Fructan, a fructose polymer, is used as carbohydrate reserve in many plants. The nutritional and therapeutic benefits of fructans have attracted increasing interest by consumers and food industry. In the course of evolution, many plants have developed the ability of regulating plant frunctan metabolism genes to produce different structures and chain length fructans, which are strongly correlated with their survival in harsh environments. De nevo domestication of fructan-rich plants based on genome editing is a viable and promising approach to improve human dietary quality and reduce the risk of chronic disease. These advances will greatly facilitate breeding and production of tailor-made fructans as a healthy food ingredient from wild plants such as polygonati rhizoma. The purpose of this review is to broaden our knowledge on plant fructan biosynthesis, evolution and beneficial applications for human health.

When the antioxidants in our immune system cannot neutralize or convert Reactive oxygen species into safe molecules at the rate at which it is produced then this imbalance is termed as “oxidative stress”. It is related with a wide array of diseases that includes cancer, diabetes, cardiovascular diseases, hypertension etc. These ROS species however are utmost essential for the proper functioning of human body which are produced as a consequence of partial oxidation of cellular metabolism performing essential functions such as protein phosphorylation, activation of several transcriptional factors, apoptosis, immunity, and differentiation. The sources by which these are produced can be broadly classified are intrinsic and extrinsic sources. There are variety of natural antioxidant enzymes of human body that combat against this oxidative stress. The extrinsic sources of ROS include the use of natural plants, extracted flavonoids and vitamins. In this review we will briefly explain how the sources of ROS, its essential function in human body, its elevation and associated damage to organs and effect on various diseases, and a hope of finding a way of how this oxidative stress can be exploited for therapeutic potential.

Pediculus humanus capitis, the head louse, is an obligate blood-sucking ectoparasite that occurs in six divergent mitochondrial haplogroups (A, D, B, F, C and E), each exhibiting a particular geographic distribution. A few years ago, several studies reported the presence of different pathogenic agents in head lice specimens from different clades collected worldwide. These findings suggest that head louse could be a vector for dangerous diseases and therefore a serious public health problem. Herein, we aimed to study the mitochondrial genetic diversity, the PHUM540560 gene polymorphisms profile of head lice collected in Guinea, as well as to screen for the pathogens present in these lice. In 2018, a total of 155 head lice were collected from 49 individuals at the Medicals Centers of rural (Maférinyah village) and urban (Kindia city) areas, in Guinea. All head lice were subjected to genetic analysis and screened for the presence of several pathogens using molecular tools. The results showed that all head lice belonged to the haplogroups C/E using the duplex qPCR which detects both clades. Standard PCR and sequencing revealed that all specimens belonged to the haplogroup E, including 8 haplotypes, whither 6 new identified for the first time in this study. The study of the PHUM540560 gene polymorphisms in our Guinean head lice revealed that 7/40 (17.5%) of our tested samples exhibit three different polymorphism profiles compared to the clade A-head lice PHUM540560 gene profile, while the remaining specimens 33/40 (82,5%) showed the same PHUM540560 gene polymorphism profile as the previously reported clade A-body lice. Molecular investigations of the targeted pathogens revealed only the presence of Acinetobacter species in 9% of our samples using real time PCR. Sequencing results identified highlighted the presence of several Acinetobacter species, including Acinetobacter baumannii (14.3%), Acinetobacter nosocomialis (14.3%), Acinetobacter variabilis (14.3%), Acinetobacter haemolyticus (7.2%), Acinetobacter towneri (7.2%). Furthermore, a candidate new species of Acinetobacter sp. (7.2%) was detected. Positive specimens were collected from 24,5% individuals in Maférinyah. We also investigated in our study the carbapenem’s-resistant profile of A. baumannii, none of our specimens were positive for the following resistance genes blaOXA-21, blaOXA-24 and blaOXA-58. To the best of our knowledge, our study is the first to report the existence of the Guinean haplogroup E, the PHUM540560 gene polymorphism profile as well as the presence of Acinetobacter species in head lice collected from Guinea.

Remdesivir (RDV) has garnered much hope for its moderate anti-COVID-19 effects, but its limited amelioration of survival in hospitalized patient causes a huge controversy over the applicability of RDV to COVID-19 treatment. Developing strategies to improve its antivirus efficacy is urgently required. As anticipated, RDV exhibits similar behavior with other nucleotide analogs to disrupt the metabolism of natural endogenous ribonucleotides (RNs) and deoxyribonucleotides (dRNs). Alterations in endogenous RNs and dRNs play a critical role in virus replication as well as other key cellular functions. Thus elucidation of the disturbances of RDV on RNs and dRNs could help to understand its exact mechanism of action. Here, the metabolic profiling determined by liquid chromatography–mass spectrometry method showed a general increase in the abundance of nucleotides and a more than 2-fold increase for specific nucleotides. However, the variation of pyrimidine ribonucleotides was relative slight or even contrary, resulting in obvious imbalance between purine and pyrimidine ribonucleotides, which implied the obstacle of RDV to pyrimidine synthesis and could further block the transcription and replication of viral RNA. Additionally, the extreme disequilibrium between cytidine triphosphate (CTP) and cytidine monophosphate might result from the inhibition of CTP synthase and provide a metabolic target for the treatment of COVID-19 infection. Since nucleotides metabolism pathways are vulnerable to nucleotide analogues and are liable to be the regulation targets, it is promising to enhance the efficacy of RDV through co-administration with CTP synthase inhibitors or de novo pyrimidine synthesis inhibitors to exacerbate the imbalance of nucleotide pools.

In recent years, photobiomodulation (PBM) has been recognized as a physical therapy in wound management. Despite several published research papers, the mechanism underlying photobiomodulation is still not completely understood. The investigation about application of blue light to improve wound healing is a relatively new research area. Tests in selected patients evidenced a stimulation of the healing process in superficial and chronic wounds treated with a blue LED light emitting at 420 nm; a study in animal model pointed out a faster healing process in superficial wound, with an important role of fibroblasts and myofibroblasts. Here we present a study aiming at evidencing the effects of blue light on the proliferation and metabolism in fibroblasts and keratinocytes. Different light doses were used to treat the cells, evidencing inhibitory and stimulatory effects. Electrophysiology was used to investigate the effects on membrane currents, while Raman spectroscopy revealed the mitochondrial Cytochrome C (Cyt C) oxidase dependence on blue light irradiation. In conclusion, we observed that the blue LED light can be used to modulate the activity of human fibroblasts, and the effects in wound healing are particularly evident when studying the fibroblasts and keratinocytes co-cultures.

In humans, coronaviruses can cause infections of the respiratory system, with damage of varying severity depending on the virus examined: ranging from mild or moderate upper respiratory tract diseases, such as the common cold, to pneumonia, severe acute respiratory syndrome, kidney failure and even death. Human coronaviruses known to date, common throughout the world, are seven. The most common - and least harmful - ones were discovered in the 1960s and cause a common cold. Others, more dangerous, were identified in the early 2000s and cause more severe respiratory tract infections. Among these the SARS-CoV, isolated in 2003 and responsible for the Severe Acute Respiratory Syndrome (the so-called SARS), which appeared in China in November 2002, the Coronavirus 2012 (2012-nCoV) cause of the Middle Eastern Respiratory Syndrome from Coronavirus (MERS), which exploded in June 2012 in Saudi Arabia, and actually SARS-CoV-2. On December 31, 2019, a new Coronavirus strain was reported in Wuhan, China, identified as a new Coronavirus beta strain ß-CoV from Group 2B, with a genetic similarity of approximately 70% to SARS-CoV, the virus responsible. of SARS. In the first half of February, the International Committee on Taxonomy of Viruses (ICTV), in charge of the designation and naming of the viruses (i.e., species, genus, family, etc.), thus definitively named the new coronavirus as SARS-CoV-2. This article highlights the main knowledge we have about the biomolecular and pathophysiologic mechanisms of SARS-CoV-2.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), an RNA virus, is responsible for coronavirus disease 2019 (COVID-19) pandemic of 2020. Experimental evidence suggests that microRNA can mediate an intracellular defence mechanism against some RNA viruses. The purpose of this study was to identify microRNA with predicted binding sites in the SARS-CoV-2 genome, compare these to their microRNA expression profiles in lung epithelial tissue and make inference towards possible roles for microRNA in mitigating coronavirus infection. We hypothesize that high expression of specific coronavirus-targeting microRNA in lung epithelia may protect against infection and viral propagation, conversely low expression may confer susceptibility to infection. We have identified 128 human microRNA with potential to target the SARS-CoV-2 genome, most of which have very low expression in lung epithelia. Six of these 128 microRNA are differentially expressed upon in vitro infection of SARS-CoV-2. Twenty-eight and 23 microRNA also target the SARS-CoV and MERS-CoV, respectively. In addition, 48 and 32 microRNA are commonly identified in two other studies. Further research into identifying bona fide coronavirus targeting microRNA will be useful in understanding the importance of microRNA as cellular defence mechanism against pathogenic coronavirus infections.

We have surveyed peer-reviewed literature on the awareness of human papillomavirus (HPV) infection among Indigenous males in North America and Oceania. Using keywords HPV plus male, men or boy, and ethnical filters such as Indigenous, Aboriginal or First Nations, we retrieved 47 articles based on titles of which we kept 14 after reading the abstracts. Reported HPV awareness was generally low in Indigenous males in North America with no peer-reviewed data from Oceania. The lower understanding by males compared to females was largely attributable to misconceptions about HPV-related diseases, their transmission, and prevention. Lack of awareness and concern toward the risk of contracting HPV infection in Indigenous males suggests an impediment in disseminating health information about this cancer-causing virus. Culturally sensitive education, with emphasis on Indigenous males, is needed to improve this group’s HPV knowledge. Researchers should also engage meaningfully with Indigenous communities by building rapport to achieve a positive change in attitude.

The Zika virus (ZIKV) is a mosquito-borne Flavivirus and can be transmitted through an infected mosquito bite or through human-to-human interaction by sexual activity, blood transfusion, breastfeeding or perinatal exposure. After the 2015-2016 outbreak in Brazil, a strong link between ZIKV infection and microcephaly emerged. ZIKV specifically targets human neural progenitor cells, suggesting that proteins encoded by ZIKV bind and inactivate host cell proteins leading to microcephaly. Here, we present a systematic annotation of interactions between human proteins and the seven non-structural ZIKV proteins corresponding to a Brazilian isolate. The interaction network was generated by combining tandem-affinity purification followed by mass spectrometry with yeast two-hybrid screens. We identified 150 human proteins, involved in distinct biological processes, as interactors to ZIKV non-structural proteins. Our interacting network is composed of proteins that have been previously associated with microcephaly in human genetic disorders and/or animal models. This study builds on previously published interacting networks of ZIKV and genes related to autosomal recessive primary microcephaly to generate a catalog of human cellular targets of ZIKV proteins implicated in processes related to microcephaly in humans. Collectively, this data can be used as a resource for future characterization of ZIKV infection biology and help create a basis for the discovery of drugs which may disrupt the interaction and reduce the health damage to the fetus.

Objective: Lipids are secreted into milk as bilayer-coated structures: milk lipid globules (MLGs). Adipophilin (ADRP) and perilipin 3 (TIP47) are associated with MLGs in human breast milk; however, the role of these proteins in milk lipid secretion is not fully understood. The aim of the study was to investigate levels of ADRP, TIP47 and total lipid content in human breast milk, their mutual correlations and dynamics during lactation. Research Methods & Procedures: Milk samples from 22 healthy lactating women (Caucasian, Central European) were collected at five time points during lactation (1–3, 12–14, 29–30, 88–90 and 178–180 days postpartum). Mass spectrometry-based method was used for quantification of ADRP and TIP47 in the samples. The gravimetric method was used to determine milk total lipid content. Results: We observed distinctive trends in ADRP, TIP47 levels and lipid content in human breast milk during the first 6 months of lactation. We also found a significant association between lipid content and ADRP, lipid content and TIP47, and ADRP and TIP47 concentrations in breast milk at all sampling points. Moreover, we derived an equation for estimating the mean lipid content of milk based on ADRP concentration in human breast milk. Conclusions: A mass spectrometry-based method was developed for quantifying ADRP and TIP47 in human breast milk. Strong mutual correlations were found between ADRP, TIP47 and total lipid content in human breast milk.

Bronchopulmonary dysplasia (BPD) is the most common complication after preterm birth. Pasteurized donor human milk (DHM) has increasingly become the standard of care for very preterm infants over the use of preterm formula (PF) if mother’s own milk (MOM) is unavailable. Studies have reported beneficial effects of DHM on BPD. We conducted a systematic review and meta-analysis of randomized controlled trials (RCTs) and observational studies on the effects of DHM on BPD and other respiratory outcomes. Eighteen studies met the inclusion criteria. Meta-analysis of RCT’s could not demonstrate that supplementation of MOM with DHM reduced BPD when compared to PF (3 studies, risk ratio [RR] 0.89, 95% confidence interval [CI] 0.60–1.32). However, meta-analysis of observational studies showed that DHM supplementation reduced BPD (8 studies, RR 0.78, 95% CI 0.67–0.90). An exclusive human milk diet reduced the risk of BPD, compared to a diet with PF and/or bovine milk-based fortifier (3 studies, RR 0.80, 95% CI 0.68–0.95). Feeding raw MOM, compared to feeding pasteurized MOM, protected against BPD (2 studies, RR 0.77, 95% CI 0.62–0.96). In conclusion, our data suggest that DHM protects against BPD in very preterm infants, but pasteurization of human milk reduces the benefit.

