To mitigate the COVID-19 infection, many world governments endorsed the cessation of non-essential activities, such as the school attendance. Thereby, forcing the evolution of the teaching model to the virtual classroom. In the present work we show the application of a modified version of the adapted COVID-19 stress scales (ACSS) which also included teaching anxiety and preparedness, and resilience for academic professionals in Mexico, during the unprecedented transformation of the education system undergone in the COVID-19 quarantine. Most of the studied variables: gender, age, academic degree, household occupants, having a disease, teaching level, teaching mode, work hours, resilience, teaching anxiety and preparedness, and fear of being an asymptomatic patient (FOBAP), showed significant statistical correlation between each other (p<0.050) and to the 6 areas of the ACSS (danger, contamination, social economical, xenophobia, traumatic stress and compulsive checking). Our results further showed that the perceived stress and anxiety, fell into the category of absent to mild with only the danger section of the ACSS falling into the moderate category. Finally, resilience generated throughout the quarantine, seems to be a predictor of the adaptation the academic professional has undergone to cope with stress.

Drought is one of the major stress factors affecting growth and development of plants. In this context, drought-related losses of crop plant productivity impede sustainable agriculture all over the world. In general, plants responses to water deficit by multiple physiological and metabolic adaptations at the molecular, cellular and organism levels. To understand the underlying mechanisms of drought tolerance, adequate stress models and arrays of reliable stress markers are required. Therefore, in this review we comprehensively address currently available models of drought stress, based on culturing plants in soil, hydroponic or agar culture. These experimental setups give access to different aspects of plant response to drought, like decrease of tissue water potential, reduction of stomata conductance and photosynthesis efficiency, accumulation of low-molecular weight solutes (metabolic adjustment) and drought protective proteins. Till now, this pattern of markers was successfully extended to the methods of enzyme chemistry, molecular biology and omics techniques. Thus, conventional tests can be efficiently complemented by determination of phytohormone and reactive oxygen species (ROS) contents, activities of antioxidant enzymes, as well as comprehensive profiling of transcriptome, proteome and metabolome.

This study examines the feasibility of using event-related potentials (ERPs) obtained from electroencephalographic (EEG) recordings as biomarkers for long-term memory item classification. Previous studies have identified old/new effects in memory paradigms associated with explicit long-term memory and familiarity. Recent advancements in convolutional neural networks (CNNs) have enabled the classification of ERP trials under different conditions and identification of features related to neural processes at the single-trial level. We employed this approach to compare three CNN models with distinct architectures using experimental data. Participants (N = 25) performed an association memory task while recording ERPs that were used for training and validation of the CNN models. The EEGNET-based model achieved the most reliable performance in terms of precision, recall, and specificity compared with the shallow and deep convolutional approaches. The classification accuracy of this model reached 70% for known items and 62% for unknown items. Good overall accuracy requires a trade-off between recall and specificity and depends on the architecture of the model and the dataset size. These results suggest the possibility of integrating ERP and CNN into online learning tools and identifying the underlying processes related to long-term memorization.

Recent research has highlighted associations between sleep and microbial taxa and pathways. However, the causal effect of these associations remains unknown. To investigate this, we performed a two-sample bidirectional Mendelian randomization (MR) analysis using summary statistics of genome-wide association studies (GWAS) from 412 gut microbiome traits (N = 7,738) and GWAS studies from seven sleep-associated traits (N = 345,552 to 386577). We employed multiple MR methods to assess causality, with Inverse Variance Weighted (IVW) as the primary method. We further applied Cochran’s Q statistical analysis, MR-Egger intercept, and MR-PRESSO for heterogeneity and pleiotropy assessment, alongside a Bonferroni correction ((P

The growth of the wind power sector has been marked by environmental, economic, and political drivers. Its starring role is also visible in the emergence of the so-called “green jobs”. Notwithstanding, its evolution ought not to compromise issues related to occupational risks. This exploratory study examines psychosocial risks in the operation and maintenance of onshore wind turbines in a leading Portuguese company. We conducted interviews with main stakeholders (Human Resources, OHS professionals, and team leaders); developed an “activity diary” for the operation and maintenance technicians to describe their activity and perceived impacts on health, complemented with collective interviews; and applied the Work and Health Survey. The results revealed particular risks and health impacts: working under adverse weather conditions; working at heights and in confined spaces; spending long work hours inside of the nacelles to achieve an optimum balance between favorable wind slots to intervene and avoiding additional trips up and down the wind turbines without lifts (70m-120m); and the feeling of early ageing. At a time when these workers are striving for recognition of their profession as a “rapid wear profession”, it is a key moment to discuss these results to guarantee sustainable conditions for future generations of workers.

Electroencephalography (EEG) enabled earbuds represent a promising frontier in evaluating brain activity beyond traditional laboratory settings. However, these devices need more comprehensive characterization before widespread health related usage. A toolbox was developed to facilitate and expand the assessment of ear-EEG devices. The first component of this toolbox is a desktop application (“EaR-P Lab”) that integrates EEG validation paradigms. This application is designed to be used with EEG amplifiers compatible with the Lab Streaming Layer (LSL) protocol. The second element of the toolbox introduces an adaptation of the phantom testing concept, to the domain of ear-EEG by using 3D ear scans of the tested individuals, allowing controlled assessment of ear-EEG devices. The EEG paradigms were validated for scalp acquisitions and applied on ear-EEG measurements, under wet ear electrode conditions. The ear-EEG phantom was successful in measuring useful metrics in EEG system characterization, highlighting performance differences within the electrodes on the tested earpieces. This knowledge was factored in to select an optimal electrode reference which resulted in increased response power on the auditory steady-state response (ASSR). Through this work, an ear-EEG evaluation toolkit is made available with the intention to enable future and systematic assessment of novel ear-EEG devices from the hardware to the neural signals.

Better understanding of the quality of life among nursing home residents with dementia is im-portant for developing interventions. The objectives of this cross-sectional study were to examine factors associated with poor health-related quality of life in older adults with dementia living in nursing homes in Hanoi, Vietnam. In-person interviews were conducted with 140 adults 60 years and older with dementia and information about their quality of life was obtained using the Quality of Life in Alzheimer’s Disease scale (QOL-AD). A number of sociodemographic and clinical factors associated with poor health-related quality of life (lowest tertile) were assessed through the results of physical tests, interviews with nursing home staff, and review of medical records. The average age of the study sample was 78.3 years, 65% were women, and their av-erage QOL-AD total score was 27.3 (SD = 4.4). Malnutrition, total dependence in activities of daily living, and urinary incontinence were associated with poor quality of life after controlling for multiple potentially confounding factors. Our findings show that Vietnamese nursing home residents with dementia have a moderate quality of life and interventions based on comprehen-sive geriatric assessment remain needed to modify risk factors associated with poor health-related quality of life.

The world is facing an energy crisis. Governments are seeking to provide universal energy access and guarantee energy security while trying to mitigate climate change. One possible solution is energy transitions towards low carbon energy systems. Among other things (physical infrastructure, public policy and regulatory enablers and knowledge and capacities) changes in the energy systems require a well informed and participative citizenship. Within this context the concept of energy literacy appears. Energy literacy is the understanding of how energy is generated, transported, stored, distributed and used, awareness about its environmental and social impacts and the knowledge to use it efficiently in the different sectors of the economy. This paper provides a systematic literature review in the Web of Science’s Core Collection. Most of the work done around energy literacy addresses its evaluation among different groups, particularly students at different levels, and the construction, application and evaluation of tools for improving energy literacy. Other frequently studied issues are the influence of energy literacy in decision making, its drivers and conceptual research about the topic. Energy enables citizens to effectively contribute to energy efficiency and sustainable development, nevertheless energy literacy is not strongly correlated to energy consumption habits.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

The durability of ecological concrete in a marine environment was studied. Specimens of a six-year-old submerged ecological concrete from a breakwater located in the East Mediterranean sea were analyzed for their biological carbonate deposition cover, chloride effective diffusion, carbonation, and mineralogy. About 57% of the surface was found to be covered by biogenic-deposited carbonates. The effective chloride diffusion coefficient and the carbonation rate were found to be reduced proportionally to the biogenic-carbonate cover. Most of the aluminates were found in non-crystalline minerals. No evidence of a sulfate attack was found.

In northern Thailand, the problem of small particulate matter happens every year, with the pri-mary source being agricultural weed burning and wildfire. The tourism industry is strongly impacted and has been the spotlight for the past few years. Thus, the study aims to investigate the effect of small particulate matter on tourism and related SMEs in Chiang Mai, Thailand. The data was collected from 286 entrepreneurs in the tourism and related SMEs sectors. The data was analyzed using data mining and association rule techniques. The study revealed that small particulate matter has a considerable impact on customer factors, especially the number of customers has decreased. Operational factors and prod-uct/service factors are also affected by the dust in the form of adjustments to keep the business running and the protection of the health of employees and customers. Certainly, financial factors are affected by the small particulate matter situation, both lower revenues and higher costs.

The combination of statistical learning technologies with large databases of psychophysiological data has appropriately generated enthusiastic interest in future clinical applicability. It is argued here that this enthusiasm should be tempered with the understanding that significant obstacles must be overcome before the systematic introduction of psychophysiological measures into neuropsychiatric practice becomes possible. The nonspecificity of psychophysiological measures complicates their use in diagnosis. Low test-retest reliability complicates use in longitudinal assessment, and quantitative psychophysiological measures can normalize in response to placebo intervention. Ten cautionary observations are introduced and, in some instances, possible directions for remediation are suggested.

Abstract Background The number of immune-related endocrine dysfunctions (irEDs) has concurrently increased with the widespread use of immunotherapy in clinical practice and further expansion of the approved indications for immune checkpoint inhibitor (ICI) combinations using different modalities of anti-cancer treatment. Method A retrospective analysis was conducted on consecutive patients >18 years of age with advanced solid malignancies who had received at least one dose of anti-programmed cell death protein 1 (anti-PD-1) and/or anti-CTLA4 antibodies between January 2014 and December 2019 at a Hong Kong university hospital. Patients were reviewed for up to two months after the last administration of an ICI. The types, onset times and grades of irEDs, including hypothyroidism, hyperthyroidism, adrenal insufficiency and immune-related diabetes mellitus, were recorded. Factors associated with irEDs were identified using multivariate analysis. Result A total of 953 patients (male: 603, 64.0%; median age: 62.0 years) received ICIs during the study period. Of these, 580 patients (60.9%) used ICI-alone, 132 (13.9%) used dual-ICI, 187 (19.6%) used an ICI combined with chemotherapy (chemo+ICI), and 54 (5.70%) used immunotherapy with a targeted agent (targeted+ICI). A significantly higher proportion of patients using targeted+ICI had irEDs and hypothyroidism; in contrast, a higher proportion of patients using dual-ICI had adrenal insufficiency. There was no significant difference in the incidence of irED between the younger (<65 years) and older (>65 years) patients. Using logistic regression, only treatment type was significantly associated with irEDs. Notably, older patients had a higher risk of having immune-related diabetes mellitus. Conclusions This large, real-world cohort demonstrates that combining ICI with targeted therapy has a higher risk of overall irED and hypothyroidism. Immunotherapy is safe and well-tolerated regardless of age, but close monitoring of fasting glucose is needed in older populations.

