Introduction: Osteoarthritis (OA) and age-related degeneration (ARD) are stimulants for the development of the fabella in the knee joint. This meta-analysis updates previous studies and reviews on the prevalence of the fabella in OA or ARD knee joints. In addition, it provides a quantitative estimation of the fabellar prevalence in knees having OA and ARD. Methodology: Twenty studies comprising of data from 11,056 knee joints were included in the analysis, consisting of 6,819 Knees of OA subjects (including those with age more than 40 years) and 4,237 knees of non-OA subjects (including less than 40years) knees, respectively. 2,434 knees had fabellae present in OA subjects (including more than 40years), and 844 fabellae were present in non-OA subjects (including less than 40years). The Odds and Risk Ratios were calculated. Sensitivity analysis and cumulative analysis were conducted to assess the robustness of the findings. Results: Prevalence of fabella was found to be higher in OA knees, where the Risk Ratio of developing fabella was 2.50 (2.07-3.01). Compared with this, the Risk Ratio for the incidence of fabella in OA with ARD knee was 1.84 (1.66-2.03). The bilateral occurrence of fabella was more common than unilateral. The risk of developing fabella in individuals aged less than forty-year was 63% less than individuals aged more than forty years. Conclusion: OA and ARD would increase the prevalence of fabella by 84%, thus acting as stimulants and risk factors for ossified fabella.

Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

The present study was conducted to evaluate the effects of dietary supplementation of tea polyphenol （TP） on serum hormone, serum enzyme activity, antioxidant-related and immune-related gene expression of laying hens under heat stress. A total of 288 Chinese yellow chicken (186 days old) were randomly distributed among two treatments, each of which included 6 replicates of 24 hens. Dietary treatments were that the basal diet was supplemented with 200 mg / kg tea polyphenol. The study lasted for 7 weeks, including 1 week of adaptation and 6 weeks of the formal test. The content of high-density lipoprotein cholesterol (HDL-C) and total protein (TP) in serum significantly decreased by dietary supplementation with tea polyphenol. Dietary tea polyphenol supplementation improved serum superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) enzyme activity and decreased serum malondialdehyde (MDA) content in treatments compared to the control. However, supplementation of tea polyphenol did not affect the activity of serum catalase (CAT). The results indicated that long-term feeding of tea polyphenols help to increase the amount of hormones (FSH, E2) associated with reproduction in laying hens and thus improve egg production. It also improved the immune function of laying hens in high temperature environments. Adding tea polyphenols to the diet can significantly increase the serum IgG, IgM content of the laying hens and can upregulate the IgA content. Dietary supplementation of tea polyphenols in the laying hens significantly increased the expression of antioxidant enzyme-related genes (SOD, CAT and GPX1) in the liver. Moreover, the addition of tea polyphenols significantly increased the expression of immune-related genes (Interferon-γ (INF-γ), Interleukin 2 (IL-2) and Interleukin 4 (IL-4)) in the spleen. It is concluded that addition of tea polyphenols has a positive effect on antioxidant activity and immune function of laying hens.

EZH2 overexpression is associated with tumor proliferation, metastasis, and poor prognosis. Targeting and inhibiting EZH2 may be an effective therapeutic strategy for head and neck squamous cell carcinoma (HNSCC). We previously analyzed EZH2 mRNA expression in a well-characterized dataset of 230 (110 original and 120 validation cohorts) human head and neck cancer samples. This study aimed to investigate the effects of inhibiting EZH2, either via RNA interference or via pharmacotherapy, on HNSCC growth. EZH2 upregulation was significantly correlated with recurrence (P < 0.001) and the methylation index of tumor suppressor genes (P < 0.05). DNMT3A was significantly upregulated upon EZH2 upregulation (P = 0.043). Univariate analysis revealed that EZH2 upregulation was associated with poor disease-free survival (log-rank test, P < 0.001). In multivariate analysis, EZH2 upregulation was evaluated as a significant independent prognostic factor of disease-free survival (hazard ratio: 2.085, 95% confidence interval: 1.390–3.127; P < 0.001). Cells treated with RNA interference and DZNep, an EZH2 inhibitor, showed the most dramatic changes in expression, accompanied with a reduction in the growth and survival of FaDu cells. These findings suggest that EZH2 upregulation is correlated with tumor aggressiveness and adverse patient outcomes in HNSCC. Evaluation of EZH2 expression might help predict the prognosis of HNSCC patients.

Recent evidence suggests the existence of shared neural resources for rhythm processing in language and music. Such overlaps could be the basis of the facilitating effect of regular musical rhythm on spoken word processing previously reported for typical children and adults, as well as adults with Parkinson’s disease and children with developmental language disorders. The present study builds upon these previous findings by examining whether musical rhythmic priming also influences visual word processing, and the extent to which such cross-modal priming effect of rhythm is related to individual differences in musical aptitude and reading skills. EEG was recorded while participants listened to a rhythmic tone prime, followed by a visual target word with a stress pattern that either matched or mismatched the rhythmic structure of the auditory prime. Participants were also administered standardized assessments of musical aptitude and reading achievement. ERPs elicited by target words with a mismatching stress pattern showed an increased fronto-central negativity. Additionally, the size of the negative effect correlated with individual differences in musical rhythm aptitude and reading comprehension skills. Results support the existence of shared neurocognitive resources for linguistic and musical rhythm processing, and have important implications for the use of rhythm-based activities for reading interventions.

