Introduction: Osteoarthritis (OA) and age-related degeneration (ARD) are stimulants for the development of the fabella in the knee joint. This meta-analysis updates previous studies and reviews on the prevalence of the fabella in OA or ARD knee joints. In addition, it provides a quantitative estimation of the fabellar prevalence in knees having OA and ARD. Methodology: Twenty studies comprising of data from 11,056 knee joints were included in the analysis, consisting of 6,819 Knees of OA subjects (including those with age more than 40 years) and 4,237 knees of non-OA subjects (including less than 40years) knees, respectively. 2,434 knees had fabellae present in OA subjects (including more than 40years), and 844 fabellae were present in non-OA subjects (including less than 40years). The Odds and Risk Ratios were calculated. Sensitivity analysis and cumulative analysis were conducted to assess the robustness of the findings. Results: Prevalence of fabella was found to be higher in OA knees, where the Risk Ratio of developing fabella was 2.50 (2.07-3.01). Compared with this, the Risk Ratio for the incidence of fabella in OA with ARD knee was 1.84 (1.66-2.03). The bilateral occurrence of fabella was more common than unilateral. The risk of developing fabella in individuals aged less than forty-year was 63% less than individuals aged more than forty years. Conclusion: OA and ARD would increase the prevalence of fabella by 84%, thus acting as stimulants and risk factors for ossified fabella.

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

The present study was conducted to evaluate the effects of dietary supplementation of tea polyphenol （TP） on serum hormone, serum enzyme activity, antioxidant-related and immune-related gene expression of laying hens under heat stress. A total of 288 Chinese yellow chicken (186 days old) were randomly distributed among two treatments, each of which included 6 replicates of 24 hens. Dietary treatments were that the basal diet was supplemented with 200 mg / kg tea polyphenol. The study lasted for 7 weeks, including 1 week of adaptation and 6 weeks of the formal test. The content of high-density lipoprotein cholesterol (HDL-C) and total protein (TP) in serum significantly decreased by dietary supplementation with tea polyphenol. Dietary tea polyphenol supplementation improved serum superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) enzyme activity and decreased serum malondialdehyde (MDA) content in treatments compared to the control. However, supplementation of tea polyphenol did not affect the activity of serum catalase (CAT). The results indicated that long-term feeding of tea polyphenols help to increase the amount of hormones (FSH, E2) associated with reproduction in laying hens and thus improve egg production. It also improved the immune function of laying hens in high temperature environments. Adding tea polyphenols to the diet can significantly increase the serum IgG, IgM content of the laying hens and can upregulate the IgA content. Dietary supplementation of tea polyphenols in the laying hens significantly increased the expression of antioxidant enzyme-related genes (SOD, CAT and GPX1) in the liver. Moreover, the addition of tea polyphenols significantly increased the expression of immune-related genes (Interferon-γ (INF-γ), Interleukin 2 (IL-2) and Interleukin 4 (IL-4)) in the spleen. It is concluded that addition of tea polyphenols has a positive effect on antioxidant activity and immune function of laying hens.

EZH2 overexpression is associated with tumor proliferation, metastasis, and poor prognosis. Targeting and inhibiting EZH2 may be an effective therapeutic strategy for head and neck squamous cell carcinoma (HNSCC). We previously analyzed EZH2 mRNA expression in a well-characterized dataset of 230 (110 original and 120 validation cohorts) human head and neck cancer samples. This study aimed to investigate the effects of inhibiting EZH2, either via RNA interference or via pharmacotherapy, on HNSCC growth. EZH2 upregulation was significantly correlated with recurrence (P < 0.001) and the methylation index of tumor suppressor genes (P < 0.05). DNMT3A was significantly upregulated upon EZH2 upregulation (P = 0.043). Univariate analysis revealed that EZH2 upregulation was associated with poor disease-free survival (log-rank test, P < 0.001). In multivariate analysis, EZH2 upregulation was evaluated as a significant independent prognostic factor of disease-free survival (hazard ratio: 2.085, 95% confidence interval: 1.390–3.127; P < 0.001). Cells treated with RNA interference and DZNep, an EZH2 inhibitor, showed the most dramatic changes in expression, accompanied with a reduction in the growth and survival of FaDu cells. These findings suggest that EZH2 upregulation is correlated with tumor aggressiveness and adverse patient outcomes in HNSCC. Evaluation of EZH2 expression might help predict the prognosis of HNSCC patients.

Recent evidence suggests the existence of shared neural resources for rhythm processing in language and music. Such overlaps could be the basis of the facilitating effect of regular musical rhythm on spoken word processing previously reported for typical children and adults, as well as adults with Parkinson’s disease and children with developmental language disorders. The present study builds upon these previous findings by examining whether musical rhythmic priming also influences visual word processing, and the extent to which such cross-modal priming effect of rhythm is related to individual differences in musical aptitude and reading skills. EEG was recorded while participants listened to a rhythmic tone prime, followed by a visual target word with a stress pattern that either matched or mismatched the rhythmic structure of the auditory prime. Participants were also administered standardized assessments of musical aptitude and reading achievement. ERPs elicited by target words with a mismatching stress pattern showed an increased fronto-central negativity. Additionally, the size of the negative effect correlated with individual differences in musical rhythm aptitude and reading comprehension skills. Results support the existence of shared neurocognitive resources for linguistic and musical rhythm processing, and have important implications for the use of rhythm-based activities for reading interventions.

Choroidal neovascularization (CNV) is a key pathological feature of several of the leading causes of vision loss including neovascular age-related macular degeneration. Here we show that a calreticulin anti-angiogenic domain (CAD)-like peptide 27, CAD27, inhibited in vitro angiogenic activities, including tube formation and migration of endothelial cells, and suppressed vascular sprouting from rat aortic ring explants. In rat model of laser-induced CNV, we demonstrate that intravitreal injection of CAD27 significantly attenuated the formation of CNV lesions as measured via fundus fluorescein angiography and choroid flat-mounts (19.5% and 22.4% reductions at 10μg and 20μg of CAD27 injected, respectively). Similarly, the reduction of CNV lesions was observed in the groups of rats that had received topical applications of CAD27 (choroid flat-mounts: 17.9% and 32.5% reductions at 10μg/mL and 20μg/mL of CAD27 installed, respectively). Retinal function was unaffected, as measured using electroretinography in both groups received interareal injection or topical applications of CAD27 at least for 9 days. These findings show that CAD27 can be used as a potential therapeutic alternative for targeting CNV in the diseases such as neovascular age-related macular degeneration.

Garment sector has crucial working field in Turkey.It has also very high risky occupational health conditions and safety.The objective of this study is to define level of job level, work-related stress’ symptoms, social support and coping mechanisms of garment workers and to determine any related factors.This study is descriptive and cross-sectional. The study population comprised garment workers in the 16-65 age range. The data was collected by Assessment Form, The Brief Stress Coping Profile and Brief Job Stress Questionnaire. The level of work-related stress was statistically higher among the workers who had chronic disease, low economic, education status and poor quality of sleep. Psychological and physical physiological reactions to stress were found higher among women workers and those with chronic disease.It also was seen that job stress scores had a meaningful relationship with “emotional expression involving others” (r =.20) and “Avoidance and suppression” coping profile (r =.16; p <.01).Psychological symptom scores were found to have a low level of meaningful relationship with “Seeking help for solution” (r =-.08), “changing point of view” (r=.13) and “emotional expression involving others” coping profiles (r=.21). Work-related stress causes many health and behavioral problems. Work related reasons and coping profiles have powerful effects on stress.

Age-related diseases (ARDs) are the leading cause of death worldwide, and contribute to 90% of mortality in developed countries. Interestingly, the mortality rates of individual ARDs increase exponentially with age. Processes described by the exponential growth function typically involve a branching chain reaction or, more generally, a positive feedback loop. Here I propose that each ARD is mediated by one or several positive feedback loops (vicious cycles). I then identify critical vicious cycles in five major ARDs: atherosclerosis, hypertension, diabetes, Alzheimer’s and Parkinson’s. I also propose that the progression of ARDs can be halted by selectively interrupting the vicious cycles and suggest the most promising targets. An evolutionary perspective is also offered.

Interoperable multilayer networks are pivotal and transformative in public digital health. They not only enhance the delivery of healthcare services but also contribute significantly to improving public health outcomes. Through better accessibility, efficiency, and data-driven decision-making, these networks are revolutionizing how we approach public health. The seamless data exchange and integration they facilitate across different healthcare systems and providers can lead to substantial cost savings for public healthcare systems. These networks pave the way for a more efficient and effective healthcare system by reducing redundancies, optimizing resource allocation, and minimizing unnecessary procedures. This study combines the pressing issues of public digital health with the innovative interpretation of multilayer network theory, proposing practical solutions that inspire academics and practitioners alike.Public digital health is not just about improving care access and patient engagement. It is also about ensuring the financial sustainability of our healthcare systems. Innovative multilayer network analysis is critical in this game, improving interoperability and reducing spatial and temporal constraints. These networks streamline processes and improve efficiency by easing complex interactions within healthcare systems. This process, in turn, allows healthcare providers to deliver high-quality care at a lower cost, transforming, whenever possible, in-patients and out-patients into home-patients. Networks are a cornerstone and a beacon of hope for transforming public digital health. They are increasing the Value for Money and enhancing a patient-centric approach, making us optimistic about the future of healthcare.This study shows that revolutionizing digital healthcare methodologies has a profound impact on crucial elements like resilience, interoperability, and patient well-being within public health. The enhancement of interoperability facilitates the smooth flow of data exchange across various platforms and healthcare providers, fostering improved collaboration and decision-making processes and elevating the safety of patients.

Thoracic aortopathy encompasses a spectrum of conditions affecting the aorta, ranging from aneurysms to dissections, posing significant challenges in management and care. In recent years, remote care, facilitated by telemedicine and digital health technologies, has emerged as a promising approach to overcome barriers in delivering timely and efficient healthcare services. This paper explores the practical considerations and challenges associated with implementing remote care strategies in the management of thoracic aortopathy in India with the largest population in the world. By evaluating existing literature and drawing upon clinical experiences, we discuss the potential benefits, limitations, and best practices for incorporating remote care into the management of patients with thoracic aortopathy. Additionally, we address important factors such as patient engagement, technology integration, privacy concerns, and regulatory requirements to optimize the delivery of remote care in this specialized field.

Hepatocellular carcinoma (HCC) results in high mortality due to ineffective systemic therapy. Human immortalized cell lines are commonly used to study anti-tumour effects in the context of new anti-tumour therapies and tumour biology. As immortalized cell lines have limited biological relevance and heterogeneity compared to primary cells, patient-derived tumour tissues and corresponding immune cells are the gold standards for studying the complexity of individual tumour entities. However, culturing primary HCC cells has a low success rate. Here, we aimed to establish a reproducible approach to preserve the patient-derived liver cancer cells for in vitro and in vivo studies. The underlying study aimed to establish an in vitro pre-screening platform to test treatment options' effectivity and dosage, e.g., for new substances, autologous modified immune cells, or combined therapies in HCC. We initially employed 15 surgical resection specimens from patients with different HCC entities for isolation and preservation. The isolated liver cancer cells from four HCC-diagnosed patients were used for orthotopic transplantation into the healthy liver of immunodeficient mice, allowing them to grow for six months before human liver cancer cells were isolated and cultured. As a result, we generated and characterized four new primary-like liver cancer cell lines. Compared to immortalized HCC cell lines, freshly generated liver cancer cells displayed individual morphologies and heterogenous protein-level characteristics. We assessed their ability to proliferate, migrate, form spheroids, and react to common medications compared to immortalized HCC cell lines. All four liver cancer cell lines exhibit strong migration and colony-forming characteristics in vitro, comparable to extensively investigated immortalized HCC cell lines. Moreover, the four etiological different liver cancer cell lines displayed differences in the response to 5-FU, Sorafenib, Axitinib and Interferon-alpha treatment, ranking from non-responders to responders depending on the applicated medication. In sum, we generated individual patient-derived liver cancer cell lines suitable for predictive in vitro drug screenings and moreover for xenograft transplantations to realize the in vivo investigation of drug candidates. We overcame the low cultivation success rate of liver cancer cells derived from patients and analyzed their potential to serve a pre-clinical model.