Apathy is a fundamental neuropsychiatric symptom of Korsakoff’s syndrome (KS) and has also been reported in patients with alcohol use disorder with no (AUD) or less severe cognitive disorders (ALC). However, research on the nature of apathy is limited in these groups. Aim of this study was to examine the multidimensional nature of apathy in patients with KS, ALC and AUD. Moreover, we examined differences between apathy ratings by patients and their professional caregivers, and related apathy to everyday functioning and overall cognition. Twenty-four patients with KS, 24 patients with ALC and 21 patients with AUD participated in this study. Apathy was measured using the Apathy Motivation Index (AMI), which distinguishes behavioral, emotional and social apathy. Both patients and professional caregivers reported social apathy as most prominent symptom, compared to behavioral and emotional apathy. Apathy ratings did not differ across the three patient groups. Discrepancies between patient and caregiver ratings were observed in patients with KS and ALC, with more severe apathy reported by caregivers. Caregiver-reported behavioral and social, but not emotional, apathy was related to everyday functioning. These results show that apathy is present in a substantial proportion of patients with alcohol addiction with or without cognitive impairments.

Emotional dysfunction, including flat affect and emotional perception deficits, is a specific symptom of schizophrenia disorder. We used a modified multimodal odd-ball paradigm with fearful facial expressions accompanied by congruent and non-congruent sounds to investigate the impairment of emotional perception and reaction to other people's emotions. We analyzed subjective assessments and ERP data for emotionally charging congruent and non-congruent stimuli in patients with schizophrenia and healthy peers. The results showed the deficit of multimodal perception of fearful stimuli in patients with schizophrenia compared to healthy controls. The amplitude of N50 was significantly higher in subjects of the control group for non-congruent stimuli than congruent and did not differ in patients with schizophrenia. The dynamics of P100 and N200 components confirmed the impaired sensory gating in patients with schizophrenia. The lower amplitude of P3a could be associated with deficits in verbal memory and attention, less emotional arousal, or incorrect interpretation of emotional valence as specific features of patients. The difficulties in identifying the incoherence of facial and audial components of emotional expression could be significant in understanding the psychopathology of schizophrenia.

Daphne wolongensis described on the basis of a few known individuals was investigated in the wild, in Baoxing Valey, Sechuan. Its status of valid species was verified morphologically and genetically. Three newly found populations were compared to the closely related species Daphne retusa, D. tangutica, D. longilobata, D. acutiloba, D. sureil, to clones available in cultivation and selected cultivars. The high bootstrap values indicate a good level of genetic differentiation between each of the studied species. The hypothesis whether D. wolongensis is a hybridogenous species was rejected, it is a well-defined independent species. Based on morphological and genetic data, it seems likely that another species, D. limprichtii can be a mountain form of D. tangutica. Variability of populations in Wolong gives a good opportunity to select genotypes with a higher or better performance of combination of traits. From 51samples collected in Wolong it was possible to select the top ten different types as genetic resources for breeding. Daphne wolongensis, in the visited sites of Wolong area, occupies less than 1 km2. Together with isolated finds, the number of found individuals is less than 500 and the area is not larger than 10 km2, thus it falls to the IUCN category of “Critically Endangered” plants.

Introduction: Osteoarthritis (OA) and age-related degeneration (ARD) are stimulants for the development of the fabella in the knee joint. This meta-analysis updates previous studies and reviews on the prevalence of the fabella in OA or ARD knee joints. In addition, it provides a quantitative estimation of the fabellar prevalence in knees having OA and ARD. Methodology: Twenty studies comprising of data from 11,056 knee joints were included in the analysis, consisting of 6,819 Knees of OA subjects (including those with age more than 40 years) and 4,237 knees of non-OA subjects (including less than 40years) knees, respectively. 2,434 knees had fabellae present in OA subjects (including more than 40years), and 844 fabellae were present in non-OA subjects (including less than 40years). The Odds and Risk Ratios were calculated. Sensitivity analysis and cumulative analysis were conducted to assess the robustness of the findings. Results: Prevalence of fabella was found to be higher in OA knees, where the Risk Ratio of developing fabella was 2.50 (2.07-3.01). Compared with this, the Risk Ratio for the incidence of fabella in OA with ARD knee was 1.84 (1.66-2.03). The bilateral occurrence of fabella was more common than unilateral. The risk of developing fabella in individuals aged less than forty-year was 63% less than individuals aged more than forty years. Conclusion: OA and ARD would increase the prevalence of fabella by 84%, thus acting as stimulants and risk factors for ossified fabella.

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

The present study was conducted to evaluate the effects of dietary supplementation of tea polyphenol （TP） on serum hormone, serum enzyme activity, antioxidant-related and immune-related gene expression of laying hens under heat stress. A total of 288 Chinese yellow chicken (186 days old) were randomly distributed among two treatments, each of which included 6 replicates of 24 hens. Dietary treatments were that the basal diet was supplemented with 200 mg / kg tea polyphenol. The study lasted for 7 weeks, including 1 week of adaptation and 6 weeks of the formal test. The content of high-density lipoprotein cholesterol (HDL-C) and total protein (TP) in serum significantly decreased by dietary supplementation with tea polyphenol. Dietary tea polyphenol supplementation improved serum superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) enzyme activity and decreased serum malondialdehyde (MDA) content in treatments compared to the control. However, supplementation of tea polyphenol did not affect the activity of serum catalase (CAT). The results indicated that long-term feeding of tea polyphenols help to increase the amount of hormones (FSH, E2) associated with reproduction in laying hens and thus improve egg production. It also improved the immune function of laying hens in high temperature environments. Adding tea polyphenols to the diet can significantly increase the serum IgG, IgM content of the laying hens and can upregulate the IgA content. Dietary supplementation of tea polyphenols in the laying hens significantly increased the expression of antioxidant enzyme-related genes (SOD, CAT and GPX1) in the liver. Moreover, the addition of tea polyphenols significantly increased the expression of immune-related genes (Interferon-γ (INF-γ), Interleukin 2 (IL-2) and Interleukin 4 (IL-4)) in the spleen. It is concluded that addition of tea polyphenols has a positive effect on antioxidant activity and immune function of laying hens.

EZH2 overexpression is associated with tumor proliferation, metastasis, and poor prognosis. Targeting and inhibiting EZH2 may be an effective therapeutic strategy for head and neck squamous cell carcinoma (HNSCC). We previously analyzed EZH2 mRNA expression in a well-characterized dataset of 230 (110 original and 120 validation cohorts) human head and neck cancer samples. This study aimed to investigate the effects of inhibiting EZH2, either via RNA interference or via pharmacotherapy, on HNSCC growth. EZH2 upregulation was significantly correlated with recurrence (P < 0.001) and the methylation index of tumor suppressor genes (P < 0.05). DNMT3A was significantly upregulated upon EZH2 upregulation (P = 0.043). Univariate analysis revealed that EZH2 upregulation was associated with poor disease-free survival (log-rank test, P < 0.001). In multivariate analysis, EZH2 upregulation was evaluated as a significant independent prognostic factor of disease-free survival (hazard ratio: 2.085, 95% confidence interval: 1.390–3.127; P < 0.001). Cells treated with RNA interference and DZNep, an EZH2 inhibitor, showed the most dramatic changes in expression, accompanied with a reduction in the growth and survival of FaDu cells. These findings suggest that EZH2 upregulation is correlated with tumor aggressiveness and adverse patient outcomes in HNSCC. Evaluation of EZH2 expression might help predict the prognosis of HNSCC patients.

Recent evidence suggests the existence of shared neural resources for rhythm processing in language and music. Such overlaps could be the basis of the facilitating effect of regular musical rhythm on spoken word processing previously reported for typical children and adults, as well as adults with Parkinson’s disease and children with developmental language disorders. The present study builds upon these previous findings by examining whether musical rhythmic priming also influences visual word processing, and the extent to which such cross-modal priming effect of rhythm is related to individual differences in musical aptitude and reading skills. EEG was recorded while participants listened to a rhythmic tone prime, followed by a visual target word with a stress pattern that either matched or mismatched the rhythmic structure of the auditory prime. Participants were also administered standardized assessments of musical aptitude and reading achievement. ERPs elicited by target words with a mismatching stress pattern showed an increased fronto-central negativity. Additionally, the size of the negative effect correlated with individual differences in musical rhythm aptitude and reading comprehension skills. Results support the existence of shared neurocognitive resources for linguistic and musical rhythm processing, and have important implications for the use of rhythm-based activities for reading interventions.

Choroidal neovascularization (CNV) is a key pathological feature of several of the leading causes of vision loss including neovascular age-related macular degeneration. Here we show that a calreticulin anti-angiogenic domain (CAD)-like peptide 27, CAD27, inhibited in vitro angiogenic activities, including tube formation and migration of endothelial cells, and suppressed vascular sprouting from rat aortic ring explants. In rat model of laser-induced CNV, we demonstrate that intravitreal injection of CAD27 significantly attenuated the formation of CNV lesions as measured via fundus fluorescein angiography and choroid flat-mounts (19.5% and 22.4% reductions at 10μg and 20μg of CAD27 injected, respectively). Similarly, the reduction of CNV lesions was observed in the groups of rats that had received topical applications of CAD27 (choroid flat-mounts: 17.9% and 32.5% reductions at 10μg/mL and 20μg/mL of CAD27 installed, respectively). Retinal function was unaffected, as measured using electroretinography in both groups received interareal injection or topical applications of CAD27 at least for 9 days. These findings show that CAD27 can be used as a potential therapeutic alternative for targeting CNV in the diseases such as neovascular age-related macular degeneration.

Age-related diseases (ARDs) are the leading cause of death worldwide, and contribute to 90% of mortality in developed countries. Interestingly, the mortality rates of individual ARDs increase exponentially with age. Processes described by the exponential growth function typically involve a branching chain reaction or, more generally, a positive feedback loop. Here I propose that each ARD is mediated by one or several positive feedback loops (vicious cycles). I then identify critical vicious cycles in five major ARDs: atherosclerosis, hypertension, diabetes, Alzheimer’s and Parkinson’s. I also propose that the progression of ARDs can be halted by selectively interrupting the vicious cycles and suggest the most promising targets. An evolutionary perspective is also offered.

