutrient, cancer nutritional needs for energetic purposes have been studied primarily as dependent on glycolysis. Since the end of the last century, awareness of dependence of cancer metabolism on amino acids not only for protein syntheses but also for matching energy needs has grown. The roles of specific amino acids, like glutamine, glycine and serine have been explored in different experimental conditions and reviewed. Moreover, there are epidemiological evidences that some amino acids used as supplement for therapeutic reasons (the branched chain ones) may reduce incidence of liver cancer, and some molecular mechanism has been proposed as functional to their protective action. On the contrary, metabolic signature of some pathology connected with increased risk of cancer, like prolonged hyperinsulinemia in insulin resistant patients, is signed by plasma elevated levels of the same branched chain amino acids, posing puzzling questions to clinicians. Most recently, peculiar formulations of amino acids, deeply different if compared to amino acids compositions normally present in foods, have shown the power to master epigenetics slowing growth or driving cancer cells to apoptotic death, while being even beneficial for normal cells and for animals health and life span. In this review, we will analyze and try to disentangle some of the many knots dealing with complexities of amino acids biology and linked to cancer metabolism.

Herpes simplex virus (HSV) infections can be treated with direct acting antivirals like acyclovir and foscarnet, but long-term use can lead to drug resistance, which motivates research into broadly-acting antivirals that can provide a greater genetic barrier to resistance. Photodynamic inactivation (PDI) employs a photosensitizer, light, and oxygen to create a local burst of reactive oxygen species that inactivate microorganisms. The botanical plant extract Orthoquin^TM is a powerful photosensitizer with antimicrobial properties. Here we report that Orthoquin also has antiviral properties. Photoactivated Orthoquin inhibited herpes simplex virus type 1 (HSV-1) and herpes simplex virus type 2 (HSV-2) infection of target cells in a dose-dependent manner, across a broad range of sub-cytotoxic concentrations. HSV inactivation required direct contact between Orthoquin and the inoculum, whereas pre-treatment of target cells had no effect. Orthoquin did not cause appreciable damage to viral capsids or pre-mature release of viral genomes as measured by qPCR for the HSV-1 genome. By contrast, immunoblotting for HSV-1 antigens in purified virion preparations suggested that higher doses of Orthoquin had a physical impact on certain HSV-1 proteins that altered protein mobility or antigen detection. Orthoquin PDI also inhibited the non-enveloped adenovirus (AdV) in a dose-dependent manner, whereas Orthoquin-mediated inhibition of the enveloped vesicular stomatitis virus (VSV) was light-independent. Together, these findings suggest that broad antiviral effects of Orthoquin-mediated PDI may stem from damage to viral attachment proteins.

An efficient, eco-compatible and very cheap method for the construction of triazoles via eliminative azide–olefin cycloaddition (EAOC) reaction has been developed by a catalytic system IL/FeCl3, offering an highly regioselective approach to structurally diverse 1,5-disubstituted 1,2,3-triazoles in up to 95% yield. This strategy features the reuse of catalytic system through simple operations. Mechanistic studies indicated that an asynchronous concerted dipolar cycloaddition-elimination process might be involved.

Metformin use in pregnancy is increasing worldwide as randomised controlled trial (RCT) evidence is emerging demonstrating its safety and efficacy. The Metformin in Gestational Diabetes (MiG) RCT changed practice in many countries demonstrating that metformin had similar pregnancy outcomes to insulin therapy with less maternal weight gain and a high degree of patient acceptability. A multicentre RCT is currently assessing the addition of metformin to insulin in pregnant women with type 2 diabetes. RCT evidence is also available for the use of metformin for women with Polycystic Ovarian Syndrome and for non-diabetic women with obesity. No evidence of an increase in congenital malformations or miscarriages has been observed even when metformin is started before pregnancy and continued to term. Body composition and metabolic outcomes at two, seven and nine years have now been reported for the offspring of mothers treated in the MiG study. In this review, we will briefly discuss the action of metformin and then consider the evidence from the key clinical trials.

Though melatonin is known to improve ultraviolet B (UVB)-induced oxidative damage and inflammatory conditions via blockade of nuclear factor (NF)-κB, interleukin (IL)-6, there is no report on anti-wrinkle effect of melatonin to date. Hence in the present study, anti-wrinkle mechanism of melatonin was elucidated in UVB treated HaCaT keratinocytes and hairless mice. Herein melatonin protected against a radical initiator tert-Butyl hydroperoxide (t-BOOH) induced reactive oxygen species (ROS) production, matrix metalloprotease 1 (MMP-1) and cytotoxicity in HaCaT keratinocytes. Also, melatonin suppressed the expression of sonic hedgehog (SHH) and GLI for hedgehog signaling, p-NF-kB, cyclooxygenase (COX-2), p-ERK for inflammatory responses in UVB treated HaCaT keratinocytes. Furthermore, melatonin protected skin from wrinkle formation, transdermal water loss in hairless mice irradiated by UVB for 8 weeks. Notably, melatonin prevented against epidermal thickness and dermal collagen degradation in UVB irradiated hairless mice by Hematoxylin & Eosin and Masson’s trichrome staining. Taken together, these findings suggest that melatonin reduces wrinkle formation via inhibition of ROS/SHH and inflammatory proteins such as NF-kB/COX-2/ERK/MMP1.

Shiga toxin (Stx) produced by Escherichia coli is the main pathogenic factor of diarrhea-associated hemolytic uremic syndrome (HUS), which is characterized by obstruction of renal microvasculature by platelet-fibrin thrombi. It is well known that the oxidative imbalance generated by Stx induces platelet activation, contributing to thrombus formation. Moreover, activated platelets release soluble CD40 ligand (sCD40L) which in turn contributes to oxidative imbalance, triggering the release of reactive oxidative species (ROS) on various cellular types. The aim of this work was to determine if the interaction between the oxidative response and platelet-derived sCD40L participates in the pathogenic mechanism during HUS. Activated human glomerular endothelial cells (HGEC) by Stx2 induced platelets to adhere to them. Although platelet adhesion did not contribute to endothelial damage, high levels of sCD40L were released to the medium. The release of sCD40L by activated platelets was inhibited by antioxidant treatment. Furthermore, we found increased levels of sCD40L in plasma from HUS patients, which were also able to trigger the respiratory burst in monocytes, in a sCD40L-dependent manner. Thus, we concluded that platelet-derived sCD40L and the oxidative response are reciprocally stimulated during Stx2-associated HUS. This process may contribute to the evolution of glomerular occlusion and the microangiopathic lesions.

Distribution systems can form islands when faults occur. Each island represents a subsection with variable boundaries subject to the location of a fault(s) in the system. A subsection with variable boundaries is referred to as island in this paper. For operation in autonomous mode, it is imperative to detect the island configurations and stabilize these subsections. This paper presents a novel scheme for the detection of islanding boundaries and stabilizing the system during autonomous operation. In the first stage, a boundary detection method is proposed to detect the configuration of the island. In the second stage a dynamic voltage sensitivity factor (DVSF) is proposed to assess the dynamic performance of the system. In the third stage, a wide area load shedding program is adopted based on DVSF to shed the load in weak busbars and stabilize the system. The proposed scheme is validated and tested on a generic 18-bus system using a combination of EMTDC/PSCAD and MATLAB softwares.