It is postulated in this research that the paradox of “advances in technology and management not keeping pace with the ever-increasing urban problems” is due to the poor understanding of person-focused governance of societal, environmental and economic entities. Therefore, the objective of this paper is to present an adaptive institutional model of person-driven effectiveness and ineffectiveness. The model proposes that human, ecologic and economic outcomes are heavily influenced by a complex system of systems, spanning from individually unique “non-physical influencers” to a broader set of social and environmental influencers that have a common impact on the larger society-environment-economy (SEE) system. At the heart of the model is an analytic formulation that explains the phenomena of non-physical blocker, enhancer and indifferent that are responsible for the adaptation and maladaptation of social agents, and accordingly for the sustainability and unsustainability of SEE systems. Examples are provided to illustrate the model applications: (a) the non-physical and maladaptive syndromes as antecedents of multi-morbidity and (b) the broadened and narrowed minds as sources of sustainability and unsustainability at the SEE system level within the context of emerging technologies such as engineered nanomaterials.

Asthma is a chronic inflammatory airway disease induced by many environmental factors. The inhalation of allergens and pollutants promote the reactive oxygen species (ROS) production leading to airway inflammation, hyper-responsiveness and remodeling in allergic asthma. The effects of asthma medications on ROS production are unclear. The present study investigated the anti-ROS effects of current asthma medications including inhaled corticosteroid (ICS; budesonide and fluticasone), leukotriene receptor antagonist (LTRA; montelukast), long acting β2 agonists (LABAs; salmeterol and formoterol) and a new extra-LABA (indacaterol). The human monocyte cell line THP-1 cells were pre-treated with different concentrations of the asthma medications at different time-points after hydrogen peroxide (H₂O₂) stimulation. H₂O₂ production was measured with DCFH-DA by flow cytometry. Montelukast, fluticasone and salmeterol suppressed H₂O₂-induced ROS production. Indacaterol enhanced H₂O₂-induced ROS production. Budesonide and formoterol alone had no anti-ROS effects, but the combination of these two drugs significantly suppressed H₂O₂-induced ROS production. Different asthma medications have different anti-ROS effects on monocytes. The combination therapy with LABA and ICS seemed not be the only choice for asthma control. Montelukast may be also a good supplemental treatment for the poorly-controlled asthma because of its powerful anti-ROS effects. Our findings provide a novel therapeutic view in asthma.

Our skin epidermis constitutes the most important innate defense barrier against all pathogens. Therefore, even if skin lesions are common due to infections, scarring, genetic disorders, and other diseases, skin integrity is crucial for maintaining body homeostasis. Marine collagen peptides (MCPs) and Glycosaminoglycans (GAGs) have been described as potential wound healing (WH) agents. Recently, through an ex vivo clinical approach, we have demonstrated the nutricosmetic potential of fish cartilage hydrolysate (FCH), which presents a combination of collagen peptides and GAGs. Here, we coupled a clinical approach with in vitro experiments on human dermal fibroblasts (HDFs) and applied a Data Independent Acquisition - Parallel Accumulation Serial Fragmentation (diaPASEF) proteomic analysis, to assess the potential benefit of FCH in WH and its mode of action. Our results show that human serum enriched with circulating metabolites resulting from FCH ingestion, improved wound closure in scratch assays. In support, some proteins with anti-inflammatory and immunomodulatory properties or prone to promote hydration and extracellular matrix (ECM) stability showed increased expression in HDFs, after exposure to FCH-enriched serum. These findings suggest that FCH appears as a promising nutrient for WH and skin regeneration.

HIV-associated neurocognitive disorders (HAND) persist under antiretroviral therapy as a complex pathology that has been difficult to study in cellular and animal models. Therefore, we generated an ex vivo human brain slice model of HIV-1 infection from surgically resected adult brain tissue. Brain slice cultures processed for flow cytometry showed >90% viability of dissoci-ated cells within the first three weeks in vitro, with parallel detection of astrocyte, myeloid, and neuronal populations. Neurons within brain slices showed stable dendritic spine density and mature spine morphologies in the first weeks in culture, and they generated detectable activity in multi-electrode arrays. We infected cultured brain slices using patient-matched CD4+ T-cells or monocyte-derived macrophages (MDMs) that were exposed to a GFP-expressing R5-tropic HIV-1 in vitro. Infected slice cultures expressed viral RNA and developed a spreading infection up to 9-days post-infection, which were significantly decreased by antiretrovirals. We also detected infected myeloid cells and astrocytes within slices and observed minimal effect on cellular via-bility over time. Overall, this human-centered model offers a promising resource to study the cel-lular mechanisms contributing to HAND (including antiretroviral toxicity, substance use, and aging), infection of resident brain cells, and new neuroprotective therapeutics.

The water resources policy under climate change impacts water security, which should ensure enough water of good quality for humans and nature. Integrated water management is the state-of-the-art policy support model that, after 20 years in use, failed to achieve in many countries its primary goal of water bodies' good ecological status. Here, we show that this is due to the substantial externalities the anthropocentric character of the model generates. From the historical analysis, three main results are obtained: 1) the nature-human interplay is always composed of the coexistence of two opposite behaviors of conflict and cooperation; 2) this contradiction is a dialectical, general ontological attribute; 3) on the balance of power between nature and humans, three clusters are identified: i) naturalistic; ii) dualistic; iii) anthropocentric. A novel behaviorist dialectical conflict resolution model can resolve the differences between stakeholders and natural laws. The harmonic symbiosis of humans with nature removes environmental externalities and can lead to sustainable water security. Three case studies from the literature illustrate the merits of the new dialectical model.

SOX proteins are transcription factors which play a role in regulating the development of pro-genitor cells and tissue differentiation. Twenty members are known, clustered in eight groups named A to H, and sharing a common DNA-binding domain called the HMG (high-mobility-group) box. Eleven of the SOX genes have been associated with genetic disorders so far, covering a broad spectrum of developmental diseases. SOX4 is a single-exon gene and belongs to the SOXC group together with SOX11 and SOX12. SOX4 variants were recently described to cause a highly penetrant but heterogeneous disorder, with a phenotypic spectrum ranging from mild developmental delay and learning difficulties to intellectual disability with congenital anomalies. Nineteen pathogenic variants were reported to date, generally de novo, heterozygous, and inactivating, either stop-gain or missense, the latter ones primarily targeting the HMG domain. Further, a bi-allelic variant was reported in a single consanguineous family. Copy number variants, leading to whole gene deletion or duplication, are rare and not clearly associated with a neurodevelopmental disorder. Many open questions remain, regarding the definition of variants of unknown significance, a possible role of missense variants outside the HMG domain, genotype-phenotype correlation, the range of phenotypic spectrum and modifying factors, and treatment options.

Understanding how humans perceive animals is important for biodiversity conservation, however, only a few studies about this issue were carried out in South America. We selected two Brazilian cities to assess people’s perceptions of birds: Bauru (São Paulo, Brazil) and Belo Horizonte (Minas Gerais, Brazil). From the bird data we gathered, we developed a questionnaire and applied it between September 2020 and June 2021. The data obtained were analyzed by simple counts, Likert scale, and percentages. Also, open questions were placed on the Free Word Cloud Generator website. Our study confirmed that most respondents are aware of the importance of birds to ecological balance and that respondents had a generally positive attitude towards most of the bird species. However, they disliked exotic species such as the Domestic Dove and the House Sparrow, which are associated with disease, dirt, and disgust. Respondents also underestimated the number of birds that can live in urban areas and the song of birds is still a sense less explored and perceived by people. The concept of environmental perception seeks to cover aspects and understanding these human–biodiversity relationships is essential to successfully guide public policies, urban planning interventions, and environmental education activities.

ATP-binding cassette (ABC) transporters, acting as cellular "pumps," facilitate solutes translocation through membranes via ATP hydrolysis. Their overexpression is closely tied to multidrug resistance (MDR), a major obstacle in chemotherapy and neurological disorder treatment, hampering drug accumulation and delivery. Extensive research has delved into the intricate interplay between ABC transporter structure, function, and potential inhibition for MDR reversal. Cryo-electron microscopy has been instrumental in unveiling structural details of various MDR-causing ABC transporters, encompassing ABCB1, ABCC1, ABCG2, as well as recently revealed ABCC3 and ABCC4 structures. The newly obtained structural insight has deepened our understanding of substrate and drug binding, translocation mechanisms, and inhibitor interactions. Given the growing body of structural information available for human MDR transporters and their associated mechanisms, we believe it is timely to compile a comprehensive review of these transporters and compare their functional mechanisms in the context of multidrug resistance. Therefore, this review primarily focuses on the structural aspects of clinically significant human ABC transporters linked to MDR, with the aim of providing valuable insights to enhance the effectiveness of MDR reversal strategies in clinical therapies.

Background. Human Milk (HM) is a dynamic nourishment: its composition is influenced by several conditions such as gestational age, maternal diet and ethnicity. It appears important evaluate the impact that gestational diseases have on HM components and if their presence, as source of oxidative stress in the mother, influence milk’s redox homeostasis. To assess Preeclampsia (PE) and Gestational Diabetes Mellitus (GDM) effect on milk’s total oxidative load, we chose to investigate both oxidative and antioxidant aspects, with respectively Lipid hydrop-eroxides (LOOHs) and Glutathione (GSH)). Methods. GSH and LOOHs were quantified using an ELISA test. To investigate the effect of pathology on redox homeostasis, mixed linear model with unistructural covariance structure was performed. Results. A total of 120 mothers were re-cruited. The GSH concentration results significant lower in GDM women than in healthy only in colostrum (p<0.01). No other differences emerged. LOOHs was not detectable in almost all the samples. Discussion. Our study is the first to extensively evaluate these components in the HM of women with these gestational pathologies. The main observation is that GDM can alter the anti-oxidant composition of HM mainly in colostrum, but in case of PE, the composition of HM milk is preserved.

Phytoestrogens are plant-derived bioactive compounds with estrogen-like properties. Their potential health benefits, especially in cancer prevention and treatment, have been a subject of considerable research in the past decade. Phytoestrogens exert their effects, at least in part, through interactions with estrogen receptors (ERs), mimicking or inhibiting the actions of natural estrogens. Recently, there has been growing interest in exploring the impact of phytoestrogens on osteosarcoma (OS), a type of bone malignancy that primarily affects children and young adults, and currently presenting limited treatment options. Considering the critical role of estrogen/ERs axis in bone development and growth, the modulation of ERs has emerged as a highly promising approach in the treatment of OS. This review provides an extensive overview of current literature on the effects of phytoestrogens on human OS models. It delves into the multiple mechanisms through which these molecules regulate the cell cycle, apoptosis and key pathways implicated in the growth and progression of OS, including ERs signaling. Moreover, potential interactions between phytoestrogens and conventional chemotherapy agents commonly used in OS treatment will be examined. Understanding the impact of these compounds in OS holds great promise for developing novel therapeutic approaches that can augment current OS treatment modalities.

Teachability has been extensively studied under the context of making industrial robots to be programmable and reprogrammable. However, it is only recently that the artificial intelligence (AI) research community is accelerating the research works with the objective of making humanoid robots and many other robots to be teachable under the context of using natural languages. We human beings spend many years to learn knowledge and skills despite our extraordinary mental capabilities of being teachable with the use of natural languages. Therefore, if we would like to develop human-like robots such as humanoid robots, it is inevitable for us to face the issue of making future humanoid robots to be teachable with the use of natural languages as well. In this paper, we present the key details of a top-down design for achieving a teachable mind which consists of two major processes: the first one is the process which enables humanoid robots to gain innate mental capabilities of transforming incoming signals into meaningful crisp data, and the second one is the process which enables humanoid robots to gain innate mental capabilities of undertaking incremental and deep learning with the main focus of associating conceptual labels in a natural language to meaningful crisp data. These two processes consist of the two necessary and sufficient conditions for future humanoid robots to be teachable with the use of natural languages. In addition, this paper outlines a very likely new finding underlying human brain’s neural systems as well as the obvious mathematics underlying artificial deep neural networks. These outlines provide us the strong reason to separate the study of mind from the study of brain. Hopefully, the content discussed in this paper will help the AI research community to venture into the right direction which is to make future humanoid robots, non-humanoid robots, and many other systems to achieve human-like self-intelligence at cognitive level with the use of natural languages.

Prostate cancer is a common cancer among men and typically progresses slowly for several decades before becoming aggressive and spreading to other organs, leaving few treatment options. While large animals have been studied, the dog's prostate is anatomically similar to humans and has been used to study spontaneous prostate cancer. However, most research currently focuses on the mouse as a model organism due to the ability to genetically modify their prostatic tissues for molecular analysis. One hallmark in this research was the identification of the prostate-specific promoter Probasin, allowing for prostate-specific expression of transgenes. This has led to generations of mice with aggressive prostatic tumors through overexpression of the SV40 oncogene. The Probasin promoter is also used to drive Cre expression and allow researcher to generated prostate specific loss-of-function studies. Another landmark in the process of modeling prostate cancer in mice was orthoptic delivery of viral particles. This technology allows selective overexpression of oncogenes from lentivirus or the use of CRISPR to generate complex loss of function studies. These genetic modified models are complemented by classical xenografts of human prostate tumor cells in immune deficient mice. Overall, pre-clinical models have provided a portfolio of model systems to study and address complex mechanisms in prostate cancer for improved treatment options. This review will focus on the advances of each technique.