The gastrointestinal tract has a pivotal role in nutrient absorption, immune function, and overall homeostasis. The ileum segment of the small intestine plays respective roles in nutrient breakdown and absorption. The purpose of this study was to investigate the impact of heat-induced oxidative stress and the potential mitigating effects of an astaxanthin antioxidant treatment on the ileum of broilers. By comparing the growth performance and gene expression profiles among three groups- thermal neutral, heat stress and heat stress with astaxanthin, under two temperature conditions of 21-22°C and 32-35°C, this research aims to elucidate the role of astaxanthin in supporting homeostasis and cellular protection in the ileum. Results showed both treatments under heat stress experienced reduced growth performance, while the group treated with astaxanthin showed a slightly lesser decline. Results further showed the astaxanthin treatment group significantly upregulated in the cytoprotective gene expression for HSF2, SOD2, GPX3, and TXN, as well as the upregulation of epithelial integrity genes, LOX, CLDN1 and MUC2. In conclusion, our experimental findings demonstrate upregulation of cytoprotective and epithelial integrity genes suggests astaxanthin may effectively enhance the cellular response to heat stress to mitigate oxidative damage, and contribute to cytoprotective capacity.

The epigenetic mechanism of DNA methylation is essential for regulating gene expression and adaptation in plants, especially when exposed to various environmental stressors such as drought, heat, and nutrient availability. The impact of these stressors can lead to alterations in DNA methylation patterns and gene expression, which this study aims to investigate. Specifically, we are interested in understanding how DNA methylation plays a role in controlling the expression of stress-response genes, as well as genes involved in plant growth and development. To accomplish this, we are analyzing the changes in DNA methylation patterns and gene expression in response to different stressors like drought and heat. Our research findings suggest that DNA methylation is a vital regulator of plant adaptation to environmental stress, and we hope to gain further insight into these mechanisms by identifying genes that exhibit differential expression in response to stress and analyzing their DNA methylation status. This study offers valuable insights into the development of crops that can thrive under changing climate conditions.

Plant-microbial interactions are very crucial for the terrestrial ecosystem. At the rhizospheric, phyllospheric and endospheric regions, these interactions occur through different signalling pathways and play a pivotal role as they strengthen the plant defence mechanism against pathogen attacks and other stresses. A better knowledge of these relationships will help to develop novel solutions for sustainable agriculture and safeguarding the global food supply in the context of climate change and mounting environmental concerns. This chapter emphasises the role of the microbiome in providing resistance to plants against various environmental stresses and aiding in their improved adaption. This chapter also underscores the impact of the microbiome in providing resilience to plants under changing climatic scenarios.

Klotho (KL) is a glycosyl hydrolase and aging-suppressor gene. Stress is a risk factor for depression and anxiety that are highly comorbid with each other. The aim of this study was to determine KL is regulated by estrogen and plays an important role in sex differences in stress resilience. Our results showed that KL was regulated by estrogen in rat hippocampal neurons in vivo and in vitro and was essential for estrogen-mediated increase in the number of presynaptic vesicular glutamate transporter 1 (Vglut1) positive clusters on the dendrites of hippocampal neurons. The role of KL in sex differences in stress responses was examined in rats using three-week chronic unpredictable mild stress (CUMS). CUMS produced a deficit in spatial learning and memory, anhedonic-like and anxiety-like behaviors in male but not female rats, which was accompanied by a reduction in KL protein levels in the hippocampus of male, but not female rats. This demonstrated the resilience of female rats to CUMS. Interestingly, knockdown of KL protein levels in the rat hippocampus of both sexes caused a decrease in stress resilience in both sexes, especially in female rats. These results suggest that regulation of KL by estrogen plays an important role in estrogen-mediated synapse formation, and KL plays a critical role in the sex differences in cognitive deficit, anhedonic-like and anxiety-like behaviors induced by chronic stress in rats, highlighting an important role of KL in sex differences in stress resilience.

An immune-inflammatory response is accompanied by increased nitro-oxidative stress. The aims of this mechanistic review are to review: a) the role of redox sensitive transcription factors and enzymes, ROS/RNS production and the activity of cellular antioxidants on the activation and performance of macrophages, dendritic cells, neutrophils, T cells, B cells and natural killer cells; b) the involvement of high-density lipoprotein (HDL), apolipoprotein (Apo)A1, paraoxonase (PON)-1, and oxidized phospholipids in the regulation of the immune response; and c) the detrimental effects of hypernitrosylation and chronic nitro-oxidative stress on the immune response. The redox changes during immune-inflammatory responses are orchestrated by the actions of nuclear factor (NF)-κB, HIF1alpha, the mechanistic target of rapamycin (mTor), the phosphatidylinositol 3‑kinase (PI3K) / protein kinase B (AKT) signalling pathway, mitogen-activated protein (MAP) kinases, 5' AMP-activated protein kinase (AMPK), and peroxisome proliferator-activated receptor (PPAR). The performance and survival of individual immune cells is under redox control and sensitive to intracellular and extracellular levels of ROS/RNS and is heavily influenced by cellular anti-oxidants including the glutathione and thioredoxin systems, nuclear factor erythroid 2-related factor 2 (Nrf-2), and the HDL complex. Chronic nitro-oxidative stress and hypernitrosylation inhibit the activity of those antioxidant systems, the tricarboxylic acid cycle, mitochondrial functions, and the metabolism of immune cells. In conclusion, those redox-associated mechanisms modulate metabolic reprogramming of immune cells, macrophage and T helper cell polarization, phagocytosis, production of pro- versus anti-inflammatory cytokines, immune training and tolerance, chemotaxis, pathogen sensing, antiviral and antibacterial effects, Toll-like receptor activity, and endotoxin tolerance.

Purpose: To investigate the alterations in nitro-oxidative stress (OS) and antioxidant status in adolescents with metabolic syndrome (MetS) and whether these alterations occur independently from effects of overweight or obesity.Methods: Blood was collected in 47 adolescents with MetS and 94 adolescents without MetS as assessed with the International Diabetes Federation criteria. The International Obesity Task Force (IOTF) criteria were used to classify the subjects into those with overweight or obesity. We measured nitro-oxidative biomarkers including nitric oxide metabolites (NOx), lipid hydroperoxides (LOOH), and malondialdehyde (MDA), and antioxidant biomarkers, i.e. total radical-trapping antioxidant parameter (TRAP), paraoxonase (PON)-1 activity, thiol (SH-) groups, as well as tumor necrosis factor-α, glucose, insulin, triglycerides, uric acid and high-density lipoprotein cholesterol (HDL-C).Results: Logistic regression analysis showed that increased MDA and NOx and a lowered TRAP/uric acid ratio were associated with MetS. Machine learning including soft independent modeling of class analogy (SIMCA) showed that the top-3 most important features of MetS were increased glucose and MDA and lowered HDL-C. Support vector machine using MDA, glucose, insulin, HDL-C, triglycerides and body mass index as input variables yielded a 10-fold cross-validated accuracy of 89.8% when discriminating MetS from controls. The association between MetS and increased MDA was independent from the effects of overweight-obesity. glucose, insulin, triglycerides and HDL-C.Conclusion: In adolescents, increased MDA formation is a key component of MetS, indicating that increased production of reactive oxygen species with consequent lipid peroxidation and aldehyde formation participate in the development of MetS.

French bean (Phaseolus vulgaris L.) a member of family Leguminosae is a useful source of protein (∼22%), minerals (folate), vitamins and fibre. Abiotic and biotic stresses are the constraints to high yield and production of French bean. Varieties reluctant to diseases as well as abiotic stresses is among the top breeding objectives for the French bean. Mendelian ratios could know the genetically reliable forms of resistance, whereas it's more robust to understand the intricate kinds, often referred to as quantitative trait loci (QTL). Here, we review and compile the information from the studies related to the identification of QTLs for critical biofortification traits, biotic and abiotic stresses in French bean. Successful map-based cloning requires QTLs represent single genes which could be isolated in near-isogenic lines, and also the genotypes could be unambiguously inferred by progeny testing. Overall, this information will be useful for directing the French bean breeders to select a suitable method for the inheritance evaluation of quantitative traits and determining the novel genes in germplasm resources to ensure that much more potential of genetic information may be uncovered.

This study was undertaken to elucidate the role of trehalose (Tre) in mitigating oxidative stress under salinity and low P in maize. Eight-day-old maize seedlings of two maize varieties, BARI Hybrid Maize-7 and BARI Hybrid Maize-9 were subjected to salinity (150 mM NaCl), low P (5 µM KH2PO4) and their combined stress with or without 10 mM Tre for 15-d.Salinity and combined stress significantly inhibited the shoot length, root length, and root volume, whereas, low P increased the root length and volume in both genotypes. Exogenous Tre in the stress treatments increased all of the growth parameters as well as decreased the salinity, low P and combined stress-mediated Na+/K+, ROS, MDA, LOX activity and MG in both genotypes. Under salinity and low P stress, the SOD activity increased in both genotypes, but the activity decreased in combined stress. POD activity increased in all stress treatments. Interestingly, Tre application enhanced the SOD activity in all the stress treatments but inhibited the POD activity. Both CAT and GPX activity were increased by saline and low P stress while the activities inhibited in combined stress. Similar results were found for APX, GR, and DHAR activities in both genotypes. However, MDHAR activity was inhibited in all the stresses. Interestingly, Tre enhanced CAT APX, GPX, GR, MDHAR and DHAR activities suggesting the amelioration of ROS scavenging in maize under all the stresses. Increased GST activity in presence or absence of Tre might involve in detoxification of hydroperoxides as well as leaf senescence. On the other hand, increased glyoxalase activities in saline and low P stress in BHM-9 suggested better MG detoxification system because of down-regulation of Gly-I activity in BHM-7 in those stresses. Tre also increased the glyoxalase activities in both genotypes under all the stresses. Tre improved the growth in maize seedlings by decreasing Na+/K+, ROS, MDA, and MG through regulating antioxidant and glyoxalase systems.

BACKGROUND: Stable-phase schizophrenia may comprise two distinct nosological entities namely Major Neuro-Cognitive Psychosis (MNP, largely overlapping with the deficit syndrome) and simple NP (SNP), which are defined by neuroimmune and neurocognitive abnormalities. Furthermore, cognitive impairments and PHEM (psychotic, hostility, excitation, mannerism) and negative symptoms load on the same dimension.METHODS: The current study aimed to investigate associations of psychomotor retardation (PMR) and clinical as well as biomarker characteristics of schizophrenia. We recruited 40 healthy controls and 79 schizophrenia patients and measured IgA responses to tryptophan catabolites (TRYCATs), IgM to malondialdehyde and nitroso (NO)-cysteinyl, macrophage inflammatory protein-1 (MIP-1), soluble interleukin (IL)-1 receptor antagonist (sIL-1RA), IL-10, CCL-11 as well as PMR items of different rating scales and motor screening task (MOT). RESULTS: PMR differentiated schizophrenia from controls and MNP from SNP. In addition, PMR was strongly associated with executive functions, deficits in episodic and semantic memory, PHEM and negative (PHEMN) symptoms. Around 50% of the variance in PMR was predicted by the cumulative effects of immune activation, CCL-11, TRYCATs and NO-Cysteinyl levels, and lowered natural IgM. PRM may be reliably combined with PHEMN symptoms and memory and executive impairments into one latent vector reflecting overall psychopathology.CONCLUSIONS: Current findings indicate that PMR may be a key psychopathological feature of schizophrenia and mainly MNP. In addition, PMR and associated impairments in memory and executive functions, and PHEMN symptoms may be driven by deficits in the compensatory immune regulatory system (natural IgM) combined with increased production of neurotoxic immune products, namely TRYCATs and IgM to NO-cysteinyl, and an endogenous cognition deteriorating chemokine, namely CCL-11.

