This report provides a comprehensive overview of occupational asthma and respiratory hypersensitivity, focusing on some chemicals used in the workplace Includes numerous case studies and research papers related to occupational exposure methacrylates, such as HEMA-HPMA, and respiratory hypersensitivity are discussed And the relationship is explored The book also examines asthma pathophysiology, emerging drug delivery systems used to treat asthma, and the potential of nanoparticles , dendrimers and micellar systems have to improve pulmonary drug delivery in detail The worldwide prevalence of asthma is highlighted, with higher rates in high-GDP countries. The book highlights the need to improve asthma diagnosis, treatment and biomarkers, particularly in rural and low-income countries where the disease is often underdiagnosed and inadequately treated, and discusses the role of inflammation in asthma, in particular secondary inflammation characterized by specific cytokines and inflammation cells In addition, the paper explores various drug delivery methods, such as parenteral and parenteral drugs, pressurized inhalers (pMDIs), dry powder inhalers ( DPIs), nebulizers, nanoparticles, liposomes, micellar systems, microparticles , dendrimers, and gene therapy . These systems aim to increase pulmonary delivery of drugs and improve clinical outcomes. The potential of dendrimer bilirubin-based nanoparticles and micellar systems in the treatment of asthma and lung inflammatory diseases, including asthma, has been discussed in summary, this paper provides an overview of occupational asthma and respiratory hypersensitivity, and this discussion highlights the association between methacrylate exposure and respiratory hypersensitivity.

Neurological involvement following COronaVIrus Disease 19 (COVID-19) is thought to have a neuroinflammatory etiology. Co-ultraPEALut (an antiinflammatory molecule) and luteolin (an antioxidant) yielded promising results as neuroinflammation antagonists. This study aimed at describing cognitive impairment in post-COVID patient treated with co-ultraPEALut. Montreal Cognitive Assessment (MoCA), Prospective-Retrospective Memory Questionnaire (PRMQ), Fatigue Severity Scale (FSS) and a subjective evaluation were administered at baseline and after 10 months. Co-ultraPEALut-treated patients were retrospectively compared with controls. 26 co-ultraPEALut-treated patients showed significant improvement in PRMQ (T0: 51.94±10.55, T1: 39.67±13.02, p

To accurately and non-destructively monitor the growth of spring wheat in the Hetao Irrigation Area, UAV remote sensing was employed during various fertility stages. Digital image indices from diverse fertilization treatments were calculated and compared with physiological indices to identify the most sensitive digital image indices corresponding to these indices. The study underscored the critical importance of the flowering stage in the growth of spring wheat, thus highlighting the necessity of focusing on this stage. This finding reiterated that the flowering stage was pivotal for spring wheat development in the Hetao Irrigation Area. Several digital image indices, such as GLA, R, G, INT, g, GRVI, MGRVI, RGBVI, EXG, and GRRI, exhibited a high frequency of significant correlations with physiological indices during the four primary reproductive stages of wheat. Consequently, these sensitive digital image indices during the flowering stage can more effectively characterize the physiological indices of spring wheat.

Background: The aim was to diagnose Candida in the oral cavity of subjects with type 2 diabetes mellitus (T2DM) using a genotyping technique and to compare the results with those from con-ventional diagnosis by Papanicolau (Pap) staining. Methods: Palatal mucosa smears were per-formed in 18 dental care patients diagnosed with T2DM and grade I, II, and III prosthetic stomatitis who met the inclusion criteria; 18 healthy control subjects were also included in the study. He-moglobin A1c (HbA1c) levels were determined from total blood. Using exfoliative cytology, the Pap staining technique was used to diagnose candidiasis. Exfoliative cytology was also used for molecular diagnosis; DNA was obtained for Candida genotyping and RNA was used for gene ex-pression studies. Results: Clinical patterns indicated that all subjects were positive for Candida; however, Pap analysis revealed only three positive subjects, whereas end-point polymerase chain reaction (PCR) analysis revealed fifteen subjects with some type of Candida. The most common Candida species found were Candida guilliermondii (38.8%), Candida krusei (33.3%), Candida tropicalis, and Candida lusitaniae (22.2%). Interestingly, the coexpression of different species of Candida was found in various patients. In all patients, HbA1c levels were increased. Gene expression analysis showed a significant decrease (p ≤ 0.05) in TLR2 expression in positive subjects, whereas TLR4 expression did not differ significantly among patients. Conclusions: The end-point PCR technique showed better sensitivity for diagnosis of Candida when compared with diagnosis by Pap staining. T2DM subjects showed an increased presence of C. guilliermondii that was correlated with decreased TLR2 expression

Type II pneumocytes are the target of SARS-CoV-2 which alters their redox homeostasis to increase reactive oxygen species (ROS). Melatonin (MT) has antioxidant proprieties and protects mitochondrial function. Here we evaluated whether the treatment with MT compensated for the redox homeostasis alteration in serum from COVID-19 patients. We determined oxidative stress (OS) markers such as carbonyls, glutathione (GSH), total antioxidant capacity (TAC), thiols, nitrites (NO2–), lipid peroxidation (LPO), and thiols groups in serum. We also studied the enzymatic activities of glutathione peroxidase (GPx), -S-transferase (GST), reductase (GR), thioredoxin reductase (TrxR), extracellular superoxide dismutase (ecSOD) and peroxidases. There was a significant increase in LPO and carbonyls (p≤0.03) and a decrease in TAC, NO2–, thiols, GSH, (p<0.001) in COVID-19 patients. The activities of the ecSOD, TrxR, GPx, GST, GR and peroxidases were decreased (p≤ 0.04). The treatment with MT favored the activity of the antioxidant enzymes which contributed to increase TAC and restored the lost redox homeostasis. MT also modulated glucose homeostasis functioning as a glycolytic agent and inhibited the Warburg effect. Thus, MT restores the redox homeostasis which is altered in COVID-19 patients and can be used as adjuvant therapy in the SARS-CoV-2 infection.

The possible future emergence of new SARS-CoV-2 virus variants pushes the development of new chemoprophylaxis protocols complementary to the unspecific and specific immune-prophylaxis measures currently used. The SARS-CoV-2 virus is particularly sensitive to oxidation due to the relevant positive electrical charge of its spike protein used as a ligand for target cells. The present study evaluated the safety and efficacy of a new oxidant preparation, liquid hyperoxygen (IOL), to neutralize the SARS-CoV-2 virus. IOL was incubated with throat swabs containing a human wild-type virus. The samples were then incubated with cells expressing the ACE2 receptor and therefore very sensitive to SARS-CoV-2 infection. The ability to neutralize SARS-CoV-2 was determined by assessing the amount of viral nucleic acid inside cells by PCR. The results obtained indicate that IOL, even at considerable dilutions, is capable, after incubation times of less than 30 min and even equal to 5 min, to completely inhibit SARS-CoV-2 infection. This inhibitory effect has been shown to be due to the oxidizing capacity of the IOL. This oxidizing capacity is exerted towards the virus but does not damage eukaryotic cells either in the in vitro or in the in vivo skin model. Obtained results indicate that the use of IOL, a hydrophilic liquid mixture saturated with highly reactive oxygen and nitrogen species, is a new powerful, safe, and effective tool for preventing possible future outbreaks of COVID-19 disease.

Nowadays, it is highly desired to develop highly active and humidity resistive ozone decomposition catalyst to eliminate the ozone contaminant, one of the primary pollutants in air. In this work, a series of Cu2S hollow structured materials are rapidly synthesized using different structured Cu2O templates. The Cu2S from porous Cu2O shows the highest ozone catalytic decomposition efficiency of >95% to 400 ppm ozone with a weight hourly space velocity of 480,000 cm3g-1h-1 in dry air. Importantly, the conversion still keeps >85% in a high relative humidity of 90%. The mechanism is explored by diffusive reflectance infrared spectroscopy which shows the decomposition intermediate of O22-, and the X-ray photoelectron spectroscopy reveals the dual active site of both Cu and S. All these results show the effective decomposition of ozone by Cu2S especially in harsh environments, promising for active ozone elimination.

To analyze the viral titers of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and respiratory syncytial virus (RSV) at the anterior nasal site (ANS) and nasopharyngeal site (NS), evaluate their virological dynamics, and validate the usefulness of a newly developed two antigen-detecting rapid antigen diagnostic test (Ag-RDT) that simultaneously detects SARS-CoV-2 and RSV using clinical specimens. This study included 195 asymptomatic to severely ill patients. Overall, 668 specimens were collected simultaneously from the ANS and NS. The cycle threshold (Ct) values calculated from real-time polymerase chain reaction were used to analyze temporal changes in viral load and evaluate the sensitivity and specificity of the Ag-RDT. The mean Ct values for SARS-CoV-2-positive, ANS, and NS specimens were 28.8, 28.9, and 28.7, respectively. The mean Ct values for RSV-positive, ANS, and NS specimens were 28.7, 28.8, and 28.6, respectively. SARS-CoV-2 and RSV showed the same trend in viral load, although the viral load of NS was higher than that of ANS. The sensitivity and specificity of the newly developed Ag-RDT were excellent in specimens collected up to 10 days after the onset of SARS-CoV-2 infection and up to 6 days after the onset of RSV infection.

As humans age, aberrancies in several signaling pathways occur. In the aging population, some patients display abnormal bone morphogenetic protein (BMP) signaling. This can lead to osteoporosis (OP), a debilitating bone disorder caused by an imbalance between osteoblasts and osteoclasts. In 2002, the Food and Drug Administration (FDA) approved usage of recombinant human BMP-2 (rhBMP-2) during spinal fusion surgery as it is crucial for bone formation. However, complications have been reported with rhBMP-2 and primary osteoblasts isolated from OP patients are unresponsive to BMP-2. While patient samples are available, previous medical history may alter results. Therefore, C57BL/6 mice, an aging model that displays aberrant BMP-signaling, can be utilized to investigate OP and aging. We show that BMP receptor type Ia (BMPRIa) is upregulated in the bone marrow stromal cells (BMSCs) of 15-month mice similar to previous data. We show that a conjugation between BMP-2 and Quantum Dots (QDot®s) effectively binds to BMPRIa and can investigate BMP-2 activity. After incubating BMSCs with methyl-β-cyclodextrin (MβCD), BMP-signaling is restored in 15-month mice as shown by western blotting and the von Kossa assay. MβCD may be used to rescue BMPRIa and the BMP-signaling pathway can be utilized by future therapeutics to treat OP.

Tamm Plasmon Polariton (TPP) is a nanophotonic phenomenon that has attracted much attention due to its spatial strong field confinement, ease of mode excitation and polarization independence. TPP has applications in sensing, storage, lasing, perfect absorber, solar cell, nonlinear optics, and many others. In this work, we demonstrate a biosensing platform based on TPP resonant mode. Both theoretical analyses based on Transfer Matrix Method and experimental validation through nonspecific detection of liquids of different refractive indices and specific detection of SARS-CoV-2 nucleocapsid protein (N-protein) are presented. Results show that TPP biosensor has high sensitivity and good specificity. For N-protein detection, the sensitivity is 1.5 nm/(µg/ml) and the limit of detection can reach down to below 7 ng/ml with spectrometer of 0.01 nm resolution of wavelength shift. This work paves the way for design, optimization, fabrication, characterization, and performance analysis of TPP based biosensors

In its prefusion state, the SARS-CoV-2 Spike protein (similarly to other class I viral fusion proteins) is metastable, which is considered to be an important feature for optimizing or regulating their functions. After the binding process of its S1 subunit (S1) with the ACE2, the Spike protein (S) suffers a dramatic conformational change where S1 splits from the S2 subunit, which then penetrates the membrane of the host cell, promoting the fusion of the viral and cell membranes. This results in the infection of the host cell. In a previous work, we showed -using large scale molecular dynamics simulations- that the application of external electric fields (EF) induces drastic changes and damage in the receptor-binding domain (RBD) of the wild type Spike protein, as well of the Alpha, Beta and Gamma variants, leaving a structure which cannot be recognized any more by ACE2. In this work, we first extend the study to the Delta and Omicron variants and confirm the high sensitivity and extreme vulnerability of S to moderate EF (as weak as 104 V m-1), but, more importantly, we also show that, in contrast, the postfusion state of the spike protein does not suffer structural damage even if electric field intensities four orders of magnitude higher are applied. These results provide a solid scientific basis to confirm the prefusion state metastability roots of the SARS-CoV-2 Spike protein susceptibility to be damaged by EF. After the virus docks to the ACE2 receptor, the stable and robust postfusion conformation develops, which exhibits a similar resistance to EF (damage threshold higher than 108 V m-1) like most globular proteins.

Background. Type 2 diabetes mellitus (T2DM) is becoming a major global health concern, especially in poorer nations. The high prevalence of obesity and the ensuing diabetes is attributed to rapid economic progress, physical inactivity, consumption of high-calorie foods, and changing lifestyles. Objectives. We investigated the role of pro-inflammatory chemokines; CCL1, 2, 4 and 5 with varying levels of obesity in T2DM in the Asir region of Saudi Arabia. Materials and methods. 170 confirmed T2DM patients and a normal control group were enrolled. The demographic data, serum levels CCL-1, 2, 4 and 5 and the biochemical indices were assessed in patients and control groups by standard procedures. Results. T2DM patients were divided into four groups: A (normal body weight), B (Overweight), C (obese), and D (highly obese). n controls. We observed that male and female control patients had similar mean serum concentrations of pro-inflammatory chemokines CCL 1, 2, 4, and 5. Chemokines CCL1, CCL2, and CCL4 in the serum of Type 2 Diabetes Mellitus patients with normal or overweight body weights were significantly higher than the control group, regardless of gender. In T2DM individuals with obesity and severe obesity, the rise was most significant. There was a progressive rise in the concentrations of CCL1, 2, and 4 in T2DM) patients with increasing BMI. Serum CCL5 levels increased significantly in all T2DM patient groups. The increase in CCL5 was more predominant in normal-weight people as compared to overweight and obese T2DM patients. Conclusions. Male and female control patients had similar serum levels of pro-inflammatory chemokines CCL 1, 2, 4, and 5. The progressive rise in blood concentrations of three Pro-inflammatory chemokines; CCL1, 2, and 4 in T2DM patients with increasing BMI supports the idea that dyslipidemia and obesity contribute to chronic inflammation and insulin resistance. Serum CCL5 levels increased significantly in all T2DM patient groups. The selective and more pronounced increase of CCL5 in the T2DM group with normal BMI as compared to patients with varying degrees of obesity, was rather surprising. Further research is needed to determine if CCL5 under-expression in overweight and obese T2DM patients is due to some unexplained counterbalancing processes.