Balanced fear supports human rational decision making and useful behavioral responses. In contrast, overwhelming, persistent, and unbalanced fear can paralyze the individual and result in heightened anxiety, lack of cognitive flexibility, fear-based public compliance and serious mental health issues. Psychobiotics research has established that a healthy microbiome is required for balanced fear and mental health protection via control of fear extinction. The recent Covid-19 pandemic featured daily, persistent, fear-of-a single contagion conditioning on a global scale paired with various behavioral mandates (e.g., lockdowns of the healthy, masks, isolation from environmental microbes and each other) that degraded the human microbiome and isolated us from each other and useful environmental microbes. It also ignored the historic role of secondary bacterial pathobionts, in pandemic deaths. This narrative review examines how institutional promotion of fear-of-a single contagion, lack of balanced risk communication, and appalling disregard of our fundamental nature (as majority-microbial human superorganisms) resulted in problems rather than solutions. This review concludes that government-public health-media promotion of pervasive fear and microbiome-degrading behaviors: 1) increased public compliance, 2) reduced cognitive flexibility, and 3) increased risk of mental health conditions. It further argues that microbiome-first public health should be embraced to ensure that human freedom, rather than paralyzing fear, dominates our future.

Human pluripotent stem cells (PSCs), which include both embryonic and induced pluripotent stem cells, are widely used in fundamental and applied biomedical research. They have been instrumental for better understanding development and cell differentiation processes, disease origin and progression, and can aid in the discovery of new drugs. PSCs also hold great potential in regenerative medicine to treat or diminish the effects of certain debilitating diseases, such as degenerative disorders. However, some concerns have recently been raised over their safety for the use in regenerative medicine. One of the major concerns is the fact that PSCs are prone to errors in passing the correct number of chromosomes to daughter cells, resulting in aneuploid cells. Aneuploidy, characterised by an imbalance in chromosome number, elicits the upregulation of different stress pathways that are deleterious to cell homeostasis, impair proper embryo development and can potentiate cancer development. In this review we will summarise known molecular mechanisms recently revealed to impair mitotic fidelity in human PSCs and the consequences of the decreased mitotic fidelity of these cells. We will finish with speculative views on how the physiological characteristics of PSCs can affect the mitotic machinery and how their suboptimal mitotic fidelity may be circumvented.

With the emergence of new VR/AR technologies, the question arises of how they can be used in human-swarm interaction. Where are the limitations and boundaries of conventional interfaces, and how can VR/AR overcome them? To find out, a user study was conducted. The subjects were able to interact with an autonomously acting swarm of drones using both a conventional desktop interface (Desktop-HSI) and a newly developed VR interface (VR-HSI).The resulting assessments are used as a basis for determining the extent to which this new technology can be applied in human-swarm interaction. The technical basis was an already tested simulation software that was expanded with a network interface to allow interacting with a drone swarm using connected HSIs (Human-Swarm Interfaces). Standardized communication was emphasized to enable the development of HSIs with different requirements. Specifically for this work, a VR-HSI was developed with Unity and a desktop-HSI with Java and their performance regarding human-swarm interaction was evaluated.

In recent years, with the rapid development of computer vision technology and the popularization of intelligent hardware, as well as people’s increasing demand for intelligent products for human-computer interaction, visual grounding technology can help machines and humans identify and locate objects, thereby promoting human-computer interaction and intelligent manufacturing. At the same time, human-computer interaction is constantly evolving and improving, becoming increasingly intelligent, humane, and efficient. This paper proposes a new VG model and designs a language verification module that uses language information as the main information to increase the model’s interactivity. Additionally, we propose the combination of visual grounding and human-computer interaction, aiming to explore the research status and development trends of visual grounding and human-computer interaction technology, as well as their application in practical scenarios and optimization directions, to provide references and guidance for relevant researchers and promote the development and application of visual grounding and human-computer interaction technology.

The potentially active A subunit of coagulation factor XIII (FXIII-A) is an intracellular transglutaminase expressed in various cell types including platelets and monocytes/macrophages. It is involved in stabilizing protein structures by cross-linking through Nε-(?-L-glutamyl)-L-lysyl iso-peptide bonds. Macrophages are major cellular constituents of the atherosclerotic plaque and are important in determining its structural/functional features. Two of their important functions are the accumulation of oxidized LDL in the lipid core, and by cross-linking structural proteins they may stabilize the plaque and protect the thrombi of atherogenic origin against fibrinolytic degradation. It is important to know whether these functions operate in parallel utilizing the same cellular compartments. First, we showed that monocyte-derived human macrophages significantly increase their FXIII-A content when up-taking oxidized LDL. This phenomenon is very likely independent of the process of transformation into foam cells, as the transformation of vascular smooth muscle cells into foam cells fails to result in the expression of FXIII-A. FXIII containing macrophage-like cells are abundant in the plaque and FXIII-A is also present in the extracellular core. Several cells co-stained for FXIII-A and for Oil Red O suggest that expression of FXIII-A and lipid up-take are common features of macrophages present in the atherosclerotic plaque.

This paper describes the successful application of the Transformer model used in the natural language processing and vision tasks as a means of processing the time series of signals from gyroscope and accelerometer sensors for the classification of human activities. The Transformer model is based on deep neural networks with many layers which can generalize well on signals. All measured signals come from a smartphone placed in a waist bag. Activity prediction is sequence-to-sequence, each time step of the signal is assigned a designation of the performed activity. Emphasis is placed on attention mechanisms, which express individual dependencies between signal values within a time series. In comparison with another recent result, the recognition precision was improved from 89.67 percent to 99.2 percent. The transformer model should in the future be included among the top options in machine learning methods for human activity recognition.

Cyber defense is reactive and slow. On average, the time-to-remedy is hundreds of times larger than the time-to-compromise. In response to the expanding ever-more-complex threat landscape, Digital Twins (DTs) and particularly Human Digital Twins (HDTs) offer the capability of running massive simulations across multiple knowledge domains. Simulated results may offer insights into adversaries' behaviors and tactics, resulting in better proactive cyber-defense strategies. For the first time, this paper solidifies the vision of DTs and HDTs for cybersecurity via the Cybonto conceptual framework proposal. The paper also contributes the Cybonto ontology, formally documenting 108 constructs and thousands of cognitive-related paths based on 20 time-tested psychology theories. Finally, the paper applied 20 network centrality algorithms in analyzing the 108 constructs. The identified top 10 constructs call for extensions of current digital cognitive architectures in preparation for the DT future.

Individual response to drugs is highly variable and largely influenced by genetic variants and gene-expression profiles. Also, it has been shown that response to drugs is strongly sex-dependent, both in terms of efficacy and toxicity. To expand current knowledge on sex differences in the expression of genes relevant for drug response, we generated a catalogue of differentially expressed human transcripts encoded by 289 genes in 41 human tissues from 838 adult individuals of the Genotype-Tissue Expression project (GTEx, v8 release) and focused our analysis on relevant transcripts implicated in drug response. We have detected significant sex-differentiated expression of 99 transcripts encoded by 59 genes in the tissues most relevant for human pharmacology (Liver, Lung, Kidney, Small intestine terminal ileum, Skin not sun-exposed, and Whole Blood). Among them, as expected, we observed significant differences in the expression of transcripts encoded by the cytochromes in the liver, CYP2B6, CYP3A7, CYP3A5, and CYP1A1. Our systematic investigation on differences between male and female in the expression of drug response related genes, reinforce the need to overcome the sex bias of clinical trials.

Pathogenic Neisseria gonorrhoeae causes the sexually-transmitted infection gonorrhea. N. gonorrhoeae has evolved high levels of antimicrobial resistance (AR) leading to therapeutic failures even in dual-therapy treatment with azithromycin and ceftriaxone. AR mechanisms can be acquired by genetic transfer from closely related species, such as naturally-competent commensal Neisseria species. At present, little is known about the antimicrobial resistance profiles of commensal Neisseria. Here, we characterized the phenotypic resistance profile of four commensal Neisseria species (N. lactamica, N. cinerea, N. mucosa, and N. elongata) against 10 commonly used antibiotics, and compared their profiles to 4 N. gonorrhoeae strains, using disk diffusion and minimal inhibitory concentration assays. Overall, we observed that 3 of the 4 commensals were more resistant to several antibiotics than pathogenic N. gonorrhoeae strains. Next, we compared the penicillin-binding-protein 2 (PBP2) sequences between commensal and N. gonorrhoeae strains. We found mutations in PBP2 known to confer resistance in N. gonorrhoeae also present in commensal Neisseria sequences. Our results suggest that commensal Neisseria have unexplored antibiotic resistance gene pools that may be exchanged with pathogenic N. gonorrhoeae, possibly impairing drug development and clinical treatment.

The knowledge of human body proportion and segmental properties of limbs, head and trunk are of fundamental importance in biomechanical research. As many methods are employed, it is important to know which they are currently available, which data on human body masses, lengths, center of mass (COM) location, weights and moment of inertia are available and which methods are most suitable for a specific research purposes. The present review examines the literature concerning human body segments properties for biomechanical purposes. It emerges that data obtained in studies on cadaveric specimens are still the most accurate, whilst technological tools currently available are manifolds, each one with proper advantages and disadvantages. Classical studies were focused mainly on white men, while in recent year the available data of body segments has been extended to children, woman, and other races. Also, data on special population (obese, pregnant women) are starting to appear in the scientific literature.

The pomegranate, an ancient plant native to Central Asia, cultivated in different geographical areas including the Mediterranean basin and California, consists of flowers, roots, fruits and leaves. Presently, it is utilized not only for the exterior appearance of its fruit but above all, for the nutritional and health characteristics of the various parts composing this last one (carpellary membranes, arils, seeds and bark). The fruit, the pomegranate, is rich in numerous chemical compounds (flavonoids, ellagitannins, proanthocyanidins, mineral salts, vitamins, lipids, organic acids) of high biological and nutraceutical value that make it the object of study for many research groups, particularly in the pharmaceutical sector. Its interest is mainly addressed to the knowledge of its biological and functional properties and the research of new formulations to apply it in a wide range of diseases such as neoplastic, cardiovascular, viral, inflammatory, metabolic, microbial, intestinal, reproductive and skin diseases. In this review we highlight the health-promoting properties of pomegranate and its bioactive compounds against human diseases.

Forests across the world stand at the crossroad with climate and land use changes shaping their future. Despite the demonstration of political will and global efforts, forest loss, fragmentation and land degradation continue unabated. No clear evidence exists that these initiatives are working. Why are policies designed to halt deforestation and increase restoration of forest landscapes failing? A key reason for this apparent ineffectiveness lies in the failure to recognize the agency of the stakeholders involved and the adaptive capacities of the systems we seek to steer. Landscapes do not happen. We make them. They are the result of the sum of individual actions and decisions made by all stakeholders, and the interactions between these and biophysical processes. Likewise, forest transitions are not ecological, but social and behavioral. They are a product of the way humans manage ecosystems. Decision-makers need to integrate better representations of people’s agency in their mental models. We suggest possible solution pathways to overcome this key current barrier. These involve eliciting mental models behind policy decision, changing perspectives to better understand divergent points of view and refining strategies through explicit theories of change. Games designed to represent the constraints and opportunities that exist in the landscapes can help decision makers in these task.

Starting from the fact that the units of local self-government of the Republic of Serbia are not sufficiently oriented towards innovations related to human resources and the environment, the application of quantitative research tradition examines the positioning and understanding of certain procedures and decisions of human resources management regarding the functioning of the environmental protection system, on the one hand, and future strategies for changing the given system, on the other. A series of 105 face-to-face interviews were conducted during the whole of 2016 in 105 of the 191 municipalities in the Republic of Serbia. Examination of the attitudes of the local self-government was carried out using a specially designed closed electronic questionnaire. The results of the multivariate regressions show that the most important predictor of the possible improvement of the environment is the size of the municipality. The remaining variables (e.g., human resources policy, human resources service) did not have significant effects on the ability to improve the environment. In more than half of local self-governments, there was no clearly defined human resources strategy in the field of environmental protection, an environmental protection service, an Environmental Action Plan, as well as an employment plan for waste management in local governments, etc. The research has shown that top managers of local governments agree that the management of human resources in environmental protection represents a significant opportunity to improve the quality of the environment. The results of the research can be used to improve the organization of human resource competence in environmental protection and the quality of a working and sustainable environment in the area of local self-government.

Sensory evaluation has been widely applied in assessing the quality of many consumer products that directly serve human needs such as food, beverages, clothing, etc. This paper first examined the inherent deficiencies in this approach, due mainly to the essentially subjective nature of human sensory preference. It then argued that instinctively designating certain materials attributes as sensory perceptions is unnecessary; considering every scientific concept is in essence the processed results of our sensory organs/brains, i.e., all quantities were initially human perceptions. Scientific advances have inevitably generated gradual transformation of such human perceptions as warmth and heaviness into objective parameters measurable in physical quantities like temperature and kilograms. Then using existing successful examples, it demonstrated firmly how the sensory attributes can be assessed by more reliable instrumental methods, and envisioned the key steps to turning a perception into scientifically measurable parameter(s).

There is an important role non-human primates (NHP) play in biomedical research. Phylogenetic proximity of any of the NHP species to Homo sapiens assures that much better translatability of research outcomes from model studies involving human diseases can be achieved than from those generated with other pre-clinical systems. Our group and others used during past two decades NHPs in research directed towards viral and autoimmune disorders of the gastrointestinal tract. This review summarizes progress made in the area of enteric viral infections and its applicability to human disease.

Human coronaviruses cause both upper and lower respiratory tract infections in humans. In 2012 a sixth human coronavirus (hCoV) was isolated from a patient presenting with severe respiratory illness. The 60-year-old man died as a result of renal and respiratory failure after admission to a hospital in Jeddah, Saudi Arabia. The aetiological agent was eventually identified as a coronavirus and designated Middle East respiratory syndrome coronavirus (MERS-CoV). MERS-CoV has now been reported in more than 27 countries across the Middle East, Europe, North Africa and Asia. As of July 2017, 2040 MERS-CoV laboratory confirmed cases, resulting in 712 deaths, were reported globally, with a majority of these cases from the Arabian Peninsula. This review summarises the current understanding of MERS-CoV, with special reference to the (i) genome structure, (ii) clinical features, (iii) diagnosis of infection and (iv) treatment and vaccine development.