Transposable elements (TE) function as one of the major effectors to respond to biological or environmental stress. The mobility of TEs, which is heavily controlled under normal conditions, may be activated by stress. LncRNAs are emerging as a crucial tool in the regulation of TEs. This study focuses on the gene expression of THAP9, a domesticated transposon and lncRNA THAP9-AS1 (THAP9-antisense1), which form a sense and antisense gene pair with a promoter overlap of approximately 350bp. Under basal conditions, THAP9 is preferentially transcribed while THAP9-AS1 is heavily down-regulated. In the S-phase of the cell cycle, THAP9 expression exhibits stress-specific effects ranging from moderate enhancement to no change. On the other hand, THAP9-AS1, which has previously been reported to be upregulated in several cancers, always demonstrates enhanced expression under stress. Moreover, THAP9-AS1 is transcriptionally favoured during stress since the stress-induced fold-increase of THAP-AS1 expression is always higher than THAP9. Interestingly, the expression of both THAP9 and THAP9-AS1 exhibit a striking periodicity throughout the S-phase, reminiscent of cell cycle regulated genes. Thus, this study sets the stage to further explore the relationship between THAP9 and THAP9-AS1 and investigate THAP9-AS1’s potential regulatory role during stress.

This article shows the alternative learning methodology to stimulate the holistic side of students’ minds to achieve the increment of the innovation skill, managing the creative competencies and level of stress. The present research study is pre-experimental research designed with prior and posterior measurement, longitudinal, explanatory, and co-relational, with the main objective to demonstrate the effect of the holistic innovation coefficient of the beneficiaries of the program “Impulsa Peru”. Program Results: It has been concluded that the experimental group is significant over the control group. Therefore, the holistic innovation methodology had an impact on the experimental group. Conclusions: Hypothesis 1 is fulfilled in which it is affirmed that the holistic innovation methodology has a positive impact on the level of coefficient of holistic innovation of the student mentors of the women recyclers of the program Impulsa Peru with a significance level of 0.05%.

The agricultural sector faces challenges due to climate change and the growing global population. Alkaline stress could adversely impact plant growth and crop production. This stressor diminishes water quality essential for crop cultivation, consequently impairing plant growth and overall productivity. Gamma-aminobutyric acid (GABA), a non-protein amino acid, may exhibit multifaceted roles in plant responses to adverse environmental conditions. Optimization of crop production in controlled environmental agriculture under artificial light attracted much attention. In the present study, we investigated the effects of different light spectra and GABA concentrations on Lollo Rosso lettuce plants under alkaline stress. Seedlings were placed under different light spectra [red (R), blue (B), white (W), 3R:1B, and 2R:1B:1far-red (FR)] and treated by GABA (0 and 50 µmol). Alkaline conditions were instituted by applying NaHCO3 at a concentration of 40 mM. The experiment incorporated a control treatment without NaHCO3. In general, R light exposure caused the highest growth performance of lettuce plants. GABA augmented biomass production in control and alkaline-treated plants across all light spectra. Additionally, it increased the concentrations of photosynthetic and protective pigments under alkaline conditions. GABA also improved the photosynthetic performance under all light spectra. Non-photochemical quenching and pigmentation were enhanced by exposure to B light, especially in plants treated with GABA. Alkaline stress induced an increase in soluble carbohydrate content in the lettuce leaves. These findings highlight the support of GABA application in facilitating coping plants to alkaline stress.

Male infertility (MI) involves various endogenous and exogenous facts. These include oxidative stress (OS), which is known to alter several physiological pathways and it is estimated to be present at high levels in up to 80 % of infertile men. That is why since the late 20th Century, the relationship between OS and MI has been widely studied. New terms have emerged, such as Male Oxidative Stress Infertility (MOSI), which is proposed as a new category to define infertile men with high OS levels. Another important term is MOXI: Male, Antioxidants, and Infertility. Such term refers to the hypothesis that antioxidants could improve male fertility without the use of assisted reproductive technology. However, there is no evidence-based antioxidant treatments that directly improve seminal parameters or birth ratio. In this regard, there is controversy about their use. While certain scientists argue against their use due to the lack of results, others support this use because of their safety profile and low price. Some uncertainties related to the use of antioxidants for treating MI are their questionable efficacy or the difficulties to know their correct dosage. In addition, the lack of quality methods for OS detection can lead to an excessive antioxidant supplementation, resulting in “reductive stress”. Another important problem is that, although the inflammatory process is interdependent and closely linked to OS, it is usually ignored. To solve these uncertainties, new trends have recently emerged. These include the use of molecules with anti-inflammatory and antioxidant potential, and which are also able to specifically target the reproductive tissue; as well as the use of new methods that allow for reliable quantification of OS and a quality diagnosis. This review aims to elucidate the main uncertainties about MOXI and to outline the latest trends in research to achieve effective therapies with clinically relevant outcomes.

Endoplasmic reticulum (ER) is an important organelle responsible as protein synthesis regulator in plant. High salinity can also lead to the activation of ER stress, caused by the accumulation of misfolded protein. This could lead to a stress response mechanism, unfolded protein response (UPR). Failure of UPR to reverse the effect of protein misfolding will activate Programmed Cell Death (PCD). Metacaspase genes regulate programmed cell death (PCD) in plants. The present study was focused on comprehensive gene analyses of the expression patterns of type II rice metacaspase (OsMC) genes in response to the endoplasmic reticulum (ER) and salinity stress in rice leaf and OsMC4 in callus. A strong evidence of unfolded protein response (UPR) during tolerance to both ER and salinity stress was found in the present study. Overexpression of OsMC4 in rice callus as a fusion protein with TagRFP and controlled by the CaMV35 promoter caused major changes in the expression of the stress ER-marker genes, protein disulfide isomerase (PDI) and Binding immunoglobulin Protein (BiP), and OsMC4 in overexpressing calli. These expression analyses of the OsMC family provide valuable information for further functional studies on the biological roles of OsMCs in PCD related to ER and salinity stress responses.

Trypanosoma cruzi infection results in debilitating cardiomyopathy, which is a major cause of mortality and morbidity in the endemic regions of Chagas disease (CD). The pathogenesis of Chagasic cardiomyopathy (CCM) has been intensely studied as a chronic inflammatory disease until recent observations reporting the role of cardio-metabolic dysfunctions. In particular, we demonstrated accumulation of lipid droplets and impaired cardiac lipid metabolism in the hearts of cardiomyopathic mice and patients, and their association with impaired mitochondrial functions and endoplasmic reticulum (ER) stress in CD mice. In the present study, we examined whether treating infected mice with an ER stress inhibitor can modify the pathogenesis of cardiomyopathy during chronic stages of infection. T. cruzi infected mice were treated with an ER stress inhibitor 2-Aminopurine (2AP) during the indeterminate stage and evaluated for cardiac pathophysiology during the subsequent chronic stage. Our study demonstrates that inhibition of ER stress improves cardiac pathology caused by T. cruzi infection by reducing ER stress and downstream signaling of phosphorylated eukaryotic initiation factor (P-elF2α) in the hearts of chronically infected mice. Importantly, cardiac ultrasound imaging showed amelioration of ventricular enlargement, suggesting that inhibition of ER stress may be a valuable strategy to combat the progression of cardiomyopathy in Chagas patients.

Background: Cancer therapies predispose survivors to a high symptom burden. This study utilized mobile health (mHealth) technology to assess the feasibility of collecting daily symptoms from adult survivors of childhood cancer and evaluate symptom fluctuation and associations with future health-related quality-of-life (HRQOL). Methods: A prospective study using an mHealth platform to distribute a 20-item cancer-related symptom survey (5 consecutive days each month) and an HRQOL survey (the day after symptom survey) over 3 consecutive months to participants from the Childhood Cancer Survivor Study. PROMIS-29 Profile and Neuro-QOL assessed HRQOL. Daily symptom burden was calculated by summing the severity (mild, moderate, or severe) of 20 symptoms. Univariate linear mixed-effects models analyzed total, person-to-person, day-to-day, and month-to-month variability for the burden of 20 individual symptoms. Multivariable linear regression analyzed the association between daily symptom burden in the first month and HRQOL in the third month, adjusting covariates. Results: Out of the 60 survivors invited, 41 participated in this study (68% enrollment rate); 83% reported their symptoms ≥3 times and 95% reported HRQOL, both in each week across 3 months. Variability of daily symptom burden differed from person-to-person (74%), day-to-day (18%), and month-to-month (8%). Higher first-month symptom burden was associated with poorer HRQOL related to anxiety (regression coefficient: 6.56; 95%CI: 4.10-9.02), depression (6.32; 95%CI: 3.18-9.47), fatigue (7.93; 95%CI: 5.11-10.80), sleep (6.07; 95%CI: 3.43-8.70), pain (5.16; 95%CI: 2.11-8.22), and cognitive function (-6.89; 95%CI: -10.00 to -3.79) in the third month. Conclusion: Daily assessment reveals fluctuations in symptomology, and higher symptom burden was associated with poorer HRQOL in the future. Utilizing mHealth technology for daily symptom assessment improves our understanding of symptom dynamics and sources of variability.