Choroidal neovascularization (CNV) is a key pathological feature of several of the leading causes of vision loss including neovascular age-related macular degeneration. Here we show that a calreticulin anti-angiogenic domain (CAD)-like peptide 27, CAD27, inhibited in vitro angiogenic activities, including tube formation and migration of endothelial cells, and suppressed vascular sprouting from rat aortic ring explants. In rat model of laser-induced CNV, we demonstrate that intravitreal injection of CAD27 significantly attenuated the formation of CNV lesions as measured via fundus fluorescein angiography and choroid flat-mounts (19.5% and 22.4% reductions at 10μg and 20μg of CAD27 injected, respectively). Similarly, the reduction of CNV lesions was observed in the groups of rats that had received topical applications of CAD27 (choroid flat-mounts: 17.9% and 32.5% reductions at 10μg/mL and 20μg/mL of CAD27 installed, respectively). Retinal function was unaffected, as measured using electroretinography in both groups received interareal injection or topical applications of CAD27 at least for 9 days. These findings show that CAD27 can be used as a potential therapeutic alternative for targeting CNV in the diseases such as neovascular age-related macular degeneration.

Age-related diseases (ARDs) are the leading cause of death worldwide, and contribute to 90% of mortality in developed countries. Interestingly, the mortality rates of individual ARDs increase exponentially with age. Processes described by the exponential growth function typically involve a branching chain reaction or, more generally, a positive feedback loop. Here I propose that each ARD is mediated by one or several positive feedback loops (vicious cycles). I then identify critical vicious cycles in five major ARDs: atherosclerosis, hypertension, diabetes, Alzheimer’s and Parkinson’s. I also propose that the progression of ARDs can be halted by selectively interrupting the vicious cycles and suggest the most promising targets. An evolutionary perspective is also offered.

Background: The work and life of a junior doctor has changed dramatically over the past 50 years. Descriptions of historic working conditions are usually anecdotal and tinted with nostalgia. But presented with the facts, do heath care professionals feel working conditions things have improved or declined in the last 50 years? Methods: An interview was conducted with a retired surgeon who, in 1970, worked as a house surgeon (Foundation Year 2, FY2 equivalent) at a regional burns service. This was compared with a review of available literature to assess objectively working conditions in that period. The information generated from this produced a poster summarizing the key differences over a 53-year timeframe. This information was presented to the current medical work force and a survey was conducted to determine their preference. Statistical analysis including binary logistic regression was performed. Results: The questionnaire was completed by 76 respondent healthcare workers of mixed grades and backgrounds. The majority of respondents (64%) would choose to work in today’s burns unit. The age of the respondent was the best predictor for preference of working conditions (p = 0.043). Conclusions: Multiple changes in the working conditions were identified. The majority of respondents consider today’s working conditions to be better than that of the past. However, more senior clinicians were more likely to prefer the conditions of 1970 to present day, suggesting a generational shift in opinion.

Job characteristics shape organizational sustainability, conferring tangible benefits to employees. Job characteristics shape attitudes toward work, such as satisfaction and engagement, and are related to the well-being and health of employees. The aim of the study was to determine and describe the role of work engagement and support at work in the relation between selected job characteristics (organizational justice, job control, and role clarity) and self-rated health. The study was conducted on a sample of 368 employees representing various industries. The study used: Utrecht Work Engagement Scale (UWES), Organizational Justice Survey, Coworker Support Scale, Supervisor Support Scale, Role Clarity Scale, Job Control Scale. Cantril ladder was used to measure self-rated health. The presented study established the importance of lower scores on the UWES subscale: dedication as a significant moderator of the examined correlations. In relation to the correlation: justice and its dimensions, and self-rated health, support from supervisors showed a greater effect than that from coworkers. The conducted study expands knowledge on the formation of employees' self-rated health through the sense of justice experienced within the organization. The results obtained are applicable to organizational practice. This finding highlights the importance of supporting organizational justice, which contributes to employee well-being (particularly when combined with high levels of work engagement and supervisor support) and ultimately increases organizational sustainability. Further research can be continued taking into account the limitations of the previous procedure of selecting people for the study and the measurement tools used.

Many quantum dot light-emitting diodes (QLEDs) utilize ZnO nanoparticles (NPs) as an electron injection layer (EIL). However, the use of ZnO NP ETL material often results in charge imbalance within the quantum dot (QD) emitting layer (EML) and exciton quenching at the interface of QD EML and ZnO NP EIL. To overcome these challenges, we introduced an Arginine (Arg) interlayer (IL) onto the ZnO NP EIL. The Arg IL elevated the work function of ZnO NPs, thereby suppressing electron injection into the QD, leading to improved charge balance within the QDs, Additionally, the inherent insulating nature of the Arg IL prevented direct contact between QDs and ZnO NPs, reducing exciton quenching and consequently improving device efficiency. The inverted QLED (IQLED) utilizing a 20-nm-thick Arg IL on ZnO NP EIL exhibited a 2.22-fold increase in current efficiency and a 2.28-fold increase in EQE and compared to an IQLED without an IL. Likewise, the IQLED with a 20-nm-thick Arg IL on ZnO NP EIL demonstrated a 1.34-fold improvement in current efficiency and a 1.36-fold increase in EQE compared to IQLED with a 5-nm-thick PEI IL on ZnO NPs.

Understanding that organizational communication is crucial for the consistent functioning of any establishment, this research assesses its influence on work-life balance, organizational climate, and job satisfaction among Portuguese firefighters, a rarely studied group. Effective organizational communication is identified as a potential pathway for nurturing a favorable work setting and bolstering employee contentment, essential elements of work-life balance. Data compiled from a group of 102 firefighters, using a sociodemographic questionnaire, the Work Social Climate Scale, and Portuguese versions of the ICA Communication Audit Survey Instrument and the Labor Satisfaction Questionnaire S20/23, unveil multiple significant correlations among various dimensions of the ICA, the Work Social Climate Scale, and communication metrics. Explicitly, correlations were discerned between received and sent communications and aspects of implication, support, and cohesion. Links were also evident between desired communications and the control dimension. Positive and statistically significant relationships were further observed between received and sent communications, all five satisfaction dimensions, necessary outgoing communications and the physical environment, and required outgoing communications and benefits, highlighting the pivotal role of adept communication in augmenting work-life balance, organizational climate, and job satisfaction among firefighters.