Evidence-based medicine (EBM) is in crisis, in part due to bad methods, which are understood as misuse of statistics that is considered correct in itself. This article exposes two related common misconceptions in statistics, the effect size (ES) based on correlation (CBES) and a misconception of contingency tables (MCT). CBES is a fallacy based on misunderstanding of correlation and ES and confusion with 2 × 2 tables, which makes no distinction between gross crosstabs (GCTs) and contingency tables (CTs). This leads to misapplication of Pearson’s Phi, designed for CTs, to GCTs and confusion of the resulting gross Pearson Phi, or mean-square effect half-size, with the implied Pearson mean square contingency coefficient. Generalizing this binary fallacy to continuous data and the correlation in general (Pearson’s r) resulted in flawed equations directly expressing ES in terms of the correlation coefficient, which is impossible without including covariance, so these equations and the whole CBES concept are fundamentally wrong. MCT is a series of related misconceptions due to confusion with 2 × 2 tables and misapplication of related statistics. The misconceptions are threatening because most of the findings from contingency tables, including CBES-based meta-analyses, can be misleading. Problems arising from these fallacies are discussed and the necessary changes to the corpus of statistics are proposed resolving the problem of correlation and ES in paired binary data. Since exposing these fallacies casts doubt on the reliability of the statistical foundations of EBM in general, we urgently need to revise them.

Cornea severe inflammation produces opacity or even perforation, scarring, and angiogenesis, resulting in blindness. The cornea can be used to study the effect of new anti-angiogenic chemopreventive agents. We researched the anti-angiogenic effect of two extracts, Methanol (Met) and Hexane (Hex), from the seed of Cucurbita argyrosperma, in the inflamed corneas. The corneas of Wistar rats were alkali-injured and treated intragastrically for seven successive days. Clinical manifestation as opacity score, corneal neovascularization (CNV) area, re-epithelialization percentage, and histological evaluation were performed. Inflammatory (COX-2, NF-κB, and IL-1β), and angiogenic (VEGF-A, VEGFR1, VEGFR2) markers were assessed by immunohistochemistry. Cox-2, Il-1β, and Vegf-a mRNA levels were also determined. After treatments, we observed slim corneal thickness with lower opacity scores and low cell infiltration compared to untreated rats. Treatment also accelerated wound healing and decreased CNV area. The staining of inflammatory and angiogenic factors was significantly decreased. These effects are related to a down-expression of Cox-2, Il-1β, and Vegf. These results suggest that intake of C. argyrosperma seed can be used to attenuate the angiogenesis secondary to inflammation in corneal chemical damage.

Human coronaviruses cause both upper and lower respiratory tract infections in humans. In 2012 a sixth human coronavirus (hCoV) was isolated from a patient presenting with severe respiratory illness. The 60-year-old man died as a result of renal and respiratory failure after admission to a hospital in Jeddah, Saudi Arabia. The aetiological agent was eventually identified as a coronavirus and designated Middle East respiratory syndrome coronavirus (MERS-CoV). MERS-CoV has now been reported in more than 27 countries across the Middle East, Europe, North Africa and Asia. As of July 2017, 2040 MERS-CoV laboratory confirmed cases, resulting in 712 deaths, were reported globally, with a majority of these cases from the Arabian Peninsula. This review summarises the current understanding of MERS-CoV, with special reference to the (i) genome structure, (ii) clinical features, (iii) diagnosis of infection and (iv) treatment and vaccine development.

The viticulture sector, spanning over 7.3 million hectares worldwide, plays a crucial economic role but faces challenges such as labor shortages, rising production costs, market competition, and climate change stresses. Addressing these issues requires monitoring the spatial and temporal variability in vineyard productivity. Traditional ground-based observations, though accurate, are time-consuming and limited in scope. Precision viticulture, leveraging technologies like GPS, remote sensing, and artificial intelligence, offers efficient, non-destructive monitoring tools. This study aims to develop and test a technological workflow using the mobile app Digivit, integrated with the AgroSat platform, to estimate yield variability in vineyards. The workflow was performed during the 2023 growing season in a series of vineyards near Siena (Italy) and involved two main steps: spatial variability characterization using AgroSat and yield estimation using the mobile Digivit app. AgroSat processed Sentinel-2 NDVI data to identify homogeneous zones, while Digivit used smartphone images of grape clusters to estimate yields. The field campaign, performed three weeks before harvest, involved monitoring representative vines within identified zones and uploading georeferenced images for cluster segmentation analysis. Yield estimates were validated against measured weights, showing a strong linear correlation (R²=0.85, RMSE=43.74g). Excluding one outlier improved correlation to R²=0.95, RMSE=14.58g. Vineyard-level yield predictions were compared with harvest data, achieving an overall error of approximately 7%, in agreement with other methods in the literature. The study demonstrates that the Digivit app provides accurate, timely yield prediction, supporting farmers in harvest planning and winemaking management. The user-friendly mobile app approach facilitates a broader adoption of precision viticulture technologies among farmers, overcoming barriers related to technical expertise.

Background: Monogenic Alzheimer's disease (AD) has severe health and socioeconomic repercussions. Its rarest cause are presenilin 2 (PSEN2) gene mutations. We present two new cases with presumed PSEN2-AD, with unusual clinical and neuroimaging findings in order to provide more information on the pathophysiology and semiology of these patients. Methods: Women aged 69 and 62 years at clinical onset, marked by prominent behavioral and language dysfunction, progressing to severe dementia within three years. Neuroimaging, laboratory study, genetic testing. In addition, a systematic review of the PSEN2-AD were performed. Results: Neuroimaging revealed pronounced frontal white matter hyperintensities (WMH) and frontotemporal atrophy/hypometabolism. The genetic study unveiled PSEN2 variants: c.772G>A (p.Ala258Thr) and c.1073-2_1073-1del. Both cerebrospinal fluid (CSF) and experimental blood biomarkers shouldered AD etiology. Conclusions: Prominent behavioral and language dysfunction suggesting frontotemporal dementia (FTD) may be underestimated in the literature as a clinical picture in PSEN2 mutations. Thus, it may be reasonable to include PSEN2 in genetic panels when suspecting FTDL. PSEN2 mutations may cause striking WMH, arguably related with myelin disruption induced by amyloid accumulation.