Background: Retinal diseases such as neovascular age related macular degeneration (nAMD), diabetic macular edema (DME) or branch-/central retinal vein occlusion (B/CRVO) have significant implications for patients' social and psychological well-being. To gain a comprehensive understanding of patients' backgrounds and attitudes, we developed an exploratory questionnaire, the Basic Care and Patient Satisfaction Questionnaire (BPZ-9). Methods: The ALBATROS study aimed to assess the care situation of treatment-naïve patients diagnosed with either nAMD, DME or B/CRVO. The data collection took place at the beginning of treatment and after twelve months of anti-VEGF (vascular endothelial growth factor) therapy. The BPZ-9 instrument comprises nine questions to evaluate patients’ psychological and social situation and their satisfaction with treatment. Results: Data were collected from 1.478 nAMD (mean 78 years), 445 DME (67 years), 233 BRVO (70 years) and 144 CRVO (71 years) patients at 102 study centers throughout Germany. Approximately one third of the patients was living alone and six percent were in organized care. One in four patients had difficulties to walk and one in five needed accompany for treatment. Anxiety to lose vision was present in three out of four patients at the beginning and slightly decreased to two out of three over the 12-month treatment preriod. The distress of having a retinal disease was generally higher than the distress related to treatment. Most patients reported high treatment satisfaction (73%) and felt well informed (81%). Conclusion: Patients receiving anti-VEGF therapy commonly experience impaired mobility, dependency on others, distress and the fear of vision loss.

Outcome of redo-mitral valve replacement in the small mitral annulus with the use of the chimney technology is not well documented. From 2019 to 2020, 77 consecutive patients underwent redo-mitral valve replacement with the use of the chimney technology because of a small mitral annulus. To evaluate heart structural integrity and clinical outcomes, postoperative clinical data and echocardiograms were examined. Mean age was 56.7 ± 15.98 years. All patients underwent mitral valve surgery of which 62 were mitral valve replacements, 7 mitral valve repairs, and 8 double valve replacements. Preoperative Mitral valve mean gradient was 18.07 ± 9.40 mmHg. Postoperative mitral prosthesis size 28.51 ± 1.22 mm. The median increment of mitral size enlargement was 4 (0, 6) valve sizes. Mean mitral gradient coming out of the operating room was 10.34 ± 2.12 mmHg and at follow-up echocardiogram performed at 3 years after the procedure was 10.36 ± 1.70 mmHg. One-year survival was 93.3%, while 4-year survival was 89.3% with no reoperation. Use of the chimney technology in small mitral valve re-mitral valve replacement results in larger valve sizes. Moreover, the mean gradients over the mitral valve are acceptable intraoperatively and over time.

The intensive care unit is characterized by the critical care of the infants and children who access it, as well as the high complexity of care. This implies and requires optimal integration among the various professionals working there and their ability to work as a team. The purpose of the study was to describe how nurses perceive clinical risk and how they relate to it and to identify adverse events and related risk factors. Nine nurses, two moderators and one external observer partici-pated in the focus group. In the qualitative analysis, 9 themes describing the perception of clinical risk in PICU were identified, including teamwork, specific training, time management, team communication, management, individual errors, structural criticality, patient fac-tors/characteristics, and standardization. Safety culture can be fostered by hospital management to involve PICU nurses in promoting patient safety, which could improve breaking down barriers that prevent nurses from fulfilling their roles.

Introduction: Chronic Obstructive Pulmonary Disease (COPD) is a common, preventable and treatable disease. The first PREM (Patient Reported Outcome Measure) type questionnaire that has been dedicated to asses experience of care in COPD is the PREM-C9. Aim: To create a Polish version of the PREM-C9 and determine its the psychometric characteristics. Methods: The validation procedure involved forward and back translation and included 42 COPD patients. The psychometric properties were assessed using Cronbach's alpha, Bartlett's test, Kaiser-Meyer-Olkin and Spearman correlation coefficient. The validity of the questionnaire was assessed using Principal Component Analysis for the extracted principal components. The validity of the factor analysis was demonstrated by the Bartlett's sphericity test and the Kaiser-Meyer-Olkin (KMO). Factor analysis was performed using the Oblimin and Varimax rotation. The reliability of the questionnaire was assessed using the Cronbach's alpha. Results: The Polish version of the PREM-C9 questionnaire met all validation criteria: face, translation, psychometric, functional and reconstruction equivalence. The Spearman correlation results between Polish PREM-C9&amp;CAT: rho= 0,44, p=0,003539; HADS-Anxiety: rho= 0.370864, p=0,015612, HADS-Depression: rho= 0,387405, p=0,011253. Conclusion: The developed Polish PREM-C9 questionnaire is a reliable and valid tool that assesses Polish COPD patients' experiences of their disease and the care they receive.

Type 1 diabetes imposes a complex and challenging routine on patients and caregivers. Therefore, considering individual experiences and personal facilitators to promote assertive interventions is crucial. However, no studies have addressed these perspectives in the Brazilian adult population. We aimed to identify psycho-behavioral characteristics perceived as facilitators for coping with the condition. We used a biographical method to conduct semi-structured, face-to-face, in-depth interviews for each participant. Transcripts were analyzed using inductive thematic analysis. Participants (n = 22) were aged 18–57 years (mean: 30.2, standard deviation (SD): 8.7), and the duration since diagnosis was approximately 20.6 years (SD: 4.6). Twelve (54.4%) were women, 13 (59.1%) used insulin pumps, 14 (63.6%) had at least a college degree, and 13 (59.1%) had HbA1C (glycated hemoglobin) levels above 58 mmol/mol (7.5%). Five major themes emerged: 1) peer learning, 2) ownership, 3) welcoming experiences, 4) equity, and 5) reframe the path (P.O.W.E.R.). All themes appeared in the lived experiences shared by participants with HbA1C levels below 58 mmol/mol (7.5%). Improved glycemic control can be achieved, and the challenges encountered in diabetes care within similar socioeconomic contexts can be addressed, by an interdisciplinary care team that takes P.O.W.E.R into consideration when providing person-centered care strategies.

Esophageal cancer is a formidable challenge in the realm of cancer treatment. Conventional methods such as surgery, chemotherapy, and immunotherapy have demonstrated limited success rates in managing this disease. In response, targeted drug therapies have emerged as a promising strategy to improve outcomes for patients. These therapies aim to disrupt specific pathways involved in the growth and development of esophageal cancer cells. This review explores various drugs used to target specific pathways, including cetuximab and monoclonal antibodies (gefitinib) that target the epidermal growth factor receptor (EGFR), trastuzumab that targets human epidermal growth factor receptor 2 (HER-2), drugs targeting the vascular endothelial growth factor receptor (VEGFR), mTOR inhibitors, and cMET inhibitors. Additionally, the article discusses the impact of drug resistance on the effectiveness of these therapies, highlighting factors such as cancer stem cells, cancer-associated fibroblasts, immune-inflammatory cells, cytokines, hypoxia, and growth factors. While drug targeting approaches do not provide a complete cure for esophageal cancer due to drug resistance and associated side effects, they offer potential for improving patient survival rates.

Ketogenic dietary therapies (KDTs) are an effective and safe non-pharmacological treatment for drug-resistant epilepsy, but adherence can be challenging for both patients and caregivers. In Europe, there are no adequate tools to measure it other than monitoring ketosis. This study aimed to adapt and validate the Brazilian adherence questionnaire, Keto-check, into the Italian version: iKetoCheck. Using the Delphi technique, 12 judges validated the contents through agreement rate and the Content Validity Index (CVI). The iKetocheck was self-completed electronically by drug-resistant epilepsy or GLUT1 deficiency patients within an interval of 15 days to measure its reproducibility. Test-retest reliability was evaluated using Pearson correlation and relative significance test. Exploratory and confirmatory factorial analyses were made using Factor software. The final tool, iKetoCheck, consists of 10 questions with 5-point Likert scale answers. It evaluates various aspects such as informing caregivers about the diet, organization of meals, measurement of ketosis, weighing food consumed, diet negligence, use of carbohydrate-free medications, attending follow-up visits, reading food labels, consulting an expert for dietary concerns, and cooking at home. The factorial analysis resulted in three factors: "attention," "organization," and "precision," with satisfactory results for indices in exploratory and confirmatory analyses. Although higher mean values of ketonemia measurement were observed in patients with a higher adherence score, these values were not statistically significant (p=0.284). In conclusion, iKetoCheck is a valid tool for evaluating KDTs' adherence in Italian drug-resistant epilepsy or GLUT1 deficiency patients. It can provide valuable information to improve patient management and optimize the effectiveness of KDTs.

There has been limited research on improving Internet-delivered Cognitive Behavioural Therapy (ICBT) in routine online therapy clinics that serve people from diverse ethnocultural groups (PDEGs). This article describes a patient-oriented adaptation approach used to address this gap in research. A working group consisting of people with lived experience, community stakeholders, ICBT clinicians, managers, and researchers, was formed. The working group examined archival feedback on ICBT from past clients who self-identified as being from diverse ethnocultural back-grounds (N=278) and results of interviews with current patients (N=16), community stakeholders (N=6), and clinicians (N=3). The archival data and interviews revealed the majority of the pa-tients reported being satisfied with and benefitting from ICBT. Suggestions for improvement were not related to the cognitive-behavioural model and techniques, but rather to making treatment materials more inclusive. Consequently, the ICBT adaptation focused on adding content related to cultural influences on mental health, addressing stigma, diversifying case stories, examples and imagery, adding audiovisual introductions, and replacing English idioms with more descriptive language. Moreover, further training was offered to clinicians and efforts were made to improve community outreach. This study demonstrates a process for using patient-oriented research to improve ICBT within routine care serving patients of diverse backgrounds.

Cloud computing appears to be the dreamed vision of the healthcare industry; it refers to means of storing and accessing data and programs over the internet instead of the computer’s hard drive. However, the adoption of cloud computing requires solving several issues and infor-mation privacy is a major one. This work proposes a cloud architecture design for the healthcare information system. The proposed architecture enables for storing and sharing information in a privacy-preserving manner. Patients’ information in the proposed architecture is divided into four categories identified in the case study data analysis. User identity management protocol (U-IDM) is employed for controlling the access to patients’ information, and patients have means of control over who can access their information. A scenario-based instantiation validated the proposed architecture's privacy-preserving patient data exchange. The instantiation proved that the proposed architecture allows sharing healthcare information without violating the privacy of patients.

The COVID-19 pandemic has presented an unprecedented challenge to the healthcare system. Identifying the genomics and clinical biomarkers for effective patient stratification and management is critical to controlling the spread of the disease. Omics datasets provide a wealth of information that can aid in understanding the underlying molecular mechanisms of COVID-19 and identifying potential biomarkers for patient stratification. Artificial intelligence (AI) and machine learning (ML) algorithms have been increasingly used to analyze large-scale omics and clinical datasets for patient stratification. In this manuscript, we demonstrate the recent advances and predictive accuracies in AI and ML-based patient stratification modeling linking omics and clinical biomarker datasets, focusing on COVID-19 patients. Our ML model not only demonstrates that clinical features are enough an indicator of COVID-19 severity and survival but also infers what clinical features are more impactful, which makes our approach a useful guide for clinicians for prioritization of best-fit therapeutics for a given cohort of patients. Moreover, with weighted gene network analysis, we are able to provide insights into gene networks that have a significant association with COVID-19 severity and clinical features. Finally, we have demonstrated the importance of clinical biomarkers in identifying high-risk patients and predicting disease progression.