Partial differential equations (PDEs) are used to describe a wide range of phenomena, such as heat transfer, fluid dynamics, and quantum mechanics. By solving PDEs, we can ob- tain insights into the behavior of the system and make predictions about its future evolution. Conventional numerical methods for obtaining the approximate solutions of PDEs may re- quire extensive computational resources and time, especially for complex PDEs and large- scale problems. The recently developed physics-informed neural network (PINN) has shown promise in a variety of scientific and engineering fields by incorporating physical laws into the loss functions of the neural network (NN). In addition, the training of PINN does not require ground truth data, but it has poor generalization ability to unseen domains. On the other hand, a convolutional neural network (CNN) has fast inference and better generalization ability, but it requires a large amount of training data. Taking the advantages of PINN and CNN by using Legendre multiwavelets (LMWs) as basis functions, we introduce a new method to approach the PDEs in this paper, namely Physics-Informed Legendre Multiwavelets CNN (PiLMWs-CNN), in order to continuously approximate a grid-based state representation that can be handled by a CNN. PiLMWs-CNN enable us to train our models using only physics-informed loss functions without any pre- computed training data, simultaneously providing fast and continuous solutions that gener- alize to previously unknown domains. In particular, the LMWs can simultaneously possess compact support, orthogonality, symmetry, high smoothness, and high approximation order. Compared to orthonormal polynomial (OP) bases, the approximation accuracy can be greatly increased and computation costs can be significantly reduced by using LMWs. We applied PiLMWs-CNN to approximate the damped wave equation, incompressible Navier-Stokes (N- S) equation, and two-dimensional heat conduction equation. The experimental results show that this method provides more accurate, efficient, and fast convergence with better stability when approximating the solution of PDEs.

Background: The seasonal variation of peptic ulcers is a rhythmic phenomenon reported worldwide, exhibiting diverse patterns and controversies. Unfortunately, it has remained an unresolved mystery for more than 90 years. Numerous studies have found that this phenomenon was closely associated with multiple environmental factors, but the underlying mechanism has never been elucidated. Objectives: This study aims to elucidate the seasonal variation of peptic ulcers and identify the role of environmental factors in the disease. Methods: Based on a recently identified etiology of peptic ulcers, two inverse operations in calculus, differentiation and integration, are iterated to analyze the existing data. First, the fluctuation curve in the seasonal variation is differentiated twice into the monthly incidences caused by multiple individual environmental factors, and the fluctuation curve due to each individual environmental factor is generated separately. Second, the monthly incidences caused by the individual environmental factors are integrated twice to reproduce the fluctuation curves in the seasonal variation of peptic ulcers. Results: The differentiations of the fluctuation curves in the season variation reveal a parallel relationship between the psychological impacts of each individual environmental factor and the monthly incidences of peptic ulcers. The integrations of the monthly incidences caused by 3 environmental factors reproduce the fluctuation curves in 3 representative seasonal patterns of peptic ulcers but make the parallel relationships invisible. Discussion: The parallel relationships revealed a causal role of environmental factors in peptic ulcers, whereas the reproduction of the fluctuation curves elucidated that multiple environmental factors cause the seasonal variation of peptic ulcers by Superposition Mechanism. The regional differences in environmental factors result in the diverse patterns, as well as the controversy questioning the seasonality of peptic ulcers. Significantly, the data analyses exemplify the application of a new concept, Superposition Mechanism, which might be an indispensable methodological complement to life science and medicine.

Abstract: Self-regulated Learning has become one of educational psychology's most critical research areas. Contemporary research indicates that student creativity is crucial to the success of arts education. However, there is limited research on creativity in arts education in Self-regulated Learning. Therefore, this study aims to define the creativity characteristics that determine the quality of students’ work. This study implemented a creative competition in painting and composition for first-year undergraduates. It evaluated the characteristics of creativity during the three main phases of the task: planning, execution, and completion. We discovered through semi-open questionnaires (n=178)，and using the content analysis method. According to the competition results, the students with the highest scores in Flow, Inspiration, and Idea Generation in the Performance phase had the best quality work. In the Forethought phase, Analogical Thinking and Idea Generation worked best for most students, while in the Performance phase, Flow Sense, Idea Generation, and Idea Manipulation worked best.Data on creativity characteristics at different work phases and final quality might adequately guide and organize educational procedures. These findings can serve as a theoretical foundation for quantifying the creativity phase in Self-regulated Learning and offer arts educators a reference for creativity instruction.

With increased participation in telework expected to continue, to support emerging hybrid work models in the aftermath of the Covid-19, it is important to consider the long-term impact this practice could have on sustainability outcomes. This paper describes a systematic review of 113 academic journal articles and identifies associations between telework and sustainability, explored by previous researchers. Those associations were categorized and discussed, based on their contributions to different United Nations Social Development Goals. Most of research was found to focus on countries classified as having a very high human development index status, and regions with a low, medium or high human development index, largely ignored. The SWOT matrix technique was used to illustrate the strengths and weaknesses identified in the current literature as well as threats and opportunities for future work. This can help to ensure policy coherence and that strategies to promote one outcome, such as economic productivity improvements, does not undermine another, such as improved health. Practical implications and potential research opportunities were identified across a range of SDG impact areas, including good health and well-being, gender equality, reduced inequality, climate mitigation, sustainable cities and resilient communities. On the whole, our impression is that increased rates of telework present an important opportunity to improve sustainability outcomes, however, it will be important that integrated and holistic policy is developed that mitigates key risks.

This paper presents a hypothesis about the origins of life in a clay mineral, starting with the earliest molecules, continuing through the increasing complexity of the development, in neighboring clay niches, of “Metabolism First,” “RNA World,” and other necessary components of life, to the encapsulation by membranes of the components in the niches, to the interaction and fusion of these membrane-bound protocells, resulting finally in a living cell, capable of reproduction and evolution. Biotite (black mica) in micaceous clay is the proposed site for this origin of life. Mechanical energy of moving biotite sheets provides one endless source of energy. Potassium ions between biotite sheets would be the source of the high intracellular potassium ion concentrations in all living cells.