Some of the most promising small molecule toxins used to generate antibody drug conjugates (ADCs) include anti-mitotic agents (e.g auristatin and its derivatives) which are designed to attack cancerous cells at their most vulnerable state during mitosis. We were interested to identify a human cystostatic protein eventually showing comparable activities and allowing the generation of corresponding targeted fully human cytolytic fusion proteins. Recently, we identified the human microtubule associated protein tau (MAP tau) which binds specifically to tubulin and modulates the stability of microtubules thereby blocking mitosis and presumably vesicular transport. By binding and stabilizing polymerized microtubule filaments, MAP tau-based fusion proteins skew microtubule dynamics towards cell cycle arrest and apoptosis. This biological activity makes rapidly proliferating cells (e.g cancer and inflammatory cells) an excellent target for MAP tau-based targeted treatments. Their superior selectivity for proliferating cells confers additional selectivity towards upregulated tumor-associated antigens at their surface, thereby preventing off-target related toxicity against normal cells bearing tumor-associated antigens at physiologically normal to low levels. In this review, we highlight recent findings on MAP tau-based targeted cytolytic fusion proteins reported in preclinical immunotherapeutic studies.

Ovarian cancer (OC) is an umbrella term for cancerous malignancies affecting the ovaries, yet treatment options for all subtypes are predominantly derived from high-grade serous ovarian cancer, the largest subgroup. The concept of "functional precision medicine" involves gaining personalized insights on therapy choice, based on direct exposure of patient tissues to drugs. This especially holds promise for rare subtypes like low-grade serous ovarian cancer (LGSOC). This study aims to establish an in vivo model for LGSOC using zebrafish embryos, comparing treatment responses previously observed in mouse PDX models, cell lines, and 3D tumor models. To address this goal, a well characterized patient-derived LGSOC cell line with the KRAS mutation c.35 G > T (p.(Gly12Val)) was used. Fluorescently labelled tumor cells were injected into the perivitelline space of 2 days post fertilization zebrafish embryos. At 1 day post-injection xenografts were as-sessed for tumor size, followed by random allocation into treatment groups with trametinib, luminespib, and trametinib + luminespib. Subsequently xenografts were euthanized and analysed for apoptosis and proliferation by confocal microscopy. Tumor cells formed compact tumor masses (n=84) in vivo and with clear Ki67 staining, indicating proliferation. Zebrafish xenografts exhibited sensitivity to trametinib and luminespib, individually or combined, within a two-week period, establishing them as a rapid and complementary tool to existing in vitro and in vivo models for evaluating targeted therapies in LGSOC.

Recent studies have emphasized the influence of resettlement factors on the mental health of refugees resettling in developed countries. However, little research has addressed gender differences in the nature and influence of resettlement stressors and sources of resilience. We address this gap in knowledge by investigating how gender moderates and mediates the influence of several sources of distress and resilience among 259 Afghan refugees residing in northern California. Gender moderated the effects of four factors on levels of distress. Intimate and extended family ties have little correlation with men’s distress levels, but are strongly associated with lower distress for women. English ability is positively associated with lower distress for women, but not men. In terms of gender ideology, traditionally oriented women and egalitarian men have lower levels of distress. And experiencing greater dissonant acculturation increases distress for men, but not women. The influence of gender interaction terms is substantial and patterns may reflect difficulty adapting to a different gender order. Future studies of similar populations should investigate gender differences in sources of distress and resilience, and efforts to assist new arrivals might inform them of changes in gender roles they may experience, and facilitate opportunities to renegotiate gender roles.

Whole genome duplication (WGD) or polyploidization can occur at the cellular, tissue, and organismal levels. At the cellular level, tetraploidization has been proposed as a driver of aneuploidy and genome instability, and correlates strongly with cancer progression, metastasis, and development of drugs resistance[1–6]. WGD is also a key developmental strategy for regulating cell size, metabolism, and cellular function[1,7–10]. In specific tissues, WGD is involved in normal development (e.g. organogenesis), tissue homeostasis, wound healing, and regeneration[10–17]. At the organismal level, WGD propels evolutionary processes such as adaptation[18], speciation[19], and crop domestication[20]. An essential strategy to further our understanding of the mechanisms promoting WGD and its effects is to compare isogenic strains that differ only in their ploidy. Caenorhabditis elegans (C. elegans) is emerging as an animal model for these comparisons, in part because relatively stable and fertile tetraploid strains can be produced rapidly from nearly any diploid strain[7]. Here we review the use of Caenorhabditis polyploids as tools to understand important developmental processes (e.g. sex determination, dosage compensation, and allometric relationships)[21–27] and cellular processes (e.g. cell cycle regulation, chromosome dynamics during meiosis)[28–32]. We also discuss how the unique characteristics of the C. elegans WGD model will enable significant advances in our understanding of mechanisms of polyploidization and its role in development and disease.

The forage fish, a crucial source of nutrition in developing countries, are unfortunately primarily used for fishmeal and aquafeed production for aquaculture that mainly serves consumers in developed countries. Industrial fish use leaves a meager portion of the catch for direct human consumption in the fish-producing countries, leading to inflated fish prices locally. Overfishing forage fish necessary to support the fish reduction industry disrupts the ecosystem, diminishes the catch of larger fish, such as mackerel, and marginalizes local artisanal fishermen. This article appraises roughly the financial and nutritional impacts of elevated fish prices on low-income consumers in forage fish-producing countries, drawing attention to the ethical implications of this situation. A hypothetical 10% boost in the annual supply of fresh forage fish to the current global supply of 5 million MT markets could save consumers hundreds of millions of US dollars globally, tens of mil-lions of US dollars nationally, and several dollars for a family while improving the nutrition of families that depend on forage fish. The numbers suggest that even a modest boost to the supply of forage fish in fresh fish markets could significantly benefit the fish-producing nations' consumers and the fish-producing nations. In some countries, such as South Africa, the orders of magnitude of these sums approach that of the entire local fish reduction industries' value. The increased fish prices could be considered involuntary subsidies by low-income consumers to the aquafeed and aquaculture industries. In summary, the reduction industry's and aquaculture's current use of captured forage fish warrants further scrutiny, as it inadvertently burdens disadvantaged societies financially and nutritionally. The article proposes alternative protein sources and cultivating non-carnivorous fish among several optional measures to ensure equitable distribution of forage fish resources.

The ribosome is a macromolecular complex composed of RNA and proteins that interact through an integrated and interconnected network to preserve its ancient core activities. In this review, we emphasize the pivotal role played by RNA-binding proteins as a driving force in the evolution of the current form of the ribosome, underscoring their importance in ensuring accurate protein synthesis. This category of proteins includes both ribosomal proteins and ribosome biogenesis factors. Impairment of their RNA-binding activity can also lead to ribosomopathies, a group of disorders characterized by defects in ribosome biogenesis that are detrimental to protein synthesis and cellular homeostasis. A comprehensive understanding of these intricate processes is essential for elucidating the mechanisms underlying the resulting diseases and advancing potential therapeutic interventions.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Aim: Streptococcus pneumoniae and influenza H1N1 virus are common organisms associated with human infections. These infections could play a significant role in immune regulation. The study was performed to analyse the genome sequences of these organisms with human genome and study its functional significance. Methods: The study was performed to analyse the overlapping of genome sequences in Streptococcus pneumoniae and Influenza (H1N1) virus against human genome sequences by BLASTn sequence analysis. The alignments are studied against the corresponding genes for their functional significance with DAVID and NDEx software.Results: Several hits or overlapping nucleotide segments were identified. Between streptococcus and homo sapiens 287 overlaps were identified, and among influenza and homo sapiens 124 hits were identified. A wide range of functional significance of these genes were identified, and the results are presented in this study. The results show insights into functional pathways and biological activities associated with the respective vaccinations or infections by these microorganisms. Conclusion: The common organisms like Streptococcus pneumoniae and Influenza H1N1 virus actively interact with the immune system and result in a wide range of immune regulations.

Angiotensin II (Ang II) plays a role in several inflammatory diseases and is capable of inducing the release of inflammatory mediators in several cell types. The objective was to investigate the potential of Ang II to induce mRNA expression of inflammatory mediators by cultured primary human periodontal cells. A synergistic effect of a co-treatment with Ang II and IL1β on mRNA expression of inflammatory mediators was also explored. Primary cultures of human fibroblast-like cells isolated from gingival and periodontal ligament tissues from 3 subjects were established using explant techniques. Immunophenotyping of STRO-1, Ang II type 1 receptor (AT1R) and Ang II type 2 receptor (AT2R) was performed by flow cytometry analysis. Cell cultures were challenged with Ang II (1M) for 3, 6 and 24h with or without a co-treatment with IL1β (0.1ng/mL) for 24h. mRNA expression of inflammatory mediators was performed by real time quantitative polymerase chain reaction (RT-qPCR). We present, for the first time, a precise quantification for AT1R and AT2R on human gingival and periodontal fibroblast-like cell types; the percentage of positive immunostaining compared to the total population of cells varied from 3.35% through 5.29% for AT1R and 2.97% through 4.57% for AT2R. Ang II slightly upregulated mRNA expression of IL6 and CCL2/MCP1 in gingival cells and IL8 and PTGS2/COX2 in periodontal ligament cells. IL1β induced upregulation of IL8, IL6 CCL2/MCP1, PTGS2/COX2 and IL1β mRNA in both cell types. Co-treatment with Ang II and IL1β did not show a synergistic effect under these experimental conditions. Ang II shows a low potential to induce mRNA upregulation of inflammatory mediators in cultured primary human gingival and periodontal ligament cells, most likely due to the low percentage of Ang II receptors in such cells, and no synergistic effect with the co-treatment with IL1β.

Smart Living, an increasingly prominent concept, entails incorporating sophisticated technologies in homes and urban environments to elevate the quality of life for citizens. A critical success factor for Smart Living services and applications, from energy management to healthcare and transportation, is the efficacy of human action recognition (HAR). HAR, rooted in computer vision, seeks to identify human actions and activities using visual data and various sensor modalities. This paper extensively reviews the literature on HAR in Smart Living services and applications, amalgamating key contributions and challenges while providing insights into future research directions. The review delves into the essential aspects of Smart Living, the state of the art in HAR, and the potential societal implications of this technology. Moreover, the paper meticulously examines the primary application sectors in Smart Living that stand to gain from HAR, such as smart homes, smart healthcare, and smart cities. By underscoring the significance of the four dimensions of Context Awareness, Data Availability, Personalization, and Privacy in HAR, this paper serves as a valuable resource for researchers and practitioners striving to advance Smart Living services and applications.

Angiotensin II (Ang II) plays a role in several inflammatory diseases and is capable of inducing the release of inflammatory mediators in several cell types. The objective was to investigate the potential of Ang II to induce mRNA expression of inflammatory mediators by cultured primary human periodontal cells. A synergistic effect of a co-treatment with Ang II and IL1β on mRNA expression of inflammatory mediators was also explored. Primary cultures of human fibroblast-like cells isolated from gingival and periodontal ligament tissues from 3 subjects were established using explant techniques. Immunophenotyping of STRO-1, AT1 and AT2 receptors was performed by flow cytometry analysis. Cell cultures were challenged with Ang II (1M) for 3, 6 and 24h with or without a co-treatment with IL1β (0.1ng/mL) for 24h. mRNA expression of inflammatory mediators was performed by real time quantitative polymerase chain reaction (RT-qPCR). We present, for the first time, a precise quantification for AT1 and AT2 receptors on human gingival and periodontal fibroblast-like cell types; the percentage of positive immunostaining compared to the total population of cells varied from 3.35% through 5.29% for AT1 and 2.97% through 4.57% for AT2. Ang II slightly upregulated mRNA expression of IL6 and CCL2/MCP1 in gingival cells and IL8 and PTGS2/COX2 in periodontal ligament cells. IL1β induced upregulation of IL8, IL6 CCL2/MCP1, PTGS2/COX2 and IL1β mRNA in both cell types. Co-treatment with Ang II and IL1β did not show a synergistic effect under these experimental conditions. Ang II shows a low potential to induce mRNA upregulation of inflammatory mediators in cultured primary human gingival and periodontal ligament cells, most likely due to the low percentage of Ang II receptors in such cells, and no synergistic effect with the co-treatment with IL1β.

Background: The electroretinogram is a clinical test used to assess the function of the photoreceptors and retinal circuits of various cells in the eye, with the recorded waveform being the result of the summated response of neural generators across the retina. Methods: The present investigation involved an analysis of the electroretinogram waveform in both the time and time-frequency domain through the utilization of the discrete wavelet transform and continuous wavelet transform techniques. The primary aim of this study was to monitor and evaluate the effects of treatment in a New Zealand rabbit model of endophthalmitis via electroretinogram waveform analysis and to compare these with normal human electroretinograms Results: The wavelet scalograms were analyzed using various mother wavelets, including the Daubechies, Ricker, Wavelet Biorthogonal 3.1 (bior3.1), Morlet, Haar, and Gaussian wavelets. Distinctive variances were identified in the wavelet scalograms between rabbit and human electroretinograms. The wavelet scalograms in the rabbit model of endophthalmitis showed recovery with treatment in parallel with the time -domain features. Conclusions: The study compared Adult, Child, and Rabbit electroretinogram responses using DWT and CWT, finding that Adult signals had higher power than Child signals, and Rabbit signals showed differences in a-wave and b-wave depending on the type of response tested, while Haar Wavelet was found to be superior in visualizing frequency components in electrophysiological signals in following the treatment of endophthalmitis and may give additional outcome measures for the management of retinal disease.