Objectives: The purpose of this systematic review was to ascertain critical care nurses’ understanding and experiences of patient advocacy in adult critical care settings. The specific objectives were to identify how critical care nurses define patient advocacy, to explore the understanding and experiences of critical care nurses regarding patient advocacy, to explore critical care nurses’ role in patient advocacy, and to ascertain the barriers to encouraging advocacy in the critical care setting. Research design: Systematic literature search of CINAHL and Medline databases, Google Scholar, and Cochrane Database of Systematic Reviews, as well as grey literature search, was conducted. Search dates were restricted from January 2005 to 2015 in both CINAHL and Medline. Findings: 62 studies were identified, of which 6 qualitative research papers were included. Nurses gave varied definitions of patient advocacy, which were categorized into three themes: communication, protection, and doing. Nurses perceive advocacy as truly listening to patients and their families. Conclusion: For critical care nurses to be effective advocates, there must be support, collaboration, and improved working relationship between professional groups. Moreover, nurses must be empowered to be able to give power to patients and family.

Patient-derived xenograft (PDX) models are created by engraftment of patients’ tumor tissues into immunocompetent mice. Since PDX model keep the characteristics of primary patient’s tumor such as gene expression profiles and drug sensitivity, it now becomes most reliable in vivo human cancer model. The engraftment rate are increased with the introduction of NOD/Scid based immunocompromised mice, especially, NK cell defective NOD strains such as NOD/Scid/IL2Rγnu (NOG/ NSG) mice and NOD/Scid/Jak3null (NOJ) mice. Success ratio differs from the origin of tumor: Gastrointestinal tumors tend to higher success rate and breast cancer is lower. Subcutaneous transplantation is most popular method to establish PDX, but some tumor needs orthotropic or renal capsule transplantation, and human hormone treatment is needed to establish hormone dependent cancers such as prostate and breast cancer. PDX library with patient’s clinical data, gene-expression patterns, mutational status, drug responsiveness and tumor architecture will be the powerful tool for developing specific biomarker and novel individualized therapy and establishing precision cancer medicine.

Background: Even though a number of studies have verified the positive effect of physical activity (PA) on self-related health (SRH) no previous research has examined this association among pediatric patients with Type 1 diabetes mellitus (T1DM). Objective: The purpose of this study was to investigate the association between regular physical activity (PA) and self-rated health (SRH) in pediatric patients with Type 1 diabetes mellitus (T1DM) who lacked diabetes care. Methods: We conducted a retrospective study among pediatric patients with T1DM who lacked diabetes care and were enrolled in a diabetes education program between January 2011 to January 2015 at the endocrinology clinic of Seoul National University Children’s Hospital in South Korea. The eligible participants for this study were 37 pediatric patients with T1DM aged 9 to 17 years. PA was divided into regular PA and muscle strength exercise to analyze the relationship with SRH using binomial logistic regression analysis. Results: The results showed SRH of pediatric patients with T1DM who did not engage in regular PA was significantly lower than those who did (OR in regular PA = .199 [95% CI: .040, .995]; OR in regular muscle strength exercise = .097 [95% CI: .023, .825]). Conclusions: In conclusion, regular PA and muscle strength exercise in pediatric patients with T1DM who lacked diabetes care were effective in improving their SRH. A systematic plan is required to enhance regular PA for pediatric patients with T1DM.

Background. The Stanford Health Assessment Questionnaire-Disability Index (HAQ) is widely used to measure functional ability in persons with Rheumatoid Arthritis (RA). The instrument was developed with limited involvement from persons with RA, and their perception of the instrument has not been studied in depth. The aim of this study was to explore how persons with RA experience the use of the HAQ in care. Methods. Forty persons with RA were purposefully recruited to participate in semi-structured interviews. The interviews were then analyzed qualitatively using thematic analysis. Results. The participants questioned the relevance of the HAQ but nevertheless experienced that the instrument had a profound effect on their understanding of health and how care is delivered. The analysis resulted in three themes: Problems with individual items, meaning of the summative score, and effects on care and health perceptions. Conclusions. To make the HAQ relevant to persons with RA, it needs to be revised or to include an option to select items most meaningful to the respondent. To ensure relevance, the HAQ update should preferably be co-created by researchers, clinicians and persons with RA.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

OCTA is an imaging modality used in the assessment of the retinal vasculature. It operates on the principle of coherence tomography used in standard OCT with the addition of delineating the retinal vascular. This provides a modern non-invasive retinal vascular imaging method compared to conventional dye-based imaging. High quality depth resolution of the superficial and deep capillary networks is possible on OCTA whereas this was not possible prior. OCTA may be limited by image quality degradation from factors such as motion artefact or media opacities, and therefore may not be the investigation of choice for all patient groups. There are multiple potential clinical applications for OCTA in retinal and choroidal vascular disease. Ongoing research is necessary to substantiate the more widespread use of OCTA due to its significant cost burden compared to current modalities.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Overweight and obesity adversely affect health-related quality of life (HRQOL) through day-to-day impairments of both mental and physical functioning. It is assumed that polyphenols within the Mediterranean diet may contribute to improve HRQOL. This investigation aimed at studying the effects of a polyphenol-rich ingredient on HRQOL in overweight and obese but otherwise healthy individuals. A randomized, double-blind, placebo-controlled study including 72 volunteers was conducted. Subjects were randomly assigned to receive for a 16-week period either 900 mg/day of the supplement or a placebo. Dietary recommendations were individually determined, and intakes were recorded; daily physical mobility was monitored. Improvement of HRQOL was set as the primary outcome and assessed at baseline and at the end of the investigation, using the Short-Form 36 (SF-36) Health survey. Body composition was analyzed using dual-energy X-ray absorptiometry (DXA). Physical activity level was calculated using International Physical Activity Questionnaire (IPAQ). After 16 weeks, despite there was no adherence to the Mediterranean Diet Serving Score (MDSS), supplemented individuals experienced significant HRQOL improvement (+5.3%; P=0.001), including enhanced perceived physical (+11.2%; P=0.002) and mental health (+4.1%; P=0.021) components; bodily pain, vitality, and general health, being the greatest contributors. Besides, body fat mass significantly decreased (-1.2 kg; P=0.033), mainly within trunk area (-1.0 kg; P=0.002). Engagement in physical activity significantly increased (+1308 Met-min/week; P=0.050). Hence, chronic supplementation with a nutritional diversity and dose of a Mediterranean diet-inspired polyphenol-rich ingredient resulted in a significant amelioration in both perceived physical and mental health, concomitant with the improvement of body composition, in healthy subjects with excessive adiposity.

This research addresses a gap in the literature by conducting a comprehensive analysis of patients’ level of satisfaction with dental care. Methods: By combining quantitative and qualitative survey methods with the PSQ questionnaire this study aims to augment ongoing initiatives to enhance dental patients’ experiences by painting a more comprehensive depiction of patients' level of satisfaction; Results: When asked about their overall level of satisfaction 77,1% of the patients said they received excellent services from the office personnel and 72,2% said they trust their doctors; Conclusions: Assessing patient satisfaction in the realm of dental services quality is crucial for enhancing service quality and accuracy, benefiting both patients and dentists, and ultimately improving public health.

Familial Mediterranean fever (FMF) is a systemic autoinflammatory disorder caused by inherited mutations in the MEFV (Mediterranean FeVer) gene located on chromosome 16 (16p13.3) and coding pyrin protein. Despite the existing data on MEFV mutations, the exact mechanism of their effect on the development of pathological processes leading to autoinflammation observed in FMF, remains unclear. Induced pluripotent stem cells (iPSCs) are considered an important tool for studying the molecular genetic mechanisms of various diseases due to their ability to differentiate into any cell type, including macrophages, which contribute to the development of FMF. In this study, we developed iPSCs of an Armenian patient with FMF having M694V, p.(Met694Val) (c.2080A&gt;G, rs61752717) pathogenic mutation in exon 10 of the MEFV gene. As a result of direct differentiation, macrophages expressing CD14 and CD45 surface markers were obtained. In addition, we found that the morphology of patient macrophages derived from iPSCs with MEFV mutation was significantly different from that of differentiated from iPSCs of a healthy donor carrying wild-type MEFV gene.

Mathematical models of non-small cell lung cancer are powerful tools that use clinical and experimental data to describe various aspects of tumorigenesis. The developed algorithms capture phenotypic changes in the tumor and predict changes in tumor behavior, drug resistance, and clinical outcomes of anti-cancer therapy. The aim of this study was to propose a mathematical model that predicts the changes in the cellular composition of patient-derived tumor organoids over time with a perspective of translation of these results to the parental tumor, and therefore to possible clinical course and outcomes for the patient. Using the data on specific biomarkers of cancer cells (PD-L1), tumor-associated macrophages (CD206), natural killer cells (CD8), and fibroblasts (αSMA) as input, we proposed a model that accurately predicts the cellular composition of patient-derived tumor organoids at a desired time point. Combining the obtained results with “omics” approaches will improve our understanding of the nature of NSCLC. Moreover, their implementation into clinical practice will facilitate a decision-making process on treatment strategy and develop a new personalized approach in anti-cancer therapy.

Electric stimulation via a Cochlear Implant (CI) enables people with severe to profound sensorineural hearing loss to regain speech understanding and music appreciation and thus allowing them to actively engage in social life. Three main manufacturers (Cochlear, MED-EL and Advanced Bionics “AB”) have been offering CI systems, thus challenging CI recipients and Otolaryngologists with a difficult decision, as currently no comprehensive overview or meta-analyses on performance outcome following CI implantation is available. The main goal of this scoping review is to provide evidence that data and standardized speech and music performance tests are available for performing such comparisons. To this end, a literature search was conducted to find studies that address speech and music outcomes in CI recipients. From a total of 1592 papers, 188 paper abstracts were analyzed and 147 articles were found suitable for examination of full text. From which, 42 studies were included for synthesis. A total of 16 studies used the consonant-nucleus-consonant (CNC) word recognition test in quiet at 60db SPL. We found that aside from technical comparisons, only very few publications compare speech outcomes across manufacturers of CI systems. Evidence suggests though, that these data are available in large CI centers in Germany and US. Future studies should therefore leverage large data cohorts to perform such comparisons that could provide critical evaluation criteria and assist both CI recipients and Otolaryngologists to make informed performance-based decisions.

With the rise of powerful computational technologies, healthcare systems are going through a paradigm shift to the era of healthcare 5.0, also known as" smart healthcare". This new-age healthcare system not only enhances the life of patients but also aims to reduce healthcare costs significantly. People's health data collected through various means, including various Internet of Things (IoT) devices, is too sensitive to be regulated by particular organisations owing to increasing privacy and security threats. The sheer size of data makes it difficult for centralised bodies to regulate, due to which third-party involvement is introduced, which again poses threats to the privacy of the data holder. Motivated by the abovementioned gaps, we propose a decentralised approach using Ethereum blockchain technology and Oasis protocol. The patient-driven solution approach effectively solves the privacy problem by providing complete control of data to the owner. Along with this, byproducts such as fine-grained access control and on-chain data processing capabilities are also obtained.