Mobile elevating work platforms (MEWPs) consist of a work platform, extending structure, and chassis, and are used to move persons to working positions. MEWPs are useful but are composed of pieces of equipment, and accidents do occur owing to equipment defects. Among these defects, accidents caused by the fracture of bolts fixed to the extension structure and swing system are increasing. This paper presents a failure analysis of the fixing bolts of MEWP. Standard procedure for failure analysis was employed in this investigation. Visual inspection, chemical analysis, tensile strength measurement, and finite element analysis (FEA) were used to analyze the failure of the fixing bolts. Using this failure analysis approach, we found the root cause of failure and proposed a means for solving this type of failure in the future. First, the chemical composition of the fixing bolt is obtained by a spectroscopy chemical analysis method, which determined that the chemical composition matched the required standard. The tensile test showed that the tensile and yield strengths were within the required capacity. The stress analysis was carried out at five different boom angles, and it was determined that the fixing bolt of MEWP can withstand the loads at all the boom angles. The outcomes of the fatigue analysis revealed that the fixing bolt fails before reaching the design requirements. The results of the fatigue analysis showed primarily that the failure of the fixing bolt was due to fatigue. A visual inspection of the fractured section of the fixing bolt also confirmed the fatigue failure. We propose a method to prevent failure of the fixing bolt of the MEWP from four different standpoints: the manufacturer, safety certification authority, safety inspection agency, and owner.

Cryptocurrencies like Bitcoin rely on a proof-of-work system to validate transactions and prevent attacks or double-spending. A new proof-of-work is introduced which seems to be the first number theoretic proof-of-work unrelated to primes: it is based on a new metric associated to the Collatz algorithm whose natural generalization is algorithmically undecidable: the inflation propensity is defined as the cardinality of new maxima in a developing Collatz orbit. It is numerically verified that the distribution of inflation propensity slowly converges to a geometric distribution of parameter $0.714 \approx \frac{(\pi - 1)}{3}$ as the sample size increases. This pseudo-randomness opens the door to a new class of proofs-of-work based on congruential graphs.

Background: Cancer therapies predispose survivors to a high symptom burden. This study utilized mobile health (mHealth) technology to assess the feasibility of collecting daily symptoms from adult survivors of childhood cancer and evaluate symptom fluctuation and associations with future health-related quality-of-life (HRQOL). Methods: A prospective study using an mHealth platform to distribute a 20-item cancer-related symptom survey (5 consecutive days each month) and an HRQOL survey (the day after symptom survey) over 3 consecutive months to participants from the Childhood Cancer Survivor Study. PROMIS-29 Profile and Neuro-QOL assessed HRQOL. Daily symptom burden was calculated by summing the severity (mild, moderate, or severe) of 20 symptoms. Univariate linear mixed-effects models analyzed total, person-to-person, day-to-day, and month-to-month variability for the burden of 20 individual symptoms. Multivariable linear regression analyzed the association between daily symptom burden in the first month and HRQOL in the third month, adjusting covariates. Results: Out of the 60 survivors invited, 41 participated in this study (68% enrollment rate); 83% reported their symptoms ≥3 times and 95% reported HRQOL, both in each week across 3 months. Variability of daily symptom burden differed from person-to-person (74%), day-to-day (18%), and month-to-month (8%). Higher first-month symptom burden was associated with poorer HRQOL related to anxiety (regression coefficient: 6.56; 95%CI: 4.10-9.02), depression (6.32; 95%CI: 3.18-9.47), fatigue (7.93; 95%CI: 5.11-10.80), sleep (6.07; 95%CI: 3.43-8.70), pain (5.16; 95%CI: 2.11-8.22), and cognitive function (-6.89; 95%CI: -10.00 to -3.79) in the third month. Conclusion: Daily assessment reveals fluctuations in symptomology, and higher symptom burden was associated with poorer HRQOL in the future. Utilizing mHealth technology for daily symptom assessment improves our understanding of symptom dynamics and sources of variability.

This study investigated the relationship between fundamental movement skills (FMSs) and health-related fitness (HRF) among first and second graders in South Korean elementary schools. It aimed to provide foundational data for developing physical education programs tailored to the motor development stages and fitness levels of younger elementary school students. In October 2023, FMSs (jumping, running, hopping, static balance, dynamic balance, overhand throwing, and kicking) and HRF (muscular strength, cardiorespiratory endurance, and flexibility) were evaluated among 291 first and second graders. The collected data were analyzed through frequency and multiple regression analyses performed using the SPSS software. The results revealed that higher scores in jumping and hopping are associated with greater muscular strength, cardiorespiratory endurance, and flexibility. Running had no significant effect on HRF elements. Higher scores in static balance (single-leg stance) were associated with increased muscular strength, cardiorespiratory endurance, and flexibility, but dynamic balance (balance beam walking) did not have a significant effect. Higher scores in overhand throwing were associated with greater muscular strength and cardiorespiratory endurance, but kicking did not show a significant association. Overall, these findings emphasize the importance of prioritizing jumping and static balance in physical education for the well-rounded health development of first and second graders.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