This study investigated the relationship between fundamental movement skills (FMSs) and health-related fitness (HRF) among first and second graders in South Korean elementary schools. It aimed to provide foundational data for developing physical education programs tailored to the motor development stages and fitness levels of younger elementary school students. In October 2023, FMSs (jumping, running, hopping, static balance, dynamic balance, overhand throwing, and kicking) and HRF (muscular strength, cardiorespiratory endurance, and flexibility) were evaluated among 291 first and second graders. The collected data were analyzed through frequency and multiple regression analyses performed using the SPSS software. The results revealed that higher scores in jumping and hopping are associated with greater muscular strength, cardiorespiratory endurance, and flexibility. Running had no significant effect on HRF elements. Higher scores in static balance (single-leg stance) were associated with increased muscular strength, cardiorespiratory endurance, and flexibility, but dynamic balance (balance beam walking) did not have a significant effect. Higher scores in overhand throwing were associated with greater muscular strength and cardiorespiratory endurance, but kicking did not show a significant association. Overall, these findings emphasize the importance of prioritizing jumping and static balance in physical education for the well-rounded health development of first and second graders.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

OCTA is an imaging modality used in the assessment of the retinal vasculature. It operates on the principle of coherence tomography used in standard OCT with the addition of delineating the retinal vascular. This provides a modern non-invasive retinal vascular imaging method compared to conventional dye-based imaging. High quality depth resolution of the superficial and deep capillary networks is possible on OCTA whereas this was not possible prior. OCTA may be limited by image quality degradation from factors such as motion artefact or media opacities, and therefore may not be the investigation of choice for all patient groups. There are multiple potential clinical applications for OCTA in retinal and choroidal vascular disease. Ongoing research is necessary to substantiate the more widespread use of OCTA due to its significant cost burden compared to current modalities.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Overweight and obesity adversely affect health-related quality of life (HRQOL) through day-to-day impairments of both mental and physical functioning. It is assumed that polyphenols within the Mediterranean diet may contribute to improve HRQOL. This investigation aimed at studying the effects of a polyphenol-rich ingredient on HRQOL in overweight and obese but otherwise healthy individuals. A randomized, double-blind, placebo-controlled study including 72 volunteers was conducted. Subjects were randomly assigned to receive for a 16-week period either 900 mg/day of the supplement or a placebo. Dietary recommendations were individually determined, and intakes were recorded; daily physical mobility was monitored. Improvement of HRQOL was set as the primary outcome and assessed at baseline and at the end of the investigation, using the Short-Form 36 (SF-36) Health survey. Body composition was analyzed using dual-energy X-ray absorptiometry (DXA). Physical activity level was calculated using International Physical Activity Questionnaire (IPAQ). After 16 weeks, despite there was no adherence to the Mediterranean Diet Serving Score (MDSS), supplemented individuals experienced significant HRQOL improvement (+5.3%; P=0.001), including enhanced perceived physical (+11.2%; P=0.002) and mental health (+4.1%; P=0.021) components; bodily pain, vitality, and general health, being the greatest contributors. Besides, body fat mass significantly decreased (-1.2 kg; P=0.033), mainly within trunk area (-1.0 kg; P=0.002). Engagement in physical activity significantly increased (+1308 Met-min/week; P=0.050). Hence, chronic supplementation with a nutritional diversity and dose of a Mediterranean diet-inspired polyphenol-rich ingredient resulted in a significant amelioration in both perceived physical and mental health, concomitant with the improvement of body composition, in healthy subjects with excessive adiposity.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

To date, soil salinity becomes a huge obstacle for food production worldwide since salt stress in plants is one of the major factors limiting agricultural productivity. It is estimated that a significant loss of crops (20%–50%) would be due to drought and salinity. To embark upon this harsh situation, numerous strategies such as plant breeding, plant genetic engineering, and a large variety of agricultural practices including the applications of plant growth-promoting rhizobacteria (PGPR) and seed biopriming technique have been developed to improve plant defense system against salt stress, resulting in higher crop yields to meet human’s increasing food demand in the future. In the present review, we update and discuss the advantageous roles of beneficial PGPR as green bioinoculants in mitigating the burden of high saline conditions on morphological parameters and on physio-biochemical attributes of plant crops via diverse mechanisms. In addition, the applications of PGPR as a useful tool in seed biopriming technique are also updated and discussed since this approach exhibits promising potentials in improving seed vigor, rapid seed germination, and seedling growth uniformity, Furthermore, the controversial findings regarding the fluctuation of antioxidants and osmolytes in PGPR-treated plants are also pointed out and discussed.

Plants are continually exposed to multiple stresses, which co-occur in nature and the net effects are frequently more non-additive (i.e., synergistic or antagonistic) suggesting ‘unique’ responses respect to that of the individual stress. Further, plant stress responses are not uniforms showing a high spatial and temporal variability among and along the different organs. In this respect, the present work investigated the morphological responses of different root types (seminal, seminal lateral, primary, primary lateral) of maize plants exposed to single (drought and heat) and combined stress (drought + heat). Data were evaluated by a specific root image analysis system (WinRHIZO) and analyzed by uni- and multi-variate statistical analysis. The results indicated that primary root and their laterals were the types more sensitive to the single and combined stresses while the seminal laterals specifically responded to the combined only. Further, antagonistic and synergistic effects were observed for the specific traits in the primary and their laterals and in the seminal lateral roots in response to the combined stress. These results suggested that maize root system modified specific root types and traits to face with different stressful environmental conditions highlighting that the adaptation strategy to the combined stress may be different from that of the individual ones. The knowledge of “unique or shared” responses of plant to multiple stress can be utilized to develop varieties with broad spectrum stress tolerance.

The present study investigated the effect of different ambient temperature and relative humidity (RH) but equal temperature-humidity index (THI) on laying performance, egg quality, heterophil to lymphocyte ratio (H/L ratio), corticosterone (CORT) concentration in blood, yolk and albumen, and plasma biochemical parameters in laying hens. One hundred and twenty commercial hens (Hy-Line Brown) aged 60 weeks were allocated into 2 environmental chambers. Laying hens were subjected to either one of two thermal treatments, i.e., 26ºC and 70% RH (LH75) and 30ºC and 30% RH (HL75) for 28 days. Both thermal treatments had equal THI being 75. Neither LH75 nor HL75 affected (P > 0.05) laying performance including egg production, egg weight, egg mass, feed intake, and feed conversion ratio. Plasma biochemical parameters such as total cholesterol, high-density lipoprotein cholesterol, triglyceride, calcium, magnesium, and phosphorus was not altered (P > 0.05) by thermal treatments. As to the stress indicators, both environment regimes failed (P > 0.05) to affect blood H/L ratio and CORT levels in plasma, yolk and albumen although albumen CORT levels were elevated (P < 0.05) in LH75 vs. HL75 at days 3, 7, and 28. In conclusion, our study suggests that laying hens performed and responded equally when they were exposed to equal THI environment conditioned from either 26ºC and 70% RH or 30ºC and 30% RH. The results of this study will be served as a scientific basis for management decisions and handling under thermally challenging conditions.

The world is currently, subjected to the worst health crisis documented in modern history; an epidemic led by the novel coronavirus disease 2019 (COVID-19). At the epicenter of this crisis, healthcare professionals continue working to safeguard our well-being. To the regular high levels of stress, COVID new heights even more to healthcare professionals so depending on the area, specialty, and type of work. Here we investigated what are the tendencies, or areas most affected. Through an adaptation of the original COVID-stress scale, we developed a remote, fast test designed for healthcare professionals of the Northeastern part of Mexico, an important part of the country with economic and cultural ties to the US. Our results showed 4 key correlations as highly dependent: Work area – Xenophobia (p &lt; 0.045), Work with COVID patients - Traumatic stress (p &lt; 0.001) and Total number of COVID patients per day – Traumatic stress (p &lt; 0.027), and Total number of COVID patients - Compulsive checking and reassurance. Overall concluding that normal levels of stress have increased (mild – moderate). Additionally, we further determine that the fear of being an asymptomatic patient (potential to spread without knowing) continues being a concern.

Rapid and accurate prediction of residual stress in metal additive manufacturing processes is of great importance to guarantee the quality of the fabricated part to be used in a mission-critical application in the aerospace and automotive industries. Experimentation and numerical modeling are valuable tools for measuring and predicting the residual stress; however, to-date conducting experimentation and numerical modeling is expensive and time-consuming. Thus, herein, a physics-based thermomechanical analytical model is proposed to predict the residual stress of the additively manufactured part rapidly and accurately. A moving point heat source approach is used to predict the temperature field by considering the effects of scan strategies, heat loss, and energy needed for solid-state phase transformation. Due to the high temperature gradient in this process, part experiences a high amount of thermal stress following solidification which may exceed the yield strength of the material. The thermal stress is obtained using Green’s function of stresses due to the point body load. The Johnson-Cook flow stress model is used to predict the yield surface of the part under repeated heating and cooling. As a result of the cyclic heating and cooling and the fact that the material is yielded, the residual stress build-up is predicted based on incremental plasticity and kinematic hardening behavior of the metal according to the property of volume invariance in plastic deformation in coupling with the equilibrium and compatibility conditions. The computational methodology is realized with the laser powder fusion of maraging steel 350 as a material of example. The validation of the predictive models has been presented in terms of the comparison of predicted and measured scan-direction and build-direction residual stress distributions along depth of build under various process parameter combinations. Moreover, for the first time, the Jonson-Cook parameters of maraging steel 350 are predicted using analytical modeling of machining forces and non-linear optimization techniques.

Salinity is a serious environmental hazard which limits world agricultural production by adversely affects plant physiology and biochemistry. Hence increase tolerance against salt stress is very important. In this study, we explored the function of β-aminobutyric acid (BABA) in enhancing salt stress tolerance in rapeseed (Brassica napus L.). After pretreatment with BABA, seedlings were exposed to NaCl (100 mM and 150 mM) for 2 days. Salt stress increased Na content and decreased K content in shoot and root. It disrupted the antioxidant defense system by producing reactive oxygen species (ROS; H2O2 and O2•−), methylglyoxal (MG) content and causing oxidative stress. It also reduced the growth and photosynthetic pigments of seedlings but increased proline (Pro) content. However, BABA pretreatment in salt-stressed seedlings increased ascorbate (AsA) and glutathione (GSH) contents; GSH/GSSG ratio; and the activities of ascorbate peroxidase (APX), monodehydroascorbate reductase (MDHAR), dehydroascorbate reductase (DHAR), glutathione reductase (GR), glutathione peroxidase (GPX), superoxide dismutase (SOD), catalase (CAT), glyoxalase I (Gly I), and glyoxalase II (Gly II) as well as growth and photosynthetic pigments of plants. In addition, compared to salt stress alone BABA increased Pro content, reduced the H2O2, MDA and MG contents and decreased Na content in root and increased K content in shoot and root of rapeseed seedlings.

Being a chilling-sensitive staple crop, rice (Oryza sativa L.) is vulnerable to climate change. The competence of rice to withstand chilling stress should, therefore, be enhanced through technological tools. The present study employed chemical intervention like application of sodium nitroprusside (SNP) as nitric oxide (NO) donor and elucidated the underlying molecular mechanisms of NO-mediated chilling tolerance in rice. At germination stage, germination indicators were interrupted by chilling stress (5.0 ± 1.0°C for 8 h day‒1), while pretreatment with 100 μM SNP markedly improved the indicators. At seedling stage (14-day-old), chilling stress caused stunted growth with visible toxicity along with alteration of biochemical markers, for example, increase in oxidative stress markers (superoxide, hydrogen peroxide, and malondialdehyde) and osmolytes (total soluble sugar; proline and soluble protein content, SPC), and decrease in chlorophyll (Chl), relative water content (RWC), and antioxidants. However, NO application attenuated toxicity symptoms with improving growth performance which might be attributed to enhanced activities of antioxidants, mineral contents, Chl, RWC and SPC. Furthermore, principal component analysis indicated that water imbalance and increased oxidative damage were the main contributors to chilling injury, whereas NO-mediated mineral homeostasis and antioxidant defense were the critical determinants for chilling tolerance in rice. Collectively, our findings revealed that NO protects against chilling stress through valorizing cellular defense mechanisms, suggesting that exogenous application of NO could be a potential tool to evolve cold tolerance as well as climate resilience in rice.