Abstract. Babies born to severe acute respiratory syndrome corona virus-2 (SARS-CoV-2) infected mothers are at greater risk for perinatal morbidity and more likely to receive a neurodevelopmental diagnosis in the first year of life. However, the effect of maternal infection on placental function and neonatal outcomes varies depending upon the patient population. We set out to test our hypothesis that maternal SARS-CoV-2 infection in our underserved, socioeconomically disadvantaged, predominantly African American and Latina population in the Bronx, NY would have effects evident at birth. Fifty-five SARS-CoV-2 positive and 61 negative third trimester patients were randomly selected from Montefiore Medical Center (MMC), Bronx, NY. In addition, two positive cases from Yale New Haven Hospital, CT were included as controls. All 55 placentas delivered by SARS-CoV-2 positive mothers were uninfected by the virus, based on immunohistochemistry, in-situ hybridization, and qPCR analysis. However, placental villous infarcts, mild preeclampsia, shortened gestational periods and lower Apgar scores were observed in the infected cases. These findings suggest that even without entering the placenta, SARS-CoV-2 can affect various systemic pathways culminating in altered placental development and function, which may adversely affect the fetus, especially in a high-risk patient population such as ours. These results underline the importance of vaccination among pregnant women, particularly in low resource areas.

This study reports results of focus groups with school nurses and teachers from elementary, middle, and high schools to explore their perceptions of child and adolescent oral health. Participants included 14 school nurses and 15 teachers (83% Female; 31% Hispanic, 21% White, 21% Asian, 14% African American, and 13% Others). Respondents were recruited from Los Angeles County schools and scheduled by school level for six one-hour focus groups, using Zoom. Audio recordings were transcribed, reviewed, and saved with anonymization of speaker identities. NVivo software was used to facilitate content analysis and identify key themes. The nurses’ rate of “Oral Health Education” comments statistically exceeded that of teachers, while teachers had higher rates for “Parental Involvement” and “Mutual Perception” “Need for Care” was perceived to be more prevalent in immigrants to the United States based on student behaviors and complaints. “Access to Care” was seen as primarily the nurse’s role. Strong relationships between community clinics and schools were viewed by some as integral to students achieving good oral health. The results suggest dimensions and questions important to item development for oral health surveys of children and parents to address screening, management, program assessment, and policy planning.

Background and objectives: Traditional intravenous, patient-controlled analgesia (PCA) uses a fixed-rate continuous background infusion mode. However, some patients suffer from inadequate analgesia or opioid-related adverse effects due to the biphasic pattern of postoperative pain. Therefore, we investigated the postoperative analgesic efficacy of PCA using an optimizing background infusion mode (OBIM), where the background injection rate varies depending on the patient's bolus demand. Materials and Methods: We prospectively enrolled 204 patients who underwent laparoscopic cholecystectomy in a randomized, controlled, double-blind study. Patients were allocated into either the optimizing (group OBIM) or the traditional background infusion group (group TBIM). The numeric rating scale (NRS) score for pain was evaluated at admission to and discharge from the recovery room, as well as at the 6th, 24th, and 48th postoperative hours. Data of bolus demand count, total infused volume, and background infusion rate was downloaded from the PCA device at 30-min intervals until the 48th postoperative hour. Results: The NRS score was not significantly different between groups throughout the postoperative period (P = 0.621), decreasing with time in both groups (P < 0.001). The bolus demand count was not significantly different between groups throughout (P = 0.756). The mean cumulative infused PCA volume was lower in group OBIM [84.0 (95% confidence interval: 78.9−89.1) mL) than in group TBIM [102 (97.8−106.0) mL] (P < 0.001). The background infusion rate was significantly different between groups throughout (P < 0.001); it was higher in group OBIM than in group TBIM before the 12th postoperative hour, and lower from the 18th to the 48th postoperative hours. Conclusions: The OBIM combined with bolus dosing is useful in that it reduces the cumulative PCA volume compared to the TBIM combined with bolus dosing, while yielding comparable postoperative analgesia and bolus demand in patients undergoing laparoscopic cholecystectomy.

Despite the recognition of the importance of stakeholder inclusion into decisions about new solutions offered to society, responsible innovation (RI) has stalled at the point of articulating a process of governance with a strongly normative loading, without clear practical guidelines toward implementation practices. The principles of RI direct us to involve the user early in the innovation process. However, it lacks direction of how to involve users and stakeholders into this process. In this article, we try to understand how to empower users to become a part of innovation process though empirical cases. Based on 11 cases of firms innovating in digital health and welfare services, we look on firm practices for user integration into their innovation process, as well as how user’s behavior is changing due to new trends such as availability of information and digitalization of services. We try to explore this question through lenses of responsible innovation in the emerging field of digital healthcare.

We analyze a time-delayed SIQR model that considers the transportation-related infections and entry-exit screening. This model aims to determine the measures for preventing and controlling major emergent infectious diseases and the associated costs. We calculate the basic reproduction number (R0), apply the linearization method, and construct an appropriate Lyapunov function to determine the stability of the disease-free equilibrium in the local and global. We collect COVID-19 infection data from two regions in the United States in 2020 for data fitting, obtain a set of optimal parameter values, and show that the model is suitable for simulating the outbreak and spread of emerging infectious diseases. We find that transportation-related infections increase the basic reproduction number, enhancing the impact on disease spread. Entry-exit screening effectively suppress the spread of disease by reducing the basic reproduction number. Furthermore, we investigate the influence of the incubation period on disease and find that a shorter incubation period results in a shorter duration but a larger scale of infection, and the peaks are reduced. We conduct a sensitivity analysis of the R0 and propose three measures to prevent the spread of new infectious diseases based on the most sensitive parameters: wearing masks, implementing urban closures, and administering medication to sick but not yet hospitalized patients promptly. In the case of COVID-19, we use Pontryagin’s minimum principle to get time-varying control measures to control the spread of the outbreak. Optimal control effectively controls the development and deterioration of the disease. Finally, several control measures are compared through cost-effectiveness analysis, and the results show that wearing masks is the most cost-effective measure. Our study provides some practical guidance for controlling the spread of major emerging infectious diseases.

Survival of Medulloblastoma (MB) depends on various factors, including the gene expression profiles of MB tumor tissues. In this study, we identified 967 MB survival related genes (SRBs) using the gene expression dataset of Cavalli et al. (2017) and the Cox proportional hazards regression model. Notably, the SRGs were over-represented on chromosomes 6 and 17, known for the abnormalities monosomy 6 and isochromosome 17 in MB. The most significant SRG was HMGA1 (high mobility group AT-hook 1), which is a known oncogene and a histone H1 competitor. High expression of HMGA1 was associated with worse survival, primarily in the Group 3γ subtype. The high expression of HMGA1 was unrelated to any known somatic copy number alteration. Most SRGs on chromosome 17p were associated with low expression in Group 4β, the MB subtype with 93% deletion of 17p and 98% copy gain of 17q. Pathway analysis showed that both chromosomes 6 and 17 included SRGs related to telomere maintenance and provide a rationale for testing telomerase inhibitors in Group 3 MBs. We conclude that HMGA1, along with other SRGs on chromosome 6 and 17 warrant further investigation as potential therapeutic targets in selected subgroups or subtypes of MB.

This study aimed to investigates obesity-related glomerulopathy (ORG) at cellular, structural, and transcriptomic levels. Thirty Wistar rats were randomized into two groups: control (n=15) and study groups (n=15) that were fed a standard (SD) and high-fat diet (HFD), respectively. After 10 weeks, the weight, kidney function, histological features, and transcriptomic changes were assessed. HFD group exhibited increased weight gain (55.8% vs 29.2%; P< 0.001) and albuminuria (10384.04 ng/ml vs 5845.45 ng/ml; P<0.001) compared to controls. The HFD group exhibited early stages of ORG lesions, with a predominance of mesangial matrix increase and podocyte hypertrophy (PH). These lesions correlated with differentially expressed (DE) genes and miRNAs. Functional analysis showed that four DE miRNAs in the kidneys of the HFD group negatively regulated the PTEN gene, which promotes podocyte endocytosis of lipids in ORG. Among these four miRNAs, miR-205 was upregulated in the urine of the HFD group. HFD-fed Wistar rats developed early stages of ORG, with a specific targetome of miRNAs and gene expression. The upregulation of miR-205 in the kidney and its isolation in urine are associated with lipid endocytosis in podocytes, which could become a plausible biomarker of the early stages of ORG and lead to future therapeutic research.

Objective To investigate nailfold capillary parameters in community-dwelling individuals aged over 60 years who have hypertension and do not exercise regularly. Furthermore, the study examined the correlations between capillary function and other health-related indicators. Design A single- center pilot trial Setting Faculty of Health, Tsukuba University of Technology, Japan Participants hypertensive community-dwelling elderly people Intervention Microcirculation was observed before and 1 min after arm-curl exercise by means microscopy of capillary with non-exercised limb. Additionally, we examined other health-related indicators. Outcome measures: Acute effects of reperfusion on nailfold density, flow, and diameters. Secondary outcomes included the correlations between microvascular parameters and other health-related indicators. We hypothesized that brief exercise could enhance microcirculation reperfusion and correlate with other health-related parameters.　 Results: There were 20 participants with a mean (SD) age of 67.1 (5.8) years. The capillary flow rate changed from 2.3±6.7 to 2.7±0.2 log µm/s (P

Background: Micronutrient deficiencies are common at the time of cancer diagnosis and are associated with worse prognosis. Little is known about them in cancer rehabilitation. Methods: Data from routine health related quality of life (HRQOL) were analyzed at an inpatient cancer rehabilitation center. Rehabilitation patients completed the EORTC QLQ-C30 questionnaire before and after multidisciplinary rehabilitation treatment, and three month after discharge. Selenium and zinc status was measured in whole blood at these three time points. In case of selenium deficiency up to 600 µg selenium per day as sodium selenite was supplemented. Results: A total of 271 patients (breast, colon, and pancreatic cancer) were included in the analysis. There was clinically meaningful improvement in many domains of the EORTC QLQ-C30 during rehabilitation. However, effect often waned in the three months after. Prevalence for selenium deficiency varied between 34 to 90 percent depending on cancer type (breast &lt; colon &lt; pancreas). In contrast, zinc deficiency was rare. Daily selenium supplementation of 600 µg was more efficient to correct selenium deficiency compared to 300 µg selenium per day. Rehabilitation and increasing selenium status after rehabilitation were associated with improved global quality of life, physical and emotional functioning, and fatigue. In cancer patients with decreasing selenium status, values of global quality of life, physical and emotional functioning, and fatigue were back to the values at the beginning of rehabilitation. Conclusions: Selenium deficiency is common in cancer patients admitted to a cancer rehabilitation clinic. Selenium supplementation during rehabilitation effectively corrected selenium deficiency in most cases. The positive effects of rehabilitation persisted longer, when selenium status did not decrease after rehabilitation.