Caudal type homeobox transcription factor 2 (CDX2) is a gastrointestinal cancer biomarker that regulates epithelial development and differentiation. Absence or low levels of CDX2 have been associated with poor prognosis and proposed as a chemotherapy response predictor. Tumour tissue of 668 patients with stage I-IV colorectal cancer were stained for CDX2 and stratified into two subgroups according to expression levels. Statistical tests evaluated CDX2 relationship with survival and chemotherapy response. Of 646 samples successfully stained, 51 (7.9%) had low and 595 (92.1%) had high CDX2 levels. Low CDX2 staining was associated with poor differentiation, presence of lymphovascular or perineural invasion, and more common in colon and right sided tumours. Overall survival (p&lt;0.001) and disease-free survival (p=0.009) was lower in low CDX2 expressing patients. Multivariable analysis validated CDX2 as an independent poor prognostic factor after excluding confounding variables. There was no statistically significant improvement in survival with adjuvant chemotherapy in stage II colon cancer (p=0.11). In the rectal cohort, there was no relationship between CDX2 levels and therapy response. While confirming the prognostic utility of CDX2 in colorectal cancer, our study highlights larger studies are required to confirm utility as a predictive chemotherapy biomarker, especially in left sided and rectal cancers.

Appropriate animal models of human diseases are a cornerstone in the advancement of science and medicine. To create animal models of neuropsychiatric and neurobehavioral diseases such as ASD necessitates the development of sufficient neurobehavioral measuring tools to translate human behavior to expected measurable behavioral features in animals. Indeed, at least in rodents, adequate neurobehavioral and neurological tests have been developed. Since ASD is characterized by a number of specific behavioral trends with significant severity, animal models of autistic-like behavior have to demonstrate the specific characteristic features, namely impaired social interactions, and communication, restricted, repetitive behavioral patterns with association to several additional impairments such as somatosensory, motor and memory impairments. Thus, an appropriate model must show behavioral impairment of a minimal number of neurobehavioral characteristics using an adequate number of behavioral tests. The proper animal models enable the study of ASD like-behavior from the etiologic, pathogenetic and therapeutic aspects. From the etiologic aspects, models have been developed by the use of immunogenic substances like polyinosinic-polycytidylic acid (PolyIC), Lipopolysaccharide (LPS) and propionic acid or other well-documented immunogens or pathogens, like mycobacterium tuberculosis. Another approach is the use of chemicals like valproic acid, Polychlorinated biphenyls (PCBs), organophosphate pesticides - chlorpyrifos (CPF) and others. These substances were administered either prenatally, generally after the period of major organogenesis, or, especially in rodents, during the early postnatal life. In addition, using modern genetic manipulation methods, genetic models have been created of almost all human genetic diseases that are manifested by autistic like behavior (i.e. fragile X, Rett syndrome, SHANK gene mutation Neuroligin genes and others). Ideally, we should not only evaluate the different behavioral modes affected by the ASD-like behavior but also assess the severity of the behavioral deviations by an appropriate scoring system, as applied to humans.

This study describes the synthesis and characterization of mixed hydrotalcite–organosilica membrane for gas separation. Hydrotalcite exhibits the capability to adsorb carbon dioxide at elevated temperatures. High surface area and favorable coating properties are essential to harness its potential for practical applications. Stable alcohol-based dispersions are needed for thin film applications of mixed membranes containing hydrotalcite. Currently, producing such dispersions without the need for delamination and dispersion agents is a challenging task. This work introduces for the first time a manufacturing approach to overcoming the drawbacks mentioned above. It includes a synthesis of hydrotalcite nanoparticles, followed by agent-free delamination of their layers and final dispersion into alcohol without dispersion agents. Further, the hydrotalcite-derived sorption agent is dispersed in a matrix based on organo-silica gels derived from 1,2-bis(triethoxysilyl)ethane (BTESE). The analytical results indicate that the interconnection between hydrotalcite and BTESE-derived gel occurs via forming a strong hydrogen bonding system between the interlayer species (OH groups, CO32-) of hydrotalcite and oxygen and silanol active gel centers. These findings lay the foundation for applications involving incorporating hydrotalcite-like compounds into silica matrices, ultimately enabling the development of materials with exceptional mass transfer properties. In part 2 of this study, gas separation performance of the organo-silica and the hydrotalcite-like materials and their combined form will be investigated

In late December 2019 a novel RNA beta-coronavirus was recognized as the causative agent of previously pneumonia cases of unknown origin. The virus was successively named Severe Acute Respiratory Syndrome CoronaVirus 2 (SARS-CoV-2) as well as the respiratory illness that it causes Coronavirus disease 19 (COVID-19) (1, 2). The global spread of SARS-CoV-2 and the thousands of deaths caused by COVID-19 led the World Health Organization (WHO) to declare a pandemic on 11 March 2020. To date, the world has paid a high toll in this pandemic in terms of human lives lost, economic repercussions and increased poverty. Indeed, even if most patients with COVID-19 are asymptomatic or experience mild self-limiting disease, 14% of them progress to severe disease and 5% to critical illness with complications, such as interstitial pneumonia, respiratory failure with acute respiratory distress syndrome (ARDS) and multiple organ dysfunction syndromes (MODS) (3). It is accepted that SARS-CoV-2 primarily affects the respiratory system, although other organs are also involved (4). The virus enters host cells by attaching its Spike like surface projections to the angiotensin-converting enzyme-2 (ACE2) receptor which is mainly expressed on alveolar epithelial cells and in nearly all human organs in varying degrees. Thus, although the central target of SARS-CoV-2 infection is the lung, the wide distribution of ACE2 receptors in other organs may lead to cardiovascular, gastrointestinal, kidney, liver, central nervous system and ocular damages that have to be closely monitored during the disease (5, 6). The virus then activates the innate and adaptive immune system resulting in a large number of cytokines release, known as “cytokine storm”, that is directly correlated with tissue injury and unfavourable prognosis of severe lung disease (7). In particular, interleukin (IL)-6 seems to plays an important role in driving this cytokine release so that its increased levels have been recognized as a hallmark inflammatory signature in sera of COVID-19 patients (8). IL-6 is a polyfunctional cytokine with both anti-inflammatory and pro-inflammatory properties which exerts its several functions through two main signal transduction pathways (9). In the classical signal transduction pathway, IL-6 binds to IL-6-trans membrane receptor (IL-6R) to form a complex that, then, binds to the trans membrane glycoprotein gp130, inducing its homo-dimerization and initiating intracellular signal transduction. This kind of signaling is limited to cells (hepatocytes, macrophages, neutrophils, T cells, etc.) that express IL-6R on their cell surface (10). Nevertheless, cells do not express IL- 6R, as stromal and epithelial cells, are able to still respond to IL-6 because the soluble form of the receptor (sIL-6R) binds to IL-6 in circle and then anchors to membrane gp130 receptor, initiating the trans-signaling pathway. For this reason, sIL-6R is able to increase the function of IL-6 and is considered the agonist form of its receptor. When the level of IL-6 increases, its effects are widely expressed because gp130 molecules are ubiquitous and, therefore, also present in cells without IL-6R in the membrane form. On the contrary, a soluble form of the glycoprotein 130 (sgp130) can complex with sIL-6R to prevent the sIL-6R from binding to the membrane-bound gp130. In this case sgp130 is able to decrease the function of IL-6 and is considered the antagonist form of IL-6 receptor system (11). Based on the central role of IL-6 in the inflammatory pathology of COVID-19 and the consistent association between elevated levels of the cytokine and severe disease outcomes found in the first phase of infection, we sought to analysis IL-6 and its soluble receptor complex behavior during the different waves of COVID-19 pandemic, in order to evaluate the possible differences which occur among them and to hypothesize if they might be used as prognostic markers of disease severity.