Water stress (WS) and heat stress (HS) have a negative effect on soybean plant growth and crop productivity. During WS, soybean plants opt for survival through ion homeostasis and the conformations of proteins are disconcerted as plant cells lose water while HS leads to difficulties in flowering and fruiting. Some of these changes include oxidative stress leading to the destruction of photosynthetic apparatus, macromolecules within cells and the onset of complex signaling cascades. Changes in the physiological characteristics, proteome, and certain metabolites investigated on molecular and cellular functions were studied in two soybean cultivars exposed to different heat and water stress conditions independently and in combination. Leaf protein composition was studied using 2-DE and complemented with MALDI TOF mass spectrometry. While two cultivars displayed genetic variation in response to water and heat stress, thirty-nine proteins were significantly altered in their relative abundance in response to WS, HS and combined WS+HS in both cultivars; a majority of them involved in metabolism, response to heat and photosynthesis showing significant cross-tolerance mechanisms. Functional analysis revealing a majority of heat responsive-proteins were more abundant during HS and combined stress (WS+HS) whereas these proteins were low to WS in cultivar PI 471938 and heat shock proteins were in low abundance to water, heat and combined stresses in cultivar R95-1705. Most protein abundances were not correlated with their expression at mRNA levels in PI cultivar, however, in cultivar R 95, the expression levels of transcript follow their relative abundance in proteins. Our systems bioinformatics analyses revealed that MED37C, a probable mediator of RNA polymerase transcription II protein showed potential interacting partners in Arabidopsis and our studies signifies the marked impact of this protein in PI cultivar. Elevated activities in antioxidant enzymes indicate that the PI-371938 cultivar has the ability to restore the oxidation levels and sustain the plant during the stress. Our study hypothesizes the plant’s development of cross-stress tolerance which will help foster the ongoing ventures in genetic modifications in stress tolerance.

Hypotrochoidal profile contours have been produced in industrial applications in recent years using twin-spindle processes, and they are considered effective high-quality solutions for positive shaft–hub connections. This study mainly concerns analytical approaches to determine the bending stresses in hypotrochoidal profile shafts. The formulation was developed according to bending principles using the mathematical theory of elasticity and conformal mappings. The loading was further used to investigate the rotating bending behaviour. The stress factors for the classical calculation of maximum bending stresses were also determined for all those profiles presented and compiled in the German standard DIN3689-1 for practical applications. The results were also compared with the corresponding numerical and experimental results, and very good agreement was observed. Additionally, based on previous work, the stress factor was determined for the case of torsional loading to calculate the maximum torsional stresses in the standardised profiles, and the results are listed in a table. This study contributes to the further refinement of the current DIN3689 standard.

We analyze a time-delayed SIQR model that considers the transportation-related infections and entry-exit screening. This model aims to determine the measures for preventing and controlling major emergent infectious diseases and the associated costs. We calculate the basic reproduction number (R0), apply the linearization method, and construct an appropriate Lyapunov function to determine the stability of the disease-free equilibrium in the local and global. We collect COVID-19 infection data from two regions in the United States in 2020 for data fitting, obtain a set of optimal parameter values, and show that the model is suitable for simulating the outbreak and spread of emerging infectious diseases. We find that transportation-related infections increase the basic reproduction number, enhancing the impact on disease spread. Entry-exit screening effectively suppress the spread of disease by reducing the basic reproduction number. Furthermore, we investigate the influence of the incubation period on disease and find that a shorter incubation period results in a shorter duration but a larger scale of infection, and the peaks are reduced. We conduct a sensitivity analysis of the R0 and propose three measures to prevent the spread of new infectious diseases based on the most sensitive parameters: wearing masks, implementing urban closures, and administering medication to sick but not yet hospitalized patients promptly. In the case of COVID-19, we use Pontryagin’s minimum principle to get time-varying control measures to control the spread of the outbreak. Optimal control effectively controls the development and deterioration of the disease. Finally, several control measures are compared through cost-effectiveness analysis, and the results show that wearing masks is the most cost-effective measure. Our study provides some practical guidance for controlling the spread of major emerging infectious diseases.

Survival of Medulloblastoma (MB) depends on various factors, including the gene expression profiles of MB tumor tissues. In this study, we identified 967 MB survival related genes (SRBs) using the gene expression dataset of Cavalli et al. (2017) and the Cox proportional hazards regression model. Notably, the SRGs were over-represented on chromosomes 6 and 17, known for the abnormalities monosomy 6 and isochromosome 17 in MB. The most significant SRG was HMGA1 (high mobility group AT-hook 1), which is a known oncogene and a histone H1 competitor. High expression of HMGA1 was associated with worse survival, primarily in the Group 3γ subtype. The high expression of HMGA1 was unrelated to any known somatic copy number alteration. Most SRGs on chromosome 17p were associated with low expression in Group 4β, the MB subtype with 93% deletion of 17p and 98% copy gain of 17q. Pathway analysis showed that both chromosomes 6 and 17 included SRGs related to telomere maintenance and provide a rationale for testing telomerase inhibitors in Group 3 MBs. We conclude that HMGA1, along with other SRGs on chromosome 6 and 17 warrant further investigation as potential therapeutic targets in selected subgroups or subtypes of MB.

This study aimed to investigates obesity-related glomerulopathy (ORG) at cellular, structural, and transcriptomic levels. Thirty Wistar rats were randomized into two groups: control (n=15) and study groups (n=15) that were fed a standard (SD) and high-fat diet (HFD), respectively. After 10 weeks, the weight, kidney function, histological features, and transcriptomic changes were assessed. HFD group exhibited increased weight gain (55.8% vs 29.2%; P< 0.001) and albuminuria (10384.04 ng/ml vs 5845.45 ng/ml; P<0.001) compared to controls. The HFD group exhibited early stages of ORG lesions, with a predominance of mesangial matrix increase and podocyte hypertrophy (PH). These lesions correlated with differentially expressed (DE) genes and miRNAs. Functional analysis showed that four DE miRNAs in the kidneys of the HFD group negatively regulated the PTEN gene, which promotes podocyte endocytosis of lipids in ORG. Among these four miRNAs, miR-205 was upregulated in the urine of the HFD group. HFD-fed Wistar rats developed early stages of ORG, with a specific targetome of miRNAs and gene expression. The upregulation of miR-205 in the kidney and its isolation in urine are associated with lipid endocytosis in podocytes, which could become a plausible biomarker of the early stages of ORG and lead to future therapeutic research.

Objective To investigate nailfold capillary parameters in community-dwelling individuals aged over 60 years who have hypertension and do not exercise regularly. Furthermore, the study examined the correlations between capillary function and other health-related indicators. Design A single- center pilot trial Setting Faculty of Health, Tsukuba University of Technology, Japan Participants hypertensive community-dwelling elderly people Intervention Microcirculation was observed before and 1 min after arm-curl exercise by means microscopy of capillary with non-exercised limb. Additionally, we examined other health-related indicators. Outcome measures: Acute effects of reperfusion on nailfold density, flow, and diameters. Secondary outcomes included the correlations between microvascular parameters and other health-related indicators. We hypothesized that brief exercise could enhance microcirculation reperfusion and correlate with other health-related parameters.　 Results: There were 20 participants with a mean (SD) age of 67.1 (5.8) years. The capillary flow rate changed from 2.3±6.7 to 2.7±0.2 log µm/s (P

.Background: Negative outcomes associated with medications (NOM) and drug-related problems (DRP) significantly impact individuals with kidney replacement therapy (KRT) given the complexities of managing kidney disease and associated comorbidities. The present study aims to assess the frequency of NOMs/DRPs among KRT patients and identify contributing factors. Methods: A cross-sectional study was conducted at the Virgen de las Nieves University Hospital (Granada, Spain), involving 117 outpatient adults with KRT. Data were collected from February 2021 to July 2023 using electronic records, semi-structured interviews (Dáder Method), and discussions with nephrology specialists. NOMs/DRPs were identified following treatment guidelines. Binary logistic regression determined associated factors (p-value < 0.05). Results: Across 117 patients, 2,436 NOMs and 3,303 DRPs were identified, averaging 20.82 NOMs and 28.23 DRPs per patient. Prevalent NOMs included untreated conditions (58.95%), quantitative ineffectiveness (35.43%), and non-quantitative safety problems (5.13%). Dominant DRPs were undertreated conditions (37.63%), wrong dose/posology/length (33.00%), risk of adverse drug reactions (ADR) (16.14%), and non-adherence (6.87%). Patients with ADR, undertreated condi-tions, and anemia were associated with quantitative ineffectiveness. Risk of ADR and vitamin D deficiency/insufficiency correlated with non-quantitative safety problems. Conclusions: KRT pa-tients exhibited a substantial prevalence of NOMs/DRPs. Further research is needed to deepen our understanding of these complexities for improved patient care.

Background: Micronutrient deficiencies are common at the time of cancer diagnosis and are associated with worse prognosis. Little is known about them in cancer rehabilitation. Methods: Data from routine health related quality of life (HRQOL) were analyzed at an inpatient cancer rehabilitation center. Rehabilitation patients completed the EORTC QLQ-C30 questionnaire before and after multidisciplinary rehabilitation treatment, and three month after discharge. Selenium and zinc status was measured in whole blood at these three time points. In case of selenium deficiency up to 600 µg selenium per day as sodium selenite was supplemented. Results: A total of 271 patients (breast, colon, and pancreatic cancer) were included in the analysis. There was clinically meaningful improvement in many domains of the EORTC QLQ-C30 during rehabilitation. However, effect often waned in the three months after. Prevalence for selenium deficiency varied between 34 to 90 percent depending on cancer type (breast &lt; colon &lt; pancreas). In contrast, zinc deficiency was rare. Daily selenium supplementation of 600 µg was more efficient to correct selenium deficiency compared to 300 µg selenium per day. Rehabilitation and increasing selenium status after rehabilitation were associated with improved global quality of life, physical and emotional functioning, and fatigue. In cancer patients with decreasing selenium status, values of global quality of life, physical and emotional functioning, and fatigue were back to the values at the beginning of rehabilitation. Conclusions: Selenium deficiency is common in cancer patients admitted to a cancer rehabilitation clinic. Selenium supplementation during rehabilitation effectively corrected selenium deficiency in most cases. The positive effects of rehabilitation persisted longer, when selenium status did not decrease after rehabilitation.