: Molecular targeting strategies have been used for years to control cancer progression and are often based on targeting various enzymes involved in metabolic pathways. Keeping that in mind, it is essential to know the role of each enzyme in a particular metabolic pathway. In this review, we are providing in-depth knowledge of various enzymes such as ceramidase, sphingosine kinase, sphingomyelin synthase, dihydroceramide desaturase, and ceramide synthase, which are associated with multiple types of cancer that depend on ceramide metabolism. Focus has also been given to discussing physicochemical properties of well-studied inhibitors of natural products origin and their related structures for these enzymes. Targeting ceramide metabolism exhibited promise in mono and combination therapies at preclinical stages to prevent cancer progression and paved the way for the significance of sphingolipid metabolism in cancer treatments. Targeting ceramide metabolizing enzymes will help the medicinal chemist to design potent and selective small molecules for treating cancer progression at various levels.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

To date, the impact of COVID-19 vaccination on formerly menstruating women remains unknown. For this reason, a retrospective observational cross-sectional study was conducted (N= 548) using an online survey. General characteristics, medical history, and adverse events following COVID-19 vaccination were recorded. In comparison with the first dose, significantly higher percentages of respondents experienced menstrual-related disturbances (dose 1: 38.5% vs. dose 2: 44.8%; McNemar=9.15; mid P-value=0.002), as well as the simultaneous occurrence of two or more of these symptoms (dose 1: 11.2% vs. dose 2: 15.3%; McNemar=13.53; mid P-value=0.044) after receiving the second one. Among them, those related with the length and flow stand out, being of long-term nature in about 17-20% of cases. Interindividual factors influencing this unexpected event after receiving the dose 1 may include weight (AOR 1.02, CI 95% 1.01–1.03, P&lt;.001), perimenopause (AOR 2.28, CI 95% 1.37–3.77, P=.001), pre-existing diagnoses of non-autoimmune rheumatic/articular conditions (AOR 0.31, CI 95% 0.10–1.00, P=0.05), hormonal contraceptive use (AOR 0.25, CI 95% 0.07-0.82, P=0.02), suffering from other vaccine side effects − such as arm pain (AOR 0.61, CI 95% 0.39–0.95, P=0.03), headache (AOR 0.53, CI 95% 0.35 – 0.80, P=.003), swollen glands (AOR 0.29, CI 95% 0.15 – 0.60, P=.001) and nauseas (AOR 0.35, CI 95% 0.14 – 0.86, P=0.02) – and the number of previous pregnancies (AOR 2.70, CI 95% 1.54 – 4.76, P=.001). Formerly menstruating women may experience long-term menstrual-related disturbances following COVID-19 vaccination.

This study analyses key aspects of the professional life of primary school teachers in a southern European context. In the social changes of last two decades profoundly impacted the well-being of teachers putting a strain on their ability to adapt to sometimes unfair working conditions. For this purpose twenty teachers (M = 38.85; DS = 9.17) were interviewed from different areas of Italy, data were analyzed using the Grounded Theory Method. Through data analysis were summa-rize and emphasize eight core themes. The results show the effects of a gradual impoverishment of the recognition of the role of teacher, highlighting the difficulty for teachers of renegotiating more flexible workload assessments and of reinforcing psycho-emotional skills for the development of a teaching methodology attentive to the psycho-emotional needs of pupils. Schools emerge as a rigid working context, in which a competent organizational function is often absent. Practical psychological implications are discussed.

Tyrosine kinase inhibitors (TKI) and immune checkpoint inhibitors (ICI) significantly improve the outcomes of patients with advanced clear cell renal cell carcinoma (ccRCC), but high-grade toxicities can occur, particularly during combination therapy. Herein, we report a patient with advanced metastatic ccRCC, who developed grade 4 cholestasis during combined therapy with nivolumab and cabozantinib. After the exclusion of common disorders associated with choles-tasis and a failure of corticosteroids (CS), a liver biopsy was performed that demonstrated severe ductopenia. Consequently, a diagnosis of vanishing bile duct syndrome related to TKI and ICI administration was made, resulting in CS discontinuation and ursodeoxycholic acid administra-tion. After a 7-months follow-up, liver tests had returned to normal values. Immunological studies revealed that our patient had developed robust T-cells and macrophages infiltrates in his lung metastasis, as well as in skin and liver tissues at the onset of toxicities. At the same time, peripheral blood immunophenotyping revealed significant changes in T-cell subsets suggesting their potential role in the pathophysiology of the disease.

Grapevine is one of the most relevant crops in the world being used for economically important products such as wine. Yet, relevant grapevine cultivars are heavily affected by diseases such as the downy mildew disease caused by Plasmopara viticola. Improvements on grapevine resistance are made mainly by breeding techniques where resistance traits are introgressed into cultivars with desired grape characteristics. However, there is still a lack of knowledge on how resistant or tolerant cultivars tackle the P. viticola pathogen. In this study, using a shotgun proteomics LC-MS/MS approach, we unravel the protein modulation of a highly tolerant grapevine cultivar, V. vinifera ‘Regent’, in the first hours post inoculation (hpi) with P. viticola. At 6 hpi, proteins related to defence and to response to stimuli are negatively modulated while at 12 hpi there is an accumulation of proteins belonging to both categories. The co-occurrence of effector-triggered susceptibility (ETS) and effector-triggered immunity (ETI) is detected at both time-points, showing that these defence processes present high plasticity. The results obtained in this study unravel the tolerant grapevine defence strategy towards P. viticola and may provide valuable insights on resistance associated candidates and mechanisms, which may play an important role in the definition of new strategies on breeding approaches.

The 2030 Agenda sets out seventeen Sustainable Development Goals (SDGs). The educational goal is to promote the education of citizens on sustainable development, among other things. Educating today's digital citizens on sustainability means training them for justice and social activism, commitment and political engagement. However, research into the subject shows a lack of consistency in the education of university students. This paper presents a study of students of Education, on education on sustainability through the practice of active and critical digital citizenship. A quasi-experimental method was used to learn about the behaviours of digital citizens, and intervention was carried out by means of an SDG-focused workshop and observation of the final level of commitment. The results show a positive level of commitment and digital activism around content related to sustainable development, which can be addressed from the university syllabus in a cross-curricular way.

Deregulation of cell growth and development lead to cancer, a severe condition that claims millions of lives worldwide. Targeted or selective approaches used during cancer treatment determine the efficacy and outcome of the therapy. In order to enhance specificity and targeting and better treatment options for cancer, novel and alternative modalities are currently under development. Photodynamic therapy has the potential to eradicate cancer and combination therapy would yield even greater outcomes. Nanomedicine-aided cancer therapy shows enhanced specificity for cancer cells and minimal side-effects coupled with effective cancer destruction both in vitro and in vivo. Nanocarriers used in drug-delivery systems are well able to penetrate cancer stem cell niche, simultaneously killing cancer cells and eradicate drug-resistant cancer stem cells, yielding therapeutic efficiency up to 100 fold against drug-resistant cancer in comparison with free drugs. Safety precautions should be considered when using Nano-mediated therapy as the effects of extended exposure to biological environments are still to be determined.

Background: Patients with locally advanced/metastatic urothelial cancer have been conventionally treated with platinum-based chemotherapy. Recently, numerous new treatments have been proposed to improve overall survival (OS) and reduce adverse effects, but no head-to-head direct comparison is available. Methods: We considered: a) monotherapy with immune checkpoint inhibitors (ICI); b) combinations of an ICI with chemotherapy; c) combinations of an ICI with other drugs. An indirect comparison was performed to identify the regimens most effective in prolonging OS compared to each other and to chemotherapy. Results: A total of 6 articles were included. In our final analysis, nivolumab plus chemotherapy showed better OS compared to chemotherapy (HR= 0.70, 95%CI: .59-0.82); while durvalumab plus tremelimumab showed no OS benefit (HR=0.95, 95%CI 0.82-1.11). More interestingly, enfortumab vedotin plus pembrolizumab significantly prolonged OS compared to both chemotherapy alone (HR=0.53, 95%CI 0.45-0.63) and nivolumab plus chemotherapy (HR= 0.76, 95%CI 0.60-0.97). Discussion and conclusion: Among new treatments for locally advanced and metastatic urothelial cancer, enfortumab vedotin + pembrolizumab showed the best efficacy in terms of OS. Our results support the use of this combination as first-line treatment in this setting.

Diabetic foot ulcers (DFUs) significantly affect the lives of patients and increase the risk of hospital stay and amputation. We suggest a remote-monitoring platform for better DFU care. This system uses digital health metrics (scaled from 0 to 10, where higher scores indicate a greater risk of slow healing) to provide a comprehensive overview through a visual interface. The platform features smart offloading devices that capture behavioral metrics such as offloading adherence, daily steps, and cadence. Coupled with remotely measurable frailty and phenotypic metrics, it offers an in-depth patient profile. Additional demographic data, wound characteristics, and clinical parameters, such as cognitive function, were integrated, contributing to a comprehensive risk factor profile. We evaluated the feasibility of this platform with 124 DFU patients over 12 weeks; 39% experienced unfavorable outcomes such as dropout, adverse events, or non-healing. Digital biomarkers were benchmarked (0-10), categorized into low, medium, and high risk for unfavorable outcomes, and visually represented using color-coded radar plots. The initial results of case reports illustrate the value of this holistic visualization to pinpoint the underlying risk factors for unfavorable outcomes, including a high number of steps, poor adherence, and cognitive impairment. Although future studies are needed to validate the effectiveness of this visualization in personalizing care and improving wound outcomes, early results in identifying risk factors for unfavorable outcomes are promising.

Background. Malignant pleural mesothelioma (MPM) is still a rather incurable disease. Many classes of compounds with various mechanisms of action have been tested in vivo and ex-vivo, with rather disappointing results. This is partly due to preclinical studies mostly performed in models that fail to recapitulate MPM complexity and do not retain the intra-tumor heterogeneity, a propelling force for tumor progression. Additionally, we and others have shown that, under stress-induced chemotherapy, profound rearrangements take place in MPM cultures to fuel the emergence of chemoresistant cell subpopulations. Thus, finding clinically actionable modulators of MPM resistance is still a very urgent need. Methods. Setup and propagation of patient-derived organoid cultures from MPM pleural effusions; flow cytometry-based validation of organoid cultures, isola-tion and propagation of mesothelioma-associated fibroblasts; co-cultures, Lu-minex-based Cytokine array, ELISA assay to quantitate IL-6 in the conditioned media, qRT-PCR to assess mRNA expression of cancer stem cell markers and fibroblast markers. Results. Organoid cultures were obtained from eight MPM patients by using specific growth media and conditions to propagate pleural effusion-derived cells. We proved that primary MPM specimens and serially passaged (mesothelio-ma-Patient-Derived-Organoids) mPDOs were cytologically similar, with the obtained mPDOs expressing mesothelial markers similarly to the originating specimen. As expected from a clinically relevant model, the size and number of mPDOs were altered, in a patient-specific way, when pharmacologically relevant doses of chemotherapy drugs were added. We derived Mesothelio-ma-Associated-Fibroblasts (MAFs) and the addition of MAFs, to various ratios, altered the response of the mPDOs to pemetrexed + cisplatin, toward a reduced sensitivity to the latter anticancer agents. Additionally, organoid formation and size were altered by MAF-conditioned media, and this correlated with increased expression of cancer stem cell markers. We showed increased levels of IL-6 in the media of the treated cocultures and showed that this latter was derived from the MAFs. Conclusions. Increased secretion of IL-6 by mesothelioma-associated fibroblasts (MAFs) contributes to the resistance of the MPM to therapy.

The Sarcoma Assessment Measure (SAM) was developed as a sarcoma-specific patient-reported outcome measure to be used in clinical practice. We have reported in detail how SAM has been developed in collaboration with patients and healthcare professionals. The aim of this paper is to report the preliminary validation of SAM. The 22-item SAM was administered alongside a validated quality of life questionnaire and measure of activities of daily living. Linear modelling was used to build a measure, which had predictive validity in comparison to more established outcome measures. Of the 762 patients who participated in the study, 44.1% identified as male, and participant age ranged from 13-82 years. Clinically, participants presented with a range of soft tissue (82.2%) and bone (21.8%) sarcomas. Our preliminary analysis indicates that SAM accounts for 35% of the Global quality of life scale and 18% of the TESS so psychometrically it overlaps with quality of life and activities of daily living, but also measures distinct concerns. This demonstrates that this measure picks up issues that are important to patients with sarcoma that are not reflected in other measures. We have established the preliminary validity of SAM and believe it has utility as a patient-reported outcome measure both as a research tool and for assessing the impact of symptoms and dysfunction related to sarcoma as part of clinical care. Further validation using a larger and more clinically diverse sample is now needed.