Transcription factors are diverse intracellular proteins facilitating cellular responses to inducing factors via gene expression. Regulatory signalling cascades from the membrane proteins (sensors) to transcription factors (effectors) are paramount to accurate phenotypic display against external factors. This review examines several transcription factors germane to Cryptococcus (C.) neoformans adaptation and survival for human infection. These opportunistic pathogenic single-cell yeasts (fungi) possess several gene duplications and peculiar membrane proteins due to adaptive phenotypes and morphological plasticity. Consequently, hundreds of responsible pleiotropic genes have been studied to understand how these genes are induced, regulated, and coordinated. However, these findings are sparsely converged and interlinked, making it cumbersome to relate one gene to the other or group them by their functions. We reviewed several wide-ranging transcriptional analysis works associated with C. neoformans into comparable phenotypic traits that necessitate adaptation, survival, and human infection. We present a robust work that addresses several transcription factors and their inducing factors. Lastly, we converge, link, and group several of these factors according to their multifunctional expression pattern. We also provide adequate information on certain genes critical to this fungus, which could be explored pharmaceutically in drug targeting for more effective antifungal management.

Climate change is one of the biggest challenges of our times. Its impact on human populations is not yet completely understood. Many studies have focused on single aspects with contradictory observations. However, climate change is a complex phoenomenon that cannot be adequately addressed from a single discipline's perspective. Hence, we propose a comprehensive conceptual framework on the relationships between climate change and human responses. This framework includes biological, psychological and behavioural aspects, and provides a multidisciplinary overview and critical information for focused interventions. The role of tipping points and regime shifts is explored, and a historical perspective is presented to describe the relationship between climate evolution and socio-cultural crisis. Vulnerability, resilience and adaptation are analyzed from an individual and a community point of view. Finally, emergent behaviours and mass effect phenomena are examined that account for mental maladjustment and conflicts.

Fogo (Fogo island, Cape Verde Republic) is the youngest and most active volcano of the archipelago. The last eruption occurred in 2014–2015. Aiming at studying dust emissions and transport during the eruption period and assessing their impact on air quality and human health, a mineralogical and chemical characterization was undertaken in outdoor dust from all over the island, as well as in the lava resulting from this event. Air quality monitors were used to obtain concentrations of atmospheric particulate matter (PM) and gaseous pollutants. The mineralogical constitution of the samples was analysed by X-ray diffraction and Electron Microprobe, while the chemical characterization was performed through X-ray Fluorescence Spectrometry and ICP-MS. The volcanic rock was found to be tephritic to basanitic, with high potassium content. Several minerals were identified, such as titanian augite with ilmenite, basaltic hornblendes, pyrrhotites, apatites, pyroxenes, basaltic hornblendes and hematites. Concentrations of the particulate matter inhalable fraction (PM10) exceeded the 24-hour mean of 50 µg/m3 recommended by the World Health Organization. Nevertheless, total volatile organic compounds (TVOCs) showed levels lower than the worrying range. The highest levels of CO2 were recorded in more populated villages and farthest from the volcano. The Pollution Load Index (PLI) for outdoor dust collected on rooftops was always above 1, suggesting enrichment, with higher values in the dust size fraction < 63 µm. In the same way, the Contamination Factor pointed to high enrichment of As, Ni and Pb, and very high enrichment of Cd in the same size fraction. The Non-carcinogenic Hazard Quotient and Hazard Index estimated for Children suggest that health problems may arise. The Carcinogenic Risk, for all size fractions, was above the target risk. The element that most contributed to the global risk was As, followed by Pb and Co. Ingestion was the main exposure route for all size fractions. The dust size fraction that represented the highest risk was < 63 µm, mostly due to the As concentration.

Excessive alcohol consumption is one of the significant causes of morbidity and mortality worldwide. Alcohol is oxidized to toxic and carcinogenic acetaldehyde by alcohol dehydrogenase (ADH) and further oxidized to a non-toxic acetate by aldehyde dehydrogenase (ALDH). Emerging evidence shows that Lactobacillus and Bifidobacterium species encode alcohol dehydrogenase (ADH) and acetaldehyde dehydrogenase (ALDH) mediate alcohol and acetaldehyde metabolism, respectively. This study involves supplementation of Lactobacillus and Bifidobacterium probiotic mixture in humans and assessed their effects on alcohol and acetaldehyde metabolism. Here, twenty-seven wild types (ALDH2*1/*1) and the same number ofheterozygotes (ALDH2*2/*1) were recruited for the study. The enrolled participants were randomly divided into either the probiotic (Duolac ProAP4) or the placebo group. Each group received a probiotic or placebo capsule for 15 days with subsequent crossover. Primary outcomes were measurement of alcohol and acetaldehyde in the blood after the alcohol intake. Blood levels of alcohol and acetaldehyde in the ALDH2 heterozygote group were significantly downregulated in the probiotic-supplemented group with no changes in hangover score symptoms than the placebo group. No clinically significant changes were observed in safety parameters. These results suggest that probiotic has a potential to downregulate the alcohol and acetaldehyde concentrations, and their effects depend on the presence or absence of polymorphism on the ALDH2 gene.

OBJECTIVE: Although 3D-printed anatomic models are not new to medicine, the high costs and lengthy production times entailed have limited their application. Our goal was developing a new and less costly 3D modeling method to depict organ-tumor relations at faster printing speeds. METHODS: We have devised a method of 3D modeling using DICOM images. Coordinates are extracted at a specified interval, connecting them to create mesh-work replicas. Adjacent constructs are depicted by density variations, showing anatomic targets (ie, tumors) in contrasting color. RESULTS: An array of organ solid-tumor models were printed via Fused Deposition Modeling 3D printer at significantly less cost ($0.05/cm3) and time expenditure (1.73 min/cm3; both, p<.001). Printed models helped promote visual appreciation of organ-tumor anatomy and adjacent tissues. Our mesh-work 3D thyroidal prototype reproduced glangular size/contour and tumor location, readily approximating the surgical specimen. CONCLUSIONS: This newly devised mesh-type 3D printing method may facilitate anatomic modeling for personalized care and improve patient awareness during informed surgical consent.

Almond is worldwide consumed and renowned as a valuable healthy food. In spite of this, it is also a potent source of allergenic proteins able to trigger several mild to life-threatening immunoreactions. Food processing proved to alter biochemical characteristics of proteins, thus affecting the respective allergenicity. In this paper we investigated the effect of autoclaving, preceded or not by a hydration step, on the biochemical and immunological properties of almond proteins. Any variation in the stability and immunoreactivity of almond proteins extracted from the treated materials, were evaluated by total protein quantification, ELISA assay and protein profiling by electrophoresis-based separation (SDS-PAGE). The autoclaving alone was found to weakly affect almond proteins stability, despite what observed for the combination of hydration and autoclaving, which resulted in a loss of approximately 70% of total protein content compared to untreated sample, and in a final negligible immunoreactivity, as well. The final SDS-PAGE protein pattern recorded for almonds hydrated and autoclaved disclosed significant changes. In addition, the same samples were further submitted to in vitro simulated gastro-duodenal (GI) digestion to evaluate potential changes induced by these processing on allergens digestibility. Digestion products were identified by HPLC-HRMS/MS analysis followed by software-based data mining, and complementary information were provided by analyzing the proteolytic fragments lower that 6 kDa in size. The autoclave based treatment was found not to alter the allergens digestibility, whereas an increased susceptibility to proteolytic action of digestive enzymes was observed in almonds subjected to the combination of prehydration and autoclaving. Finally, the residual immunoreactivity of the GI resistant peptides was investigated in-silico by bioinformatic tools, confirming that by following both approaches, no epitopes survived the almond digestion, thus demonstrating the potential effectiveness of these treatments to reduce almond allergenicity.

We investigate the human sustainability of ICT and management changes using a French linked employer-employee survey on organizational changes and computerization (COI). We approach the human sustainability of changes through the evolutions of work intensity, skill utilization and the subjective relationship to work. We compare in the private sector and the State civil service the impacts of ICT and management changes on the evolution of these three dimensions of work experience. We find that when ICT and management changes are intense, they are positively associated in the public sector with work intensification and new knowledge. In the private sector ICT and management changes increase the use of skills, but at a rate decreasing with their intensity and without favoring the accumulation of new knowledge. However, their impacts on the subjective relationship to work are much stronger, with public sector employees expressing discouragement as well as the feeling of an increased effort-reward imbalance when private sector employees become more committed. We tested that the self-selection of employees, the specific sources and paths of changes and the implementation of performance pay did not explain this divergence. We identify two partial explanations: one is related with employee turnover in the private sector, the other one with the role of trade unions. These results suggest that the human sustainability of ICT and management changes depends on their intensity and on how their implementation takes into account the institutional context of the organization.

For decades, compounds present in foods and beverages have been implicated in the etiology of human cancers. The International Agency for Research on Cancer (IARC) continues to classify such agents regarding their potential carcinogenicity in humans based on new evidence from animal and human studies. Furfuryl alcohol and β-myrcene belong to these potential human carcinogens due to be evaluated. The major source of furfuryl alcohol in foods is thermal processing and ageing of alcoholic beverages while β-myrcene occurs naturally as a constituent of essential oils of plants such as hops, lemongrass and derived products. This study aimed to summarize the occurrence of furfuryl alcohol and β-myrcene in foods and beverages using data from own nuclear magnetic resonance (NMR) analysis and literature review. The highest content of furfuryl alcohol was found in coffee beans (>100 mg/kg) and in some fish products (about 10 mg/kg) while among beverages, wines contained between 1–10 mg/L with 8 mg/L in pineapple juice. The content of β-myrcene was highest in hops. In conclusion, the data about the occurrence of the two agents is either very old or based on single sample analysis, and currently judged as insufficient for exposure and risk assessment. The results of this study point out the food and beverage groups that may be considered for future monitoring of furfuryl alcohol and β-myrcene.

The present study describes a comprehensive analysis of the Adverse Drug Reactions (ADRs) documented in the Database of the Spanish Pharmacovigilance System (FEDRA) concerning the use of biological medications used for severe refractory asthma, specifically omalizumab, mepolizumab, reslizumab, benralizumab, dupilumab, and tezepelumab. Emphasis was placed on ADRs not documented in the Technical Sheet (Summary of Product Characteristics, SmPC) of the respective specialties (Xolair®, Nucala®, Cinqaero®, Fasenra®, Dupixent®, and Tezspire®), which could potentially trigger a warning signal in Pharmacovigilance, indicating previously unidentified risks. The analysis encompassed data from the inception of each drug ́s marketing until January 22, 2024, including cases originating from various sources: direct submissions to the Spanish Pharmacovigilance System, communications from the Pharmaceutical Industry, and findings from literature review. Notifications were analyzed independently of their origin, so a complete review of all ADRs associated with these medications was ensured. In essence, this investigation highlights the critical role of post-marketing safety information, emphasizing the relevance of comprehensive reporting by healthcare professionals to facilitate a robust Pharmacovigilance system, ultimately advancing patient care and safety.

Abstract: Obesity and overweight also increasingly affect women of childbearing age and pregnant women. In maternal obesity, the activation of metabolic, inflammatory, and oxidative stress pathways is proven, which appears to be a key step in placental and uterus function pathological changes. Several recent studies have evidenced that aquaporins (AQPs) are critical players in adipose tissue biology and are involved in the onset of obesity. Our studies aimed to investigate the changes in placental volume and vascularization and measure the AQP5 expression and total antioxidant capacity (TAC) in the placenta and uterus tissues in obese and normal-weight mothers. We also aim to measure the AQP5 plasma concentration. We found AQP5 dominance in the uterus and plasma at 34 weeks of normal pregnancy. The placental volume increased, and the vascularization decreased in obese mothers compared to the control. The AQP5 expression increased in the uterus of the obese group and did not change in the placenta. The TAC decreased in the plasma of overweight mothers. We hypothesize that increased AQP5 expression prolongs the length of pregnancy and inhibits the onset of contractions. Based on our findings, we can develop diagnostic tests and provide new targets for tocolytic drug development.

Human-elephant conflict poses serious conservation challenge in Asia and Africa. We deployed an AI-based camera-alert system in a conflict hotspot in West Bengal, India that accurately detected elephants near villages (266 events) and transmitted real-time alerts ( = 42 seconds). Among detections of separate age and sex classes, lone adult bulls were the most prone to conflict. Real-time alerts permitted rapid response by field personnel to prevent conflict at the site ( = 18.2, SD = 12.4 min to arrival). Frequent detections of humans (33,217 events) on elephant trails highlighted the value of real-time alerts. Four human fatalities and five serious injuries occurred in the study area over a two-year period prior, but none during the study (2023-2024) after deploying the AI-alerting system. Loss of lives and livelihoods underscore the urgency of applying this approach to other elephant ranges and adapting AI models to other conflict-pronespecies to promote coexistence.

Viral tropism is most commonly linked to receptor use, but host cell protease use can be a notable factor in susceptibility to infection. Here we review the use of host cell proteases by human viruses, focusing on those with primarily respiratory tropism, particularly SARS-CoV-2. We first describe the various classes of proteases present in the respiratory tract, as well as elsewhere in the body, and incorporate the targeting of these proteases as therapeutic drugs for use in humans. Host cell proteases are also linked to the systemic spread of viruses and play important roles outside of the respiratory tract; therefore, we address how proteases affect viruses across the spectrum of infections that can occur in humans, intending to understand the extrapulmonary spread of SARS-CoV-2.