SARS-CoV-2 attachment and entry inside mammalian cells is mainly mediated by human angiotensin-converting enzyme 2 (ACE2) and its interaction with spike protein. However, it is well known that spike protein also interacts with other molecules like glycosaminoglycans (GAG), e.g., heparan sulfate (HS) or Enoxaparin (EX), which are linear, anionically charged polysaccharides known for their biological activities. The mode of action of these two polysaccharides is to bind spike protein to block the interaction with ACE2 receptors. This study aimed to assess a model capable of confirming the activity of these GAGs in both the wild-type strain of SARS-CoV-2 and its variants, such as the highly variable BA.2.86. This was achieved by combining in silico modeling with in vitro determination using BacMam technology. The results showed the antiviral activity of HS and EX both in vitro and through the in-silico analysis, reconciling conflicting findings from recent studies on the cellular entry of SARS-CoV-2. In conclusion, it is possible to highlight the ability of these molecules to circumvent the high variability of SARS-CoV-2, providing valuable insights into intervention strategies targeting cell entry mechanisms and establishing a safe in vitro model.

Cognitive reserve is the adaptability of cognitive processes in the face of brain aging and pathology. This study aimed to validate the Arabic version of the Cognitive Reserve Index Questionnaire (CRIq) in a healthy Lebanese sample. CRIq assesses cognitive reserve through three domains: education, working activity, and leisure time. Statistical measures, including descriptive and regression analysis along with structural equation modeling, were utilized to investigate the convergent and discriminant validity of CRIq, incorporating fluid intelligence (Gf) and measures of cognitive function, long-term memory encoding and retrieval (Glr), and processing speed (Gs). Results from 174 participants revealed that the activities assessed by CRIq-Arabic were comparable to the original CRIq study, with slight cultural differences. The internal consistency of CRIq-Arabic was good (Cronbach's α = 0.88), indicating reliability. Convergent validity was confirmed, with moderate to high loadings on the cognitive reserve latent construct. Discriminant validity was supported as correlations between cognitive reserve variables and non-target constructs (Gf, Glr, Gs) were less than 1. The findings provide an initial psychometric validation of the CRIq-Arabic. Further research in clinical samples is needed to enhance its utility in neuropsychological practice.

Optimal detection strategies for effective convalescent immunity after SARS-CoV-2 infection and vaccination remain unclear. The objective of this study was to characterize convalescent immunity targeting the SARS-CoV-2 spike protein using a multiparametric approach. At the beginning of the pandemic, we recruited 30 COVID-19 unvaccinated convalescent donors and 7 unexposed asymptomatic controls. Peripheral blood mononuclear cells (PBMCs) were obtained from leukapheresis cones. The humoral immune response was assessed by measuring serum anti-SARS-CoV-2 spike S1 subunit IgG semiquantitative ELISA and T cell immunity against S1 and S2 subunits were studied by IFN-γ Enzyme-Linked Immune absorbent Spot (ELISpot), flow cytometric (FC) activation-induced marker (AIM) assays and the assessment of cytotoxic CD8+ T-cell function (in the subset of HLA-A2 positive patients). No single immunoassay was sufficient in identifying anti-spike convalescent immunity among all patients. There was no consistent correlation between adaptive humoral and cellular anti-spike responses. Our data indicate that the magnitude of anti-spike convalescent humoral and cellular immunity is highly heterogeneous and highlights the need for using multiple assays to comprehensively measure SARS-CoV-2 convalescent immunity. These observations might have implications for COVID-19 surveillance, and optimal vaccination strategies for emerging variants. Further studies are needed to determine the optimal assessment of adaptive humoral and cellular immunity following SARS-CoV-2 infection, especially in the context of emerging variants and unclear vaccination schedules.

COVID-19 has rapidly spread worldwide since December 2019. During the pandemic, SARS-CoV-2 repeatedly mutated from Alpha to Omicron. The severity and mortality are related to age, sex, and underlying diseases (respiratory, cerebrovascular, cardiovascular, metabolic, cancer, and immune diseases). We retrospectively studied 44 hospitalized stroke patients infected with the SARS-CoV-2 Omicron variant. The mortality rate of hospitalized stroke patients with COVID-19 was 6 (13.6%). The cause of death was coagulopathy in 3 cases of ischemic stroke. High modified Rankin Scale score（mRS）of stroke patient was correlated with severity of COVID-19. The timing of vaccination is inversely correlated with COVID-19 severity. In conclusion, stroke patients with COVID-19 have high mortality rates attributed to coagulopathy. Stroke patients with high mRS scores are more likely to develop severe COVID-19. In high mRS scores, therapy for severe COVID-19 should be administered.

: (1) Background: Healthcare workers (HCWs) are a well-known risk group for coronavirus infections with increased working hours in a potentially infectious environment. We evaluated both IgG and Neutralizing antibody levels, with IgG avidity index and persistence among health workers. (2) Methods: 1001 HCWs were tested for both IgG and Neutralizing antibodies. IgG avidity testing and one-year follow-up testing were done on selected HCWSs. (3) Results: COVID-19 IgG antibody levels were high among 299 (94.62%) HCWs with a history of COVID-19 infection (p <0.0001) compared with 479 (69.92%) HCWs who were not infected with COVID-19 during the first and second wave. A total of 899 (89.81%) HCWs had more than 50% neutralizing antibodies while the remaining 102 (10.19%) HCWs had less than 50% of Neutralizing antibodies. The avidity index was maintained at almost 40% (Gray zone). Both antibody levels were found markedly increased after one year when compared to initial results. (4) Conclusions: Healthcare workers are at a 2.29-fold higher risk of infection; Two folds higher IgG levels in HCWs involved in COVID-19 duty and their persistence for a longer time than in other groups signifies IgG antibody role in the prevention of severe disease in HCWs involved in Covid-19 patient care.

Type 2 diabetes mellitus (T2DM) is a common metabolic disease characterised by insulin resistance and elevated blood glucose levels, affecting millions of people worldwide. T2DM patients with dyslipidaemia have an increased risk of cardiovascular disease (CVD). A complex interplay of risk factors such as hyperglycaemia, dyslipidaemia, hypertension, obesity, inflammation and oxidative stress favour the development of atherosclerosis, a central mechanism in the pathogenesis of cardiovascular disease. Dyslipidaemia, a hallmark of T2DM, is characterised by elevated triglycerides, decreased high-density lipoprotein (HDL) cholesterol and the presence of small, dense low-density lipoprotein (LDL) particles, all of which promote atherosclerosis. In this article, we have attempted to present various treatment strategies that include pharmacological interventions such as statins, ezetimibe, PCSK9 inhibitors, fibrates and omega-3 fatty acids. We have also tried to highlight the pivotal role of lifestyle modifications, including physical activity and dietary changes, in improving lipid profiles and overall cardiovascular health in T2DM patients. We have also tried to present the latest clinical guidelines for the management of dyslipidaemia in T2DM patients. In conclusion, the treatment of dyslipidaemia in T2DM patients is of great importance as it lowers lipid particle levels, slows the progression of atherosclerosis and ultimately reduces susceptibility to cardiovascular disease.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The Main Protease (Mpro) plays a pivotal role in the replication of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and is considered a highly conserved viral target. Disruption of the catalytic activity of Mpro produces a detrimental effect on the course of the infection, making this target one of the most attractive for the treatment of COVID-19. The current success of the SARS-CoV-2 Mpro inhibitor Nirmatrelvir, the first oral drug for the treatment of severe forms of COVID-19, has further focused the attention of researchers on this important viral target, making the search for new Mpro inhibitors a thriving and exciting field for the development of antiviral drugs active against SARS-CoV-2 and related coronaviruses.

The SARS-CoV-2 virus, causative agent of COVID-19, is known for its genetic diversity. Virus variants of concern (VOCs) as well as variants of interest (VOIs) are classified by the World Health Organization (WHO) according to their potential risk to global health. This study seeks to enhance the identification and classification of such variants by developing a novel bioinformatics criterion centered on the virus's spike protein (SP1), a key player in host cell entry, immune response, and a mutational hotspot. To achieve this, we pioneered a unique phylogenetic algorithm which calculates EIIP-entropy as a distance measure based on the distribution of the Electron-Ion Interaction Potential (EIIP) of amino acids in SP1. This method offers a comprehensive, scalable, and rapid approach to analyze large genomic data sets and predict the impact of specific mutations. This innovative approach provides a robust tool for classifying emergent SARS-CoV-2 variants into potential VOCs or VOIs. It could significantly augment surveillance efforts and understanding of variant characteristics, while also offering potential applicability to the analysis and classification of other emerging viral pathogens and enhancing global readiness against emerging and re-emerging viral pathogens.

D-Glucaric acid is an important bio-based building block of polymers and is a high value-added chemical that can be used in a variety of applications. In the present study, the Udh target genes from Pseudomonas putida and Pseudomonas syringae were used together to construct the expression vector pETDuet-2×Udh. The transformants of BL21(DE3) with vector pETDuet-2×Udh was applied to produce glucaric acid from glucuronic acid. After optimization of induction conditions, the highest Udh expression were achieved when 0.4 mmol L-1 isopropyl-β-d–thiogalactoside (IPTG) was added to cell cultures at an OD600 value of 0.6 followed by culture at 26℃ for 6 hours. The production of glucaric acid substantially reached 5.24 ± 0.015 g L-1 in fed-batch cultures in a 30 L tank. In the present study, a new system for glucaric acid production was established, which was more economic and friendly to environment.

The COVID-19 pandemic has raised questions about indirect impact in pregnant women on the development of their future children. Investigating the characteristics of lipid metabolism in the "mother-placenta-fetus" system can give information about the pathophysiology of COVID-19 infection during pregnancy. 234 women were included in study. Maternal plasma, cord blood, amniotic fluid lipidome were analyzed using HPLC-MS/MS. Differences in lipid profile were searched by Manna-Whitney and Kruskall-Wallis test, diagnostic model based on logistic regres-sion were bilt by AIC. Elevation levels of lysophospholipids, triglycerides, sphingomyelins, and oxidized lipids was registered in patients’ after COVID-19 maternal and cord plasma. An increase in maternal plasma sphingomyelins and oxidized lipids was observed in cases of infection during the second trimester. In amniotic fluid, compared to the control group, nine lipids are reduced, six lipids are elevated. Levels of phosphoglycerides, lysophosphoglycerides, and phosphatidylinosi-tols decreased during infection in the second and third trimesters of pregnancy. Newborn’s health diagnostic model based on maternal plasma were developed for each group and exhibit good di-agnostic value (AUC> 0.85). Maternal and cord plasma’s lipidome changes during delivery, asso-ciated with Covid-19 infection during pregnancy, are synergistic. The most significant disturbances occur with infections in the second trimester of pregnancy.

One of the hallmarks of microgravity-induced effects in several cellular models is represented by the alteration of oxidative balance with the consequent accumulation of Reactive Oxygen Species (ROS). It is well known that male germ cells are sensitive to oxidative stress and to changes of gravitational force even if published data on germ cell models are scarce. To gain more insights into the mechanisms of male germ cell response to altered gravity, a 3D cell culture model has been established from TCam-2 cells, a seminoma-derived cell line considered the only human cell line available to study in vitro mitotically active human male germ cells. TCam-2 cell spheroids were cultured for 24 hours under unitary gravity (Ctr) or simulated microgravity (s-microgravity) conditions, these last ones were obtained using the Random Positioning Machine (RPM). A significant increase in intracellular ROS and mitochondria superoxide anion levels has been observed after RPM exposure. In line with these results a trend of protein and lipid oxidation increase, and increased pCAMKII expression levels were observed after RPM exposure. The ultrastructural analysis by Transmission Electron Microscopy revealed that RPM-exposed mitochondria appeared enlarged and, even if seldom, disrupted. Notably, even the expression of the main enzymes involved in the redox homeostasis appears modulated by RPM exposure in a compensatory way, being GPX1, NCF1, and CYBB downregulated, whereas NOX4 and HMOX1 upregulated. Interestingly, HMOX1 is involved in the heme catabolism of mitochondria cytochromes, and therefore the positive modulation of this marker can be associated to the observed mitochondria alteration. All together, these data demonstrate TCam-2 spheroid sensitivity to acute SM exposure and indicate the capability of these cells to trigger compensatory mechanisms that allow to overcome the exposure to altered gravitational force.

Systemic sclerosis (SSc) is a multisystem connective tissue disease characterized by pathological processes involving autoimmunity, vasculopathy, and resultant extensive skin and organ fibrosis. Recent studies have demonstrated activation and aberrant wound healing responses in the epithelial layer of the skin in this disease, implicating the epithelial keratinocytes as a source of pro-fibrotic and inflammatory mediators. In this paper we investigated the role of Immunoglobulin G (IgG) autoantibodies directed against epithelial cells, as potential initiators and propagators of pathological keratocyte activation and the ensuing SSc fibrotic cascade. A keratinocyte cell-based ELISA is used to evaluation binding of SSc IgG. SSc skin biopsies were stained by immunofluorescence for the presence of IgG in the keratinocyte layer. Moreover, IgG purified from SSc sera is evaluated for the potential to activate keratinocytes in tissue culture and to induce signaling in TLR2 & 3 reporter cell lines. We demonstrate enhanced binding of SSc IgG to keratinocytes, and activation of these cells leading to release of IL-1α, representing a potential initiating pathway in this disease.