Machine learning (ML) techniques can help predict survival among cancer patients and might help with a timely integration in palliative care. We aim to explore the importance of subjective variables self-reported and collected via electronic patient reported outcome measure (ePROM) for survival prediction. A total of 256 advanced cancer patients met the eligible criteria. We analyzed objective variables collected from electronic health records, subjective variables collected via ePROM and all clinical variables combined. We used logistic regression (LR), decision trees, and random forests to predict 1-year mortality. Receiver operating characteristic (ROC) curve - area under the curve (AUC) and the ML models feature importance were analyzed. The performance of all variables for predictions (LR reaches 0.80 [ROC AUC] and 0.72 [F1 Score]) does not improve over the performance of only clinical non-patient reported outcome (non-PRO) variables (LR reaches 0.81 [ROC AUC] and 0.72 [F1 Score]). Our study indicates that patient-reported outcome (PRO) variables, which measure subjective burden, cannot be reliably used to predict survival. Further research in this area is needed to clarify the role of self-reported patient's burden and mortality prediction via ML.

Background: Measuring vital signs has always been a central task for Critical Care Nurse´s (CCNs) and Registered Nurse Anesthetist`s (RNAs) providing care in the post-anesthesia care unit (PACU) and a prerequisite for their decision-making. Properly measuring and understanding pediatric vital signs is a challenge in younger pediatric patients up to 36 months old. Purpose: gain a greater understanding of CCNs' and RNAs' perceptions of decision-making regarding the level of vital sign monitoring children require in the PACU. Method: A qualitative study design involving the critical-incident technique was used. Interviews were carried out with a purposeful sample of CCNs and RNAs (n=17) from two different hospitals. Findings: According to the nurses' experience, grounds for decisions concerning children’s need of vital-sign monitoring were both adequate and inadequate. They used actions to adjust the monitoring of vital signs to optimise conditions for assessment and the prospects of a safe recovery for the child. Conclusions: Evidence-based care and safety are compromised when the technology has limitations and is not adapted for children. Its use means that experience and clinical assessment are relied on to a greater extent. This not only makes experience important for reliable assessment, but also means that greater risks are accepted.

As medical care aiming to maintain the quality of life for elderly patients is increases, implant treatment for elderly patients is increasing worldwide. Therefore, we aimed to investigate implant stability and the reliability of different measuring devices according to implant placement site and duration in patients aged over 65 years. The study evaluated 60 implants in 60 patients aged ≥ 65 years. The implant placement sites were divided into six evenly distributed sections (n=10) i.e., maxillary right- posterior, A; maxillary anterior, B; maxillary left-posterior, C; mandibular right-posterior, D; mandibular anterior, E; mandibular left-posterior, F. Participants visited the hospital seven times: preoperatively, 1V; implant surgery, 2V; stitch removal, 3V; 1-month follow-up, 4V; 2-months follow-up, 5V; before final-restoration delivery, 6V; and after final-restoration delivery, 7V. The implant stability was evaluated with the Osstell Mentor (ISQ), Periotest M (PTV), and Anycheck (IST). The mean values of ISQ, PTV, and IST were analyzed (α=.05). ISQ, PTV, and IST results of 5V and 6V were significantly higher than those of 2V (P<.05). The lowest ISQ results occurred in E location at 5V and 6V (P<.05). In all mandibular locations, IST results of 7V were significantly higher than those of 2V, 3V, 4V, and 5V (P<.05). ISQ results were negatively correlated with PTV and positively correlated with IST, and PTV was negatively correlated with IST. By considering various factors that affect implant stability, the appropriate implant load application time was determined. This could help increase the implant success rate in elderly patients. And as a diagnostic device for implant stability for evaluation of osseointegration in elderly patients, Anycheck was also able to prove its relative reliability compared to Osstell ISQ Mentor and Periotest M.

The past several decades have seen a shift in patient care towards digitalisation, which has ushered in a new era of health care delivery and improved sustainability and resilience of health systems, with positive impacts on both internal and external stakeholders. This study’s aim was to understand the role of digital virtual consultations in improving internal and external stakeholders’ health, as well as wellbeing among hospital doctors. A qualitative research approach was used with semi-structured online interviews administered to hospital doctors. The interviews showed that the doctors viewed digital virtual consultations as supplementary to in-person consultations, and as tools to reduce obstacles related to distance and time. If the necessary infrastructure and technology were in place, doctors would be willing to use these options. Implementing these technologies would improve the medical profession’s flexibility on the one hand; but it might affect doctors’ work–life balance if consultations extended beyond standard working hours.

Mandibular advancement devices (MAD) are an effective alternative treatment to CPAP. However, different maneuvers have been performed during the performance of drug sleep-induced endoscopy (DISE) to mimic the effect of MAD. Using the Selector Avance Mandibular (SAM) device, we aimed to identify MAD candidates during DISE using a titratable, reproducible, and measurable maneuver. This DISE-SAM protocol may help to find the relationship between the severity of the respiratory disorder and the degree of response, and to determine the advancement required to improve the collapsibility of the upper airway. Explorations were performed in 161 patients (132 males; 29 females) with a mean age of 46.81 (SD = 11.42) years, a BMI of 27.90 (SD = 4.19) kg/m2 and a mean AHI of 26.51 (SD = 21.23). Results showed no relationship between severity and MAD recommendation. Also, there was a weak positive relationship between the advancement required to obtain a response and the disease severity. Using the DISE-SAM protocol, the response and the range of mandibular protrusion were assessed, avoiding the inter-examiner bias of the jaw thrust maneuver. We suggest prescribing MAD as a single, alternative, or multiple treatment approaches following the SAM recommendations in a personalized design.

Persistent Pain after Spinal Surgery can be successfully addressed by Spinal Cord Stimulation (SCS). International guidelines strongly recommend that a lead trial be performed before any permanent implantation. Recent clinical data highlight some major limitations of this approach. First, it appears that patient outcomes, WITH OR WITHOUT lead trial, are similar. In contrast, during trialing, infection rate drops drastically within time and can compromise the therapy. Using composite pain assessment experience and previous research, we hypothesized that ma-chine learning models could be robust screening tools and reliable predictors of long-term SCS efficacy. We developed several algorithms including logistic regression, Regularized Logistic Regression (RLR), naive Bayes classifier, artificial neural networks, random forest and gradient boosted trees to test this hypothesis and to perform internal and external validations, the objec-tive being to confront model predictions with lead trial results using a 1-year composite out-come from 103 patients. While almost all models have demonstrated superiority on lead trial-ing, the RLR model appears to represent the best compromise between complexity and inter-pretability in prediction of SCS efficacy. These results underscore the need to use AI based-predictive medicine, as a synergistic mathematical approach, aimed at helping implanters to optimize their clinical choices on daily practice.

Background: ED overcrowding is described as one of the main issues in emergency departments (EDs) of any hospital. In Saudi Arabia, the ministry of health applied new telemedicine technology to serve patients by using the mobile application which include Sehha application and 937 medical call center. The main aim of this study is to determine the role of different telemedicine services in reducing non-urgent visits to EDs in Saudi Arabia. Methods: A cross-section study was conducted during August 2020 - May 2021 among 319 patients were using two telemedicine services in Saudi Arabia, including medical call center, and Sehha smart phone application. The primary endpoint of this study aims to determine the role of different telemedicine services in reducing non-urgent visits to EDs in Saudi Arabia. Results: This study analyzed the data from 319 patients who completed the survey provided by the Saudi Ministry of Health that concerning on information related to their health status, and ED visits. Among patients that had the intention to visit the ED (N=159), 53 of them did not go to EDs after using telemedicine services (p-value < 0.01). Regarding medical call center and Sehha application, 9.6% and 24.4%, respectively of the patients used these telemedicine services had changed their mind concerning visiting ED after taking the medical advice (p-values < 0.01).Conclusion: The implemented telemedicine services in Saudi Arabia, namely Sehha application and medical call center showed to be effective in reducing ED overload by providing medical advices to less- and non-urgent patients and deal with their minor medical issues.

Dupilumab is used to treat atopic dermatitis patients who have proven to be refractory to previous treatments. The aim of this study was to assess evolution and patient reported outcome measures in adult patients with moderate-to-severe atopic dermatitis treated with Dupilumab in routine clinical practice. The outcomes were evaluated and registered at baseline and weeks-16, 40 and 52. The variables evaluated were: diseases severity, pruritus, stressful life events, difficulty to sleep, anxiety and depression, quality of life, satisfaction, adherence to the treatment, efficacy and safety. Eleven patients were recruited between Nov 14th 2017 and Jan 16th 2018. Demographic variables: 90% Caucasian, 82% women. Clinical variables: Mean duration of AD =17.7 (±12.8), 91% had severe disease severity. At baseline, SCORAD mean score = 61.7 (±15.5); itch was reported by 100% of patients; itch Visual Analogue Scale mean range of 8 (6-10); HADS mean total score =13.9 (±5.5); DLQI mean score =13.3 (±8.3): EQ-5D-3L mean range = 57 (30-99). At week-52 there is a significant reduction of SCORAD scores, HADS total score and improved quality of life. ¡This study confirms that Dupilumab, used for 52-weeks under routine clinical practice, maintains the improved atopic dermatitis signs and symptoms obtained at week-16, with a good safety profile.

Background: New regional techniques can improve pain management after nephrectomy. Methods: This study was a randomized controlled trial conducted at two teaching hospitals. Patients undergoing elective open and laparoscopic nephrectomy were eligible to participate in the trial. A total of 100 patients were divided into a quadratus lumborum block (QLB) group and a control (CON) group. At the end of surgery, but while still under general anesthesia, unilateral QLB with ropivacaine was performed on the side of nephrectomy for patients in the QLB group. The main measured outcome of this study was oxycodone consumption via a patient-controlled anesthesia (PCA) pump during the first 24 hours following surgery; other measured outcomes included postoperative pain intensity assessment, patient satisfaction with pain management, and persistent pain evaluation. Results: Patients undergoing QLB needed less oxycodone than those in the CON group (34.5 mg [interquartile range 23–40 mg] vs. 47.5 mg [35–50 mg]; p<0.001). No difference between the groups was seen in postoperative pain intensity measured on the visual analog scale, except for the evaluation at hour 2, which was in favor of the QLB group (p=0.03). Patients who received QLB were more satisfied with postoperative pain management than the CON group. Persistent postoperative pain was assessed with the Neuropathic Pain Symptom Inventory (NPSI) at months 1, 3, and 6 and was found to be significantly lower in the QLB group at each evaluation (p<0.001). We also analyzed the impact of the surgery type on persistent pain severity, which was significantly lower after laparoscopic procedures than open procedures at months 1, 3, and 6. Conclusions: QLB reduces oxycodone consumption in patients undergoing open and laparoscopic nephrectomy and decreases persistent pain severity months after hospital discharge.