This article introduces an analytical framework that interprets individual measures of entropy-based mobility derived from mobile phone data. We explore and analyze two widely recognized entropy metrics: random entropy and uncorrelated Shannon entropy. These metrics are estimated through collective variables of human mobility, including movement trends and population density. By employing a collisional model, we establish statistical relationships between entropy measures and mobility variables. Furthermore, our research addresses three primary objectives: firstly, validating the model; secondly, exploring correlations between aggregated mobility and entropy measures in comparison to five economic indicators; and finally, demonstrating the utility of entropy measures. Specifically, we provide an effective population density estimate that offers a more realistic understanding of social interactions. This estimation takes into account both movement regularities and intensity, utilizing real-time data analysis conducted during the peak period of the Covid-19 pandemic.

Neutrophil elastase (NE) is taken up by macrophages, retains intracellular protease activity and induces a pro-inflammatory phenotype. However, the mechanism of NE-induced pro-inflammatory polarization of macrophages is not well understood. We hypothesized that intracellular NE degrades histone deacetylases (HDAC) and Sirtuins, disrupting the balance of lysine acetylation and deacetylation, and resulting in nuclear to cytoplasmic translocation of a major alarmin, High Mobility Group Box 1 (HMGB1), a pro-inflammatory response in macrophages. Human blood monocytes were obtained from healthy donors, or from subjects with cystic fibrosis (CF) or chronic obstructive pulmonary disease (COPD). Monocytes were differentiated into blood monocyte derived macrophages (BMDM) in vitro. Human BMDM were exposed to NE or control vehicle and the abundance of HDACs and Sirtuins was determined by western blotting of total cell lysates or nuclear extracts, or determined by ELISA. HDAC, Sirtuin, and Histone acetyltransferase (HAT) activities were measured. NE degraded most HDACs and Sirtuin (Sirt)1, resulting in decreased HDAC and sirtuin activities, with minimal change in HAT activity. We then evaluated whether the NE-induced loss of Sirt activity or loss of HDAC activities would alter the cellular localization of HMGB1. NE-treatment or treatment with Trichostatin A (TSA), a global HDAC inhibitor, both increased HMGB1 translocation from the nucleus to the cytoplasm, consistent with HMGB1 activation. NE significantly degraded Class I and II HDAC family members and Sirt 1 which shifted BMDM to a pro-inflammatory phenotype.

In this study, the effect of NaOCl (10–200 ppm of Cl2) on the inactivation of human norovirus (HuNV) GII.4 and hepatitis A virus (HAV) in groundwater was investigated using PMA/RT­qPCR. Initially, 4.00 log copies/μL of HuNV GII.4 or 5.50 log copies/μL of HAV were artificially inoculated in ground water. The titers of HuNV GII.4 and HAV decreased significantly (p < 0.05) with increasing Cl2 concentrations. Ground water was treated with 10, 30, 50, 100, 150, and 200 ppm of Cl2, and the viable HuNV GII.4 was significantly (p < 0.05) reduced to 3.28 (0.21 log reduction), 3.18 (0.31 log reduction), 3.01 (0.48 log reduction), 2.75 (0.74 log reduction), 2.54 (0.95 log reduction), and 2.34 (1.15 log reduction) log copies/μL, respectively. The viable HAV was also significantly (p < 0.05) reduced to 4.99 (0.23 log reduction), 4.76 (0.46 log reduction), 4.55 (0.67 log reduction), 4.21 (1.01 log reduction), 3.89 (1.33 log reduction), and 3.64 (1.58 log reduction) log copies/μL, respectively. The decimal reduction time (D-value) (1-log reduction) of HuNV GII.4 and HAV infectivity in ground water was predicted as 116.7 and 98.9 ppm of Cl2, respectively using the first-order kinetics model (HuNV GII.4 ; y = - 0.0054x + 3.3585, R2= 0.97, HAV ; y = - 0.0091x + 5.0470, R2= 0.97). The result specifically suggests that 150–200 ppm Cl2 can potentially be used for the inactivation of > 1 log copies/μL HuNV GII.4 and HAV in ground water.

Background: Taeniasis and cysticercosis are human infections caused by the pork tapeworm, Taenia solium. This study is a baseline for the Community-based intervention. We determined the prevalence of human cysticercosis and associated risk factors following deworming program conducted throughout the country, Mbulu District being among the districts in Northern Tanzania.Methods: Human cysticercosis was determined by enzyme-linked Immunosorbent assay (Ag- ELISA). Household interviews and observations were conducted to identify risk factors for cysticercosis transmissions among households and communities. Results: Three hundred individuals participated in the study. The age ranged from five to 89 years, with a median of 19 years. The prevalence of human cysticercosis was 23(7.67%). The prevalence was high 6(11.76%) among individuals aged 26 to 35 years and ±45 years. There was no statistically significant difference in the prevalence by age group, sex, or occupation. Among the 300 participants, 82(27.3%) had received anthelmintic during the previous year; among these, 5(21.7%) were infected. The likelihood of infection was low among anthelmintic users by 28% [0.72 (0.26-2.01)], but the protection was not significant. The communities differed in risk factors on the availability of clean and safe water supply; 52.7% (46/86) of households visited had no pit latrine. The cysticercosis prevalence showed a significant difference by communities. Conclusion: The prevalence of human cysticercosis was high and associated with higher age groups. The prevalence was low among those who had taken anthelmintic and was associated with lower age groups. The school current school deworming program has a positive effect for school children meanwhile the elderly are at higher risk because the intervention did not target them. It is recommended to scale up anthelmintic intervention to higher age groups.

The characteristics of exhaled aerosols outside the human respiratory airway are of significant importance in understanding virus transmission, yet they remain poorly understood. In order to effectively prevent and control the spread of respiratory infectious diseases, this study numerically investigates the exhaling characteristics of aerosols exhaled from the bronchus or larynx of a human upper airway model. This is achieved using the Euler-Lagrange method and considering various aerosol diameters (dp=0.1, 0.3, 0.5, and 1-20 μm) as well as five expiratory flow intensities (Q=15, 30, 60, 90, and 120 L/min). The important findings of this study are as follows: (1) Expiratory airflow exhibits complex flow phenomena, including jet-flow, flow separations, and vortex structures, with their characteristics being influenced by the expiratory flow intensities. (2) The exhaling characteristics of aerosols vary depending on the combined effects of expiratory flow intensities, virus aerosol diameters, and initial exhaled locations from either the bronchus or larynx. (3) A critical diameter (dc) is identified to represent the size at which aerosols can effectively exit the respiratory airway and potentially pose a transmission risk. This critical diameter is identical for aerosols exhaled from both the bronchus and larynx under the same expiratory flow intensity, but it decreases as the expiratory flow intensity increases. In conclusion, expiratory flow intensity is the most critical factor in determining whether aerosols can be expelled from the respiratory airway, as well as influencing the critical diameter (dc) for aerosols initially located in/after the larynx.

The present work fronts the human pose estimation problem, developing a method that enables automated ergonomic risk assessment. A research methodology is developed to calculate joint angles from digital snapshots or videos by using computer vision and machine learning techniques to get a more accurate ergonomic risk assessment. Starting from an ergonomic analysis, the study explores the use of a semi-supervised training method to detect the skeletons of workers. The research methodology developed aims to infer the positions and angles of the joints, to calculate the criticality index based on the RULA scores and fuzzy rules. Then, to prevent work-related musculoskeletal disorders (WMSD), improve production capacity and decrease the ergonomic risk, the system uses joint with a collaborative robot to support the worker in carrying out the most critical operations. The method has been tested on a real industrial case in which manual assembly activities of electrical components are conducted. The approach developed can overcome the limitations of recent developments based on computer vision or wearable measurement, sensors by performing an assessment with an objective and flexible ap-proach to postural analysis development.

Angiotensin-converting enzyme 2 (ACE2) and the transmembrane serine protease 2 (TMPRSS2) are recognized as entry proteins of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and recently their Single Nucleotide Polymorphisms (SNP) have been studied in different populations to elucidate the impact on disease. The aim of this study was to evaluate the genetic SNP of ACE2 (rs35803318) and TMPRSS2 (rs2070788) genes in COVID-19 patients from Northeast Brazil compared with global populations, as well as the expression quantitative trait locus (eQTL). For ACE2 (rs35803318), we found 92.6% CC, 3.4% CT, and 4.0% TT genotype carriers in SARS-CoV-2-positive patients. Surprisingly, only the genotype frequencies of ACE2 SNP were not in Hardy-Weinberg equilibrium. For TMPRSS2 rs2070788, we found 22.3% GG, 50.7% AG, and 27% AA genotype carriers in SARS-CoV-2-positive patients. The expression quantitative trait loci (eQTLs) revealed that rs35803318 was associated with an altered PIR gene expression, and rs2070788 was found eQTLs association only with lung tissue. No significant association was identified between the genotype distribution of SNPs and the 'patient's outcome. In conclusion, our results suggest that ACE2 and TMPRSS2 may not be protective factors for global populations, including the Brazilian population, since the presence of SNPs does not affect the 'patient's outcome as described by other studies.

CD8+ cytotoxic T lymphocytes (CTLs) play a crucial role in anti-tumor immunity. In a previous study, we identified a subset of murine effector CTLs expressing the hepatocyte growth factor (HGF) receptor c-Met (c-Met+ CTLs) that are endowed with enhanced cytolytic capacity. HGF directly inhibited the cytolytic function of c-Met+ CTLs, both in 2D in vitro assays and in vivo, leading to reduced T cell responses against metastatic melanoma. To further investigate the role of c-Met+ CTLs in a three-dimensional (3D) setting, we studied their function within B16 melanoma spheroids and examined the impact of cell-cell contact on the modulation of inhibitory checkpoint molecules expression such as KLRG1, PD-1 and CTLA-4. Additionally, we evaluated the cytolytic capacity of human CTLs clones expressing c-Met (c-Met+) and compared it to c-Met− CTLs clones. Our results indicated that, similar to their murine counterparts, c-Met+ human CTLs clones exhibited increased cytolytic activity compared to c-Met− CTLs clones, and this enhanced function was negatively regulated by the presence of HGF. Taken together, our findings highlight the potential of targeting the HGF/c-Met pathway to modulate CTL-mediated anti-tumor immunity. This research holds promises for developing strategies to enhance the effectiveness of CTL-based immunotherapies against cancer.

In recent years, organic agriculture has gained more popularity, yet its approach to food production and its potential impact on consumers’ health and various environmental aspects remain to be fully discovered. The goal of organic farming practices is to maintain soil health, sustain ecological systems, maintain fairness in its relationship with the environment and protect the environment in its entirety. Various health benefits have been associated with higher consumption of organic foods. This review identified some of these health benefits including a reduction in obesity and body mass index (BMI), improvements in blood nutrient composition as well as a reduction in maternal obesity and pregnancy-associated preeclampsia risk. Furthermore, organic food consumption can reduce the development of non-Hodgkin lymphoma and colorectal cancers. Upon reviewing existing literature regarding the nutritional value of organic foods, it was found that organic food contained higher levels of iron, magnesium, and vitamin C. However, the evidence available to draw definitive generalizations remains limited. In this review, we provided essential insights to support sustainable organic farming and highlighted the potential of organic food consumption that could play a pivotal role in positively impacting human health.

In this study, we investigated the effects of three surface treatment techniques on 316L stainless steel, low-temperature immersion corrosion, shot peening followed by immersion corrosion, and electrochemical corrosion. Surface alterations were analyzed using scanning electron microscopy, Raman spectroscopy, and α-step thin-film thickness profiling. Human osteoblast adhesion was evaluated using Liu’s stain and metallographic optical microscopy. The results revealed weak cell adhesion after low-temperature immersion and shot peening followed by immersion corrosion. By contrast, electrochemical corrosion, particularly with a high current density and low corrosive solution concentration, resulted in a uniformly corroded surface, thus promoting dense cell adhesion. All three techniques resulted in porous oxide layers. Overall, our experimental findings highlighted shot peening (1 kg/cm2 for 20 s) and electrochemical corrosion (0.5 M HCl) as effective processes. Electrochemical corrosion produced uniformly dense corrosion pits, whereas shot peening produced semicircular grooves with small corrosion pits, both favorable for cell adhesion. Electrochemical corrosion also yielded excellent cell adhesion, emphasizing its suitability for biomedical activity. We developed a process for creating a porous surface layer and thereby enhancing the cell adhesion to 316L stainless steel for potential biomedical implant applications.

Aortic dissection is a clinicopathological entity caused by rupture of the intima leading to a high mortality if not treated. Over time, diagnostic and investigative methods, antihypertensive therapy, and early referrals have resulted in improving outcomes according to registry data. Some data has also emerged from recent studies suggesting a link between Human Cytomegalovirus (HCMV) infection and aortic dissection. Furthermore, the use of microRNAs have also become increasingly widespread in the literature. These have been noted to play a role in aortic dissections with elevated levels noted in studies as early as 2017. This review aims to provide a broad and holistic overview of the role of miRNAs, while studying the role of HCMV infection in the context of aortic dissections. The role of long non-coding RNAs, circular RNAs and microRNAs are explored to identify changes in expression during aortic dissections. The use of such biomarkers may one day be translated into clinical practice to allow early detection and prognostication of outcomes and drive preventative and therapeutic options in the future.