Suffocation syndrome is the leading cause of hypoxia and mortality in the most common lung diseases, asthma and COVID-19. Inhaled corticosteroids (ICSs) have been shown to be the main-stay of critical care in these diseases. Meanwhile, mortality from strangulated hypoxia is highest in low-income countries because ICSs are not currently available to many patients. Warm alkaline hydrogen peroxide solutions (WAHPSs) have reportedly been invented in recent years to urgently turn thick sputum, mucus, pus, serous fluid, blood clots and many other biological masses con-taining the enzyme catalase into a fluffy oxygenated foam. It has been shown that the mechanism of action of WAHPSs consists in alkaline saponification of lipid and protein-lipid complexes of bi-ological masses and their transformation into oxygen foam, because hydrogen peroxide is urgently decomposed into water and oxygen gas under the action of the biological masses catalase enzyme At that excess oxygen is absorbed into blood through lungs and increases blood oxygen saturation. Based on the described mechanism of action of WAHPSs and the high availability of their ingre-dients, it is suggested that mortality from choking and hypoxia in asthma and COVID-19 can be reduced by combining ICSs with inhaled WAHPSs, especially in poor countries. The essence of the inventions underlying the formation of WAHPSs is given.

N'-(5-bromofuran-2-carbonyl)isonicotinohydrazide (1) was obtained as a white solid in 83% yield by 2-methyl-6-nitrobenzoic anhydride (MNBA)/4-dimethylaminopyridine (DMAP)-catalyzed reaction of 5-bromofuran-2-carboxylic acid and isoniazid in dichloromethane at room temperature. The structure of N'-(5-bromofuran-2-carbonyl)isonicotinohydrazide (1) was elucidated by 1H NMR, 13C NMR, FTIR, and the high resolution mass spectrometers. Molecular docking screening of the title compound (1) on the cyclooxygenase-2 (COX-2) protein (PDB ID: 5IKR) exhibited that compound (1) has a good binding affinity, suggesting that it is very interesting for further structure optimization and in-depth research as a potential COX-2 inhibitor.

The Covid-19 pandemic has produced a change in the way of living, socializing and a modification in Health Systems around the world. A multicentre retrospective study was carried out to study orofacial trauma in one of the regions most affected during the first wave of the pandemic, with the participation of the five main tertiary hospitals in Madrid. The aim of this study is to evaluate the epidemiology of orofacial surgical trauma during the 1 year of COVID pandemic and compared to de prior year. Age, sex, mechanism, localization, and treatment were studied. P-value <0.05 was considered statically significative. Reduction of 39.36% (<0.001) in maxillofacial fractures was observed, without significance change in sex, localization or treatment. Significant increase in age (35,92 vs. 40,26) (p = 0.006) was observed. Significant decline in mechanism was noted (p = 0.025), decreasing personal violence (41% vs 35%) and sports (14% vs 8%); increasing in falls (27% vs 35%), precipitation (2 vs 5%), and traffic accidents (12% vs 13%). The mandible was the most frequent fractured bone. The COVID pandemic has produced epidemiological variations in orofacial trauma, making it necessary to monitor social and legal changes that may require reorganization to adjust to population needs.

Adipose tissue is a crucial organ in energy metabolism and thermoregulation. Adipose tissue phenotype is controlled by various signaling mechanisms under pathophysiological conditions. Type II transmembrane serine proteases (TTSPs) are a group of trypsin-like enzymes anchoring on the cell surface. These proteases act in diverse tissues to regulate physiological processes, such as food digestion, salt-water balance, iron metabolism, epithelial integrity, and auditory nerve development. More recently, several members of the TTSP family, namely, hepsin, matriptase-2, and corin, have been shown to play a role in regulating lipid metabolism, adipose tissue phenotype, and thermogenesis, via direct growth factor activation or indirect hormonal mechanisms. In mice, hepsin deficiency increases adipose browning and protects from high-fat diet-induced hyperglycemia, hyperlipidemia, and obesity. Similarly, matriptase-2 deficiency increases fat lipolysis and reduces obesity and hepatic steatosis in high-fat diet-fed mice. In contrast, corin deficiency increases white adipose weights and cell sizes, suppresses adipocyte browning and thermogenic responses, and causes cold intolerance in mice. These findings highlight an important role of TTSPs in modifying cellular phenotype and function in adipose tissue. In this review, we provide a brief description about TTSPs and discuss recent findings regarding the role of hepsin, matriptase-2, and corin in regulating adipose tissue phenotype, energy metabolism, and thermogenic responses.

Keywords: Marine sulfated glycans; SARS-CoV-2; Omicron XBB.1.5, Spike protein; Heparin

Recent studies have confirmed that lung microvascular endothelial injury plays a critical role in the pathophysiology of COVID-19. Our group and others have demonstrated the beneficial effects of H2S in several pathological processes and provided a rationale for considering the therapeutic implications of H2S in COVID-19 therapy. Here, we evaluated the effect of the slow-releasing H2S donor, GYY4137, on the barrier function of a lung endothelial cell monolayer in vitro, after challenging the cells with plasma samples from COVID-19 patients or inactivated SARS-CoV-2 virus. We also assessed how the cytokine/chemokine profile of patients’ plasma, endothelial barrier permeability, and disease severity correlated with each other. Alterations of barrier permeability after treatments with patient plasma, inactivated virus, and GYY4137 were monitored and assessed by electrical impedance measurements in real-time. We present evidence that GYY4137 treatment reduced endothelial barrier permeability after plasma challenge and completely reversed the endothelial barrier disruption caused by inactivated SARS-CoV-2 virus. We also showed that disease severity correlated with the cytokine/chemokine profile of the plasma but not with barrier permeability changes in our assay. Overall, these data demonstrate that treatment with H2S-releasing compounds has the potential to ameliorate SARS-CoV-2–associated lung endothelial barrier disruption.

The mRNA vaccines for SARS-CoV-2 have demonstrated efficacy and immunogenicity in the re-al-world setting. However, most of the research on vaccine immunogenicity has been centered on characterizing the antibody response, with limited exploration into the persistence of spike-specific memory B cell response. Here we monitored the durability of the memory B cell response and characterize the trajectory of spike-specific B cell phenotypes in healthy individuals who have received two doses of the BNT162b2 vaccine up to 9 months post-vaccination. To profile the spike-specific B cell response we applied the tSNE and Cytotree automated approaches. Our data showed the induction of spike-specific IgA+ and IgG+ plasmablasts and IgA+ activated cells 7 days after the second dose which disappeared 3 months later, while subsets of spike-specific IgG+ resting memory B cells became predominant 9 months after vaccination, and they were capable to differentiate into spike-specific IgG secreting cells when in vitro restimulated. Other subsets of spike-specific B cells, such as IgM+ or unswitched IgM+IgD+ or IgG+ double negative/atypical cells, were also elicited by the BNT162b2 vaccine and persisted up to month 9. The analysis of circulating spike-specific IgG, IgA and IgM was in line with the plasmablasts observed. The longitudinal analysis of the antigen-specific B cell response elicited by mRNA-based vaccines provides valuable insights into our understanding of the immunogenicity of this novel vaccine platform destined to a future widespread use, and it is crucial in guiding future decisions and vaccination schedules.

Preterm delivery can be precipitated by infection, and preterm infants are at heightened risk of postnatal infection. Little is known about the ontogeny of inflammatory biomarkers in extremely preterm infants. We hypothesized that suspected prenatal infection (chorioamnionitis or spontaneous preterm labor) and clinically diagnosed postnatal infection would be associated with unique biomarker signatures, and those patterns would be influenced by the degree of prematurity. Venous blood was collected daily for the first week and weekly for up to 14 additional weeks from 142 neonates born at 22-32 weeks gestation. A custom array was utilized to measure monocyte chemoattractant protein-1 (MCP-1) and interleukin-6 (IL-6). C-reactive protein (CRP) levels were obtained from the electronic medical record. 90 infants had suspected prenatal infection and 63 were diagnosed with postnatal infection. Independent of gestational age at delivery, MCP-1 was significantly increased (P &lt; 0.001) in association with maternal preeclampsia, but MCP-1 was decreased (P&lt;0.01) and CRP was increased (P&lt;0.05) in the presence of chorioamnionitis. IL-6 and CRP were both increased in infants diagnosed with postnatal infection with peak levels observed on days 2 and 3, respectively. In conclusion, suspected prenatal and postnatal infections and non-infectious complications of pregnancy are associated with unique biomarker profiles, independent of gestational age. In those clinically diagnosed with a postnatal infection in the absence of antenatal infection concerns, IL-6 increases before CRP, emphasizing a potential role for expanded biomarker screening if antibiotics are initially avoided in infants born exclusively for maternal indications.

Erectile dysfunction (ED) is a common and feared complication of radical prostatectomy (RP) for prostate cancer. Recently, tissue engineering is being attempted for post-prostatectomy ED, with controlled interactions between cells, growth factors, and extracellular matrix (ECM) being important for nerve regeneration's structural integrity. In this study, we evaluated the effects of biomechanical ECM patch on human bone marrow-derived mesenchymal stem cells (hBMSCs) morphology and behavior in bilateral cavernous nerve injury (BCNI) rat model. The ECM patch, made of decellularized human fibroblast-derived ECM (hFDM) and a biocompatible polyvinyl alcohol (PVA) hydrogel, was tested with human bone marrow-derived mesenchymal stem cells (hBMSCs) on a bilateral cavernous nerve injury (BCNI) rat model. In vitro analysis showed that the hFDM/PVA + hBMSCs patches significantly increased neural development markers. In vivo experiments demonstrated that the rats treated with the hFDM/PVA patch had higher ICP/MAP ratio, a higher ratio of smooth muscle to collagen, increased content of nNOS, higher levels of eNOS protein expression, and a higher cGMP level compared to the BCNI group. These results indicate that the hFDM/PVA patch is effective in promoting angiogenesis, smooth muscle regeneration, and nitrergic nerve regeneration, which could contribute to improved erectile function in post-prostatectomy ED.

Beyond plasma glucose-lowering in patients with type 2 diabetes, sodium- glucose cotransporter 2 inhibitors (SGLT2i) significantly reduced the hospitalization for heart failure (HF) and retarded the progression of chronic kidney disease (CKD). Endothelial dysfunction is not only involved in the development and progression of cardiovascular disease (CVD), and is also associated with the progression of CKD. In patients with type 2 diabetes, hyperglycemia, insulin resistance, hyperinsulinemia and dyslipidemia induce the development of endothelial dysfunction. SGLT2i have shown an improvement in endothelial dysfunction, as assessed by flow-mediated vasodila-tion, in individuals at high risk for CVD. Along with an improvement of endothelial dysfunction, SGLT2i showed improvements in oxidative stress, inflammation, mitochondrial dysfunction, glucotoxicity such as advanced glycation end products signaling and nitric oxide bioavailability. The improvements in endothelial dysfunc-tion and such endothelium-derived factors may play an important role in preventing the development of coronary artery disease, coronary microvascular dysfunction and diabetic cardiomyopathy which cause HF and in retarding CKD. The suppression of the development of HF and the progression of CKD achieved by SGLT2i might have been largely induced by the improvement of vascular endothelial function by SGLT2i.

Natural herbs and functional foods contain bioactive molecules capable of augmenting the immune system and mediating anti-viral functions. Functional foods, such as prebiotics, probiotics, and dietary fibers, have been shown to have positive effects on gut microbiota diversity and immune function. The use of functional foods has been linked with en-hanced immunity, regeneration, improved cognitive function, maintenance of gut mi-crobiota, and significant improvement in overall health. The gut microbiota plays a critical role in maintaining overall health and immune function, and disruptions to its balance have been linked to various health problems. SARS-CoV-2 infection has been shown to affect gut microbiota diversity, and the emergence of variants poses new challenges to combat the virus. SARS-CoV-2 recognizes and infects human cells through ACE2 receptors prevalent in lung and gut epithelial cells. Humans are prone to SARS-CoV-2 infection because the respiratory and gastrointestinal tracts are rich in microbial diversity and contain high ACE2 and TMPRSS2. This review article explores the potential use of functional foods in mitigating the impact of SARS-CoV-2 variants on gut microbiota diversity and the potential use of functional foods as a strategy to combat these effects.

Abstract: The SARS-CoV-2 pandemic has significantly impacted world health and economic status. In response, much work has been undertaken to provide effective, safe vaccines, antibodies and antiviral drugs with which to address this pandemic. Treatment of a pandemic population presents multiple challenges in addition to the primary issue of drug efficacy and safety, such as large scale drug manufacture and distribution, drug stability, oral dosing and pharmacoeconomic considerations. Ideally, these factors must be addressed if new candidate drugs are to be advanced for treatment of large (pandemic) populations. Subsequently, new antivirals have reached the market but choices are few. According to the NIH Covid Treatment Guidelines, only three small molecule antiviral drugs are available to treat COVID-19 disease. As such, a significant part of the research towards discovery of new antiviral drugs has focused on screening and evaluation of ‘repurposed drugs’ or previously approved or clinical stage drugs. Yet, in spite of this increased research activity, one promising clinical stage candidate drug has received little attention regarding its potential as a monotherapy or component of combination therapy for treatment of COVID-19 disease. Tucaresol, with documented human safety and pharmacokinetic data, is an orally active, stable, small molecule amenable to large scale manufacture by a proprietary two-step synthesis developed by us. Tucaresol functions as a host-targeted antiviral by selective protection/reconstitution of CD4+ T helper cells as demonstrated in HIV patients and SIV macaques. In view of similarities between HIV and SARS-CoV-2, especially with respect to host CD4+ T helper cells, and the suitability of Tucaresol for facile treatment of pandemic populations, Tucaresol is presented herein for treatment of mild-to-moderate COVID-19 patients but may also be useful for treatment of advanced disease accompanied by lymphopenia.

Background: The SARS-CoV-2 laboratory PCR tests were generally reported only as binary positive or negative outcomes. Instead test positivity, these results contain a great deal of epidemiological information related to viral transmission patterns in populations. These transmission patterns during India’s SARS-CoV-2 viral waves remain largely undocumented. Methods: We analysed 2.7 million real-time polymerase chain reaction (PCR) testing records collected in Mumbai, a bellwether for other Indian cities. We used the inverse of cycle threshold (Ct) values to determine community-level viral load. We quantified wave-specific differences by age, sex and slum population density. Results: Overall PCR positivity was 3.4% during non-outbreak periods, rising to 23.2% and 42.8% during the Aleph (June-November 2020) and Omicron waves (January 2022), respectively, but only 9.9% during the Delta wave (March-June 2021). The community-level median Ct values fell and rose ~7-14 days prior to PCR positivity rates. Viral loads were 4-fold higher during the Delta and Omicron waves than during non-outbreak months. The Delta wave had high viral loads at older ages, in women and in areas of higher slum density. During the Omicron wave, differences in viral load by sex and for slum density had disappeared, but older adults continued to show higher viral load. Conclusions: Mumbai’s viral waves had markedly high viral loads representing an early signal of pandemic trajectory. Continue the vaccination in elderly Indians could reduce viral load in subsequent waves. Ct values are practicable monitoring tools.