Formaldehyde (HCHO), an indoor volatile organic compound, is seriously harmful to human health. Therefore, green and effective decomposition of HCHO is essential. TiO₂ has been employed for the degradation of HCHO via photocatalytic generation of reactive oxygen species (ROS) (O^2-, ·OH), yet the low specific surface area of crystalline TiO₂ depressed the catalytic performance. Herein, we prepared TiO₂ aerogels with high specific surface area and high porosity by sol-gel method, and added PVA to introduce flexible molecular chains for pore size regulation. The photocatalytic performance test verifies that the pore size of TiO₂ aerogel is one of the important factors for HCHO decomposition. Notably, through the establishment of theoretical model and calculation, we validated that the efficiency of HCHO decomposition is related to the oxygen pressure in the pores of TiO₂ aerogel, and the oxygen pressure is inversely proportional to the pore size. Accordingly, the optimal pore size of TiO₂ aerogel for the photocatalytic HCHO decomposition is 2 nm~10 nm. This study provides a theoretical idea for TiO₂ aerogels in the decomposition reaction of HCHO, which is expected to inspire more breakthroughs in the study of TiO₂ aerogels for green chemistry.

We produced a recombinant eel luteinizing hormone (rec-eel LH) analog with high potency in Chinese hamster ovary DG44 (CHO DG44) cells. The eel LH mutant (LH-M), which had a linker comprising the equine chorionic gonadotropin (eCG) β-subunit carboxyl-terminal peptide (CTP) region (amino acids 115 to149), was inserted between the β-subunit and α-subunit of wild-type tethered eel LH (LH-wt). Monoclonal cells transfected with the eel LH-wt and eel LH-M plasmids were isolated from five and nine clones of CHO DG44 cells, respectively. The secreted quantities abruptly increased on day 3, with peak levels of 5,000–7,500 ng/mL on day 9. The molecular weight of eel LH-wt was 32–36 kDa while that of eel LH-M increased to approximately 38–44 kDa, indicating the detection of two bands. Treatment with peptide N-glycanase F decreased the molecular weight by approximately 8 kDa. The oligosaccharides at the eCG β-subunit O-linked glycosylation sites were appropriately modified post-translation. The EC50 value and maximal responsiveness of eel LH-M increased by approximately 2.90- and 1.29-fold, respectively, indicating that the mutant exhibited more potent biological activity than eel LH-wt. Phosphorylated extracellular regulated kinase (pERK1/2) activation resulted in a sharp peak 5 min after agonist treatment, with a rapid decrease thereafter. These results indicate that the new rec-eel LH analog which contains the eCG β-subunit CTP linker comprising O-linked glycosylation sites, had more potent activity than the wild-type in vitro. Taken together, this new eel LH analog can be produced in large quantities using a stable CHO DG44 cell system.

In this research, the primary goal was to investigate the relationship between strategic planning and organizational performance in Iraq's manufacturing context. The study's primary data sources were 360 manager respondents. The structured questionnaire was used to collect primary data from manufacturing firms located throughout Iraq. To analyze the result, the researcher used descriptive statistics, correlation, and multiple regression analysis. SPSS version 16 software was used to conduct data analysis. The result reveals that the process of strategic planning has a beneficial effect on financial performance. Environmental scanning has a statistically significant positive effect on a company's non-financial performance. Management participation and planning formality positively and statistically significantly affect a business's non-financial performance at the 10 percent level. The domain of strategy and technique has not impacted the company's non-financial performance.

This study aimed to produce single-chain recombinant eel follicle-stimulating hormone (rec-eel FSH) analogs with high activity in Chinese hamster ovary DG44 (CHO DG44) cells. We recently reported that an O-linked glycosylated carboxyl-terminal peptide (CTP) of the equine chorionic gonadotropin (eCG) β-subunit plays contributes on high activity and time-dependent secretion in mammalian cells. We constructed a mutant (FSH-M) in which a linker including the eCG β-subunit CTP region (amino acids 115 to149) was inserted between the β-subunit and α-subunit of wild-type single chain eel FSH (FSH-wt). Plasmids containing eel FSH-wt and eel FSH-M were transfected into CHO DG44 cells. Single cells expressing each protein were isolated from 10 and 7 clones, respectively. Secretion increased gradually during the cultivation period and peaked at 4,000–5,000 ng/mL on day 9. The molecular weight of eel FSH-wt was 34–40 kDa, while that of eel FSH-M increased substantially, with two bands at 39–46 kDa. Treatment with PNGase F to remove the N glycosylation sites decreased the molecular weight remarkably to approximately 8 kDa. The EC50 value and maximal responsiveness of eel FSH-M were approximately 1.23- and 1.06-fold higher than those of eel FSH-wt, indicating that the mutant showed slightly higher biological activity. Phosphorylated extracellular regulated kinase (pERK1/2) activation exhibited a sharp peak at 5 min, followed by a rapid decline. These findings indicate that the new rec-eel FSH molecule with the eCG β-subunit CTP linker showed potent activity and could be produced in massive quantities using the stable CHO DG44 cell system.

A two-year experiment was conducted with a local maize hybrid under full irrigation (F), deficit irrigation (D) and rainfed conditions (R) to estimate maize evapotranspiration in Bosnia and Herzegovina. Three approaches (Allen & Pereira (A&P), SIMDualKc (SD), and Vegetation Index (VI)) were used to estimate the actual crop coefficient (Kc act), actual basal crop coefficient (Kcb act), and actual crop evapotranspiration (ETc act) were applied with the dual crop coefficient method and remote sensing (RS) data. While Kcb act from all approaches matched FAO56 tabulated values, SD showed differences, in comparison to A&P, of up to 0.24 in D and R conditions, especially in initial and mid-season stages. VI demonstrated very good performance in all treatments. In F, the obtained Kc act for all approaches during the initial and end stages were higher than the tabulated values, ranging from 0.71-0.87 for Kc ini act and from 0.80-1.06 for Kc end act, while the mid-season period showed very good agreement with the literature. Maize crop evapotranspiration range is 769-813 mm, 480-752 mm, and 332-618 mm for F, D and R, respectively. The results confirmed the suitability of both approaches (SD and VI) to estimate maize crop evapotranspiration under F, with the VI approach demonstrating an advantage in calculating Kcb act, Kc act, and ETc act values under water stress conditions. The 67.6% increase in grain yields with irrigation emphasizes the need to transition from rainfed to irrigation-dependent agriculture, even for drought-resistant crops like maize.