The time required to reach a correct diagnosis is one of the most important problems for rare disease (RD) patients. Diagnostic delay can be intolerably long, to the point that it is usually described as a “diagnostic odyssey” and, sometimes, a diagnosis might never occur. The International Rare Disease Research Consortium proposed, as ultimate goal for 2017-2027, to enable all people with a suspected RD to be diagnosed within one year if the disorder is known, and to enter a globally coordinated diagnostic and research pipeline for the unsolved cases. In-depth analysis of the genotype through next generation sequencing, together with a standardized in-depth phenotype description and sophisticated high-throughput approaches, have been applied as diagnostic tools to increase the chance of a timely and accurate diagnosis. This approach is very fruitful as, according to the Orphanet database, from 2010 to March 2017 more than 600 new RDs have been described and about 3600 genes linked to RDs have been identified. However, combination of -omics and phenotype data and international sharing of this information raise ethical concerns. Values to be assessed include not only patient autonomy but also family implications, beneficence, non-maleficence, justice, solidarity and reciprocity, which must be respected and promoted and, at the same time, balanced among each other. In this work we suggest that, to maximise patients involvement in the search for a diagnosis and identification of new causative genes, undiagnosed patients should have the possibility to: 1) actively participate in the description of their phenotype; 2) choose the level of visibility of their profile in matchmaking databases; 3) express their preferences regarding return of new findings, in particular which level of Variant of Unknown Significance (VUS) significance should be considered relevant to them. The quality of the relation between individual patients and physicians, and between the patient community and the scientific community is critically important for making the best use of available data and combining efforts in the search for matches with similar cases worldwide that will help to solve unsolved cases. The contribution of patients to collecting and coding data comprehensively is critical for efficient use of data downstream of data collection.

Backgorund and Objectives: In this study, we aimed to evaluate and compare the changes in visual and structural outcomes in patients with intravitreal aflibercept (IVA)-resistant neovascular age-related macular degeneration (nAMD) switched to either intravitreal brolucizumab (IVBr) or intravitreal faricimab (IVF) injections in a clinical setting. Materials and Methods: This obser-vational clinical study included 20 eyes of 20 patients switched to brolucizumab and 15 eyes of 14 patients switched to faricimab for aflibercept-resistant nAMD. We measured the structural outcome (central macular thickness (CMT)) and the visual outcome (best-corrected visual acuity (BCVA); logMAR) as follows: just before the most recent IVA injection (B0), one month after the most recent IVA injection (B1), just before the first IVBr or IVF injection (A0), one month after (A1) and three months after (A3) the first IVBr or IVF injection. Results: BCVA showed significant im-provement at A1 (0.25 ± 0.34) and at A3 (0.19 ± 0.24) compared to A0 (0.38 ± 0.35) in IVBr group (p = 0.0156, p = 0.0166, respectively). CMT (μm) was significantly thinner at A1 (IVBr; 240.55 ± 51.82, IVF; 234.91 ± 47.29) and at A3 (IVBr; 243.21 ± 76.15, IVF; 250.50 ± 72.61) compared to at A0 (IVBr; 303.55 ± 79.18, IVF; 270.33 ± 77.62) in IVBr group (A1; p = 0.0093, A3; p = 0.0026) and in IVF group (A1; p = 0.0161, A3; p = 0.0093). There was no significant difference in BCVA and CMT improvement observed between two groups at any time point (p > 0.05 for all). Conclusion: Switching from aflibercept to either brolucizumab or faricimab has a significant anatomical ef-fect on eyes with aflibercept-resistant nAMD and both treatments appear to be effective short-term treatment options. There is a trend towards greater visual improvements and reductions in CMT with brolucizumab.

Depression is diagnosed when a specific set of symptoms appear over a defined period with a certain intensity. According to the DSM-5, Major Depressive Disorder (MDD) is diagnosed when five or more symptoms are present over a two-week period. Depression, a debilitating mental health disorder affecting millions worldwide, poses a complex challenge for researchers and clinicians. In children and adolescents, depression can result in negative outcomes such as substance abuse, academic problems, risky sexual behavior, physical health issues, impaired social relationships, and a thirty-fold increased risk of suicide. This paper presents the findings of a study that evaluated the effectiveness of Cognitive Behavioral Therapy (CBT) alone and CBT combined with selective ser-otonin reuptake inhibitors (SSRIs) in a remediation program. The study included 16 children and adolescents with depression (8 males and 8 females) and 16 typically developing peers (8 males and 8 females) aged 9 to 15 years (M = 11.94, SD = 2.02). Baseline evaluations using Event-Related Po-tentials (ERPs), the Children Depression Inventory (CDI), and reaction time tests showed that participants with depression had cognitive deficits in attention and memory, indicated by longer P300 latencies. After undergoing remediation with either CBT alone or CBT combined with med-ication, the children and adolescents with depression exhibited lower CDI scores and shorter P300 latencies and reaction times compared to before remediation and relative to the control group.

This study explores the multifaceted influence of litter size, maternal care, exercise, and aging on rats' neurobehavioral plasticity and dentate gyrus microglia dynamics. Body weight evolution revealed a progressive increase until maturity, followed by a decline during aging, with larger litters exhibiting lower weights initially. Notably, exercised rats from smaller litters displayed higher body weights during mature and aged stages. Dentate gyrus volumes showed no significant differences among groups, except for aged sedentary rats from smaller litters, which exhibited a reduction. Maternal care varied significantly based on litter size, with large litter dams showing lower frequencies of caregiving behaviors. Behavioral assays highlighted the detrimental impact of a sedentary lifestyle and reduced maternal care/large litters on spatial memory, mitigated by exercise in aged rats from smaller litters. Microglial dynamics in the layers of dentate gyrus revealed age-related changes modulated by litter size and exercise. Exercise interventions mitigated microgliosis associated with aging, particularly in aged rats. These findings underscore the complex interplay between early-life experiences, exercise, microglial dynamics, and neurobehavioral outcomes during aging.

Until recently, no disease-specific health-related quality of life (HRQoL) instrument existed for pediatric traumatic brain injury (TBI). In this revalidation study, the psychometric properties and the validity of the final German version of the 35-item QOLIBRI-KID/ADO questionnaire were examined in 300 children and adolescents. It is the first self-reported TBI-specific instrument for measuring pediatric HRQoL in individuals aged 8–17 years. The six-factor model fits the data adequately. Internal consistencies were excellent for the total score and satisfactory to excellent for the scale scores. Intraclass correlations indicated good test-retest reliability. Construct validity was supported by overlaps between the QOLBRI-KID/ADO and the PedsQL, which measures generic HRQoL. Discriminant validity indicated that HRQoL was significantly lower in older children and girls, and in those with anxiety, depression, and post-concussion symptoms than in comparison groups, replicating the results of the questionnaire’s first development study. Our results suggest that the QOLIBRI-KID/ADO is a valid and reliable multidimensional instrument for assessing disease-specific HRQoL after pediatric TBI in clinical and research settings, which can additionally be used across the lifespan in combination with the adult version. This may help to improve care, treatment, daily functioning and HRQoL after TBI.

Chemo-resistance is a substantial challenge in the realm of cancer treatment that requires exploring new therapeutic approaches for effective mitigation. Achieving this goal requires examination of the molecular mechanisms involved in both tumor growth and therapeutic interventions. The potential of NRF2 (Nuclear factor E2-related factor 2) in addressing resistance to chemotherapy across diverse cancer types highlights its value as a promising therapeutic approach based on cancer characteristics. Manipulating the NRF2 signaling pathway has a dual impact, offering promise for both preventing and treating cancer, as well as inhibiting carcinogenesis. The influence of the NRF2/KEAP1 pathway on the progression of tumor formation and resistance to drugs has been well-documented. The interplay between the NRF2 signaling pathway and processes such as endoplasmic reticulum (ER) stress, unfolded protein response (UPR), and autophagy plays a crucial protective role. A deeper understanding of NRF2's role in the modulating these pathways is necessary to develop novel approaches for improving chemotherapeutic efficacy. This article discusses the significance of the NRF2-KEAP1 pathway in preventing/promoting cancer and resistance mechanisms to various chemotherapeutic agents, with a focus on the complementary effects of antioxidants via NRF2-mediated signaling pathways. This study aims to provide a molecular basis for targeting NRF2 via inhibitors/activators as promising therapeutic strategies to overcome chemo-resistance.

We compared the functional and morphologic effects in the loading dose between patients with treatment-naïve neovascular age-related macular degeneration treated with either intravitreal aflibercept (IVA) or intravitreal faricimab (IVF) injection in clinical settings. This retrospective study included 30 eyes from 28 patients who started IVA treatment between June and September 2022 and 30 eyes from 29 patients who started IVF treatment between October 2022 and March 2023. The mean best corrected visual acuity (BCVA) significantly improved from pre-treatment after loading dose in the IVA group (from 0.46 ± 0.46 to 0.36 ± 0.37, p=0.0047) and not in the IVF group (from 0.46 ± 0.41 to 0.44 ± 0.45, p=0.60). The mean central retinal thickness (CRT) significantly improved in both groups. The proportion of eyes with residual exudative change was greater in the IVF group than in the IVA group at 2 months after the first treatment. (p=0.026) We further analyzed the patients who obtained complete resolution of exudative changes after the loading dose. The IVA group had a significant improvement in BCVA, whereas the IVF group did not p=0.0047 and 0.20, respectively) Although IVA and IVF significantly improved the CRT, the BCVA improved significantly in IVA group and not in IVF group.

Frontotemporal lobar degeneration (FTLD) belongs to a heterogeneous group of highly complex neurodegenerative diseases and represents the second cause of presenile dementia in individuals under 65. Frontotemporal-TDP is a subgroup of frontotemporal dementia characterized by the aggregation of abnormal protein deposits, predominantly transactive response DNA-binding protein 43 (TDP-43), in the frontal and temporal brain regions. These deposits lead to progressive degeneration of neurons resulting in cognitive and behavioral impairments. Limbic age-related encephalopathy (LATE) pertains to age-related cognitive decline primarily affecting the limbic system which is crucial for memory, emotions, and learning. Though distinct, emerging research suggests a potential overlap in pathogenic processes, with some cases of limbic encephalopathy displaying TDP-43 pathology. Genetic factors play a pivotal role in both disorders. Mutations in various genes, such as progranulin (GRN) and chromosome 9 open reading frame 72 (C9orf72), have been identified as causative in frontotemporal-TDP. Similarly, specific genetic variants have been associated with an increased risk of developing LATE. Understanding these genetic links provides crucial insights into disease mechanisms and the potential for targeted therapies.

Polycystic ovary syndrome (PCOS) usually comes along with metabolic disturbances attributed to androgen excess and obesity, but the contribution of each has not been defined, and the occurrence of metabolic disturbances is frequently not investigated. We evaluated 99 PCOS and 41 non-PCOS women. Clinical biomarkers of glucose-, liver-, and endothelial-related metabolic alterations were measured; participants were categorized into four groups according with obesity (OB) and hyperandrogenemia (HA) statuses: Healthy (no-HA, lean), HA (HA, lean), OB (no-HA, OB), and HAOB (HA, OB). Metabolic disturbances were highly frequent in PCOS women (70%). BMI correlated with all biomarkers, while free testosterone (FT) only with glucose- and hepatic-related indicators. Despite insulin sensitivity and liver enzymes were associated with FT, women with obesity exhibited lower M [coeff = 8.56 – 0.080(FT) –3.71(Ob); p &lt;0.001)] and higher aspartate aminotransferase (coeff = 26.27 + 0.532(FT) + 8.08(Ob); p = 0.015)] than lean at the same level of FT. Women with obesity exhibited greater risk of metabolic disorders than lean, independently of hyperandrogenemia. Clinicians are compelled to search for metabolic alterations in PCOS women; obesity must be handled in all cases, but hyperandrogenemia needs to be managed also in those with glucose- or liver-related disturbances.

(1) Background: This article reviews the available scientific literature on drug-related problems and negative outcomes associated with medications identified by medication review with follow-up for end-stage renal disease and discussed with the physicians; (2) Methods: A systematic review was conducted of the scientific literature retrieved from the following databases: MEDLINE (via PubMed), Web of Science, SCOPUS, Cochrane Library: The Cochrane Central Register and Control Trials (CENTRAL) and Literatura Latinoamericana y del Caribe (LILACS), Medicina en Español (MEDES), and the SciELO bibliographic database (collection of scientific journals). The following terms were used as descriptors and searched in free text: "end-stage renal disease", "medication review", and "drug-related problems” and “negative outcomes associated with medication". The following limits were applied: "humans" and "adults (more than 18 years)”; (3) Results: A total of 59 references were recovered and after applying inclusion/exclusion criteria, 16 articles were selected. Of these selected articles, 15 provided information on drug-related problems and only 1 on negative outcomes associated with medications; (4) Conclusions: It can be concluded that drug-related problems and negative outcomes associated with medication affect patients with end-stage renal disease, mainly those receiving renal replacement therapy. More evidence is needed, especially on negative outcomes associated with medication.