The COVID-19 pandemic has presented an unprecedented challenge to the healthcare system. Identifying the genomics and clinical biomarkers for effective patient stratification and management is critical to controlling the spread of the disease. Omics datasets provide a wealth of information that can aid in understanding the underlying molecular mechanisms of COVID-19 and identifying potential biomarkers for patient stratification. Artificial intelligence (AI) and machine learning (ML) algorithms have been increasingly used to analyze large-scale omics and clinical datasets for patient stratification. In this manuscript, we demonstrate the recent advances and predictive accuracies in AI and ML-based patient stratification modeling linking omics and clinical biomarker datasets, focusing on COVID-19 patients. Our ML model not only demonstrates that clinical features are enough an indicator of COVID-19 severity and survival but also infers what clinical features are more impactful, which makes our approach a useful guide for clinicians for prioritization of best-fit therapeutics for a given cohort of patients. Moreover, with weighted gene network analysis, we are able to provide insights into gene networks that have a significant association with COVID-19 severity and clinical features. Finally, we have demonstrated the importance of clinical biomarkers in identifying high-risk patients and predicting disease progression.

This research intended to report amine-functionalized multiwall carbon nanotubes (MWCNTs) prepared by a simple method for efficient and rapid removal of Reactive Yellow 2 (RY2) from water. EDS analysis showed that the N content increased from 0 to 2.42% and from 2.42 to 8.66% after modification by APTES and PEI, respectively. BET analysis displayed that the specific surface area, average pore size, and total pore volume were reduced from 405.22 to 176.16 m2/g, 39.67 to 6.30 nm, and 4.02 to 0.28 cm3/g, respectively. These results proved that the PEI/APTES-MWCNTs were successfully prepared. pH edge experiment indicated that pH 2 was optimal for RY2 removal. At pH 2 and 25 °C, the time required for adsorption equilibrium was 10, 15, and 180 min at initial concentrations of 50, 100, and 200 mg/L, respectively; and the maximum RY2 uptake calculated by the Langmuir model was 714.29 mg/g. Thermodynamic studies revealed that the adsorption process was spontaneous and endothermic. 0-0.1 mol/L of NaCl showed negligible effect on RY2 removal by PEI/APTES-MWCNTs. Five adsorption/desorption cycles confirmed the good reusability of PEI/APTES-MWCNTs in RY2 removal. Overall, the PEI/APTES-MWCNTs are a potential and efficient adsorbent for reactive dye wastewater treatment.

Vaccines against SARS-CoV-2 have been pivotal in overcoming the Covid-19 pandemic yet understanding the subsequent outcomes and immunological effects remain crucial, especially for at-risk groups e.g. people living with human immunodeficiency virus (HIV) (PLWH). In this study we report the longitudinal IgA and IgG antibody titers, as well as antibody-mediated angiotensin converting enzyme 2 (ACE2) binding blockade, against the SARS-CoV-2 spike (S) proteins after 1 and 2 doses of the ChAdOx1 nCoV-19 vaccine in a population of Black PLWH. Here, we report that PLWH (N = 103) did not produce an anti-S IgA response after infection or vaccination, however, anti-S IgG was detected in response to vaccination and infection, with the highest level detected for infected vaccinated participants. The anti-IgG and ACE2 blockade assays revealed that both vaccination and infection resulted in IgG production, however, only vaccination resulted in a moderate increase in ACE2 binding blockade to the ancestral S protein. Vaccination with a previous infection results in the greatest anti-S IgG and ACE2 blockade for the ancestral S protein. In conclusion, PLWH produce an anti-S IgG response to the ChAdOx1 nCoV-19 vaccine and/or infection, and ChAdOx1 nCoV-19 vaccination with a previous infection produced more neutralizing antibodies than vaccination alone.

In an historic perspective on the development of the Standard Model of particle physics it is shown how mathematically driven axioms have masked the merits of a physically comprehensible structural view. It is concluded that the difference between the two approaches can be traced back to two major issues. Whereas in the Standard Model the quark is a Dirac particle with a single real dipole moment, the quark in the structural model, in confinement with other quarks, is a Dirac particle with two real dipole moments. The second issue is the view that empty space does not exist, but that space is filled with a polarisable energetic fluid. It is shown how recognition of these two issues pave a road to reconcile particle physics with gravity, in which the quark can be seen as a magnetic electron and in which the gluon, as the strong force carrier, can be seen as a massive photon.

In French Polynesia, Wuhan, Delta and Omicron SARS-CoV-2 variants-of-concern (VOCs) caused epidemics with variable severities. We assessed the prevalence and titers of anti-SARS-CoV-2 antibodies related to natural infection and/or vaccination, from a representative sample (N=673) of the adult population of Tahiti recruited during November-December 2021 (after the Delta outbreak and just before the Omicron epidemic). Of the 673 participants tested, 644 (95.7%) had detectable antibodies against SARS-CoV-2-S and/or -N proteins resulting from natural infection and/or vaccination, and 388 (57.7%) were positive only for the detection of anti-N antibodies indicating natural infection. SARS-CoV-2 seroprevalence extrapolated to the adult population of Tahiti was estimated at 95.9%. Concentrations of anti-SARS-CoV-2-S antibodies significantly increased with age, number of self-reported SARS-CoV-2 infections (0 or ≥1), and number of COVID-19 vaccine doses (0, 1, 2, or 3) received by the participants. Elderly people, who are at higher risk of severe outcomes, had received more vaccine doses than younger individuals both in our sample and in the general population. The high level of antibody responses related to past infections and vaccination, especially booster doses, has likely contributed to reducing the severity of the Omicron outbreak in French Polynesia.

It is already well known that infants and children infected with COVID-19 develop mild to mod-erate forms of the disease, with fever and oropharyngeal congestion being the most common symptoms. Nevertheless, there are cases in which the patients accuse respiratory symptoms. These cases need lung evaluation, which can be done using lung ultrasound (LUS), because it is a non-irradiating and repeatable imaging technique. 19 children with COVID-19 pneumonia were eval-uated using LUS. The LUS score (LUSS) for each patient varied between 1 to 8 points from a max-imum of 36 points. The arithmetic mean was 4.47 ± 2.36 (S.D), while 95% CI for the Arithmetic mean was 3.33 to 5.61. The lung changes were correlated with their biomarkers, specifically in-flammatory markers. The correlation between LUSS and LDH, D-dimers and IL-6 was a strong positive one with r=0.66 (p=0.01, 95% CI 0.147 to 0.896) between the LUSS and LDH level at symptomatic infants and children (with cough present) and r=0.66 (p=0.01, 95% CI 0.140 to 0.895) between LUSS and D-dimers level at symptomatic infants and children (with cough pre-sent). The results suggest that LUS could be a good imaging technique that can be used both in ini-tial evaluation of children with respiratory diseases, and, also in their follow-up, correlated with symptoms and biomarkers.

The global threat of COVID-19 has led to the increasing use of metabolomics to study SARS-CoV-2 infection in humans and animals. Despite this, understanding SARS-CoV-2's metabolome during infection remains difficult and incomplete. Here, metabolic responses were characterized from sampled nasal washes collected from an asymptomatic ferret model (n = 20) at different time points before and after the SARS-CoV-2 challenge using an LC-MS-based metabolomics approach. Multivariate analysis of the nasal wash metabolome data resulted in several statistically significant features being observed. Despite no effects of gender or interaction between gender and time on the time course of SARS-CoV-2 infection, 16 metabolites were significantly different at every time point post-infection. Among these altered metabolites, the relative abundance of taurine was elevated post infection which could be an indication of hepatotoxicity, while the accumulation of sialic acids could indicate SARS-CoV-2 invasion. The pathway analysis identified several pathways influenced by SARS-CoV-2 infection. Of these, sugar, glycan, and amino acid metabolisms were the key altered pathways in the upper respiratory channel during infection. These findings provide some new insights into the progression of SARS-CoV-2 infection in ferrets at the metabolic level which could be useful for the development of early clinical diagnosis tools and new or repurposed drug therapies.

Vehicle HVAC systems can accumulate and recirculate highly infectious respiratory diseases via aerosols. Integrating UVC to complement automobile HVAC systems can protect occupants from developing allergies, experiencing inflammatory problems, or acquiring respiratory infectious diseases by inactivating pathogenic organisms. UVC can add little to no static pressure with minimal space, unlike mercury lamps which are larger and heavier. Additionally, UVC LEDs are effective at low voltage and have no mercury or glass. While previous experiments have shown UVC LED technology can reduce bacteriophage Phi6 concentrations by 1 log in 5 minutes (selected as the average time to clean the cabin air), those studies had not positioned LED within the HVAC itself or studied the susceptibility of the surrogate at the specific wavelength. This study aimed to assess the disinfection performance of UVC LEDs in automotive HVAC systems and determine the dose-response curve for bacteriophage Phi6, a SARS-CoV-2 surrogate. To achieve this, UVC LEDs were installed in a car HVAC system. To determine inactivation efficacy, a model chamber of 3.5 m3, replicating the typical volume of a car, containing the modified automobile HVAC system was filled with bacteriophage Phi6, and the HVAC was turned on with and without the UVC LEDs being turned on. The results revealed that HVAC complemented with UVC reduced bacteriophage Phi6 levels significantly more than the HVAC alone and reduced the viral concentration in the cabin by more than 1 LRV (90% viral reduction) in less than 5 minutes. The performance after 5 minutes is expected to be significantly better against SARS-CoV-2 because of its higher sensitivity to UVC, especially at lower wavelengths (below 270 nm). HVAC alone could not achieve a 90% viral reduction of bacteriophage Phi6 in 15 minutes. Applying UVC LEDs inside an HVAC system is an effective means of quickly reducing the number of aerosolized viral particles in the chamber, by inactivating microorganisms leading to improved cabin air quality.

A significant proportion of SARS-CoV-2 infections in Africa are identified as asymptomatic, facilitating the silent spread of the virus especially in populated urban cities. With the surge of the highly transmissible Omicron variant, the inclusion of asymptomatics in epidemiological surveys is key in estimating true infections and seroprevalence in the population. The aim of the study was to determine seroprevalence, active infection and circulating variants in Accra, the capital city of Ghana during the Omicron wave. The study was a cross-sectional survey conducted in 22 municipalities in December 2021. Naso-oropharyngeal swabs and serum samples were collected from 1027 individuals aged 5 years and above, for detection of infection by RT-qPCR and estimation of total antibodies using the WANTAI ELISA kit. Our results show 10% SARS-CoV-2 prevalence, with the Omicron and Delta variants accounting for 44.1% and 8.8% of infections, respectively. Omicron was most prevalent (48.9.%) among the 20–39-year-olds. Asymptomatic individuals accounted for 75.2% of infections. Seropositivity within the population was 86.8%, with the 60+ year group having significantly higher likelihood of exposure (OR 10.22: 95% CI: 3.51-29.73; p<0.001). This high seroprevalence appears to have been as a result of increased vaccination among this group (OR 2.7: 95% CI 1.78-4.09, p < 0.001). The high seropositivity of SARS-CoV-2 in the capital could be a good indication of herd immunity among the population and while the low infection rate supports the role of vaccination in reducing viral transmission.

Low back pain is a clinically highly relevant musculoskeletal burden and is associated with inflammatory as well as degenerative processes of the intervertebral disc. However, the pathophysiology and cellular pathways contributing to this devastating condition are still poorly understood. Based on previous evidence, we hypothesize that tissue renin-angiotensin system (tRAS) components, including the SARS-CoV-2 entry receptor angiotensin-converting enzyme 2 (ACE2), are present in human nucleus pulposus (NP) cells and associated with inflammatory and degenerative processes. Experiments were performed with NP cells from 4 human donors. The existence of angiotensin II, angiotensin II type 1 receptor (AGTR1), AGTR2, MAS-receptor (MasR), and ACE2 in human NP cells was validated with immunofluorescent staining and gene expression analysis. Hereafter the cell viability was assessed after adding agonists and antagonists of the target receptors as well as angiotensin II in different concentrations for up to 48 hours of exposure. A TNF-α-induced inflammatory in vitro model was employed to assess the impact of angiotensin II addition and the stimulation or inhibition of the tRAS receptors on inflammation, tissue remodeling, expression of tRAS markers, and the release of nitric oxide (NO) into the medium. Further, protein levels of IL-6, IL-8, IL-10, and intracellular as well as secreted angiotensin II were assessed after exposing the cells to the substances, and inducible nitric oxide synthase (iNOS) levels were evaluated utilizing Western Blot. The existence of tRAS receptors and angiotensin II were validated in human NP cells. Cell viability analysis revealed no cytotoxic effects of angiotensin II. The AGTR1 inhibitor Candesartan and the MAS receptors AVE0991 showed cytotoxic effects at high concentrations (100 µM). The addition of angiotensin II only showed a mild impact on gene expression markers. However, there was a significant increase in NO secreted by the cells. The gene expression ratios of pro-inflammatory/anti-inflammatory cytokines IL-6/IL--10, IL-8/IL-10, and TNF-α /IL-10 were positively correlated with the AGTR1/AGTR2 and AGTR1/MAS1 ratios, respectively. The stimulation of the AGTR2 MAS-receptor and the inhibition of the AGTR1 receptor revealed beneficial effects on the gene expression of inflammatory and tissue remodeling markers. This finding was also present at the protein level. We did not find alterations in iNOS protein concentrations after adding the drugs. The current data showed that tRAS components are expressed in human NP cells and are associated with inflammatory and degenerative processes. Further characterization of the associated pathways is warranted. The findings indicate that tRAS modulation might be a novel therapeutic approach to intervertebral disc disease.