: Climate change necessitates urgent actions to mitigate carbon dioxide (CO2) emissions from fossil fuel-based energy generation. Among various strategies, the deployment of carbon capture and storage (CCS) solutions are critical for reducing emissions from point sources such as power plants and heavy industries. In this context, cryogenic carbon capture (CCC) via desublimation has emerged as a promising technology. While CCC offers high separation efficiency, minimal downstream compression work, and integration potential with existing industrial processes, challenges such as low operating temperatures and equipment costs persist. Ongoing research aims to address these hurdles in order to optimize the desublimation processes for widespread implementation. This review consolidates diverse literature works, providing insights into the strengths and limitations of CCC technology, including the latest pilot plant scale demonstrations. The transformative potential of CCC is first assessed on a theoretical basis, such as thermodynamic aspects and mass transfer phenomena. Then, recent advancements in the proposed process configurations are critically assessed and compared through key performance indicators. Furthermore, future research directions for this technology are clearly highlighted.

Despite Low Power Wide Area Networks’ ability to offer an extended range, it might still encounter challenges with coverage blind spots in the network. This article proposes an innovative energy-efficient nature-inspired relay selection algorithm for LoRa-based LPWAN networks, serving as a solution for challenges related to poor signal range in areas with limited coverage. A behavior swarm-inspired approach has been utilized to select the relays’ localization in the network, providing network energy efficiency and radio signal extension. These relays help bridge communication gaps, significantly reducing the impact of coverage blind spots by forwarding signals from devices with poor direct connectivity with the gateway. The proposed algorithm considers critical factors for the LoRa standard, such as the Spreading Factor or device energy budget analysis. The simulation experiments validate the proposed scheme’s effectiveness in terms of energy efficiency under diverse multi-gateway topology scenarios involving thousands of devices. Specifically, it has been verified that the proposed approach outperforms the reference method in preventing the battery depletion of relays, which is vital for battery-powered IoT devices. Furthermore, for some large-scale problems, the proposed heuristic method achieves over twice the speed of the exact method with a negligible accuracy loss of less than 2%.

During the last two decades several cases of venous thrombosis (VTE) after a prolonged period at a computer has been described, denominated “eThrombosis”. Video gaming on a computer has become very popular and can be a social activity where several players are gathered to play against each other or in a virtual environment for several days (“LAN (i.e., Local Area Network) parties”) where the participants are sedentary and consuming calorie-rich food items. The aim of this study was to investigate a potential coagulation activation during a 42 hour LAN party. Nine male gamers volunteered for the LAN party. Citrated blood was sampled before and every 6 hours, and plasma was analyzed for thrombin generation, and Thrombin-antithrombin-complexes (TAT), prothrombin Fragment 1+2 (F1+2), and D-dimer. Thrombin generation increased slightly but not significantly during the LAN party, whereas the coagulation activation markers were unchanged. These results do not indicate that the coagulation system is activated significantly during 42 h gaming with minimal physical activity. Although an increased activity cannot be excluded, it does not directly indicate a risk of VTE in general. It may be specific and particularly susceptible in-dividuals who are prone to thrombosis and, therefore, are at risk of developing e-thrombosis.

Nanocomposites of TiO₂ Degussa P25 nanoparticles/activated carbon (TiO₂/AC ) were prepared at various mass ratios of (4:1), (3:2), (2:3), and (1:4) by a facile process. The effects of TiO₂/AC mass ratios on the structural, morphological, and photocatalytic properties were systematically studied in comparison with bare TiO₂ and bare AC. TiO₂ nanoparticles exhibited dominant anatase and minor rutile phases, and a crystallite size of approximately 21 nm; while AC had XRD peaks of graphite and carbon, and a crystallite size of 49 nm. The composites exhibited tight decoration of TiO₂ nanoparticles on micron-/submicron AC particles, and uniform TiO₂/AC composites were obtained as evidenced by the uniform distribution of Ti, O, and C in an EDS mapping. Moreover, Raman spectra show the typical vibration modes of anatase TiO₂ (e.g., E_1g⁽¹⁾, B_1g⁽¹⁾, E_g⁽³⁾) and carbon materials with D and G bands. The TiO₂/AC with (4:1), (3:2), and (2:3) possessed higher reaction rate constants (k) in photocatalytic degradation of methylene blue (MB) than that of either TiO₂ or AC. Among the investigated materials, TiO₂/AC = 4:1 achieved the highest photocatalytic activity with a high k of 55.2×10^-3 min^-1 and an MB removal efficiency of 96.6% after 30 min treatment under UV-Vis irradiation (120 mW/cm²). The enhanced photocatalytic activity for TiO₂/AC is due to the synergistic effect of the high adsorption capability of AC and the high photocatalytic activity of TiO₂. Furthermore, TiO₂/AC promotes the separation of photoexcited electron/hole (e^-/h⁺) pairs to reduce their recombination rate and thus enhance photocatalytic activity. The optimal TiO₂/AC composite in this study can be used for treating industrial or household wastewater with organic pollutants.

This report provides a comprehensive overview of occupational asthma and respiratory hypersensitivity, focusing on some chemicals used in the workplace Includes numerous case studies and research papers related to occupational exposure methacrylates, such as HEMA-HPMA, and respiratory hypersensitivity are discussed And the relationship is explored The book also examines asthma pathophysiology, emerging drug delivery systems used to treat asthma, and the potential of nanoparticles , dendrimers and micellar systems have to improve pulmonary drug delivery in detail The worldwide prevalence of asthma is highlighted, with higher rates in high-GDP countries. The book highlights the need to improve asthma diagnosis, treatment and biomarkers, particularly in rural and low-income countries where the disease is often underdiagnosed and inadequately treated, and discusses the role of inflammation in asthma, in particular secondary inflammation characterized by specific cytokines and inflammation cells In addition, the paper explores various drug delivery methods, such as parenteral and parenteral drugs, pressurized inhalers (pMDIs), dry powder inhalers ( DPIs), nebulizers, nanoparticles, liposomes, micellar systems, microparticles , dendrimers, and gene therapy . These systems aim to increase pulmonary delivery of drugs and improve clinical outcomes. The potential of dendrimer bilirubin-based nanoparticles and micellar systems in the treatment of asthma and lung inflammatory diseases, including asthma, has been discussed in summary, this paper provides an overview of occupational asthma and respiratory hypersensitivity, and this discussion highlights the association between methacrylate exposure and respiratory hypersensitivity.