Conventional sensors used to measure properties such as deformation or pressure, etc. often make use of metals, ceramics, piezos, and other materials. Many of those materials are very hard, so if they are used as sensors, when the object is deformed, or when the pressure on the object changes from time to time, it is necessary to prepare a variety of sensors with different properties. In this experiment, a dielectric elastomer (DE) pressure sensor was fabricated using a hydrogenated nitrile rubber (HNBR) film with improved hardness and elongation. With this, even very thin film (0.2mm) can be measured at any pressure between 1gf and 20kgf. Previously developed film was harder and less stretchy than the current one, with a pressure detection width from 4 kgf to 120 kgf. This time, however, the pressure sensitivity of the finger has been made more sensitive, making it possible to measure even smaller values. A DE stretch sensor was also developed using single-walled carbon nanotube (SWCNT) electrodes with larger stretchability and flexibility, utilizing this HNBR. This greatly improved the mechanical flexibility and stretchability of the DES. Using this stretch sensor, it became possible to sense the motion of the robot's fingers, and to sense the force (pressure) when the fingertip touched the target object with the DE pressure sensor. In addition, it was confirmed that the sensation of the robot's finger touching an object can be fed back to a human finger by using a small diaphragm type vibrator DE actuator.

Dogs play an important role in the transmission of Leishmania infantum but epidemiologic and clinical studies of canine tegumentary leishmaniasis (CTL) are scarce. In an endemic area of human American Tegumentary Leishmaniasis (ATL) caused by Leishmania braziliensis, we determine the prevalence and incidence of both CTL and subclinical (SC) L. braziliensis infection in dogs and evaluated if the presence of dogs with the CTL or the SC L. braziliensis infection is associated with the occurrence of human ATL. SC infection in healthy animals and CTL in animals with ulcers was determined by PCR on biopsied healthy skin or on the ulcer or detecting antibodies against soluble leishmania antigen. We compared the occurrence of human ATL in homes with dogs with CTL or SC infection with control homes without dogs or with dogs without CTL or SC infection. The prevalence of SC infection was 35% and of CTL 31%. The incidence of SC infection in dogs was 4.6% and of CTL was 9.3%. The frequency of ATL in humans was 50% in homes with infected dogs and 13% in homes without L. braziliensis infection in dogs. CTL and SC infection is highly prevalent, and dogs may participate in the transmission chain of L. braziliensis.

Background: Cord blood represents a link between intrauterine and early extrauterine development. Cord blood cells map an important time frame in human immune imprinting processes. It is unknown whether sex of the newborn affects the lymphocyte subpopulations in cord blood. Methods: 9 B and 21 T cell subpopulations were characterized by flow cytometry in human cord blood from 16 male and 21 female newborns, respectively. Results: Except for marginal zone B cells and transitional B cells, B cell count in all subsets was higher in cord blood of male newborns than in female newborns. Frequency of naive thymus negative Th cells was significantly higher in male cord blood whereas the remaining T cell subpopulations showed a higher count in cord blood of female newborns. Conclusion: Our study is the first revealing sex differences in B and T cell subpopulations of human cord blood. These results indicate that sex might have a higher impact for the developing immune system urging the need to expand research in this area.

The suitability of an animal model to study human diseases heavily relies on the similarity between the two species at the genetic, epigenetic, gene expression and metabolic levels. However, consistent data from different animal models at each level to evaluate this suitability is lacking. With the availability of genome sequences for many mammalian species it is now possible to compare animal models based on the genomic similarities. Here, we compare the coding sequences (CDS) of five mammalian models that include rhesus macaque, marmoset, pig, mouse and rat with those from human. We identified 10,316 conserved CDS across the five organisms and human based on the sequence similarity. Mapping the human disease-associated single nucleotide polymorphisms (SNPs) from these conserved CDS in each species has identified species-specific association with various human diseases. While associations for a disease such as colon cancer were prevalent in multiple model species, pig showed the highest number (117 diseases) of model-specific human disease associations. Based on the percentage of disease-associated SNP-containing genes, marmoset models are well suited to study many human ailments including behavioral and gastrointestinal diseases. Comparison of gene expression levels of the conserved CDS from colon, heart, kidney, lung, skeletal muscle, and spleen tissues in these models showed correlations with human expression levels in a tissue-specific manner. In the gastrointestinal tissues (colon, spleen), the pig showed the highest correlation while mouse displayed a better correlation in the heart and kidney. This study demonstrated genomic as well as tissue-specific expression-based similarity evaluation of five animal models against human that could help investigators select a suitable animal model to study their targeted disease.

Regulatory macrophages (Mregs) are unique in that they have anti-inflammatory and immunosuppressive properties. Thus, treating inflammatory diseases using Mregs is an area of active research. Human Mregs are usually generated by culturing peripheral blood monocytes stimulated by macrophage colony-stimulating factor with interferon (IFN)-. Here, we generated Mregs with an elongated cell morphology from THP-1 cells stimulated with phorbol 12-myristate 13-acetate and cultured with arginylglycylaspartic acid and vitamin D3. These Mregs regulated macrophage function, and respectively downregulated and upregulated the expression of pro-inflammatory and immunosuppressive mediators. They also expressed Mregs-specific marker, such as dehydrogenase/reductase 9, even when exposed to inflammatory stimulants such as IFN-, lipopolysaccharide, purified xenogeneic antigen, and xenogeneic cells. The Mregs also exerted anti- inflammatory and anticoagulatory actions in response to xenogeneic cells and immunosuppressive effects on mitogen-induced Jurkat T-cell proliferation. Our method of generating functional Mregs in vitro without cytokines is simple and cost-effective.

The current epoch, known as the Anthropocene, is characterized by significant human impact on the global ecological system, including altered species survival and distribution patterns due to global warming resulting from industrialization. Accurately quantifying and assessing the extent of human impact on the environment is of utmost importance. To this end, four primary methods have been developed to measure human impact: (1) ecological footprint, (2) Human appropriation of net primary production (HANPP), (3) Planetary boundary, and (4) Living Planet Index. In this paper, we aim to provide a comprehensive understanding of these methods, including their strengths and weaknesses, to evaluate their efficacy in accurately assessing the impact of human activities on the global ecosystem. Furthermore, we explore the potential of utilizing novel machine learning modelling for future predictions in this area. By analyzing and comparing these methods, we can gain insight into the ways in which human activities impact the environment and use this knowledge to inform future policies and practices to mitigate negative effects.

Genetic sensorineural hearing loss and Meniere disease have been associated with rare variations in the coding and non-coding region of the human genome. Most of these variants are classified as likely pathogenic or variants of unknown significance and require functional validation in cellular or animal models. Given the difficulties to obtain human samples and the raising concerns about animal experimentation, human induced pluripotent stem cells emerge as cellular models to investigate the interaction of genetic and environmental factors in the pathogenesis of inner ear disorders. The generation of human sensory epithelia and neuron-like cells carrying the variants of interest may facilitate a better understanding of their role during differentiation. These cellular models will allow us to explore new strategies for restoring hearing and vestibular sensory epithelia as well as neurons. This review summarizes the use of human induced pluripotent stem cells in sensorineural hearing loss and Meniere disease and proposes some strategies for its application in clinical practice.

Understanding the complex relationship between sleep and memory is a major challenge in neuroscience. Many studies on memory consolidation in humans suggest that sleep triggers offline memory processes, resulting in less forgetting of declarative memory and performance stabilization in non-declarative memory. However, issues related to non-optimal experimental designs, task characteristics and measurements, and inappropriate data analysis practices can significantly affect the interpretation of the effect of sleep on memory. In this article, we discuss these issues and suggest constructive solutions to address them. We believe that implementing these solutions in future sleep and memory research will significantly advance this field by improving the understanding of the specific role of sleep in memory consolidation.

Background: Tuberculosis (TB) manifests itself primarily in the lungs as pulmonary disease (PTB) and sometimes disseminates to other organs to cause extra-pulmonary TB, such as lymph node TB (LNTB). This study aimed to investigate the role of host genetic polymorphism in immunity related genes to find a genetic basis for such differences. Methods: Sixty-three, Single nucleotide polymorphisms (SNPs) in twenty-three, TB-immunity related genes including eleven innate immunity (SLCA11, VDR, TLR2, TLR4, TLR8, IRGM, P2RX7, LTA4H, SP110, DCSIGN and NOS2A) and twelve cytokine (TNFA, IFNG, IL2, Il12, IL18, IL1B, IL10, IL6, IL4, IL1RA, IL8 and TNFB) genes were investigated to find genetic associations in both PTB and LNTB as compared to healthy community controls. The serum cytokine levels were correlated for association with the genotypes. Results: PTB and LNTB showed differential genetic associations. The genetic variants in the cytokine genes (IFNG, IL12, IL4, TNFB and IL1RA and TLR2,4 associated with PTB susceptibility and cytokine levels but not LNTB (p &lt; 0.05). Similarly, genetic variants in LTA4H, P2RX7, DCSIGN and SP110 showed susceptibility to LNTB and not PTB. Pathway analysis showed abundance of cytokine related variants for PTB and apoptosis related variants for LNTB. Conclusions: PTB and LNTB outcomes of TB infection have a genetic component and should be considered for any future susceptibility and functional studies.

Recent advances in DNA sequencing technology have shown that the human milk microbiota of healthy women varies substantially. The gDNA extraction method may influence the observed variation, biasing the microbiological reconstruction after all. In this study, a genomic DNA extraction method for DNA isolation from human milk samples was standardized and compared with commercial and standard hose make methods. Spectrophotometric measurements, gel electrophoresis, and PCR amplifications were used as criteria for evaluating the quantity, quality, and functionality of the extracted DNA. Furthermore, the standardized method of extracting gDNA from human milk was evaluated for its ability to isolate functional DNA from gram-positive, and gram-negative bacteria and fungi, to improve the reconstruction of microbiological profiles. The novel DNA extraction method increased the quantity and quality of the gDNA extracted compared with commercial and standard house-make protocols. This method even allowed PCR amplification of the V3-V4 regions of the 16S ribosomal gene in all samples, and the ITS-1 region of the fungal 18S ribosomal gene in 95 % of the samples as well. It is concluded that the proposed method provides better performance for the extraction of gDNA from complex samples such as human milk.

The ongoing exponential growth of human population poses a risk to sustainable development goals (SDGs). Unless we understand the drivers of this growth and inform policy development accordingly, SDGs would remain a dream. One of the old theories of population growth known as the Malthusian theory predicts that resource availability drives population growth to a certain time when population growth outrun resource availability, leading to all sort of crises known as Malthusian crisis. Although the link between economic growth and population has been widely investigated while testing the theory, little is known about environmental and social factors po-tentially driving population growth. Here, because of various crises of our time recalling the Malthusian crisis, we revisited the theory by fitting structural equation models to environmental, social and economic data collected over 30-year period in South Africa. None of the social varia-bles tested predicts population growth. Instead, we found that biodiversity (species protection index) correlates positively with population growth. Biodiversity provides various resources through ecosystem goods and services to human, thus supporting population growth as pre-dicted in the Malthusian theory. However, we also found that this population growth may lead to conservation conflict as we found that biodiversity habitat (wetland area) correlates negatively with population growth, thus raising the compromising effect of population growth on life on earth. What’s more, we found a significant link between economic growth measured as GDP and population growth, further supporting the Malthusian prediction. Overall, our study re-affirms the value of biodiversity to human and suggests that the Malthusian theory should continuously be tested with predictors other than economic.

Urban air quality is increasingly being studied as a fraction of the world's population is now living in megacities. In this study, particulate matter (PM) along Taft Avenue, Manila, Philippines, is investigated in terms of its ability to induce genetic damage on human peripheral blood lymphocytes (PBL). Size-segregated roadside air samples were obtained from 2015-2016 near the university gate and analyzed using in vitro micronucleus and cytokinesis-block proliferation tests. While cellular proliferation was unaffected by 0 – 0.1 kg·m-3 of PM1.0 and PM2.5, PBL cells treated with PM2.5 displayed significantly higher micronucleus count (p = 0.03) compared to the cells treated with PM1.0. Atomic Absorption Spectroscopy revealed greater amounts of Cd, Ca, Pb, K, Na, and Zn in PM2.5 compared to PM1.0. The results indicate the differences in composition of the two size fractions of air particulates are associated with their genotoxicities.

The main purpose of bovine colostrum, being the milk secreted by a cow after giving birth, is to transfer passive immunity to the calf. The calves have an immature immune system as they lack immunoglobulins (Igs). Subsequently, the supply of good quality bovine colostrum is required. The quality of colostrum is classified by low bacterial counts and adequate Ig concentrations. Bacterial contamination can contain a variety of human pathogens or high counts of spoilage bacteria, which becomes more challenging with emerging use of bovine colostrum as food and food supplements. There is also a growing risk for the spread of zoonotic diseases originating from bovines. For this reason, processing based on heat treatment or other feasible techniques are required. This review provides an overview of literature on the microbial quality of bovine colostrum and processing methods to improve its microbial quality and keep its nutritional values as food. The highlights of this review are: high quality colostrum is a valuable raw material in food products and supplements, the microbial safety of bovine colostrum is increased using appropriate processing-suitable effective heat treatment, which does not destroy the high nutrition value of colostrum, the heat treatment processes are cost-effective compared to other methods, and heat treatment can be performed in both small- and large-scale production.

Opuntia sp. contain antioxidant phytochemicals resistant to ROS damage, whose excess negatively affect fertilization. We investigate the activity of fruit extracts of O. dillenii and O. ficus indica (cv red and yellow) on sperm quality and cryopreservation. In the first experiment, we exposed the samples to extracts (50 µl) for 1 hour to then evaluate semen parameters (vitality, motility, acrosome reaction, DNA fragmentation and oxidative stress). The results showed a significant increase in the motility (86%±0.19 for OFI cv yellow, 82%±0.15 for OFI cv red and 90%±0.08 for O. dillenii) compared to the control (80%±0.17). Moreover, we noted a reduction of DNA fragmentation on treated (3%±0.03 in OFI cv yellow, 7%±0.09 in OFI cv red and 5%±0.07 in O. dillenii) than the control (40%±0.14). Furthermore, the oxidative stress was reduced after exposure to solutions (3.15mV in the control and 2.94mV in the treated). In the second experiment, 50 µl of solutions were added to the Freezing medium. After thawing, we observed an improvement in vitality and the number of intact acrosomes. Our results suggest that Opuntia sp. fruit extracts improve sperm quality, both before and after cryopreservation, optimizing the potential of fertilization of sperm cells.