OCTA is an imaging modality used in the assessment of the retinal vasculature. It operates on the principle of coherence tomography used in standard OCT with the addition of delineating the retinal vascular. This provides a modern non-invasive retinal vascular imaging method compared to conventional dye-based imaging. High quality depth resolution of the superficial and deep capillary networks is possible on OCTA whereas this was not possible prior. OCTA may be limited by image quality degradation from factors such as motion artefact or media opacities, and therefore may not be the investigation of choice for all patient groups. There are multiple potential clinical applications for OCTA in retinal and choroidal vascular disease. Ongoing research is necessary to substantiate the more widespread use of OCTA due to its significant cost burden compared to current modalities.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Overweight and obesity adversely affect health-related quality of life (HRQOL) through day-to-day impairments of both mental and physical functioning. It is assumed that polyphenols within the Mediterranean diet may contribute to improve HRQOL. This investigation aimed at studying the effects of a polyphenol-rich ingredient on HRQOL in overweight and obese but otherwise healthy individuals. A randomized, double-blind, placebo-controlled study including 72 volunteers was conducted. Subjects were randomly assigned to receive for a 16-week period either 900 mg/day of the supplement or a placebo. Dietary recommendations were individually determined, and intakes were recorded; daily physical mobility was monitored. Improvement of HRQOL was set as the primary outcome and assessed at baseline and at the end of the investigation, using the Short-Form 36 (SF-36) Health survey. Body composition was analyzed using dual-energy X-ray absorptiometry (DXA). Physical activity level was calculated using International Physical Activity Questionnaire (IPAQ). After 16 weeks, despite there was no adherence to the Mediterranean Diet Serving Score (MDSS), supplemented individuals experienced significant HRQOL improvement (+5.3%; P=0.001), including enhanced perceived physical (+11.2%; P=0.002) and mental health (+4.1%; P=0.021) components; bodily pain, vitality, and general health, being the greatest contributors. Besides, body fat mass significantly decreased (-1.2 kg; P=0.033), mainly within trunk area (-1.0 kg; P=0.002). Engagement in physical activity significantly increased (+1308 Met-min/week; P=0.050). Hence, chronic supplementation with a nutritional diversity and dose of a Mediterranean diet-inspired polyphenol-rich ingredient resulted in a significant amelioration in both perceived physical and mental health, concomitant with the improvement of body composition, in healthy subjects with excessive adiposity.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

The work and life routine of long-haul truck drivers involves the use of truck stops and rest areas to meet their basic human needs. These extensions of their workspaces while on the road, do not always offer adequate physical structures and services that drivers need for optimal health. Aim: To evaluate long-haul truck drivers’ perceptions about the services of food, safety, physical activity, rest and personal hygiene offered at truck stops and rest areas in Brazil. Method: Quantitative study conducted with long-haul truck drivers from the Southern region of Brazil. For data collection, a sociodemographic questionnaire and a Likert scale on food, rest, personal hygiene, safety and physical activity services were used, offered in general at the truck stops and rest areas along Brazilian roads, from March to August 2023. The data were analyzed with simple frequency descriptive statistics. Results: 175 long-haul truck drivers participated, 70.29% declared that the services of the truck stop and rest areas were charged; more than half (53.59%) of the professionals evaluated the rest service as “good” or “excellent”; the food services, was “good” or “excellent” for 42.24% of the drivers. The spaces for physical activities were the worst evaluated as “bad” or “terrible”, by 41.61%, followed by bathroom service (28.42%) and safety (34.24%), evaluated as “bad” or “terrible”. Conclusions: In the perception of long-haul truck drivers, the rest and feeding services had better evaluations, on the other hand, the services of bathroom, safety and physical activity presented worse evaluations. The perception of drivers demonstrates the lack of investments to improve basic services such as personal hygiene, safe environment and physical exercises, fundamental to the health of the worker, aiming to reduce vulnerability, sedentary lifestyle, and meeting the basic human needs of long-haul truck drivers.

Breast cancer (BC) is the most common invasive neoplasm and affects many women of working age. The return to work (RTW) of female survivors (BCSs) is associated with a better quality of life and longer survival. A tailored intervention to promote RTW was launched in 2022. A year later, the women were contacted to find out if RTW had occurred regularly and what their health conditions were compared to baseline. BCSs reported excessive fatigue, poor sleep quality, anxiety, depression and reduced work ability; these parameters had not improved significantly compared to baseline. Thematic analysis of the interviews confirmed the presence of personal, company and societal factors that could hinder or favor RTW. The interviews demonstrated that, even in an economically developed country that has provided numerous benefits for BCSs, protection is not always effective. Personalized intervention seems necessary to complete the process of reintegrating BCSs into their future working careers.

Background: Systemic lupus erythematosus (SLE) is characterized by inflammation and cardiovascular complications. Our study aimed to investigate subclinical and early indicators of systolic myocardial dysfunction in SLE patients using advanced echocardiographic methods and biomarkers. Methods: In this cross-sectional study, we enrolled 102 SLE patients without known cardiac impairment and 51 healthy controls. Demographics, disease characteristics, laboratory results, disease activity (SLEDAI) and organ damage (SDI) indices were recorded. Left ventricular global longitudinal strain (GLS) and myocardial work indices were assessed by utilizing speckle tracking echocardiography. In addition, high sensitivity C-reactive protein (hsCRP), high sensitivity troponin (hsTn) and N-terminal-pro B-type natriuretic peptide (NT-proBNP) levels were measured in blood samples. Results: In comparison to controls, SLE patients had significantly higher GLS (-19.94±2.71%vs-21.15±1.55%, p&lt;0.001) and global wasted work (GWW) (94±71mmHg%vs71±49 mmHg%, p=0.025). Notably, NT-proBNP and hsTn were threefold and twofold higher in SLE group compared to control group, respectively (p&lt;0.001). Within SLE cohort, patients with at least moderate disease activity (SLEDAI≥4) both biomarkers were significantly elevated than those with low disease activity (SLEDAI&lt;4). Conclusion: Advanced echocardiographic parameters combined with specific biomarkers have a promising role in detecting systolic dysfunction at an early phase in SLE patients, potentially enabling timely interventions to mitigate cardiovascular risk.