One of the models that could be used to understand the adoption of vaccine uptake is the Health Belief Model (HBM). The aim of this study is to assess the role of HBM constructs and perceived health status (PHS) on vaccination status of individuals and to understand the role of socio-demographic variables on HBM scoring. A comparative cross-sectional telephone survey was conducted among 1,325 vaccinated (60.0%) and non-vaccinated (40.0%) vaccinated individuals aged 40 years and above in July 2021 in Punjab province, Pakistan. A higher level of education was the strongest predictor of positive HBM. All constructs of HBM, PHS and cues-to-action were significant predictors of COVID-19 vaccination uptake with perceived benefits as the strongest predictor. In order to expand the vaccination coverage, doubled pronged interventions utilizing both ICT and human resources should be designed that address each barrier perceived by individuals and understandably communicate the benefits of COVID-19 vaccine to the broader population.

During the SARS-CoV-2 vaccination campaign, people with CF (pwCF) were considered a clinically vulnerable population. However, data on immunogenicity of anti-SARS-CoV-2 vaccines in pwCF are lacking. We conducted a prospective study enrolling all patients aged >12 and followed-up in our CF centre, who received two doses of the BNT162b2 vaccine in March-­­­October 2021. They underwent a blood sample for quantification of antibodies to the SARS-CoV-2 spike protein receptor binding domain immediately before receiving the first dose and after 3 and 6 months from the second dose. We enrolled 143 patients (median age: 21 years, range: 13-38); of whom 16 had a previous infection. Median antibody titer (interquartile range) after 3 months from vaccination was 1288 U/mL (730-2115) and decreased to 918 U/mL (534-1488) after 6 months (P<0.0001). Median values were higher among previously infected patients as compared to those naïve to SARS-CoV-2 (9107 vs 1229 U/mL at 3 months and 4810 vs 829 U/mL at 6 months, P<0.0001) with no significant differences in the rate of decline over time (P=0.135). All pwCF mounted an antibody response after two-doses of BNT162b2 vaccine that waned at 6 months from vaccination. Age ≥30 years and use of inhaled corticosteroids were associated with a lower humoral response.

Fusarium culmorum is a major pathogen of grain crops. Infected plants accumulate deoxynivalenol (DON), 3-acetyl-deoxynivalenol (3-ADON), or nivalenol (NIV), which are mycotoxins of the trichothecene B group. These toxins are also produced by F. graminearum species complex. New trichothecenes structurally similar to trichothecenes B but lacking the carbonyl group on C-8, designated NX toxins, were recently discovered in atypical isolates of F. graminearum from North America. Only these isolates and a few strains of a yet to be characterized Fusarium species from South Africa are known to produce NX-2 and other NX toxins. Here we report that among 20 F. culmorum strains isolated from maize, wheat, and oat in Europe and Asia over a period of 70 years, 18 strains produced NX-2 simultaneously with 3-ADON and DON or NIV. Rice cultures of strains producing 3-ADON accumulated NX-2 in amounts corresponding to 2-8% of 3-ADON (1.2 - 36 mg/kg). A strain producing NIV accumulated NX-2 and NIV at comparable amounts (13.6 and 10.3 mg/kg, respectively). In F. graminearum, producers of NX-2 possess a special variant of cytochrome P450 monooxygenase encoded by TRI1 that is unable to oxidize C-8. In F. culmorum, producers and nonproducers of NX-2 possess identical TRI1; the reason for the production of NX-2 is unknown. Our results indicate that production of NX-2 simultaneously with trichothecenes B is a common feature of F. culmorum.

Short Linear Motifs (SLiMs) are short linear sequences that can mediate protein-protein interaction. Mimicking eukaryotic SLiMs to compete with extra or intracellular binding partners or to sequester host proteins is the crucial strategy of viruses to pervert the host system. The evolved proteins in viruses facilitate minimal protein-protein interactions that significantly affect intracellular signaling networks. Unfortunately, very little information about the SARS-CoV-2 SLiMs is known, especially across the SARS-CoV-2 variants. Through ELM database-based sequence analysis of spike protein from all the major SARS-CoV-2 variants, we identified four overriding SLiMs in the SARS-CoV-2 Omicron variant including LIG_TRFH_1, LIG_REV1ctd_RIR_1, LIG_CaM_NSCaTE_8, and MOD_LATS_1. These SLiMs are highly likely to interfere with various immune functions, interact with host intracellular proteins, regulate cellular pathways, and lubricate viral infection and transmission. These cellular interactions possibly serve as potential therapeutic targets for these variants, and this approach can be further exploited to combat emerging SARS-CoV-2 variants.

Conventional methods of crop mapping need ground truth information to train the classifier. Thanks to the frequent acquisition allowed by recent satellite missions (Sentinel 2), we can identify temporal patterns that depend on both phenology and crop management. Some of these patterns are specific to a given crop and thus can be used to map it. Thus, we can substitute ground truth information used in conventional methods with agronomic knowledge. This approach was applied to identify irrigated permanent grasslands (IPG) in the Crau area (Southern France) which play a crucial role in groundwater recharge. The grassland is managed by making three mows during the May-October period which leads to a specific temporal pattern of leaf area index (LAI). The mowing detection algorithm was designed using the temporal LAI signal derived from Sentinel 2 observations. The algorithm includes some filtering to remove noise in the signal that might lead to false mowing detection. A pixel is considered a grassland if the number of detected mows is greater than 1. A data set covering five years (2016-2020) was used. The detection mowing number was done at the pixel level and then results are aggregated at the plot level. A validation data set including 780 plots was used to assess the performances of the classification. We obtained a Kappa index ranging between 0.94-0.99 according to the year. These results were better than other supervised classification methods that include training data sets. The analysis of land-use changes shows that misclassified plots concern grasslands managed less intensively with strong intra-parcel heterogeneity due to irrigation defects or year-round grazing. Time series analysis, therefore, allows us to understand different management practices. Real land-use change in use can be observed, but long time series are needed to confirm the change and remove ambiguities with heterogeneous grasslands.

In this paper, the phases in the Mg-Ti-O system using the 1:1 formulation of MgO:TiO2 mixing synthetic brucite of Mexican origin with TiO2 microparticles of high purity and with a heat treatment at 1100°C for 1 h were studied. The raw materials and formulation by XPS and DRX techniques were characterized. The results demonstrate the presence of different oxidation states in titania and the formation of different oxides in the Mg-Ti-O system when mixed and calcined at 1100°C; additionally, the formation of vacancies in the crystal lattice during the transformation from hexagonal brucite to magnesia with a cubic structure centered on the faces is estimated. With the results, its thermal behavior is warned based on the MgO-TiO2 phase diagram.

Coronavirus Disease-19 (COVID-19) is presently wreaking havoc on public health and socio-economic development. Besides the upper and lower respiratory tract involvement, gastrointestinal symptoms are also reported in COVID-19 patients through gut-lung axis. Finding its way through the feces of infected individuals and other sources, the genetic material of SARS-CoV-2 (ssRNA) is reported widely in wastewater and is being used as a fingerprint for its detection. With millions of cases arriving every day, there is a need to level up the testing speed efficiency. Due to the restricted sampling potential of testing laboratories, clinical testing is unable to track all the symptomatic and asymptomatic cases. Wastewater-based epidemiology (WBE) bestows an auxiliary monitoring tool that will contribute in community level screening. Sample collection, concentration, RNA extraction, quantification and data analysis are the main steps involved in implementation of WBE that can be relied upon as an alarm call for an upcoming wave, emergence of a new variant or any future pandemic. WBE can be a cheaper and more practical alternative to high end and sophisticated clinical testing for community transmission detection. Worldwide, there are more than 300 reports entailing the occurrence of SARS-CoV-2 in wastewater exhibiting unique temporal trends with five of them in India. This review aims to address the present knowledge on surveillance of SARS-CoV-2 in wastewater and its implications.

During the novel coronavirus disease (COVID-19) pandemic, several environmental factors have influenced the activities and the protection policy measures. This has had a major effect on climate change and global environmental catastrophe. In many countries, the strategy of closing various activities such as tourism, industrial production, stopped normal life, transportation, among others. This closure has a positive impact on the environment. However, the massive use of masks and personal protection could significantly increase pollution worldwide. The impact on the environment needs to be calculated to have information for public health actions. In this study, we present a first overview of the potential impacts of COVID-19 on some environmental matrices in Bogota, Colombia.

The purpose of the current study was directed to investigate the effectiveness of docosahexaenoic acid (DHA) as a chemopreventive agent on experimentally induced hamster buccal pouch (HBP) carcinogenesis; Material and methods: 40 Syrian male hamsters, five weeks old, were divided into 4 groups of 10 animals in each as follows, GI: Topical application of liquid paraffin alone (thrice a week for 14 weeks), GII: Topical application of 7, 12 dimethyl benz[a]anthracene (DMBA) alone (0.5 % in liquid paraffin, thrice a week for 14 weeks), GIII: Topical application of DMBA (0.5 % in liquid paraffin, thrice a week for 14 weeks) + Oral administration of DHA (125 mg/kg b.w. in 1 ml distilled water by oral gavage, thrice a week for 14 weeks on alternative days of DMBA application), GIV : Oral administration of DHA alone (125 mg/kg b.w. in 1 ml distilled water by oral gavage, thrice a week for 14 weeks); Results: Gross observations and histopathological findings revealed a-GI: normal stratified squamous epithelium b- GII: well and moderately differentiated squamous cell carcinoma (SCC) c-: GIII: showed variable results ranges from hyperkeratosis, hyperkeratosis and focal hyperplasia, mild dysplasia, and well differentiated SCC with superficial invasion of tumor cells not extended to deeper areas d: GIV: normal similar to GI. Immunohistochemical results revealed that oral DHA treatment to DMBA treated hamsters restored the normal expression of bcl-2; Conclusion: DHA has the potential to be a dietary chemopreventive agent due to its capacity to improve carcinogen detoxification and to block/suppress the initiation and promotion stages of experimentally produced HBP carcinogenesis.

Calcium dihydrogen phosphate monohydrate [Ca(H2PO4)2·H2O] (a fertilizer) was successfully synthesized by the recrystallization process by using a prepared triple superphosphate (TSP) that derived from oyster shell waste as starting material. This bio-green, eco-friendly process to produce an important fertilizer can promote a sustainable society. The shell-waste-derived TSP was dissolved in distilled water and kept at 30, 50, and 80 °C. Non-soluble powder and TSP solution were obtained. The TSP solution fraction were then dried and the recrystallized products (RCP30, RCP50, and RCP80) were obtained and confirmed as Ca(H2PO4)2·H2O. Whereas the non-soluble products (NSP30, NSP50, and NSP80) were observed as calcium hydrogen phosphate dihydrate (CaHPO4·2H2O). The recrystallized yields of RCP30, RCP50, and RCP80 were found to be 51.0%, 49.6%, and 46.3%, whereas the soluble percentages were 98.72%, 99.16%, and 96.63%, respectively. RCP30 shows different morphological plate sizes, while RCP50 and RCP80 present the coagulate crystal plates. X-ray diffractograms confirm the formation of both the NSP and RCP. The infrared adsorption spectra confirmed the vibrational characteristics of HPO42‒, H2PO4‒ and H2O existed in CaHPO4·2H2O and Ca(H2PO4)2·H2O. Three thermal dehydration steps of Ca(H2PO4)2·H2O (physisorbed water, polycondensation, and re-polycondensation) were observed. Ca(H2PO4)2 and CaH2P2O7 are the thermodecomposed products from the first and second steps, whereas the final product is CaP2O6.

Type 2 diabetes (T2D) is associated with increased cardiovascular morbidity, mortality, and hospital admissions. There is variability in clinical practice. The objectives are to analyze the variability in the control of Blood Pressure (BP), HbA1c, and LDL-C in T2D patients and its influence on admissions due to cardiovascular events (CVE) Methods: We analyzed the electronic records in Primary Care Health centers in Navarra (Spain) and hospital admission for CVE. We follow 480637 people from 2012 to 2016. We calculated indicators of control of patients with T2D for each year, percentage with: HbA1c &lt; 7%; HbA1c &gt;= 9%; BP &lt;140/90 mmHg; LDL-C &lt;100 mg/dl. We used logistic and Cox regression. Results: Patients in the best control GP practices cluster are 2.5 times more likely to have HbA1c &lt;7% [OR: 2.46 (95% CI: 2.29-3.64)]. Poor HbA1c control ≥ 9% is more likely in the worst control cluster [OR: 1.73 (95% CI:1.63-1.83)]. The probability of admission for CVE increases with age, being male, low income, obesity, history of CVE, having HbA1c ≥ 9%, and belonging to a GP practice in the cluster of HbA1C ≥ 9% worst control. In contrast, it decreases in patients with HbA1c &lt;7%, BP&lt;140/90 mmHg and LDL &lt;100 mg/dl.

The devastating impact of the ongoing coronavirus disease 2019 (COVID-19) on public health, caused by the Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) has made fighting of the COVID-19 pandemic is a top priority in medical research and pharmaceutical development. Surveillance of SARS-CoV-2 mutations is essential for the comprehension of SARS-CoV-2 variant diversity and their impact on virulence and pathogenicity. The SARS-CoV-2 open reading frame 10 (ORF10) protein interacts with multiple human proteins CUL2, ELOB, ELOC, MAP7D1, PPT1, RBX1, THTPA, TIMM8B, and ZYG11B expressed in the lung tissues. Mutations and co-mutations in the emerging SARS-CoV-2 ORF10 variants are expected to impact the severity of the virus and its associated consequences. In this article, We highlight 128 single mutations and 35 co-mutations in the unique SARS-CoV-2 ORF10 variants in this article. The possible predicted effects of these mutations and co-mutations on the secondary structure of ORF10 variants and host protein interactomes are presented. The findings highlight the possible effects of mutations and co-mutations on the emerging 140 ORF10 unique variants from secondary structure and intrinsic protein disorder perspectives.

Accurate early diagnosis of COVID-19 viral pneumonia, primarily in asymptomatic people is essential to reduce the spread of the disease, the burden on healthcare capacity, and the overall death rate. It is essential to design affordable and accessible solutions to distinguish pneumonia caused by COVID-19 from other types of pneumonia. In this work, we propose a reliable approach based on deep transfer learning that requires few computations and converges faster. Experimental results demonstrate that our proposed framework for transfer learning is a potential and effective approach to detect and diagnose types of pneumonia from chest X-ray images with a test accuracy of 94.0%.