To accurately and non-destructively monitor the growth of spring wheat in the Hetao Irrigation Area, UAV remote sensing was employed during various fertility stages. Digital image indices from diverse fertilization treatments were calculated and compared with physiological indices to identify the most sensitive digital image indices corresponding to these indices. The study underscored the critical importance of the flowering stage in the growth of spring wheat, thus highlighting the necessity of focusing on this stage. This finding reiterated that the flowering stage was pivotal for spring wheat development in the Hetao Irrigation Area. Several digital image indices, such as GLA, R, G, INT, g, GRVI, MGRVI, RGBVI, EXG, and GRRI, exhibited a high frequency of significant correlations with physiological indices during the four primary reproductive stages of wheat. Consequently, these sensitive digital image indices during the flowering stage can more effectively characterize the physiological indices of spring wheat.

Nowadays, it is highly desired to develop highly active and humidity resistive ozone decomposition catalyst to eliminate the ozone contaminant, one of the primary pollutants in air. In this work, a series of Cu2S hollow structured materials are rapidly synthesized using different structured Cu2O templates. The Cu2S from porous Cu2O shows the highest ozone catalytic decomposition efficiency of >95% to 400 ppm ozone with a weight hourly space velocity of 480,000 cm3g-1h-1 in dry air. Importantly, the conversion still keeps >85% in a high relative humidity of 90%. The mechanism is explored by diffusive reflectance infrared spectroscopy which shows the decomposition intermediate of O22-, and the X-ray photoelectron spectroscopy reveals the dual active site of both Cu and S. All these results show the effective decomposition of ozone by Cu2S especially in harsh environments, promising for active ozone elimination.

Cognitive reserve is the adaptability of cognitive processes in the face of brain aging and pathology. This study aimed to validate the Arabic version of the Cognitive Reserve Index Questionnaire (CRIq) in a healthy Lebanese sample. CRIq assesses cognitive reserve through three domains: education, working activity, and leisure time. Statistical measures, including descriptive and regression analysis along with structural equation modeling, were utilized to investigate the convergent and discriminant validity of CRIq, incorporating fluid intelligence (Gf) and measures of cognitive function, long-term memory encoding and retrieval (Glr), and processing speed (Gs). Results from 174 participants revealed that the activities assessed by CRIq-Arabic were comparable to the original CRIq study, with slight cultural differences. The internal consistency of CRIq-Arabic was good (Cronbach's α = 0.88), indicating reliability. Convergent validity was confirmed, with moderate to high loadings on the cognitive reserve latent construct. Discriminant validity was supported as correlations between cognitive reserve variables and non-target constructs (Gf, Glr, Gs) were less than 1. The findings provide an initial psychometric validation of the CRIq-Arabic. Further research in clinical samples is needed to enhance its utility in neuropsychological practice.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

D-Glucaric acid is an important bio-based building block of polymers and is a high value-added chemical that can be used in a variety of applications. In the present study, the Udh target genes from Pseudomonas putida and Pseudomonas syringae were used together to construct the expression vector pETDuet-2×Udh. The transformants of BL21(DE3) with vector pETDuet-2×Udh was applied to produce glucaric acid from glucuronic acid. After optimization of induction conditions, the highest Udh expression were achieved when 0.4 mmol L-1 isopropyl-β-d–thiogalactoside (IPTG) was added to cell cultures at an OD600 value of 0.6 followed by culture at 26℃ for 6 hours. The production of glucaric acid substantially reached 5.24 ± 0.015 g L-1 in fed-batch cultures in a 30 L tank. In the present study, a new system for glucaric acid production was established, which was more economic and friendly to environment.

Systemic sclerosis (SSc) is a multisystem connective tissue disease characterized by pathological processes involving autoimmunity, vasculopathy, and resultant extensive skin and organ fibrosis. Recent studies have demonstrated activation and aberrant wound healing responses in the epithelial layer of the skin in this disease, implicating the epithelial keratinocytes as a source of pro-fibrotic and inflammatory mediators. In this paper we investigated the role of Immunoglobulin G (IgG) autoantibodies directed against epithelial cells, as potential initiators and propagators of pathological keratocyte activation and the ensuing SSc fibrotic cascade. A keratinocyte cell-based ELISA is used to evaluation binding of SSc IgG. SSc skin biopsies were stained by immunofluorescence for the presence of IgG in the keratinocyte layer. Moreover, IgG purified from SSc sera is evaluated for the potential to activate keratinocytes in tissue culture and to induce signaling in TLR2 &amp; 3 reporter cell lines. We demonstrate enhanced binding of SSc IgG to keratinocytes, and activation of these cells leading to release of IL-1α, representing a potential initiating pathway in this disease.

Adipose tissue is a crucial organ in energy metabolism and thermoregulation. Adipose tissue phenotype is controlled by various signaling mechanisms under pathophysiological conditions. Type II transmembrane serine proteases (TTSPs) are a group of trypsin-like enzymes anchoring on the cell surface. These proteases act in diverse tissues to regulate physiological processes, such as food digestion, salt-water balance, iron metabolism, epithelial integrity, and auditory nerve development. More recently, several members of the TTSP family, namely, hepsin, matriptase-2, and corin, have been shown to play a role in regulating lipid metabolism, adipose tissue phenotype, and thermogenesis, via direct growth factor activation or indirect hormonal mechanisms. In mice, hepsin deficiency increases adipose browning and protects from high-fat diet-induced hyperglycemia, hyperlipidemia, and obesity. Similarly, matriptase-2 deficiency increases fat lipolysis and reduces obesity and hepatic steatosis in high-fat diet-fed mice. In contrast, corin deficiency increases white adipose weights and cell sizes, suppresses adipocyte browning and thermogenic responses, and causes cold intolerance in mice. These findings highlight an important role of TTSPs in modifying cellular phenotype and function in adipose tissue. In this review, we provide a brief description about TTSPs and discuss recent findings regarding the role of hepsin, matriptase-2, and corin in regulating adipose tissue phenotype, energy metabolism, and thermogenic responses.

Preterm delivery can be precipitated by infection, and preterm infants are at heightened risk of postnatal infection. Little is known about the ontogeny of inflammatory biomarkers in extremely preterm infants. We hypothesized that suspected prenatal infection (chorioamnionitis or spontaneous preterm labor) and clinically diagnosed postnatal infection would be associated with unique biomarker signatures, and those patterns would be influenced by the degree of prematurity. Venous blood was collected daily for the first week and weekly for up to 14 additional weeks from 142 neonates born at 22-32 weeks gestation. A custom array was utilized to measure monocyte chemoattractant protein-1 (MCP-1) and interleukin-6 (IL-6). C-reactive protein (CRP) levels were obtained from the electronic medical record. 90 infants had suspected prenatal infection and 63 were diagnosed with postnatal infection. Independent of gestational age at delivery, MCP-1 was significantly increased (P &lt; 0.001) in association with maternal preeclampsia, but MCP-1 was decreased (P&lt;0.01) and CRP was increased (P&lt;0.05) in the presence of chorioamnionitis. IL-6 and CRP were both increased in infants diagnosed with postnatal infection with peak levels observed on days 2 and 3, respectively. In conclusion, suspected prenatal and postnatal infections and non-infectious complications of pregnancy are associated with unique biomarker profiles, independent of gestational age. In those clinically diagnosed with a postnatal infection in the absence of antenatal infection concerns, IL-6 increases before CRP, emphasizing a potential role for expanded biomarker screening if antibiotics are initially avoided in infants born exclusively for maternal indications.