The ongoing COVID-19 global pandemic is affecting every facet of human lives (e.g., public health, education, economy, transportation, and the environment). This novel pandemic and citywide implemented lockdown measures are affecting virus transmission, people’s travel patterns, and air quality. Many studies have been conducted to predict the COVID-19 diffusion, assess the impacts of the pandemic on human mobility and air quality, and assess the impacts of lockdown measures on viral spread with a range of Machine Learning (ML) techniques. This review study aims to analyze results from past research to understand the interactions among the COVID-19 pandemic, lockdown measures, human mobility, and air quality. The critical review of prior studies indicates that urban form, people's socioeconomic and physical conditions, social cohesion, and social distancing measures significantly affect human mobility and COVID-19 transmission. During the COVID-19 pandemic, many people are inclined to use private transportation for necessary travel purposes to mitigate coronavirus-related health problems. This review study also noticed that COVID-19 related lockdown measures significantly improve air quality by reducing the concentration of air pollutants, which in turn improves the COVID-19 situation by reducing respiratory-related sickness and deaths of the people. It is argued that ML is a powerful, effective, and robust analytic paradigm to handle complex and wicked problems such as a global pandemic. This study also discusses policy implications, which will be helpful for policymakers to take prompt actions to moderate the severity of the pandemic and improve urban environments by adopting data-driven analytic methods.

Few-layer graphene oxide (GO) has shown none or very weak cytotoxicity and anti-proliferative effects in a wide range of cell lines such as glyoma cells and human skin HaCaT cells, in concentrations up to 100 µg/mL However, multi-layer GO has been hardly explored in the biomedical field. Thus, multi-layer GO was examined here in human keratinocyte HaCaT cells treated with different concentrations ranging from 0.01 to 150 µg/mL during different periods of times (3, 12 and 24 hours). The results of this study showed a time-concentration dependence with two non-cytotoxic concentrations (0.01 and 0.05 µg/mL) and a median effective concentration value of 4.087 µg/mL at 24 hours of GO exposure. Contrary to what has been reported for few-layer GO, cell proliferation of the HaCaT cells in contact with the multi-layer GO at 0.01 μg/mL showed identical proliferative activity compared to an epidermal growth factor (1.6-fold greater than the control group) after 96 hours. The effects of the multi-layer GO on the expression of 13 genes (SOD1, CAT, MMP1, TGFB1, GPX1, FN1, HAS2, LAMB1, LUM, CDH1, COL4A1, FBN and VCAN) at the non-cytotoxic concentrations of GO in the HaCaT cells were analyzed after 24 hours. Thus, the lowest non-cytotoxic GO concentration was able to up-regulate the CAT, TGFB1, FN1 and CDH1 genes, which confirms the great potential of multi-layer GO in the biomedical field.

This theoretical article provides a brief description of the model of living systems' functioning by defining them as resource flows patterns. It reviews the living systems growth limitation between their development cycles by the Fibonacci sequence. Besides, there are presented systems resource base criteria, necessary for accumulating the resources and their investment. The article also considers the conditions for the formation of various systems strategies. Then we reviewed the principles of elemental analysis of information by a person as a living system according to the considered model. The study also shows the possibility of forming priorities in analyzing information for 16 combinations as maximum. At that, it remains crucial to divide a human's information analysis between the two hemispheres of the brain. The described combinations of priorities in a person's information analysis are compared with the existing differential personality models, such as the big five personality traits, the Myers-Briggs type indicator, temperaments model and Honey and Mumford Learning styles.

Multiple preventive vaccines are being developed to counter the COVID-19 pandemic. The leading candidates have now been evaluated in non-human primates (NHPs) and human Phase 1 and/or Phase 2 clinical trials. Several vaccines have already advanced into Phase 3 efficacy trials, while others will do so before the end of 2020. Here, we summarize what is known of the antibody and T-cell immunogenicity of these vaccines in NHPs and humans. To the extent possible, we compare how the vaccines have performed, taking into account the use of different assays to assess immunogenicity and inconsistencies in how the resulting data are presented. We also summarize the outcome of SARS-CoV-2 challenge experiments in immunized macaques, while noting variations in the protocols used, including but not limited to the virus challenge doses.

Due to their unique properties, perfluorinated substances (PFAS) are widely used in multiple industrial and commercial applications, but they are toxic for animals, humans included. This review presents some available data on the PFAS environmental distribution in the world, and in particular in Europe and in Veneto region of Italy, where it has become a serious problem for human health. The consumption of contaminated food and drinking water is considered one of the major source of exposure for humans. Worldwide epidemiological studies report the negative effects that PFAS have on human health, due to environmental pollution, including infertility, steroid hormone perturbation, thyroid, liver and kidney disorders and metabolic disfunctions. In vitro and in vivo researches correlated PFAS exposure to oxidative stress effects (in mammals as well as in other vertebrates of human interest), produced by a PFAS-induced increase of reactive oxygen species formation. The cellular antioxidant defense system is activated by PFAS, but it is only partially able to avoid the oxidative damage to biomolecules.

Coronavirus that is also known as COVID-19 disease is produced by SARSCoV-2. This causative agent is highly contagious and can cause potentially fatal pneumonia worldwide with serious public health concerns. In the beginning among infected individuals, most of them were those who were mainly shown to the wet animal market in a big city of China known as Wuhan. So, it was suggested that this was almost certainly the zoonotic source of COVID-19illness. The transitional source of origin and their mode of transmission to humans were not known obviously. Conversely, from human to human rapidly transformation have been confirmed generally. Currently, there is no availability of FDA approved clinically antiviral drugs and/or vaccines to be used against the COVID-19. Afterward, SARS-CoV and MERS-CoV, the occurrence of SARS-CoV-2 has been manifested as the third sketch of an enormously pathogenic coronavirus into human population globally. In this review, we provide a brief overview of the history of COVID-19 in Pakistan up-to 18^th weeks after beginning, current situation, epidemiology, and its impact on the human population. Moreover, we focused on physiological variation during the incubation period, genome analysis of SARS-CoV2, supportive treatment approaches, and safety measures in the Pakistani population, which may be supportive for combating the risk of COVID-19 epidemic. We also reviewed the future approaches for the development of therapeutic interventions and vaccines to cope with the COVID-19 epidemic.

Consumption of milk contaminated with antibiotic residues above the maximum residue limit (MRL) causes direct toxicity to humans and the development of superbugs that leads to the failure of antibiotic therapy and threatens human life. Besides, long-duration exposure might alter the nature of gut microflora results in the enhancement of many diseases. Therefore, we examined 300 raw and processed packet milk samples using thin layer chromatography (TLC) and ultra high performance liquid chromatography (UHPLC) method against five veterinary antibiotics and assessed the risk for consumers in Chattogram, Bangladesh. Risk analysis was calculated by using hazard quotient on the basis of 165 ml per capita milk consumption. We found a total of 7% prevalence of antibiotic residues in raw milk samples which were higher (8%) in individual samples than the pooled samples (4%). However, we did not find any processed packet milk samples as positive. The mean concentration of oxytetracycline residue was detected 61.29 µg/l and amoxicillin was 124 µg/l in individual milk samples. Risk analysis showed the hazard quotient values of 0.0056 for oxytetracycline and 0.0017 for amoxicillin residue which was confirmed that, no significant health risk associated with the consumption of milk produced and marketed in the study area. Our study might fill the gap of knowledge to measure the safety status of milk regarding public health issues.

Different factors seemingly account for the emergence of present-day languages in our species. Human self-domestication has been recently invoked as one important force favouring language complexity mostly via a cultural mechanism. As a consequence, evolutionary changes impacting on aggression levels are expected to have fostered this process. Here we hypothesise about a positive effect of dog-human interactions on aggression management and more generally, on our self-domestication, ultimately, contributing to aspects of language evolution. We review evidence of diverse sort (ethological mostly, but also archaeological, genetic, and physiological) supporting a positive feedback loop between dog domestication and human-self domestication that might have favoured the mechanisms promoting structural complexity in human languages.

Background: Elucidation of epigenetic mechanisms correlating with neuropathic pain in humans is crucial for the prevention and treatment of this treatment-resistant pain state. In the present study, associations between neuropathic pain characteristics and DNA methylation of the transient receptor potential ankyrin 1(TRPA1) gene were evaluated in chronic pain patients and preoperative patients. Methods: Pain and psychological states were prospectively assessed in patients who suffered chronic pain or were scheduled for thoracic surgery. Neuropathic characteristics were assessed using the Douleur Neuropathique 4 (DN4) questionnaire. DNA methylation levels of the CpG island in the TRPA1 gene were examined using whole blood. Results: Forty-eight adult patients were enrolled in this study. Increases in DNA methylation rates at CpG -51 showed positive correlations with increases in the DN4 score both in preoperative and chronic pain patients. Combined methylation rates at CpG -51 also significantly increased together with increase in DN4 scores. Conclusions: Neuropathic pain characteristics are likely associated with methylation rates at the promoter region of the TRPA1 gene in human peripheral blood.

Pearl millet is an important food crop in the arid and semi-arid tropical regions of Africa and Asia. These regions are home to millions of poor smallholder’s households living in harsh agro ecology and reported higher prevalence of malnutrition. Such poor households have few options in terms of food crops, besides the limited markets. Indeed, pearl millet is one of the food crops they continue to grow for their food and nutritional security. Pearl millet is important sources of dietary carbohydrates, energy, protein, and important minerals such as calcium, iron and zinc. Considering inherent high nutritional values and climate resilient nature (drought and heat), demand for pearl millet as food, beside valued for its Stover as a source of livestock fodder, is projected to grow strongly in Asia (India) and Africa (West and Central Africa). Iron (cause anemia) and zinc (cause stunting) deficiencies are widespread and serious public health problems worldwide, including India and Africa. Biofortification is a cost-effective and sustainable agricultural strategy to address this problem. Research on pearl millet has shown that large genetic variability (30-140 mg/kg Fe and 20-90 mg/kg Zn) available in this crop can be effectively utilized to develop high-yielding cultivars with high iron and zinc densities. Both Open –pollinated varieties (Dhanshakti and Chakti) and hybrids (ICMH 1202, ICMH 1203 and ICMH 1301) of pearl millet with high grain yield (>3.5 tons/ha in hybrids) and high levels of iron (70-75 mg/kg) and zinc (35-40 mg/kg) densities have been developed and released. Currently, India growing >70,000 ha of biofortified pearl millet, besides more pipeline hybrids and varieties are under various stage of testing at the national (India) and international (west Africa) trials for possible release. Genomic tools will be an integral part of breeding program particularly for nutritional traits to use diagnostic markers and genomic selection. Clinical studies showed that 200g grains from biofortified cultivar would provide bioavailable Fe to meet full recommended daily allowance (RDA) in children, adult men and 80% of the RDA in women. Till today, no markets to promote biofortified cultivars/grains/products as no incentive price and such products aims to address food and nutritional security challenges simultaneously. The demand is likely to increase only after investment and integration into modern public distribution system, nutritional intervention schemes, private seed and food companies with strong mainstreaming nutritional policies. In the non-traditional regions, this will contribute to livestock and poultry feed industry as spill-over benefits to improve nutrition.

Groundwater plays a pivotal role as the largest potable water sources in Bangladesh. However, the quality of the groundwater faces challenges due to xenobiotic compounds in it. Excess amount of arsenic (As) has already been found in groundwater in many parts of Bangladesh. Thus, this study was conducted to assess the water quality and associated human health risk in central Bangladesh. A total of 99 groundwater samples from the central part of Bangladesh were analyzed to assess human health risk due to high level of nitrate (NO3-) and other trace elements i.e. arsenic (As), iron (Fe), and manganese (Mn). It was found that NO3- concentration (253.17 mg/L) in the groundwater samples exceeds the recommended guideline value by the WHO (50 mg/L). Moreover, this study area also characterized with elevated concentration of As (19.44 µg/L), Fe (811.35 µg/L), and Mn (455.18 µg/L) in the groundwater. Non-carcinogenic human health risk was calculated by justifying HQ (Hazard Quotient) and HI (Hazard Index) and attributed potential conjunctive human health risks due to NO3-, As, Fe and Mn in the study area. Moreover, high carcinogenic risk was found due to As contamination in the groundwater samples in the study area.

Emergence of more virulent forms of human pathogenic bacteria with multi drug resistance is a serious global issue and requires alternative control strategies. The current study was focused to investigate the antibacterial and antibiofilm potential of ferulic acid grafted chitosan (CFA) against Listeria monocytogenes (LM), Pseudomonas aeruginosa (PA), and Staphylococcus aureus (SA). The present result showed that CFA at 64 µg/mL concentration exhibit bactericidal action against LM and SA (>4 log reduction) and bacteriostatic action against PA (<2 log CFU) within 24 h of incubation. Further studies based on propidium iodide uptake assay, measurement of material released from the cell, and electron microscopic analysis revealed that the bactericidal action of CFA was due to the altered membrane integrity and permeability. CFA dose-dependently inhibited biofilm formation (52-89% range), its metabolic activity (30.8-75.1% range) and eradicated mature biofilms, and reduced viability (71-82% range) of the test bacteria. Also, the swarming motility of LM was differentially affected at sub-MIC concentration of CFA. In the present study, the ability of CFA to kill and alter the virulence production in human pathogenic bacteria will insight a new scope for the application of these biomaterials in healthcare to effectively treat bacterial infections.