(1) Background: Mouse-mammary tumor virus (MMTV) might play a role in the etiology of some breast cancers in humans. The purpose of our study was to identify MMTV DNA sequences in breast tissue samples from breast cancer patients operated in our regional center from Romania. (2) Methods: We have selected 75 patients with non-metastatic breast cancer treated with curative intent and searched with PCR the MMTV-like DNA sequence in the breast cancer tissue and normal breast tissue obtained from the same patients. (3) Results: None of the examined samples was positive for MMTV-like target sequences on PCR. (4) Conclusions: We could not prove that MMTV plays a role in the etiology of breast cancer in our patient group. This finding is similar to findings of other geographically related research groups and might be due to the fact that only the Mus musculus domesticus mouse species was proven to carry infectious MMTV, but not the Mus musculus musculus species, which is specific to South-Eastern Europe and some parts of Asia.

Several hypotheses have been presented on the origin of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) from its identification as the agent causing the current coronavirus disease 19 (COVID-19) pandemic. So far, no hypothesis has managed to identify the origin, and the issue has resurfaced. Here we have unfolded a pattern of distribution of several mutations in the SARS-CoV-2 proteins across different continents comprising 24 geo-locations. The results showed an evenly uneven distribution of unique protein variants, distinct mutations, unique frequency of common conserved residues, and mutational residues across the 24 geo-locations. Furthermore, ample mutations were identified in the evolutionarily conserved invariant regions in the SARS-CoV-2 proteins across almost all geo-locations we have considered. This pattern of mutations potentially breaches the law of evolutionary conserved functional units of the beta-coronavirus genus. These mutations may lead to several novel SARS-CoV-2 variants with a high degree of transmissibility and virulence. A thorough investigation on the origin and characteristics of SARS-CoV-2 needs to be conducted in the interest of science and to be prepared to meet the challenges of potential future pandemics.

It has been more than a year since the first case of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was found. This coronavirus has infected more than 110 million people worldwide by the end of February, 2021, and several virulent as well as more spreadable mutant forms of SARS-CoV-2 have emerged subsequently. In the latter group, three variants B.1.1.7, B.1.351, and P1 lineages, have been reported. Using computer simulation, the present paper investigates the structural differences between the wild type SARS-CoV-2 spike protein and its Asn501Tyr (N501Y) mutant variant. Time-based structural changes between the receptor binding domains of these two species are also examined. The N501Y mutation is common to all the three aforesaid mutant variants.

The Coronavirus 2 (SARS-CoV-2) infection is a global pandemic that has affected millions of people worldwide. The advent of vaccines, however, has permitted some restitution. Aside from the respiratory complications of the infection, there is also a thrombotic risk attributed to both the disease alongside the vaccine. There are no reliable data for the risk of thromboembolism in SARS-CoV-2 infection in patients managed out with the hospital setting. A literature review was performed to identify the pathophysiological mechanism of thrombosis from the SARS-CoV-2 infection including the role of Angiotensin-Converting Enzyme receptors. The impact of the vaccine and likely mechanisms from thrombosis following vaccination was also clarified. Finally, the utility of the vaccines available against the multiple variants is also highlighted. The systemic response to SARS-CoV-2 infection is still relatively poorly understood, but several risk factors have been identified. The roll-out of the vaccines worldwide has also allowed the lifting of lockdown measures and a reduction in the spread of the disease. The experience of the SARS-CoV-2 infection, however, has highlighted the crucial role of epidemiological research and the need for ongoing studies within this field.

Testing and isolation have been crucial for controlling the COVID-19 pandemic. Venezuela has one of the weakest testing infrastructures in Latin America and the low number of reported cases in the country has been attributed to substantial underreporting. However, the Venezuelan epidemic seems to have lagged behind other countries in the region, with most cases occurring within the capital region and four border states. Here, we describe the spatial epidemiology of COVID-19 in Venezuela and its relation to population mobility, migration patterns, non-pharmaceutical interventions and fuel availability. Using an SEI metapopulation model, we explore how movement patterns could have driven the observed distribution of cases. Low within-country connectivity most likely delayed the epidemic in most states, except for those bordering Colombia and Brazil where high immigration seeded outbreaks. NPIs slowed early epidemic growth and subsequent fuel shortages appeared to be responsible for limiting the spread of COVID-19 across the country.

COVID-19 is a contagious respiratory disease that is causing significant global morbidity and mortality. Understanding the impact of a SARS-CoV-2 infection on the host metabolism is still in its infancy but of great importance. Herein, we investigated the metabolic response during viral shedding and post-shedding in an asymptomatic SARS-CoV-2 ferret model (n=6) challenged with two SARS-CoV-2 isolates. Virological and metabolic analyses were performed on (minimally invasive) collected oral swabs, rectal swabs, and nasal washes. Fragments of SARS-CoV-2 RNA were only found in the nasal wash samples in four of the six ferrets, and in the samples collected 3 to 9 days post-infection (referred to as viral shedding). Central carbon metabolism metabolites were analyzed during viral shedding and post-shedding periods using a dynamic MRM (dMRM) database and method. Subsequent untargeted metabolomics and lipidomics of the same samples were performed using an LC-QToF-MS methodology, building upon the identified differentiated central carbon metabolism metabolites. Multivariate analysis of the acquired data identified 29 significant metabolites and three lipids that were subjected to pathway enrichment and impact analysis. The presence of viral shedding coincided with the challenge dose administered and significant changes in the citric acid cycle, purine metabolism, and pentose phosphate pathways, amongst others, in the host nasal wash samples. An elevated immune response in the host was also observed between the two isolates studied. These results support other reported metabolomic-based findings found in clinical observational studies and indicate the utility of metabolomics applied to ferrets for further COVID-19 research that advances early diagnosis of asymptomatic and mild clinical COVID-19 infections, in addition to assessing the effectiveness of new or re-purposed drug therapies.

This article analyses the environmental impact of the measures imposed during the SARS-CoV-2 pandemic. We compare the evolution of atmospheric pollution levels in recent years and during lockdown, and assess the effects of the decrease in mobility and changes in patterns and lifestyles during the latter period. Thus, the reduction in the risk to human health brought about by the improvement of air quality during the months of confinement through the use of dose-response functions is estimated. The focus of the case study is the island of Tenerife. The island of Tenerife has been selected because it can serve as an example for other sites in Europe. We distinguish between the three areas with the highest population concentrations: the Metropolitan, Southern, and Northern areas. The impacts of air pollution and its relationship with changes in consumption and activity patterns are clearly distinguishable. Therefore, the lessons learned can be easily extrapolated to other areas, in both island and mainland contexts.

In the context of the COVID-19 pandemic, thousands of healthcare workers (HCWs) infected with COVID-19 have lost their lives worldwide. At the early stage of the epidemic, when COVID-19 was still not considered as a pandemic, a large number of Chinese HCWs were infected. Officials reported that more than 3,000 HCWs in Hubei contracted the virus at the early stage of the outbreak due to limited knowledge of the virus. Following reports of overloaded local hospitals, more than 42,000 medical staff, including those from the military, were dispatched to Hubei from across the country. At the peak of the fight, one in 10 intensive care medics in China were working in Wuhan. During fighting against COVID-19 in China, although a large number of HCWs were infected by SARS-CoV-2 in the early stages of the epidemic, the timely adoption of measures indicated that, a faster rate of diagnosis could be achieved, patients were isolated in-time, HCWs’ safety was prioritized, training on basic protective knowledge and unified management of HCWs was strengthened, and effective protective measures were implemented. This resulted in the accomplishment of zero SARS-CoV-2 infection among the 42,632 members of the national medical teams sent to Hubei, and the number of COVID-19 cases among HCWs in local hospitals also significantly decreased, thereby indicating that hospital-acquired infections of SARS-CoV-2 among HCWs are fully preventable.

Water reuse for irrigation is increasingly recognized as an essential and economical strategy in areas with water scarcity. A simple, low-cost, low-maintenance, and highly efficient Pond-In-Pond (PIP) treatment system can be used for wastewater reuse. PIP is a treatment technology in which two types of ponds -- anaerobic and aerobic -- are combined into a single pond and consist of a deeper inner section entirely submerged within the outer pond. Previous studies on PIPs and PIP-like systems have reinforced the potential for reuse through promising performance results with BOD removal over 80% and a reduction in land area requirements by approximately 40%. Yet, no prior efforts have been made to understand the performance mechanism of such systems. This study makes use of two, 2-D modeling tools in developing a fundamental understanding of PIP flow dynamics and the expected performance. The modeling results showed that the PIP configuration offers improved flow diversion along with reduced flow velocity. Additionally, the PIP retained approximately 17% more (p<0.05) particles than the traditional pond with most of the particles concentrated within the inner pond. Lower velocity and the higher solids retention in the PIP thus allowed for better treatment performance compared to traditional ponds. The findings from this study can be used as preliminary data for future in-depth investigations of the PIP system leading toward effective and optimal designs. This will help address the major societal concern of water scarcity with low-cost and effective wastewater treatment.

Nowadays, the human population is facing the third and may be the worst pandemic caused by human coronaviruses (CoVs). The virus was first reported in Wuhan, China on 31 December 2019 and spread within short time to almost all countries of the world. Genome analysis of the early virus isolates has revealed high similarity with SARS-CoV and hence the new virus was officially named SARS-CoV-2. Since CoVs have the largest genome among all RNA viruses, they can adapt many point mutation and recombination events; particularly in spike gene, that enable these viruses to rapidly change and evolve in nature. CoVs are known to cross the species boundaries by using different cellular receptors. SARS-CoV-2 is believed to originate in bats and transmitted to human being through an ill-defined intermediate host. In the current review, different aspects of SARS-CoV-2 biology and pathogenicity are discussed including virus genetics and evolution, spike protein and its role in evolution and adaptation to novel hosts, and virus transmission and persistence in nature. In addition, the immune response developed during SARS-CoV-2 infection is demonstrated with special reference to the interplay between immune cells and their role in disease progression. We believe that SARS-CoV-2 outbreak will not be the last and spillover of CoVs from bats will continue. Therefore, establishing intervention approaches to reduce the likelihood of future CoVs spillover from the natural reservoirs is a priority.

Four new zoonotic coronaviruses outbreak occurred in the past two decades. The first coronavirus outbreak happened in 2003 and was named Severe Acute Respiratory Syndrome Coronavirus-1 (SARS-CoV-1), followed by Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in 2013, and by Swine Acute Diarrhoea Syndrome (SADS) in 2017. In late December 2019, a patient from Wuhan Seafood Wholesale Market, China, was admitted to Huang's hospital with respiratory distress syndrome (RDS) of apparently unknown etiology, which later was diagnosed with SARS-CoV-2-induced coronavirus disease-19 (COVID-19). SARS-CoV-2 was identified from another clade within the subgenus Sarbecovirus of the genus Betacoronavirus. This new CoV variant showed 96.2% similarity at whole-genome level to bat coronavirus. Based on genetic studies, pangolin, bats, and snakes are suspected to be a possible intermediate host of this virus, but further research is in progress to determine how this virus appeared and what is the exact source of infection. The SARS-CoV-2 outbreak has higher transmissibility, contagiosity and pathogenicity compared to that of SARS-CoV-1 and MERS-CoV. SARS-CoV-2 swiftly spread from continent to continent and is persistently causing a shocking global public health concern albeit the rate of infected cases and mortality is relatively decreasing over time. In this review, we provide an update on the origin, transmissibility, etiology, epidemiology, and evolution of COVID-19. We also highlight the current diagnostics, therapies, and prognostics for SARS-CoV-2. Eventually, we report and provide our humble opinion about the preventive strategies to control the ongoing related pandemic situation at global and individual levels, considering the international public health emergency and possible future epidemics and pandemics.

A signal analysis of the genoma sequenced of coronavirus variants: B.1.1.7, B.1.135, B.1.429-B.1.427, B.1.525 and P1 is presented. We deal with a certain type of finite alternating sum series having independently distributed terms associated with binary (0,1) indicators for the nucleotide bases A,C,G,T. This method provides additional information to conventional Similarity comparisons and Power Spectrum approaches. It leads to uncover distinctive patterns regarding the intrinsic data organization of genomic sequences according to its progression along the nucleotide bases position. Hence, the method could be useful for survelliance of genoma variants.

The novel coronavirus SARS-CoV-2 likely emerged from a wildlife source with transmission to humans followed by rapid geographic spread throughout the globe and severe impacts on both human health and the global economy. Since the onset of the pandemic, there have been many instances of human-to-animal transmission involving companion, farmed and zoo animals, and limited evidence for spread into free-living wildlife. The establishment of reservoirs of infection in wild animals would create significant challenges to infection control in humans and could pose a threat to the welfare and conservation status of wildlife. We discuss the potential for exposure, onward transmission and persistence of SARS-CoV-2 in an initial selection of wild mammals (bats, canids, felids, mustelids, great apes, rodents and cervids). Dynamic risk assessment and targeted surveillance are important tools for the early detection of infection in wildlife, and here we describe a framework for collating and synthesising emerging information to inform targeted surveillance for SARS-CoV-2 in wildlife. Surveillance efforts should be integrated with information from public and veterinary health initiatives to provide insights into the potential role of wild mammals in the epidemiology of SARS-CoV-2.

In this article, the geometry of pseudoparallel, Ricci-generalized pseudoparallel and 2-Ricci-generalized pseudoparallel invariant submanifolds of an almost $\alpha$-cosymplectic $(\kappa,\mu,\nu)$ space has been searched under the some conditions. We also give some characterizations for such submanifolds. I think that obtained new results contribute to differential geometry.

Abstract. The purpose of this review is to investigate the nature of privacy concerns in the context of Smart Local Energy Systems (SLES) to understand how SLES providers can minimize both users’ concern, and cause for concern, around privacy. We conducted a rapid realist review and thematic framework analysis against Bronfrenbrenner’s socio-ecological model to understand privacy concerns in different contexts. A common privacy concern was that sharing detailed energy use data had the potential to reveal information about home life, and to intrude upon people’s sense of autonomy, choice and control. Evidence suggests that people are willing to accept newdata sharing technologies if the benefits of doing so are clear, anticipated, and mutually beneficial. Building trust, through increasing knowledge and understanding was a mechanism for overcoming privacy concerns, but this was mediated by the organization providing the information. Non-profit organizations were more trusted to ensure appropriate safeguards to privacy were in place. One key barrier to participation with good supporting evidence was that people can resist perceived intrusions on their privacy. This could be actively resisted by refusing to install data collection technologies or passively by non-participation in adapting energy use behaviors: both of which are necessary for SLES to achieve their goals of managing energy demand and building resilience in smart grids.