This study explores the interplay between web-based professional development, teachers' self-efficacy, resilience, and work values in the context of the Davao Region. The investigation reveals significant findings in three key areas: web-based professional development, teachers' resilience, and teachers' work values. The survey indicates that web-based professional development significantly impacts teachers' self-efficacy, with interaction self-efficacy registering the highest mean score. Moreover, teachers' resilience is manifested across emotional, motivational, and social dimensions, with emotional resilience scoring the highest mean. Teachers' work values, encompassing physical facilities, social environment, job security, new challenges, professional growth, personal growth, and interpersonal relationships, all demonstrate high descriptive equivalents. The study establishes a significant positive correlation between web-based professional development and teachers' self-efficacy, as well as a significant relationship between teachers' resilience and their work values. Furthermore, both web-based professional development and teachers' resilience exert a significant influence on teachers' work values.The conclusions drawn from the study highlight the prominence of web-based professional development, teachers' resilience, and work values in the educational landscape of the Davao Region. The findings underscore the interconnectedness of these factors and their crucial role in shaping the teaching profession. In light of these results, recommendations are made to inform policy decisions and enhance professional development programs for teachers in the region. The study encourages a holistic understanding of the relationships between web-based professional development, self-efficacy, resilience, and work values, aiming to contribute to the continuous improvement of education quality in the Davao Region. Additionally, future research is suggested to delve deeper into specific aspects of teachers' general self-efficacy, social resilience, and interpersonal relationships for a more comprehensive understanding.

Policing is considered a high-stress occupation due to the demanding nature of the job. Addressing police stress requires a detailed understanding of how psychosocial risk factors influence various aspects of their well-being. Moreover, an analysis of the direct effects of work conditions and the mediating effects of cognitive appraisals is also warranted. Using the Demands-Resources-Individual Effects (DRIVE) model of work-related stress [19], this study investigated the direct effects of work conditions on well-being and also examined the intermediate role of perceived job stress and job satisfaction in the relationship between work conditions and well-being. Five hundred and seventy-eight police officers from the Jamaica Constabulary Force (J.C.F.) completed the questionnaire. Data were analyzed using hierarchical regressions and the Hayes Process tool for mediation analysis. Both perceived job stress and satisfaction mediated the relationship between work conditions and general physical health. Perceived job stress was an indirect pathway through which work conditions influenced psychological distress, whereas job satisfaction was not a significant mediator. In contrast, job satisfaction mediated the relationship between work conditions and positive well-being, but perceived job stress did not. These findings provide significant evidence for periodically monitoring and auditing perceptions of stress and job satisfaction as they are likely precursors to subsequent health problems.

In response to new developments of work and employment in high-income countries (HICs), psychosocial aspects of work and health received increased attention. In contrast, middle-income countries (MICs) are mainly concerned with severe challenges of noxious and dangerous material work environments, poor employment conditions, and deficient social policies, leaving psychosocial aspects in a marginal role at best. More recently, differences between these two worlds were even aggravated by the COVID-19 pandemic. Yet, with economic globalisation and growing worldwide interconnectivity, the world of work in MICs is being rapidly transformed, sharing several concerns with modern Western societies. In this process, psychosocial occupational health will become an increasingly pressing issue. This contribution explores to what extent psychosocial aspects of work and health are already addressed in research originating from MICs. A selective focus on recent findings from two regions, Asia Pacific and Latin America, reveals a high degree of awareness of, and inquiry into, work-stress related problems within these countries. Importantly, in addition to incorporating research progress from HICs, these analyses identify new aspects within specific cultural and socio-economic environments, thus enriching the international state of art.

: This study investigates the workplace experiences of mothers of children with intellectual disabilities. These mothers may face challenges in balancing motherhood, disability, and employment. Therefore, it is important to understand the challenges they are facing and the mechanisms they use to cope with caregiving and work responsibilities in managing the stress that develops throughout this ongoing experience. The purpose of this research was to investigate the workplace experiences of single mothers of children with intellectual disabilities. A review of the literature was conducted. For this research, a qualitative methodology was adopted to gain an in-depth understanding of the mothers’ experiences. A narrative method was used for data collection. Thematic analysis was utilized to obtain a clear understanding. The findings suggest that mothers of children with intellectual disabilities face difficulties in balancing between caregiving for their child with a disability and their job responsibilities, in addition to showing that there is a lack of flexibility in the workplace, less awareness from colleagues and bosses of the challenges these mothers face, and a lack of organizational legislation that supports these mothers. According to our findings, workplaces should provide assistance to mothers of children with intellectual disabilities in order to ensure that they are not disadvantaged in their employment.

We explored the impacts of the remote and return to in-person work periods on sleep and well-being as reported by faculty (n = 22) and non-teaching staff (n=21) with and without disabilities. Our results show that contrary to expectations, the Covid-19 remote teaching/working period resulted in better sleep, as well as greater well-being, than the return to in-person. With respect to sleep, faculty members had slightly more negative outcomes than staff, most evident in heightened anxiety and work aspects. Faculty with disabilities had somewhat worse sleep and well-being during the remote period than faculty without disabilities. During the return to in-person work, both faculty and non-teaching staff reported more negative than positive sleep and well-being outcomes. In particular, during the in-person period faculty members experienced slightly more negative sleep outcomes related to anxiety and work, while staff members experienced slightly more negative sleep outcomes related to the need to commute and lifestyle. Our findings show that there were benefits and disadvantages to both remote and in-person work periods, suggesting a hybrid work schedule should be considered in more detail, particularly as an optional reasonable accommodation for faculty and staff with disabilities. Our study highlights that training to keep faculty abreast of the latest technological innovations, ways to promote work-life balance and steps to remedy classroom size and building ventilation to prevent the spread of disease all need urgent attention.

Work in the copper mining industry is often associated with exposure to respirable dust and respirable crystalline silica. This exposure has the potential to cause silicosis, a non-curable occupational respiratory lung disease. This study aimed at establishing the relationship between knowledge, attitudes, work behaviour and practice, compliance with safety standards and exposure to respirable dust. A cross-sectional descriptive survey was conducted on 528 mine workers. Statistical package for social sciences (SPSS) was used for descriptives. Structural Equation Modelling (SEM) with latent variables and partial least-squares (LVPLS) analysis was employed to determine the relationship among these variables. The results indicated that of the four (4) hypotheses, two (2) were supported and two (2) were rejected showing that there is a significant relationship between exposure to respirable dust and work behaviour and practice, as well as compliance with safety standards. Knowledge and attitudes towards respirable dust exposure did not significantly influence exposure. According to the results from the survey, positive work behaviour and practice as well as compliance with safety standards was significantly associated with exposure to respirable dust. It is recommended that the mine should focus on the miners’ work behaviour and practice and compliance with safety standards.