: Molecular targeting strategies have been used for years to control cancer progression and are often based on targeting various enzymes involved in metabolic pathways. Keeping that in mind, it is essential to know the role of each enzyme in a particular metabolic pathway. In this review, we are providing in-depth knowledge of various enzymes such as ceramidase, sphingosine kinase, sphingomyelin synthase, dihydroceramide desaturase, and ceramide synthase, which are associated with multiple types of cancer that depend on ceramide metabolism. Focus has also been given to discussing physicochemical properties of well-studied inhibitors of natural products origin and their related structures for these enzymes. Targeting ceramide metabolism exhibited promise in mono and combination therapies at preclinical stages to prevent cancer progression and paved the way for the significance of sphingolipid metabolism in cancer treatments. Targeting ceramide metabolizing enzymes will help the medicinal chemist to design potent and selective small molecules for treating cancer progression at various levels.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

To date, the impact of COVID-19 vaccination on formerly menstruating women remains unknown. For this reason, a retrospective observational cross-sectional study was conducted (N= 548) using an online survey. General characteristics, medical history, and adverse events following COVID-19 vaccination were recorded. In comparison with the first dose, significantly higher percentages of respondents experienced menstrual-related disturbances (dose 1: 38.5% vs. dose 2: 44.8%; McNemar=9.15; mid P-value=0.002), as well as the simultaneous occurrence of two or more of these symptoms (dose 1: 11.2% vs. dose 2: 15.3%; McNemar=13.53; mid P-value=0.044) after receiving the second one. Among them, those related with the length and flow stand out, being of long-term nature in about 17-20% of cases. Interindividual factors influencing this unexpected event after receiving the dose 1 may include weight (AOR 1.02, CI 95% 1.01–1.03, P&lt;.001), perimenopause (AOR 2.28, CI 95% 1.37–3.77, P=.001), pre-existing diagnoses of non-autoimmune rheumatic/articular conditions (AOR 0.31, CI 95% 0.10–1.00, P=0.05), hormonal contraceptive use (AOR 0.25, CI 95% 0.07-0.82, P=0.02), suffering from other vaccine side effects − such as arm pain (AOR 0.61, CI 95% 0.39–0.95, P=0.03), headache (AOR 0.53, CI 95% 0.35 – 0.80, P=.003), swollen glands (AOR 0.29, CI 95% 0.15 – 0.60, P=.001) and nauseas (AOR 0.35, CI 95% 0.14 – 0.86, P=0.02) – and the number of previous pregnancies (AOR 2.70, CI 95% 1.54 – 4.76, P=.001). Formerly menstruating women may experience long-term menstrual-related disturbances following COVID-19 vaccination.

Tyrosine kinase inhibitors (TKI) and immune checkpoint inhibitors (ICI) significantly improve the outcomes of patients with advanced clear cell renal cell carcinoma (ccRCC), but high-grade toxicities can occur, particularly during combination therapy. Herein, we report a patient with advanced metastatic ccRCC, who developed grade 4 cholestasis during combined therapy with nivolumab and cabozantinib. After the exclusion of common disorders associated with choles-tasis and a failure of corticosteroids (CS), a liver biopsy was performed that demonstrated severe ductopenia. Consequently, a diagnosis of vanishing bile duct syndrome related to TKI and ICI administration was made, resulting in CS discontinuation and ursodeoxycholic acid administra-tion. After a 7-months follow-up, liver tests had returned to normal values. Immunological studies revealed that our patient had developed robust T-cells and macrophages infiltrates in his lung metastasis, as well as in skin and liver tissues at the onset of toxicities. At the same time, peripheral blood immunophenotyping revealed significant changes in T-cell subsets suggesting their potential role in the pathophysiology of the disease.

Grapevine is one of the most relevant crops in the world being used for economically important products such as wine. Yet, relevant grapevine cultivars are heavily affected by diseases such as the downy mildew disease caused by Plasmopara viticola. Improvements on grapevine resistance are made mainly by breeding techniques where resistance traits are introgressed into cultivars with desired grape characteristics. However, there is still a lack of knowledge on how resistant or tolerant cultivars tackle the P. viticola pathogen. In this study, using a shotgun proteomics LC-MS/MS approach, we unravel the protein modulation of a highly tolerant grapevine cultivar, V. vinifera ‘Regent’, in the first hours post inoculation (hpi) with P. viticola. At 6 hpi, proteins related to defence and to response to stimuli are negatively modulated while at 12 hpi there is an accumulation of proteins belonging to both categories. The co-occurrence of effector-triggered susceptibility (ETS) and effector-triggered immunity (ETI) is detected at both time-points, showing that these defence processes present high plasticity. The results obtained in this study unravel the tolerant grapevine defence strategy towards P. viticola and may provide valuable insights on resistance associated candidates and mechanisms, which may play an important role in the definition of new strategies on breeding approaches.

The 2030 Agenda sets out seventeen Sustainable Development Goals (SDGs). The educational goal is to promote the education of citizens on sustainable development, among other things. Educating today's digital citizens on sustainability means training them for justice and social activism, commitment and political engagement. However, research into the subject shows a lack of consistency in the education of university students. This paper presents a study of students of Education, on education on sustainability through the practice of active and critical digital citizenship. A quasi-experimental method was used to learn about the behaviours of digital citizens, and intervention was carried out by means of an SDG-focused workshop and observation of the final level of commitment. The results show a positive level of commitment and digital activism around content related to sustainable development, which can be addressed from the university syllabus in a cross-curricular way.

Deregulation of cell growth and development lead to cancer, a severe condition that claims millions of lives worldwide. Targeted or selective approaches used during cancer treatment determine the efficacy and outcome of the therapy. In order to enhance specificity and targeting and better treatment options for cancer, novel and alternative modalities are currently under development. Photodynamic therapy has the potential to eradicate cancer and combination therapy would yield even greater outcomes. Nanomedicine-aided cancer therapy shows enhanced specificity for cancer cells and minimal side-effects coupled with effective cancer destruction both in vitro and in vivo. Nanocarriers used in drug-delivery systems are well able to penetrate cancer stem cell niche, simultaneously killing cancer cells and eradicate drug-resistant cancer stem cells, yielding therapeutic efficiency up to 100 fold against drug-resistant cancer in comparison with free drugs. Safety precautions should be considered when using Nano-mediated therapy as the effects of extended exposure to biological environments are still to be determined.

Stress has been identified as a prominent contributor to the development and advancement of bowel cancer, however its specific involvement is intricate and diverse. This abstract tries to offer a concise summary of the correlation between stress and bowel cancer, consolidating significant discoveries from several research fields. The investigation commences by studying the molecular pathways by which chronic stress impacts the development of colon cancer. Chronic stress causes disruption in the functioning of neuroendocrine, immunological, and inflammatory pathways, leading to the development of a microenvironment within the gastrointestinal system that promotes the growth of tumours. Furthermore, changes in the composition of gut microbiota, variations in epigenetics, and alterations in immune function caused by stress also have a role in increasing the risk and advancing the advancement of cancer. Psychological aspects, including how one perceives stress, the tactics they use to cope with it, and the level of psychosocial support they receive, are crucial in determining a person's susceptibility to bowel cancer and impacting the effectiveness of treatment. Stress management therapies, such as cognitive-behavioral therapy and mindfulness-based stress reduction, have demonstrated potential in enhancing patient well-being and promoting adherence to treatment. Moreover, epidemiological studies and clinical trials offer vital knowledge regarding the correlation between stress and the risk, prognosis, and treatment results of bowel cancer. Although the evidence is inconclusive, it is essential to continue researching the intricate relationship between stress and bowel cancer. This will help us understand the connection better and create specific strategies to reduce its impact on patient outcomes.

Background: Pregnancy can be a period of increased psychological susceptibility for women living with HIV. This study aimed to determine the prevalence and factors associated with depression and psychological stress among women living with HIV during their perinatal period in Ibadan, Nigeria. Methods: This study was a facility-based cross-sectional survey conducted in three HIV treatment centers. The study population consisted of women living with HIV 18 years and above who were pregnant or had given birth within the last two years. Data obtained were analyzed using Statistical Package for Social Science version 25. Results: A total of 402 participants were eligible for this study. About 69.0% and 78.0% of the participants were depressed and had perceived stress respectively. Women who had positive partners (OR=0.60, 95% CI=0.20-1.30) were found to be significantly associated with perceived depression. Women who reported having a gestational age between 29-40 weeks (OR=0.054 95% CI = 0.006, 0.500) were found to be significantly associated with perceived stress. Factors associated with the co-occurrence of symptoms of depression and perceived stress were partner status, income level, family support, gestational age, and years on ART. Conclusions: Given the high prevalence of major depression, perceived stress, and the co-occurrence of depression and perceived stress among women living with HIV, mental health care should be incorporated into the routine maternal healthcare for all women, especially those living with HIV.

Teaching is considered a multifarious task. Teachers, in the pursuit of educational success, are burdened with numerous teaching workloads and dilemmas causing them stress. This study endeavored to determine the influence of stress on professional satisfaction of multigrade teachers. It employed correlation research design involving thirty (30) purposively selected multigrade teachers in the Schools Division of General Santos City (GSC), Southern Philippines. Employing the survey method, tailored questionnaires were utilized to gather the needed data. The statistical tools employed in the analysis were weighted mean and Pearson Product Moment Correlation Coefficient. Moderate level of stress and high level of professional satisfaction are gained among the multigrade teachers surveyed. It was further found out that there is no significant relationship between stress and professional satisfaction, providing evidence that stress may not necessarily influence satisfaction. This result offers unique implications in theory, practice, and research which are discussed in the study.

Human exposure to carbon nanotubes (CNTs) can cause health issues due to their chemical–physical features and biological interactions. These nanostructures cause oxidative stress, also due to endogenous ROS production, which increases following mitochondrial impairment. The aim of this in vitro study was to assess the health effects, due to mitochondrial dysfunction, caused by a sub-chronic exposure to a non-acutely toxic dose of multi walled CNTs (raw and functionalised). The A549 cells were exposed to MWCNTs (2 µg mL^-1) for 36 days. Periodically, cellular dehydrogenases, pyruvate dehydrogenase kinase 1 (PDK1), cytochrome c release, permeability transition pore (mPTP) opening, transmembrane potential (Δψ m), apoptotic cells, and intracellular ROS were measured. The results, compared to untreated cells and to positive control formed by cells treated with MWCNTs (20 µg mL^-1), highlighted the efficiency of homeostasis to counteract ROS overproduction, but a restitutio ad integrum of mitochondrial functionality was not observed. Despite the tendency to restore, the mitochondrial impairment persisted. Overall, the results underlined the tissue damage that can arise following sub-chronic exposure to MWCNTs.