The urgent need to improve performance in the construction industry has led to the adoption of many innovative technologies. 3D laser scanners are amongst the leading technologies being used to capture and process assets or construction project data for use in various applications. Due to its nascent nature, many questions are still unanswered about 3D laser scanning, which in turn contribute to the slow adaptation of the technology. Some of these include the role of 3D laser scanners in capturing and processing raw construction project data. How accurate is the 3D laser scanner or point cloud data? How does laser scanning fit with other wider emerging technologies such as Building Information Modelling (BIM)? This study adopts a proof-of-concept approach, which in addition to answering the afore-mentioned questions, illustrates the application of the technology in practice. The study finds that the quality of the data, commonly referred to as point cloud data is still a major issue as it depends on the distance between the target object and 3D laser scanner’s station. Additionally, the quality of the data is still very dependent on data file sizes and the computational power of the processing machine. Lastly, the connection between laser scanning and BIM approaches is still weak as what can be done with a point cloud data model in a BIM environment is still very limited. The aforementioned findings reinforce existing views on the use of 3D laser scanners in capturing and processing construction project data.

In December 2019, the novel severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) emerged in the province of Wuhan, China. Since then, it has spread worldwide with new mutations being reported. We performed genomic analysis to identify the changes in genetic diversity of SARS-CoV-2 between December 2019 and November 2020, and through molecular surveillance, we monitored the mutations that could be involved in viral fitness. We analyzed 2,213 complete genomes from 6 geographical regions worldwide, which were downloaded from GenBank and GISAID databases. Although SARS-CoV-2 presented low genetic diversity, there has been an increase over time, with the presence of several hotspot mutations throughout its genome. We identified 7 frequent mutations that resulted in non-synonymous substitutions (dN). Two of them, C14408T>P323L and A23403G>D614G, located in the nsp12 and Spike protein, respectively, emerged early in the pandemic and showed a considerable increase in frequency over time. Two other mutations, A1163T>I120F in nsp2 and G22992A>S477N in the Spike protein emerged recently and have spread in Oceania and Europe. Continuous molecular surveillance of SARS-CoV-2 will be necessary to detect and describe the transmission dynamics of new variants of the virus with clinical relevance. This information is important to improve programs to control the virus.

With data for SARS-CoV-2 and with many countries entering the second wave of contagion required the improvement of the forecasting model, structuring its model to forecast the peak of the first and second contagion wave in Brazil. The Model Estimation for SARS-CoV-2 Peak Contagion (MESPC) was structured, capable of estimating the peak of contagion for SARS-CoV-2 in the first and second waves, as the main objective of this work. Using the MESPC model, it was possible to estimate, with a certain reliability degree, the peak of contagion for the first and second waves in Brazil, with one day difference from the real to the forecast. It is possible to use MESPC to forecast the peak of contagion for several regions, provided that the necessary structure and calibration are respected.

Long-haul COVID-19 illness first gained widespread recognition among social support groups and later in scientific and medical communities. This illness is mysterious as it affects COVID-19 survivors at all levels of disease severity, even younger adults and children. While the precise definition may be lacking, the defining symptoms are fatigue, dyspnea, and headache that last for months after hospital discharge. The less typical symptoms may include cognitive impairments, chest and joint pains, myalgia, smell and taste dysfunctions, cough, mood changes, and gastrointestinal and cardiac issues. Presently, there is limited literature discussing the possible pathophysiology, risk factors, and treatments in long-haul COVID-19, which the current review aims to address. In brief, long-haul COVID-19 may be driven by long-term lung and brain damage and unresolved inflammation from multiple sources. The associated risk factors may include female sex, more than five early symptoms, early dyspnea, and specific biomarkers like D-dimer. While only rehabilitation training has been useful for long-haul COVID-19, therapeutics repurposed from mast cell activation syndrome, myalgic encephalomyelitis/chronic fatigue syndrome, and pulmonary fibrosis also hold potential. In sum, this review hopes to provide the current understanding of what is known about long-haul COVID-19.

Conventionally, eukaryotic mRNAs were thought to be monocistronic, leading to the translation of a single protein. However, large-scale proteomics has led to a massive identification of proteins translated from mRNAs of alternative ORF (AltORFs), in addition to the predicted proteins issued from the reference ORF or from ncRNAs. These alternative proteins (AltProts) are not represented in the conventional protein databases and this “Ghost proteome” was not considered until recently. Some of these proteins are functional and there is growing evidence that they are involved in central functions in physiological and physiopathological context. Based on our experience with AltProts we have got interested in finding out their involvement in development of the SARS-CoV-2 virus, responsible for the 2020 Covid-19 outbreak. Thus, we have scrutinized the recently published data by Krogan and coworkers (2020) on the SARS-CoV-2 interactome with host cells by co-IP in the perspective of drug repurposing. The initial work has revealed the interaction between 332 human cellular RefProts with the 27 viral proteins. Re-interrogation of this data using 23 viral targets and including AltProts, followed by enrichment of the interaction networks, leads to identify 218 RefProts (in common to initial study) plus 56 AltProts involved in 93 interactions. This demonstrates the necessity to take into account the Ghost proteome for discovering new therapeutic targets and establish new therapeutic strategies. Missing the ghost proteome in the drug metabolism and pharmacokinetic (DMPK) drug development pipeline will certainly be a major limitation to the establishment of efficient therapies.

Aims: Angiotensin-converting enzyme 2 (ACE2) plays an important role in the entry of coronaviruses into host cells. This paper described how carnosine, a naturally occurring supplement, can be an effective drug candidate for coronavirus disease (COVID-19) on the basis of molecular docking and modeling to host ACE2 co-crystallized with COVID-19 spike protein. Methods: First, the starting point was ACE2 inhibitors and their structure-activity relationship (SAR). Next, chemical similarity (or diversity) and PubMed searches made it possible to repurpose and assess approved or experimental drugs for COVID-19. In parallel, at all stages, authors performed bioactivity scoring to assess potential repurposed inhibitors at ACE2. Finally, investigators performed molecular docking and modeling of the identified drug candidate to host ACE2 co-crystallized with COVID-19 spike protein. Results: Carnosine emerged as the best known drug candidate to match ACE2 inhibitor structure. Preliminary docking was more optimal to ACE2 than the known typical angiotensin-converting enzyme 1 (ACE1) inhibitor (enalapril) and quite comparable to known or presumed ACE2 inhibitors. Viral spike protein elements binding to ACE2 were retained in the best carnosine pose in SwissDock at 1.75 Angstroms. Out of the three main areas of attachment expected to the co-crystallized protein structure, carnosine bind with higher affinity to two compared to the known ACE2 active site. LibDock score was 92.40 for site 3, 90.88 for site 1, and inside the active site 85.49. Conclusion: Carnosine has promising inhibitory interactions with host ACE2 co-crystallized with COVID-19 spike protein and hence could offer potential mitigating effect against current COVID-19 pandemic.

The COVID-19 pandemic has wreaked havoc on the whole world, taking over half a million lives and capsizing the world economy in unprecedented magnitudes. With the world scampering for a vaccine, early detection and containment is the only redress. Existing diagnostic technologies with high accuracy like RT-PCRs are expensive and sophisticated, requiring skilled individuals for specimen collection and screening, resulting in lower outreach. So, methods excluding direct human intervention are much sought after, and artificial intelligence-driven automated diagnosis, especially with radiography images, captured the researchers' interest. This survey marks a detailed inspection of the deep-learning-based automated detection of COVID-19 works done to date, a comparison of the available datasets, methodical challenges like imbalanced datasets, and others, along with probable solutions with different pre-processing methods, and scopes of future exploration in this arena. We also benchmarked the performance of 315 deep models in diagnosing COVID-19, Normal, and Pneumonia from x-ray images of a custom dataset created from four others. The dataset is publicly available at https://github.com/rgbnihal2/COVID-19-X-ray-Dataset. Our results show that DenseNet201 model with Quadratic SVM classifier performs the best (accuracy: 98.16%, sensitivity: 98.93%, specificity: 98.77%) and maintains high accuracies in other similar architectures as well. This proves that even though radiography images might not be conclusive for radiologists, but it is so for deep learning algorithms for detecting COVID-19. We hope this extensive review will provide a comprehensive guideline for researchers in this field.

Background: Understanding SARS-CoV-2 dynamics and transmission is a serious issue. Its propagation needs to be modeled and controlled. The Alsace region in the East of France has been among the first French COVID-19 clusters in 2020. Methods: We confront evidence from three independent and retrospective sources: a population-based survey through internet, an analysis of the medical records from hospital emergency care services, and a review of medical biology laboratory data. We also check the role played in virus propagation by a large religious meeting that gathered over 2,000 participants from all over France mid-February in Mulhouse. Results: Our results suggest that SARS-CoV-2 was circulating several weeks before the first officially recognized case in Alsace on February 26^th 2020 and the sanitary alert on March 3^rd. The religious gathering seems to have played a role for secondary dissemination of the epidemic in France, but not in creating the local outbreak. Conclusions: Our results illustrate how the integration of data coming from multiple sources could help trigger an early alarm in the context of an emerging disease. Good information data systems, able to produce earlier alerts, could have avoided a general lockdown in France.

Many of the wide-ranging symptoms of COVID-19 have not been associated previously with a respiratory illness. A similarity between these atypical symptoms and the symptoms of malnutrition was observed. To investigate, a comparison of COVID-19 symptomatology with recognised states of malnutrition showed a significant relationship that was further explored in a review of the literature. This hypothesis links the atypical symptoms to the effects of increasing protein malnutrition. The rapid appearance of malnutrition symptoms at the beginning of the COVID-19 infection is concurrent with the rapid cell proliferation of the immune system. Although previous work has, in general, assumed that the body is capable of providing for the needs of the immune system during infection, heightened immune activity from the commencement of COVID-19 could require an early increase in energy yielding sources. Should insufficient availability of protein resources occur, this could quickly lead to malnutrition. Any continuing insufficiency, during the active phase of the virus, might result in widespread depletions in the tissues and the consequential malfunctioning of many organs. A new appraisal of the immune system requirements needed to counteract the impact of the novel virus, COVID-19, could show the potential benefit for earlier protein intervention in the disease process. This hypothesis could also have relevance for other life situations where a rapid cell proliferation might occur.

Background: Dental professions are at high risk of contracting novel corona virus (COVID-19) infections during the dental procedure due to the droplets and aerosols generated during various dental procedures on infected patients. To prevent and avoid the cross-infection of the infection to dental professionals or the patients attending the dental clinic, good knowledge of the infection and its prevention mechanisms is mandatory among the professionals. Until to date, there is no pooled estimate on the knowledge,attitude and practice (KAP) of dental professionals to COVID-19 in the globe. Hence, this study aimed to determine the pooled estimate of KAP of dental professionals in this pandemic disease. Methods: Article search was done electronically using Medline, Scopus, Web of Science, EMBASE, SciELO and Google Scholar from June 1, 2020 to August 20, 2020. All studies that assessed the KAP of dental professionals to COVID-19 were searched and included in this review after passing the inclusion criteria. The pooled analysis of their knowledge (sign and symptom, mode of transmission and prevention mechanisms), attitude (their concern, intention to treat suspected patients) and practice (face mask usage, hand washing and alcohol based hand rub usage, handshaking practice, deferred procedures and checkup of patients temperature) was computed using RevMan 5.3 and random effect model was used. The presence of publication bias was assessed using the funnel plot. Results: Twelve articles with a total of 5,362 study participants were included in this study. The pooled estimate revealed that 59.91% of the dental professionals had good knowledge of the signs and symptoms of COVID-19. Two-third of dental professionals know the prevention mechanisms of the infection, and 70.13% had enough knowledge of the transmission modalities of the infection. The professional attitude revealed that only 36.43% of the participants had intention to treat a patient with cough or suspected COVID-19 (36.43%, 95%CI: 8.57, 64.29). Moreover, 47.85% of the dentists were concerned about their life, and the fate of their profession due to this pandemic disease (47.85%, 95%CI: 26.74, 68.97). The pooled analysis showed only 50.86% (95%CI: 18.64, 83.09) of the study participants worn face mask and 52.63% (95%CI: 10.54, 94.71) had avoided handshaking practice during this pandemic period. Non-emergency dental procedures were canceled by 83.98%. Conclusion: The dental professional KAP is not optimal. Thus, dental professionals should be aware of the recently updated knowledge about COVID-19 and practice according to the standards of treatment guidelines, and the recommended infection control measures in dental settings. Moreover, as saliva and droplets are the major sources of infection, dentists should follow essential protocols to regulate droplet and aerosol contamination in the dental practice

The regioselectivity in non-polar [3+2] cycloaddition (32CA) reactions has been studied within the Molecular Electron Density Theory (MEDT) at the B3LYP/6-311G(d,p) level. To this end, the 32CA reactions of nine simplest three-atom-components (TACs) with 2-methylpropane were selected. The electronic structure of the reagents has been characterised through the Electron Localisation Function (ELF) and the Conceptual DFT. The energy profiles of the two regioisomeric reaction paths and ELF of the transition state structures are studied to understand the origin of the regioselectivity in these 32CA reactions. This MEDT study permits to conclude that the least electronegative ends X1 atom of these TACs controls the asynchronicity in the C-X (X = C,N,O) single bond formation, and consequently, the regioselectivity. This behaviour is a consequence of the fact that the creation of the non-bonding electron density required for the formation of the new CX single bonds has a lesser energetic cost at the least electronegative X1 atom than that at the Z3 one.