The application of warm-mixing technology brings considerable economical and environment benefits by decreasing the mixing temperature during warm asphalt mixture(WMA) production. However, the possible water residue also generates concerns in moisture susceptibility. For deep investigation on the influencing factors and mechanism of the moisture susceptibility of WMA, surface free energy(SFE) test and laboratory tests are applied in this research. A novel indicator based on SFE namely effective adhesion work is proposed to assess the asphalt-aggregate adhesion with different moisture contents. Then, given the mixing procedure of dry mixing method, an advanced three-phase model as form of asphalt-aggregate-warm mixing additive is introduced improving from the conventional two-phase asphalt-aggregate model for better reflecting the separate addition of warm mixing additive during mixing. Afterwards, the influence of aggregate types, asphalt type, aggregate moisture contents, warm-mixing agent types and warm-mixing process on the moisture susceptibility of WMA is analyzed utilizing the models and indicators proposed. Finally, the validity of the SFE indicator is verified by comparing the calculation of effective adhesion work with freeze-thaw splitting test result. The results show that all of the above factors impact the moisture susceptibility of WMA by influencing the interfacial adhesion, with the effect of moisture content being the most significant. Meanwhile, effective adhesion work and the three-phase model brought out in this research are proven to be feasible to characterize the adhesion properties of WMA, offering theoretical support to the research on warm mixing technology.

Intracellular potassium concentrations, [K+], are high in all types of living cells, but the origins of this K+ are unknown. The simplest hypothesis is that life emerged in an environment that was high in K+. One such environment is the spaces between the sheets of the clay mineral, mica. The best mica for life’s origins is the black mica, biotite, because it has a high content of Mg++ and it has iron in various oxidation states. Life also has many of the characteristics of the environment between mica sheets, giving further support for the possibility that mica was the substrate on and within which life emerged.

Blockchain technology has been recognized as a promising solution to enhance the security and privacy of Internet of Things (IoT) and Edge Computing scenarios. Taking advantage of the Proof-of-Work (PoW) consensus protocol, which solves a computation intensive hashing puzzle, Blockchain assures the security of the system by establishing a digital ledger. However, the computation intensive PoW favors members possessing more computing power. In the IoT paradigm, fairness in the highly heterogeneous network edge environments must consider devices with various constraints on computation power. Inspired by the advanced features of Digital Twins (DT), an emerging concept that mirrors the lifespan and operational characteristics of physical objects, we propose a novel Miner-Twins (MinT) architecture to enable a fair PoW consensus mechanism for blockchains in IoT environments. MinT adopts an edge-fog-cloud hierarchy. All physical miners of the blockchain are deployed as microservices on distributed edge devices, while fog/cloud servers maintain digital twins that periodically update miners’ running status. By timely monitoring miner’s footage that is mirrored by twins, a lightweight Singular Spectrum Analysis (SSA) based detection achieves to identify individual misbehaved miners that violate fair mining. Moreover, we also design a novel Proof-of-Behavior (PoB) consensus algorithm to detect byzantine miners that collude to compromise a fair mining network. A preliminary study is conducted on a proof-of-concept prototype implementation, and experimental evaluation shows the feasibility and effectiveness of proposed MinT scheme under a distributed byzantine network environment.

We are calling for a paradigm shift in engineering education. In times of the Fourth Industrial Revolution (“4IR”), a myriad of potential changes is affecting all industrial sectors leading to increased ambiguity that makes it impossible to predict what lies ahead of us. Thus, incremental culture change in education is not an option any more. The vast majority of engineering education and training systems, having remained mostly static and underinvested in for decades, are largely inadequate for the new 4IR labor markets. Some positive developments in changing the direction of the engineering education sector can be observed. Novel approaches of engineering education already deliver distinctive, student centered curricular experiences within an integrated and unified educational approach. We must educate engineering students for a future whose main characteristics are volatility, uncertainty, complexity and ambiguity. Talent and skills gaps across all industries are poised to grow in the years to come. The authors promote an engineering curriculum that combine timeless didactic tradition, such as Socratic inquiry, project-based learning and first-principles thinking with novel elements (e.g. student centered active and e-learning by focusing on the case study and apprenticeship pedagogical methods) as well as a refocused engineering skillset and knowledge. These capabilities reinforce engineering students’ perceptions of the world and the subsequent decisions they make. This 4IR engineering curriculum will prepare engineering students to become curious engineers and excellent communicators better navigating increasingly complex multistakeholder ecosystems.

A new research stream emerged in the 2000s dedicated to flexible work arrangements in public and private organizations, called “new ways of working” (NWW). This article aims to examine NWW from both a theoretical and empirical perspective, focusing on outcomes of this new concept and the debate between “mutual gains” vs. “conflicting outcomes.” Through a literature review, it examines this research field’s innovation and its rather vague theoretical foundations. Findings demonstrate that NWW definitions are diverse and somewhat imprecise, leading to fragmented research designs and findings; the research stream’s theoretical foundations should be better addressed. Findings also highlight the current lack of empirical data, which therefore does not allow any real conclusions on NWW’s effects on employees’ and organizations’ well-being and performance.