Cucumber (Cucumis sativus L.) is a vital economic vegetable crop, and TRM (TONNEAU1 Recruiting Motif) gene plays a key role in cucumber organ growth. However, the pan-genomic characteristics of the TRM gene family and their expression patterns under different stresses have not been reported in cucumber. In this study, we identified 29 CsTRMs from the pan-genomes of 13 cucumber accessions, with CsTRM29 existing only in PI183967. Most CsTRM proteins exhibited differences in sequence length, except five CsTRMs having consistent protein sequence lengths among the 13 accessions. All CsTRM proteins showed amino acid variations. Analysis of CsTRM gene expression patterns revealed that six CsTRM genes strongly changed in short-fruited lines compared with long-fruited lines. And four CsTRM genes strongly responded to salt and heat stress, while CsTRM14 showed responses to salt stress, powdery mildew, gray mold and downy mildew. Some CsTRM genes were induced or suppressed at different treatment timepoint, suggesting that cucumber TRM genes may play different roles in responses to different stresses, with expression patterns varying with stress changes. Remarkably, the expression of CsTRM21 showed considerable change between long and short fruit and in responses to abiotic stresses (salt stress, heat stress) as well as biotic stresses (powdery mildew, gray mold), suggesting a dual role of CsTRM21 in both fruit shape determination and stress resistance. Collectively, this study provided a base for further functional identification of CsTRM genes in cucumber plant growth and stress resistance.

The characteristics of response to stressful situations depend on a complex of factors such as personality traits, emotional regulation, health state, features of the nervous system, motor functions and proprioception. In cases of disruption of the brain's dopamine system due to disease or chemotherapy, hormone discharge due to stress, changes in emotions and proprioception may occur. The aim of our study was to find the relationship of stress resilence in verbal test and individual differences performed in proprioceptive test in onco-patients, sportsmen and group of control; as well as to observe the differences between these groups in the verbal stress resistance and individual differences proprioceptive tests. The results showed that onco-patients were less resistant as per verbal stress resistance outcomes for a major part of variables compared to other groups. The sportsmen were superior in verbal Risk and Control dimensions compared to other groups; but less in Positive Affectiveness. The proprioceptive test perfomance revealed the only statistically significant difference in performance in the dimension related to Mood, showing more Pessimism in the sportsmen group, but more Optimism in the oncopatients at temperamental (or intrisinc) level. The obtained results can be used by psychologists, therapists, coach and healthcare when needed to attend the specific needs of public, being pateints or sportsmen, etc.

Keywords: Fatigue crack propagation; Welding residual stress; Plastic re-distribution; Stress ratio effect

Iris laevigata Fisch. is a perennial aquatic plant with strong cold resistance and showy flowers. However, the flowering period of a single flower is only two days, greatly limiting its potential use in landscaping and the cutting-flower industry. In addition, I. laevigata is often challenged with various abiotic stresses including high salinity and drought in its native habitat. Thus, breeding novel cultivars with prolonged flowering time and higher resistance to abiotic stress is of high importance. In this study, we first performed genome-wide identification of WRKYs, key transcription factors in modulating flowering time and abiotic stress responses. We overexpressed IlWRKY22 in Arabidopsis thaliana and found the flowering time was delayed in the transgenic plants. Molecular characterization further revealed that IlWRKY22 promotes the expression of CO and GA20OX genes in the photoperiod and gibberellin pathways, respectively, and inhibits the expression of SPL3 in the aging pathway. We also created transgenic Nicotiana tabacum overexpressing IlWRKY22, which showed significantly improved resistance to both salt and drought compared to control plants. Specifically, the photosynthetic rate, maximum potential quantum efficiency of Photosystem II (Fv/Fm), and chlorophyll content were higher in the transgenic plants, which was accompanied with higher antioxidant enzyme activity and lower levels of reactive oxygen species. Thus, our study revealed a unique dual function of IlWRKY22, an excellent candidate gene for breeding novel I. laevigata cultivars of desirable traits.

Testicular heat stress is a well described phenomenon that occurs in mammals that possess a scrotum. Different models to induce testicular hyperthermia, such as surgical cryptorchidism, hot water bath, scrotal insulation or increased environmental temperature have all shown that spermatocytes and spermatids are unambiguously affected by high temperature, resulting in poor sperm production weeks later. Furthermore, a body of evidence suggest the involvement of oxidative stress is either a major or contributory pathway, which gives rise to the potential to overcome this condition. Whilst experimental models conclusively show the deleterious effect of testicular heat on sperm quality, the physiological relevance of the work is still debated. Herein we summarise a cohort of studies that report the effect of “season” on sperm quality. The data show season can affect sperm production, motility and morphology depending on where the work was performed. In countries where temperatures drop below zero, there is evidence showing summer conditions tend to improve semen quality. However, in sub-tropical countries, some studies show a decrease in summer, whilst others show no change. Herein we offer a reasonable explanation for this apparent controversy and present a range of antioxidant supplements that may offer some protection against testicular hyperthermia.

The WRKY gene family in plants regulates the plant's response to drought through regulatory networks and hormone signaling. AfWRKY20 (MT859405) was cloned from A. fruticosa (Amorpha fruticosa,A. fruticosa) seedlings using RT-PCR. The binding properties of the AfWRKY20 protein and the W-box (a DNA cis-acting element) were verified both in vivo and in vitro using EMSA and Dual-Luciferase activity assays. RT-qPCR detected that the total expression level of AfWRKY20 in leaves and roots was 22 times higher in the 30% PEG6000 simulated drought treatment compared to the untreated group. Under the simulated drought stress treatments of sorbitol and ABA (abscisic acid,ABA), the transgenic tobacco with the AfWRKY20 gene showed enhanced drought resistance at the germination stage, with significantly increased germination rate, green leaf rate, fresh weight, and root length compared to the WT (wild type,WT) tobacco. In addition, the SOD (superoxide dismutase,SOD)activity, chlorophyll content, and Fv/Fm ratio of AfWRKY20 transgenic tobacco were significantly higher than those of the WT tobacco under natural drought stress, while the MDA (malondialdehyde,MDA) content and DAB (3,3'-diaminobenzidine,DAB) and NBT (nitroblue tetrazolium,NBT) staining levels were lower. The expression levels of oxidation kinase genes (NbSOD, NbPOD, and NbCAT) in transgenic tobacco under drought stress were significantly higher than those in WT tobacco. This enhancement in gene expression improved the ability of transgenic tobacco to detoxify ROS (reactive oxygen species,ROS). The survival rate of transgenic tobacco after natural drought rehydration was four times higher than that of WT tobacco. In summary, this study revealed the regulatory mechanism of AfWRKY20 in response to drought stress-induced ABA signaling, particularly in relation to the ROS. This finding provides a theoretical basis for understanding the pathways of WRKY20 involved in drought stress, and offers genetic resources for molecular plant breeding aimed at enhancing drought resistance.

Large aluminum alloy ring forgings are the core components of heavy-duty rocket fuel storage tanks, and the large residual stress inside the rings leads to poor shape accuracy of large thin-walled parts. The initial stress of the 2219 aluminum alloy ring blank was tested using the drilling method, and the creep constitutive coefficient of the 2219 aluminum alloy was determined through stress relaxation tests. The numerical simulation processes of thermal stress relief (TSR), vibration stress relief (VSR), and thermal-vibration stress relief (TVSR) were compared and established. Through the correlation analysis between the actual measurement results of residual stress and the simulation results, it can be seen that the strong correlation in three directions at each measurement point accounts for over 37.5%, and the moderate correlation accounts for over 62.5%. This indicates that the numerical simulation model of 2219 aluminum alloy ring containing initial residual stress can accurately reflect the size and distribution of residual stress inside the actual ring. The simulation results show that the derived constitutive model can describe the stress relaxation process of TVSR by combining a single thermal time effect stress relaxation constitutive theory with a VSR plastic deformation material model. The simulation models established above were used to calculate the residual stress homogenization ability of three types of aging. The results showed that VSR, TSR, and TVSR can homogenize and reduce the residual stress field inside the ring, improve the distribution of residual stress inside the ring, and have a better overall homogenization ability of TVSR. The VSR control has a certain effect on reducing and homogenizing residual stress, but compared with TSR and TVSR, the reduction and homogenization ability of residual stress control is limited. The homogenization control effect TVSR>TSR>VSR, and the maximum equivalent stress homogenization rates of VSR, TSR, and TVSR are 52.8%, 80.6%, and 82.2%, respectively. Then, numerical simulation technology is used to study how the initial residual stress in the blank will cause the deformation of the ring during the thin-walled machining process. The roundness error theory of the minimum containment area method is applied to evaluate the deformation degree during the thin-walled numerical machining process, and the TVSR method is used for stress regulation. The deformation law of the thin-walled machining of the ring under different aging parameters is studied.

Climate change poses a serious threat to global agricultural activity and food production. To address this issue, plant genome editing technologies have been developed to provide an alternative solution for crop improvement. Unlike conventional breeding techniques (e.g., selective breeding and mutation breeding), modern genome editing tools offer more targeted and specific alterations of the plant genome to produce crops with desired traits, such as higher yield and/or stronger resilience to the changing environment. In this review, we discuss the current development and future applications of genome editing technologies in mitigating the impacts of biotic and abiotic stresses on agriculture. We focus specifically on the CRISPR/Cas system, which has been the center of attention in the last few years as a revolutionary genome-editing tool in various species. We also conducted a bibliographic analysis on CRISPR-related papers published from 2012 to 2021 (10 years) to identify trends and possible gaps in the CRISPR/Cas-related plant research. In addition, this review article outlines the current shortcomings and challenges of employing genome editing technologies in agriculture with notes on future prospective. We believe combining conventional and more innovative technologies in agriculture would be the key to optimizing crop improvement beyond the limitations of traditional agricultural practices.

Excretory-secretory products (ESPs) are the main research targets for investigating the hosts and helminths interaction. Parasitic worms can migrate to parasitic sites and avoid the host immune response by secreting this product. Angiostrongylus cantonensisis an important food-borne zoonotic parasite that causes severe neuropathological damage and symptoms, including eosinophilic meningitis or meningoencephalitis in humans. Benzaldehydes are organic compounds composed of a benzene ring and formyl substituents. This compound has anti-inflammatory and antioxidation properties. Previous studies showed that 3-hydroxybenzaldehyde (3-HBA) and 4-hydroxybenzaldehyde (4-HBA) can reduce apoptosis in A. cantonensis ESPs treated astrocytes. These results on the protective effect underlying benzaldehyde have primarily focused on cell survival. The study was designed to investigate the molecular mechanisms of endoplasmic reticulum stress (ER stress) and oxidative stress in astrocytes in A. cantonensis ESPs treated astrocytes and to evaluate the therapeutic consequent of 3-HBA and 4-HBA. First, we initially established the RNA-seq dataset in each group, including Normal, ESPs, ESPs+3-HBA, and ESPs+4-HBA. We also found that benzaldehyde (3-HBA and 4-HBA) can stimulate astrocytes to express ER stress-related molecules after ESP treatment. The level of oxidative stress could also be decreased in astrocytes by elevating antioxidant activity and reducing ROS generation. These results suggested that benzaldehyde may be a potential therapeutic compound for human angiostrongyliasis to support brain cell survival by inducing the expression levels of ER stress- and oxidative stress-related pathway.