A COVID-19 disease threatens the population and the economies of the countries significantly. Till now, this pandemic has affected 215 counties or territories. Unavailability of vaccine is the primary concern for the society. To avoid the spread of this disease, social isolation must be preserved and the inter and intra-population movement must be minimized. To reduce the possibility of transmission, the categorization of regions based on susceptibility to COVID-19 infection is a must.Due to the unavailability of a large amount of paper collection for this novel COVID-19 diseases, we used current literature available on a COVID-19 susceptibility of the diabetic patient, human reproductivity, hemodialysis patient’s, pregnant women and meteorological factors and geographical location. Countries in the cold region are more susceptible to the risk of COVID-19 transmission. There was no evidence of the spread of this disease from non-respiratory bodies. Diabetic patients and pregnant women were found to be more susceptible to COVID-19 infection. Anosmia was observed in the majority of the COVID-19 infected cases in European countries. No evidence indicates COVID-19's impact on the human reproductive system explicitly. No cases of vertical transmission of this disease have been observed until now. All the studies available till now is the small scale study. Correlation with something always does not mean causation. There are certain factor like pollution level, temperature Diurnal temperature range, geographical factor, humidity, pollution level, wind speed, population density, medical healthcare facilities social and political factor plays a critical role in transmitting the SARS-COV-2 virus. Besides the adverse effects, it has taught us to shed our selfish goals and to promote the welfare of all.

Sun-Induced chlorophyll Fluorescence (SIF) relates directly to photosynthesis yield and stress but there are still uncertainties in its interpretation. Most of these uncertainties concern the influences of the emitting vegetation’s structure (e.g., leaf angles, leaf clumping) and biochemistry (e.g., chlorophyll content, other pigments) on the radiative transfer of fluorescent photons. The Caatinga is a large region at northeast Brazil of semiarid climate and heterogeneous vegetation, where such biochemical and structural characteristics can vary greatly even within a single hectare. With this study we aimed to characterize eleven years of SIF seasonal variation from Caatinga vegetation (2007 to 2017) and to study its responses to a major drought in 2012. Orbital SIF data from the instrument GOME-2 was used along with MODIS MAIAC EVI and NDVI. Environmental data included precipitation rate (TRMM), surface temperature (MODIS) and soil moisture (ESA CCI). To support the interpretation of SIF responses we have used red and far-red SIF adjusted by the Sun’s zenith angle (SIF-SZA) and by daily Photosynthetically Active Radiation (dSIF). Furthermore, we have also adjusted SIF through two contrasting formulations using NDVI data as proxy for structure and biochemistry, based on previous leaf-level and landscape level studies: SIF-Yield and SIF-Prod. Data was tested with time-series decomposition, rank correlation, spatial correlation and Linear Mixed Models (LMM). Results show that GOME-2 SIF and adjusted SIF formulations responded consistently to the observed environmental variation and showed a marked decrease in SIF emissions in response to a 2012 drought, that was generally larger than the corresponding NDVI and EVI decreases. Drought sensitivity of SIF, as inferred from LMM slopes, was correlated to land cover at different regions of the Caatinga. This is the first study to show correlation between landscape-level SIF and an emergent property of ecosystems (i.e., resilience), showcasing the value of remotely sensed fluorescence for ecological studies.

Anti-diabetic effects of Glycine soja seed extract (GS) on Type 2 diabetes mellitus mouse model and human hepatocytes induced insulin resistance were investigated. 3 weeks old db/db mice were divided into 5 groups (n = 6) including two control groups and 3 GS treated groups with different doses. Oral administration of GS for 6 weeks to diabetic db/db mice reduced blood glucose level significantly in a dose dependent manner by 44.7% (300 mg/kg/day), 30.9% (150 mg/kg/day) and 21.1% (75 mg/kg/day). GS treatment also lowered significantly plasma level of HbA1c, insulin, IGF-1 and leptin, and increased that of adiponectin. GS treatment activated AMPK, and down-regulated GLUT2 in liver tissues of mice while up-regulated GLUT4 in muscle tissues of mice. In in vitro study with insulin resistance induced human hepatocyte, GS treatment increased glucose uptake and increased the activities of Akt and PPAR-γ in response to insulin. Treatment of GS appears to reduce blood glucose level by regulating energy metabolism positively through various metabolic pathways and reducing insulin resistance in Type 2 diabetes mellitus.

Anti-diabetic effects of Glycine soja seed extract (GS) on Type 2 diabetes mellitus mouse model and human hepatocytes induced insulin resistance were investigated. 3 weeks old db/db mice were divided into 5 groups (n = 6) including two control groups and 3 GS treated groups with different doses. Oral administration of GS for 6 weeks to diabetic db/db mice reduced blood glucose level significantly in a dose dependent manner by 44.7% (300 mg/kg/day), 30.9% (150 mg/kg/day) and 21.1% (75 mg/kg/day). GS treatment also lowered significantly plasma level of HbA1c, insulin, IGF-1 and leptin, and increased that of adiponectin. GS treatment activated AMPK, and down-regulated GLUT2 in liver tissues of mice while up-regulated GLUT4 in muscle tissues of mice. In in vitro study with insulin resistance induced human hepatocyte, GS treatment increased glucose uptake and increased the activities of Akt and PPAR-γ in response to insulin. Treatment of GS appears to reduce blood glucose level by regulating energy metabolism positively through various metabolic pathways and reducing insulin resistance in Type 2 diabetes mellitus.

Celecoxib as adjuvant therapy has been shown in a small randomized trial for Covid-19 to prevent clinical deterioration and rapidly improve thoracic computerized axial tomography (CT-chest)¹. Multiple descriptive trials of high dose famotidine (both inpatient and outpatient) have demonstrated clinical response^2,3,4. We describe the rapid clinical responses after increasing the celecoxib dosage to 400mg bid with high dose famotidine 80mg qid in both a critical inpatient who on baseline required 40 liters per minute high flow nasal insufflation and an outpatient who declined admission but had critical Covid-19 biomarkers.

Western Anatolia comprises a vast amount of various volcanic successions spanning from Eocene to Upper Miocene periods. These units mainly display southward younging in broad sense and display large amounts of chemical variation that spanned from basalt to rhyolite. The southward younging of magmatism and chemical variations have been largely attributed to the retreat and roll-back of the Hellenic slab and the western escape of the Anatolian microplate. However, there is still a lack of high precision data to pinpoint the exact nature of the magmatism and lithospheric tectonics. In this contribution we investigated a poorly known region along the Western Anatolia along Manisa district called Karakılıçlı volcanic field. We investigated two different volcanic sections (Kalpakkaya and Çamlık hill) that display the best volcano-sedimentary features in terms of geochronology and geochemistry. Samples acquired from the bottom, middle and upper portions of these sections display Early-Middle Miocene ages of 17.64±0.20, 17.22±0.15, 16.16±0.17 and 16.36±0.13, 15.79±0.71 and 13.61±0.20 Ma respectively. The results indicate that the volcanism in the region generated by the melting of the mantle and/or lithospheric mantle by slab retreat and roll-back of the Hellenic slab and evolved in the shallow magma chambers/mushes by fractional crystallization, magma mixing and crustal assimilation.

The coronavirus disease 2019 (COVID-19) is now a global pandemic caused by the new severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Unlike other known coronaviruses, such as the Middle East respiratory syndrome coronavirus (MERS-CoV), SARS-CoV-2 reveals new clinical, immunological, and pathologic features. The lymphocyte depletion, macrophage and neutrophil hyperactivation, cytokine dysregulation, thrombophilia, delayed antiviral response, and immune exhaustion are key immunological findings linked to the clinical progression of this disease. Understanding and identifying the underlying immunological basis of COVID-19 is crucial to designing effective therapies. Here, we provide an overview of immunopathogenesis driven by SARS-CoV-2 after its interactions with the immune system.

Accurate and timely testing has become an essential measure in combatting the COVID-19 global pandemic. Currently, polymerase chain reaction (PCR) based assays are the most relied on methods for SARS-CoV-2 detection. This traditional workflow involves a viral RNA extraction from the viral transport media storing nasopharyngeal swabs collected from patients, followed by PCR based detection. While accurate, this methodology is time consuming and resource heavy, causing for delays in receiving results or limited access to testing. Herein, we demonstrate a validated method for SARS-CoV-2 detection from viral transport media using a two-step, direct-to-PCR workflow revolving around shaker-mill homogenization. This method completely bypasses the extraction steps of the traditional workflow, replacing it with 30 seconds of mechanical disruption sufficient to allow for COVID-19 detection with a 96.43% sensitivity and 100% specificity when compared to traditional extraction to PCR based methods.

COVID-19 pandemic in first seven months has led to more than 15 million confirmed infected cases and 600,000 deaths. SARS-CoV-2, the causative agent for COVID-19 has proved a great challenge for its ability to spread in asymptomatic stages and a diverse disease spectrum it has generated. This has created a challenge of unimaginable magnitude not only affecting human health and life but also potentially generating a long-lasting socioeconomic impact. Both medical sciences and biomedical research have also been challenged consequently leading to a large number of clinical trials and vaccine initiatives. While known proteins of pathobiological importance are targets for these therapeutic approaches, it is imperative to explore other factors of viral significance. Accessory proteins are one such trait that have diverse roles in coronavirus pathobiology. Here we analyze certain genomic characteristics of SARS-CoV-2 accessory protein ORF8, predict upon its protein features and review current available literature regarding its function. We have also undertaken review of ORF8 homolog ORF8ab from SARS-CoV with a purpose of developing holistic understanding of these proteins for reason that coronaviruses have been infecting humans repeatedly and might continue to do so. Despite low nucleotide and protein identity and differentiating genome level characteristics, there appears to be significant structural integrity and functional proximity between these proteins pointing towards their high significance. There is further need for comprehensive genomics and structural-functional studies to lead towards definitive conclusions regarding their criticality and that can eventually define their relevance to therapeutics development.

Background: To prioritize the development of antiviral compounds, it is necessary to compare their relative preclinical activity and clinical efficacy. Methods: We reviewed in vitro, animal model, and clinical studies of candidate anti-coronavirus compounds and placed extracted data in an online relational database. Results: As of July 2020, the Coronavirus Antiviral Research Database (CoV-RDB; covdb.stanford.edu) contained &gt;2,400 cell culture, entry assay and biochemical experiments, 240 animal model studies, and 56 clinical studies from &gt;300 published papers. SARS-CoV-2, SARS-CoV, and MERS-CoV account for approximately 85% of the data. Approximately 75% of experiments involved compounds with a known or likely mechanism of action, including receptor binding inhibitors and monoclonal antibodies (20%); viral protease inhibitors (18%); polymerase inhibitors (9%); interferons (8%); fusion inhibitors (8%); host endosomal trafficking inhibitors (7%); and host protease inhibitors (5%). For 724 compounds with a known or likely mechanism, 95 (13%) are licensed in the US for other indications, 72 (10%) are licensed outside the US or are in human trials, and 557 (77%) are pre-clinical investigational compounds. Conclusion: CoV-RDB facilitates comparisons between different candidate antiviral compounds, thereby helping scientists, clinical investigators, public health officials, and funding agencies prioritize the most promising compounds and repurposed drugs for further development.

Objective: To examine the burnout syndrome among the healthcare personnel in Puerto Rico during the COVID-19 pandemic. Methods: Descriptive study that pursues to understand burnout syndrome in the clinical personnel in Puerto Rico. The Maslach Burnout Inventory (MBI) was sent via email to healthcare professionals around the island. Furthermore, open questions were asked to the participants. Results: The overall burnout level on the clinical personnel was found to be moderate. Nonetheless, in physicians, 12.1% had severe burnout levels compared to a 13.1% score in nurses. Additionally, 92.4% of physicians and 100% of nurses had moderate to severe burnout. In the three subscales, nurses scored high levels in all of them, and physicians were high in Emotional Exhaustion and moderate level in Depersonalization and Personal Accomplishment at Work. There were high levels of burnout syndrome of the clinical personnel in Puerto Rico. Conclusion: Since the beginning of the COVID-19 pandemic, over 90% of healthcare professionals in Puerto Rico have been working with moderate to severe burnout syndrome, being the nurses the most affected. Key Words: Burnout syndrome, MBI, Clinical personnel, COVID-19, SARS-CoV-2

Since the outbreak of the COVID-19 (Coronavirus Disease 19) pandemic, researchers have been trying to investigate several active compounds found in plants that have the potential to inhibit the proliferation of SARS-CoV-2 (Severe acute respiratory syndrome coronavirus 2). The present study aimed to evaluate bioactive compounds found in plants by using a molecular docking approach to inhibit the Main Protease (M^pro) and Spike (S) glycoprotein of SARS-CoV-2. The evaluation was performed on the docking scores calculated using AutoDock Vina as a docking engine. A rule of five (RO5) was calculated to determine whether a compound meets the criteria as an active drug orally in humans. The determination of the docking score was done by selecting the best conformation of the protein-ligand complex that had the highest affinity (most negative Gibbs' free energy of binding / ΔG). As a comparison, nelfinavir (an antiretroviral drug), chloroquine and hydroxychloroquine sulfate (anti-malarial drugs recommended by the FDA as emergency drugs) were used. The results showed that hesperidin, nabiximols, pectolinarin, epigallocatechin gallate, and rhoifolin had better poses than nelfinavir, chloroquine, and hydroxychloroquine sulfate as spike glycoprotein inhibitors. Hesperidin, rhoifolin, pectolinarin, and nabiximols had about the same pose as nelfinavir, but were better than chloroquine and hydroxychloroquine sulfate as M^pro inhibitors. These plant compounds have the potential to be developed as specific therapeutic agents against COVID-19. Several natural compounds of plants evaluated in this study showed better binding free energy compared to nelfinavir, chloroquine, and hydroxychloroquine sulfate which so far are recommended in the treatment of COVID-19. As judged by the RO5 and previous study by others, the compounds kaempferol, herbacetin, eugenol, and 6-shogaol have good oral bioavailability, so they are also seen as promising candidates for the development lead compounds to treat infections caused by SARS-CoV-2.

In this paper, a solenoid based linearly movable armature system is designed using robust control theory in order to improve the performance of the system. Reference track method is the best performance analysis for position control systems. Among the robust controllers, H infinity mixed-sensitivity and Mixed H 2 /H∞ with Regional Pole Placement Controllers are used to improve the performance of the system. Comparison of the proposed controllers for tracking a reference displacement signals (step and sine wave) and a promising simulation result have been obtained.