Background: According to metacognitive theory, Cognitive–Attentional Syndrome (CAS) is a transdiagnostic factor and main mechanism of psychopathology maintenance. The main goal of this study was to examine whether CAS predicted symptoms of stress and trauma-related symptomatology in the first months of the COVID-19 pandemic and three months later. Methods: Initially 1,792 participants were recruited online via social media; data was collected at two time points. Measures included the Cognitive–Attentional Syndrome Questionnaire, Adjustment Disorder – New Module 20, the International Trauma Questionnaire, and additional measures. Results: Structural equation modeling was conducted in order to determine relations between reported stressors, CAS, and symptomatology. At both time points, CAS was a significant mediator between stressors and symptoms of adjustment disorder. Despite the decrease in the intensity of adjustment disorder symptoms between waves, it was a significant predictor of other psychopathology at both time points, except for traumatic stress. Conclusions: The findings confirm the assumption that CAS is a transdiagnostic factor of psychopathology, and has a mediating role in the relationship between stressors and adjustment disorder and co-occurring symptomatology. The effect was particularly significant in the initial phase of the pandemic, which was highly stressful for many people.

Neovascular age-related macular degeneration (nAMD) leads to visual impairment if not treated timely. Intravitreal anti-VEGF drugs have revolutionized nAMD treatment in two decades. We evaluated visual outcomes of anti-VEGF treatment in nAMD. A real-life population-based cohort study. Data included parameters for age, sex, age at the diagnosis, laterality, chronicity, symptoms, visual outcomes, lens status, and history of intravitreal injections. A total of 1088 eyes (827 patients) with nAMD were included. Visual acuity was stable or improved in 984 eyes (90%) after an average 36±25 months follow-up. Bevacitzumab was the first-line drug in 1083 (99.5%) eyes. Vision improved ≥15 ETDRS letters in 377 (35%), > 5 ETDRS letters in 309 (28%) and was stable (±5 ETDRS letters) in 298 (27%) eyes after anti-VEGF treatment. The loss of 5-<15 ETDRS letters in 44 (4%) and ≥15 ETDRS letters in 60 (6%) eyes was noted. At the diagnosis of nAMD, 110 out of 827 patients (13%) fulfilled the criteria of visual impairment, whereas 179 patients (22%) were visually impaired after the follow-up. Improvement or stabilization in vision was noted in 90% of the anti-VEGF-treated eyes with nAMD. In addition, anti-VEGF agents are crucial in diminishing nAMD-related visual impairment.

Forestry workers play a crucial role in implementing forest management programs, but their outdoor work exposes them to rising temperatures caused by global climate change, which poses potential health risks related to heat. This study focuses on Indonesian forestry workers and examines the relationship between their knowledge of heat-related issues, risk perception, and precautionary behavior in dealing with increasing workplace heat exposure. Developing effective precautionary behavior is essential for preventing heat-related health disorders and promoting health protection programs. To facilitate a comprehensive comparison of the three variables, interviews were conducted with two groups of outdoor workers, comprising 210 forestry workers and 215 paddy farmers. The findings indicate that increasing knowledge about heat-related issues promotes precautionary behavior, and risk perception acts as a mediator between knowledge and behavior. Additionally, the study highlights that the emotion of "dread" intensifies perceived risk and predicts positive behavior change. To enhance heat-related knowledge, exploring the potential use of a "fear" tone is important. In conclusion, comprehensive strategies need to be implemented to promote precautionary behavior among vulnerable forestry workers, particularly manual laborers.

Cause-Related Marketing (CRM) has emerged as a new concept that links CSR activities to marketing, enabling corporations to pursue both building company-consumer partnership and gaining sustainable mutual benefits that are elicited from the partnership. Among various cause-related marketing activities, on-line cause-related advertising is the most commonly used one. The purpose of this study is to examine the effects of on-line cause-related advertising and moderating role of ethical consumption propensity. In particular, this study intends to contribute to successful development of on-line cause-related advertising strategy by focusing on the relationship between the four factors: customers' perception of on-line cause-related advertising, brand-consumer relationship, brand attachment and loyalty. The results of this study are as follows: First, customers' perception of on-line cause-related advertising was related positively to consumer-brand- relationship. Second, brand-consumer relationship was related positively to brand attachment and customer loyalty. Third, brand attachment was related positively to customer loyalty. Furthermore, from the consumer’s psychological viewpoint, ethical consumption propensity had a significant moderating effect to between customers' perception of cause-related advertising and brand-consumer relationship as well as brand attachment. The results of this study may contribute to the existing literature as an new empirical attempt to examine the effect of the on-line cause-related advertising.

TomoBreast hypothesized that hypofractionated 15 fractions/3 weeks image-guided radiation therapy (H-IGRT) can reduce lung-heart toxicity, as compared with normofractionated 25-33 fractions/5-7 weeks conventional radiation therapy (CRT). 123 women with stage I-II operated breast cancer were randomized to receive CRT (N=64) or H-IGRT (N=59). The primary endpoint used a four-items measure of the time to 10% alteration in any of patient self-reported measure, physician clinical evaluation, echocardiography or lung function tests, analyzed by intention-to-treat without exclusion. Results found comparable survivals, but H-IGRT significantly reduced the toxicity measured by lung diffusion capacity and alveolar volume as compared with CRT, G1 in 53% (31/59) versus 72% (44/61) patients, P=0.006; G2, 29% versus 48%, P=0.020. H-IGRT significantly reduced the risk of composite cardio-pulmonary alteration at 5 years, 10.2% versus 26.7%, P=0.024. In conclusion, TomoBreast is a proof-of-concept that image-guided radiation-therapy can improve the overall balance of lung-heart outcomes in breast cancer adjuvant therapy. Furthermore, the significance of the findings supports the efficacy of a small trial size design, which can be critical when clinical research resources are limited.

Novel strategies have been developed to reduce or to avoid the intravitreal injections (IVTs) of the antiangiogenic (ranibizumab; RBZ) and the anti-inflammatory (triamcinolone acetonide; TA) agents used to treat vitreoretinal diseases. One of the strategies include liposomes. In this study, it was evaluated the safety and efficacy of topical triamcinolone-loaded liposomes formulation (TALF) as an adjuvant to intravitreal RBZ therapy in treatment-naive patients with neovascular age related macular degeneration (nAMD). Subjects were randomly assigned to the RBZ-TALF or the RBZ-pro re nata (RBZ-PRN) group. Patients from the RBZ-TALF group were instructed to apply TALF for a 12-month period after a single dose of RBZ. Patients from the RBZ-PRN group received three monthly RBZ-IVTs. Retreatment with RBZ was considered in case of nAMD reactivation. Related to safety, non-ocular abnormalities were observed during TALF therapy. Owing to the efficacy, non-significant differences are identified in visual acuity or central foveal thickness when the RBZ-PRN and RBZ-TALF groups are compared. Importantly the average number of RBZ injections was significantly lower in the RBZ-TALF group (2.5 ± 1.4 vs 6.1 ± 1.3 IVTs; p=0004). Therefore, TALF used as an adjuvant to RBZ reduce the number of RBZ-IVTs retreatment with optimal visual and anatomic results.

As Automated Driving Systems (ADS) technology gets assimilated into the market, the driver’s obligation will be changed to a supervisory role. A key point to consider is the driver’s engagement in the secondary task to maintain the driver/user in the control loop. The paper’s objective is to monitor driver engagement with a game and identify any impacts the task has on hazard recognition. We designed a driving simulation using Unity3D and incorporated three tasks: No-task, AR-Video, and AR-Game tasks. The driver engaged in an AR object interception game while monitoring the road for threatening road scenarios. From the results, there was less than 1 second difference between the means of gaming task (mean = 2.55s, std = 0.1002s) to no-task (mean = 2.55s, std = 0.1002s). Game scoring followed three profiles/phases: learning, saturation, and decline profile. From the profiles, it is possible to quantify/infer drivers’ engagement with the game task. The paper proposes alternative monitoring that has utility, i.e., entertaining the user. Further experiments AR-Game focusing on real-world car environment will be performed to confirm the performance following the recommendations derived from the current test.

Aging is accompanied by frontal lobe and non-dominant hemisphere recruitment that supports executive functioning, such as inhibitory control, which is crucial to all cognitive functions. Yet, the spatio-temporal sequence of processing underlying successful inhibition and how it changes with age is understudied. Thus, we assessed N200 (conflict monitoring) and P300 (response inhibition, performance evaluation) event-related potentials (ERPs) in young and healthy older adults during comparably performed successful stop-signal inhibition. We additionally interrogated the continuous spatio-temporal dynamics of N200- and P300-related activation within each group. Young adults had left hemisphere dominant N200, while older adults had overall larger amplitudes and right hemisphere dominance. N200 activation was biphasic in both groups but differed in scalp topography. P300 also differed, with larger right amplitudes in young, but bilateral amplitudes in old, with old larger than young in the left hemisphere. P300 was characterized by an early parieto-occipital peak in both groups, followed by a parietal slow wave only in older adults. A temporally similar but topographically different final wave followed in both groups that showed anterior recruitment in older adults. These findings illuminate differential age-related spatio-temporal recruitment patterns for conflict monitoring and response inhibition that are critically important for understanding age-related compensatory activation.

This study aims to develop a performance evaluation system that can facilitate performance evaluation at region, hospital, and department levels to enable better cost management for sustainable development. A multi-level system of performance evaluation informs a hierarchical assessment of cost management from regions to hospitals to departments using diagnosis-related group (DRGs). Various metrics are developed employing the variances between targets and actuals where targets are determined from two perspectives: benchmarking using external regional prices and change management using internal data. Targets for the latter are statistically based and specifically incorporate variability. The model is applied to two hospitals, twenty departments, nine DRGs and 1071 inpatients. The analyses indicate that the approach can provide a practical evaluation tool that allows for particular characteristics at multiple levels. The system provides macro-micro and external-internal perspectives in performance, enabling high-level variances to be decomposed thereby identifying sources of performance variability and financial impact.

This study explored intraindividual multidimensional profiles integrating psychosocial factors, namely, body image and satisfaction, weight-related self-stigma, positivity, and happiness, and behavioural-lifestyle factors, namely, adherence to a healthy diet, among Spanish adults with overweight or obesity. We further aimed to investigate the association of excess weight (i.e., measured body mass index, BMI) with the abovementioned multidimensional configurations. A convenience sample of adult individuals with excessive weight completed self-reports regarding the study variables, and their weight and height were measured. With a perspective centered on the individual, a cluster analysis established three distinct intraindividual psychosocial and diet-related profiles: a group of healthy individuals with excess weight; a group of individuals who were negatively affected by their excessive weight and showed the most distressed profile; and a group of dysfunctional individuals who seemed to be excessively unrealistic and optimistic regarding their excessive weight and unhealthy lifestyles. Furthermore, individuals in the affected cluster had higher obesity. The results showed that there are specific psychosocial and lifestyle profiles in the adult population with excess weight and that there are relationships among psychological, behavioural, and body-composition factors. For clinical application purposes, it is important to account for the heterogeneity within individuals who are obese and to individualize the interventions, with a focus from weight change to individual's overall well-being.