Erectile dysfunction (ED) is a common and feared complication of radical prostatectomy (RP) for prostate cancer. Recently, tissue engineering is being attempted for post-prostatectomy ED, with controlled interactions between cells, growth factors, and extracellular matrix (ECM) being important for nerve regeneration's structural integrity. In this study, we evaluated the effects of biomechanical ECM patch on human bone marrow-derived mesenchymal stem cells (hBMSCs) morphology and behavior in bilateral cavernous nerve injury (BCNI) rat model. The ECM patch, made of decellularized human fibroblast-derived ECM (hFDM) and a biocompatible polyvinyl alcohol (PVA) hydrogel, was tested with human bone marrow-derived mesenchymal stem cells (hBMSCs) on a bilateral cavernous nerve injury (BCNI) rat model. In vitro analysis showed that the hFDM/PVA + hBMSCs patches significantly increased neural development markers. In vivo experiments demonstrated that the rats treated with the hFDM/PVA patch had higher ICP/MAP ratio, a higher ratio of smooth muscle to collagen, increased content of nNOS, higher levels of eNOS protein expression, and a higher cGMP level compared to the BCNI group. These results indicate that the hFDM/PVA patch is effective in promoting angiogenesis, smooth muscle regeneration, and nitrergic nerve regeneration, which could contribute to improved erectile function in post-prostatectomy ED.

In an historic perspective on the development of the Standard Model of particle physics it is shown how mathematically driven axioms have masked the merits of a physically comprehensible structural view. It is concluded that the difference between the two approaches can be traced back to two major issues. Whereas in the Standard Model the quark is a Dirac particle with a single real dipole moment, the quark in the structural model, in confinement with other quarks, is a Dirac particle with two real dipole moments. The second issue is the view that empty space does not exist, but that space is filled with a polarisable energetic fluid. It is shown how recognition of these two issues pave a road to reconcile particle physics with gravity, in which the quark can be seen as a magnetic electron and in which the gluon, as the strong force carrier, can be seen as a massive photon.

Low back pain is a clinically highly relevant musculoskeletal burden and is associated with inflammatory as well as degenerative processes of the intervertebral disc. However, the pathophysiology and cellular pathways contributing to this devastating condition are still poorly understood. Based on previous evidence, we hypothesize that tissue renin-angiotensin system (tRAS) components, including the SARS-CoV-2 entry receptor angiotensin-converting enzyme 2 (ACE2), are present in human nucleus pulposus (NP) cells and associated with inflammatory and degenerative processes. Experiments were performed with NP cells from 4 human donors. The existence of angiotensin II, angiotensin II type 1 receptor (AGTR1), AGTR2, MAS-receptor (MasR), and ACE2 in human NP cells was validated with immunofluorescent staining and gene expression analysis. Hereafter the cell viability was assessed after adding agonists and antagonists of the target receptors as well as angiotensin II in different concentrations for up to 48 hours of exposure. A TNF-α-induced inflammatory in vitro model was employed to assess the impact of angiotensin II addition and the stimulation or inhibition of the tRAS receptors on inflammation, tissue remodeling, expression of tRAS markers, and the release of nitric oxide (NO) into the medium. Further, protein levels of IL-6, IL-8, IL-10, and intracellular as well as secreted angiotensin II were assessed after exposing the cells to the substances, and inducible nitric oxide synthase (iNOS) levels were evaluated utilizing Western Blot. The existence of tRAS receptors and angiotensin II were validated in human NP cells. Cell viability analysis revealed no cytotoxic effects of angiotensin II. The AGTR1 inhibitor Candesartan and the MAS receptors AVE0991 showed cytotoxic effects at high concentrations (100 µM). The addition of angiotensin II only showed a mild impact on gene expression markers. However, there was a significant increase in NO secreted by the cells. The gene expression ratios of pro-inflammatory/anti-inflammatory cytokines IL-6/IL--10, IL-8/IL-10, and TNF-α /IL-10 were positively correlated with the AGTR1/AGTR2 and AGTR1/MAS1 ratios, respectively. The stimulation of the AGTR2 MAS-receptor and the inhibition of the AGTR1 receptor revealed beneficial effects on the gene expression of inflammatory and tissue remodeling markers. This finding was also present at the protein level. We did not find alterations in iNOS protein concentrations after adding the drugs. The current data showed that tRAS components are expressed in human NP cells and are associated with inflammatory and degenerative processes. Further characterization of the associated pathways is warranted. The findings indicate that tRAS modulation might be a novel therapeutic approach to intervertebral disc disease.

In this paper, the phases in the Mg-Ti-O system using the 1:1 formulation of MgO:TiO2 mixing synthetic brucite of Mexican origin with TiO2 microparticles of high purity and with a heat treatment at 1100°C for 1 h were studied. The raw materials and formulation by XPS and DRX techniques were characterized. The results demonstrate the presence of different oxidation states in titania and the formation of different oxides in the Mg-Ti-O system when mixed and calcined at 1100°C; additionally, the formation of vacancies in the crystal lattice during the transformation from hexagonal brucite to magnesia with a cubic structure centered on the faces is estimated. With the results, its thermal behavior is warned based on the MgO-TiO2 phase diagram.

The purpose of the current study was directed to investigate the effectiveness of docosahexaenoic acid (DHA) as a chemopreventive agent on experimentally induced hamster buccal pouch (HBP) carcinogenesis; Material and methods: 40 Syrian male hamsters, five weeks old, were divided into 4 groups of 10 animals in each as follows, GI: Topical application of liquid paraffin alone (thrice a week for 14 weeks), GII: Topical application of 7, 12 dimethyl benz[a]anthracene (DMBA) alone (0.5 % in liquid paraffin, thrice a week for 14 weeks), GIII: Topical application of DMBA (0.5 % in liquid paraffin, thrice a week for 14 weeks) + Oral administration of DHA (125 mg/kg b.w. in 1 ml distilled water by oral gavage, thrice a week for 14 weeks on alternative days of DMBA application), GIV : Oral administration of DHA alone (125 mg/kg b.w. in 1 ml distilled water by oral gavage, thrice a week for 14 weeks); Results: Gross observations and histopathological findings revealed a-GI: normal stratified squamous epithelium b- GII: well and moderately differentiated squamous cell carcinoma (SCC) c-: GIII: showed variable results ranges from hyperkeratosis, hyperkeratosis and focal hyperplasia, mild dysplasia, and well differentiated SCC with superficial invasion of tumor cells not extended to deeper areas d: GIV: normal similar to GI. Immunohistochemical results revealed that oral DHA treatment to DMBA treated hamsters restored the normal expression of bcl-2; Conclusion: DHA has the potential to be a dietary chemopreventive agent due to its capacity to improve carcinogen detoxification and to block/suppress the initiation and promotion stages of experimentally produced HBP carcinogenesis.

Calcium dihydrogen phosphate monohydrate [Ca(H2PO4)2·H2O] (a fertilizer) was successfully synthesized by the recrystallization process by using a prepared triple superphosphate (TSP) that derived from oyster shell waste as starting material. This bio-green, eco-friendly process to produce an important fertilizer can promote a sustainable society. The shell-waste-derived TSP was dissolved in distilled water and kept at 30, 50, and 80 °C. Non-soluble powder and TSP solution were obtained. The TSP solution fraction were then dried and the recrystallized products (RCP30, RCP50, and RCP80) were obtained and confirmed as Ca(H2PO4)2·H2O. Whereas the non-soluble products (NSP30, NSP50, and NSP80) were observed as calcium hydrogen phosphate dihydrate (CaHPO4·2H2O). The recrystallized yields of RCP30, RCP50, and RCP80 were found to be 51.0%, 49.6%, and 46.3%, whereas the soluble percentages were 98.72%, 99.16%, and 96.63%, respectively. RCP30 shows different morphological plate sizes, while RCP50 and RCP80 present the coagulate crystal plates. X-ray diffractograms confirm the formation of both the NSP and RCP. The infrared adsorption spectra confirmed the vibrational characteristics of HPO42‒, H2PO4‒ and H2O existed in CaHPO4·2H2O and Ca(H2PO4)2·H2O. Three thermal dehydration steps of Ca(H2PO4)2·H2O (physisorbed water, polycondensation, and re-polycondensation) were observed. Ca(H2PO4)2 and CaH2P2O7 are the thermodecomposed products from the first and second steps, whereas the final product is CaP2O6.

(1) Background: Mouse-mammary tumor virus (MMTV) might play a role in the etiology of some breast cancers in humans. The purpose of our study was to identify MMTV DNA sequences in breast tissue samples from breast cancer patients operated in our regional center from Romania. (2) Methods: We have selected 75 patients with non-metastatic breast cancer treated with curative intent and searched with PCR the MMTV-like DNA sequence in the breast cancer tissue and normal breast tissue obtained from the same patients. (3) Results: None of the examined samples was positive for MMTV-like target sequences on PCR. (4) Conclusions: We could not prove that MMTV plays a role in the etiology of breast cancer in our patient group. This finding is similar to findings of other geographically related research groups and might be due to the fact that only the Mus musculus domesticus mouse species was proven to carry infectious MMTV, but not the Mus musculus musculus species, which is specific to South-Eastern Europe and some parts of Asia.

In this article, the geometry of pseudoparallel, Ricci-generalized pseudoparallel and 2-Ricci-generalized pseudoparallel invariant submanifolds of an almost $\alpha$-cosymplectic $(\kappa,\mu,\nu)$ space has been searched under the some conditions. We also give some characterizations for such submanifolds. I think that obtained new results contribute to differential geometry.

Abstract. The purpose of this review is to investigate the nature of privacy concerns in the context of Smart Local Energy Systems (SLES) to understand how SLES providers can minimize both users’ concern, and cause for concern, around privacy. We conducted a rapid realist review and thematic framework analysis against Bronfrenbrenner’s socio-ecological model to understand privacy concerns in different contexts. A common privacy concern was that sharing detailed energy use data had the potential to reveal information about home life, and to intrude upon people’s sense of autonomy, choice and control. Evidence suggests that people are willing to accept newdata sharing technologies if the benefits of doing so are clear, anticipated, and mutually beneficial. Building trust, through increasing knowledge and understanding was a mechanism for overcoming privacy concerns, but this was mediated by the organization providing the information. Non-profit organizations were more trusted to ensure appropriate safeguards to privacy were in place. One key barrier to participation with good supporting evidence was that people can resist perceived intrusions on their privacy. This could be actively resisted by refusing to install data collection technologies or passively by non-participation in adapting energy use behaviors: both of which are necessary for SLES to achieve their goals of managing energy demand and building resilience in smart grids.

The urgent need to improve performance in the construction industry has led to the adoption of many innovative technologies. 3D laser scanners are amongst the leading technologies being used to capture and process assets or construction project data for use in various applications. Due to its nascent nature, many questions are still unanswered about 3D laser scanning, which in turn contribute to the slow adaptation of the technology. Some of these include the role of 3D laser scanners in capturing and processing raw construction project data. How accurate is the 3D laser scanner or point cloud data? How does laser scanning fit with other wider emerging technologies such as Building Information Modelling (BIM)? This study adopts a proof-of-concept approach, which in addition to answering the afore-mentioned questions, illustrates the application of the technology in practice. The study finds that the quality of the data, commonly referred to as point cloud data is still a major issue as it depends on the distance between the target object and 3D laser scanner’s station. Additionally, the quality of the data is still very dependent on data file sizes and the computational power of the processing machine. Lastly, the connection between laser scanning and BIM approaches is still weak as what can be done with a point cloud data model in a BIM environment is still very limited. The aforementioned findings reinforce existing views on the use of 3D laser scanners in capturing and processing construction project data.

Sun-Induced chlorophyll Fluorescence (SIF) relates directly to photosynthesis yield and stress but there are still uncertainties in its interpretation. Most of these uncertainties concern the influences of the emitting vegetation’s structure (e.g., leaf angles, leaf clumping) and biochemistry (e.g., chlorophyll content, other pigments) on the radiative transfer of fluorescent photons. The Caatinga is a large region at northeast Brazil of semiarid climate and heterogeneous vegetation, where such biochemical and structural characteristics can vary greatly even within a single hectare. With this study we aimed to characterize eleven years of SIF seasonal variation from Caatinga vegetation (2007 to 2017) and to study its responses to a major drought in 2012. Orbital SIF data from the instrument GOME-2 was used along with MODIS MAIAC EVI and NDVI. Environmental data included precipitation rate (TRMM), surface temperature (MODIS) and soil moisture (ESA CCI). To support the interpretation of SIF responses we have used red and far-red SIF adjusted by the Sun’s zenith angle (SIF-SZA) and by daily Photosynthetically Active Radiation (dSIF). Furthermore, we have also adjusted SIF through two contrasting formulations using NDVI data as proxy for structure and biochemistry, based on previous leaf-level and landscape level studies: SIF-Yield and SIF-Prod. Data was tested with time-series decomposition, rank correlation, spatial correlation and Linear Mixed Models (LMM). Results show that GOME-2 SIF and adjusted SIF formulations responded consistently to the observed environmental variation and showed a marked decrease in SIF emissions in response to a 2012 drought, that was generally larger than the corresponding NDVI and EVI decreases. Drought sensitivity of SIF, as inferred from LMM slopes, was correlated to land cover at different regions of the Caatinga. This is the first study to show correlation between landscape-level SIF and an emergent property of ecosystems (i.e., resilience), showcasing the value of remotely sensed fluorescence for ecological studies.