Outbreaks of coronavirus disease 2019 (COVID-19) have been recorded in different countries across the globe. The virus is highly contagious, hence early detection, isolation, and quarantine of infected patients will play an important role in containing the viral spread. Diagnosis in a mobile lab can aid to find infected patients in time. Here, we develop a field-deployable diagnostic workflow that can reliably detect COVID-19. Instruments used in this workflow could easily fit in a mobile cabin hospital and also be installed in the community. Different steps from sample inactivation to detection were optimized to find the fastest steps and portable instruments in detection of COVID-19. Each step was compared to that of the normal laboratory diagnosis set-up. From the results, our proposed workflow (80 min) was two times faster compared to that of the normal laboratory workflow (183 min) and a maximum of 32 samples could be detected at each run. Additionally, we showed that using 1% Rewocid WK-30 could inactivate the novel coronavirus directly without affecting the overall detection results. Comparison of our workflow using an in-house assay to that of a commercially acquired assay produced highly reliable results. From the 250 hospital samples tested, there was a high concordance 247/250 (98.8%) between the two assays. The in-house assay sensitivity and specificity were 116/116 (100%) and 131/134 (97.8%) compared to that of the commercial assay. Based on these results, we believe that our workflow is fast, reliable, adaptable and most importantly, field deployable.

The present examination explored the impact of work spirituality and procedural justice on work locus of control, worker work fulfillment and representative authoritative duty among workers from private establishments of high learning in South Africa. Due to limited researches that have concentrated on the impact of workplace spirituality and procedural justice on work locus of control, employee job satisfaction and employee organisational commitment in developing countries especially in Southern Africa. A review was done and information was accumulated by methods for surveys on a sample of 150 academics and support staff in a private university setting in Gauteng, South Africa. Structural equation modelling was employed to analyse data using the Smart Partial Least Squares (PLS) software. By means of a partial least squares structural equation modeling approach, this study validates that elements such as workplace spirituality, procedural justice and work locus of control are instrumental in stimulating the employee job satisfaction and employee job commitment. The present investigation offers suggestions for academicians in the field of resource management by upgrading their comprehension of the how workplace spirituality and procedural justice impacts work locus of control, employee job satisfaction and employee organisational commitment

Pancreatic cancer is a refractory cancer with limited treatment options. Various cancer types are resistant to the tumor necrosis factor-related apoptosis-inducing ligand (TRAIL). Eugenol, the main component of clove oil, exhibits anticancer, anti-inflammatory, and antioxidant effects. However, no studies have reported that eugenol increases TRAIL sensitivity by upregulating death receptor (DR) expression. Here, we aimed to investigate eugenol as a potent TRAIL sensitizer. Increased apoptosis and inhibition of cell proliferation was observed in pancreatic cancer cells treated with eugenol and TRAIL compared with those treated with eugenol alone. Eugenol upregulated the expression of DR5, inhibited FLICE-inhibitory protein (FLIP), an anti-apoptotic protein, and increased p53, a tumor suppressor protein. In addition, eugenol induced the generation of reactive oxygen species (ROS) and caused endoplasmic reticulum (ER) stress. C/EBP-homologous protein (CHOP) knockdown using siRNA decreased the expression of DR5 and reduced the combined effects of eugenol and TRAIL. These results demonstrate that eugenol enhances TRAIL-induced apoptosis by upregulating DR5 through the ROS-mediated ER stress-CHOP pathway, enhancing ER stress by inducing p53 and downregulating FLIP expression. This suggests that eugenol has the potential to treat pancreatic cancer by increasing cell sensitivity to TRAIL.

We analyze a time-delayed SIQR model that considers the transportation-related infections and entry-exit screening. This model aims to determine the measures for preventing and controlling major emergent infectious diseases and the associated costs. We calculate the basic reproduction number (R0), apply the linearization method, and construct an appropriate Lyapunov function to determine the stability of the disease-free equilibrium in the local and global. We collect COVID-19 infection data from two regions in the United States in 2020 for data fitting, obtain a set of optimal parameter values, and show that the model is suitable for simulating the outbreak and spread of emerging infectious diseases. We find that transportation-related infections increase the basic reproduction number, enhancing the impact on disease spread. Entry-exit screening effectively suppress the spread of disease by reducing the basic reproduction number. Furthermore, we investigate the influence of the incubation period on disease and find that a shorter incubation period results in a shorter duration but a larger scale of infection, and the peaks are reduced. We conduct a sensitivity analysis of the R0 and propose three measures to prevent the spread of new infectious diseases based on the most sensitive parameters: wearing masks, implementing urban closures, and administering medication to sick but not yet hospitalized patients promptly. In the case of COVID-19, we use Pontryagin’s minimum principle to get time-varying control measures to control the spread of the outbreak. Optimal control effectively controls the development and deterioration of the disease. Finally, several control measures are compared through cost-effectiveness analysis, and the results show that wearing masks is the most cost-effective measure. Our study provides some practical guidance for controlling the spread of major emerging infectious diseases.

Survival of Medulloblastoma (MB) depends on various factors, including the gene expression profiles of MB tumor tissues. In this study, we identified 967 MB survival related genes (SRBs) using the gene expression dataset of Cavalli et al. (2017) and the Cox proportional hazards regression model. Notably, the SRGs were over-represented on chromosomes 6 and 17, known for the abnormalities monosomy 6 and isochromosome 17 in MB. The most significant SRG was HMGA1 (high mobility group AT-hook 1), which is a known oncogene and a histone H1 competitor. High expression of HMGA1 was associated with worse survival, primarily in the Group 3γ subtype. The high expression of HMGA1 was unrelated to any known somatic copy number alteration. Most SRGs on chromosome 17p were associated with low expression in Group 4β, the MB subtype with 93% deletion of 17p and 98% copy gain of 17q. Pathway analysis showed that both chromosomes 6 and 17 included SRGs related to telomere maintenance and provide a rationale for testing telomerase inhibitors in Group 3 MBs. We conclude that HMGA1, along with other SRGs on chromosome 6 and 17 warrant further investigation as potential therapeutic targets in selected subgroups or subtypes of MB.

This study aimed to investigates obesity-related glomerulopathy (ORG) at cellular, structural, and transcriptomic levels. Thirty Wistar rats were randomized into two groups: control (n=15) and study groups (n=15) that were fed a standard (SD) and high-fat diet (HFD), respectively. After 10 weeks, the weight, kidney function, histological features, and transcriptomic changes were assessed. HFD group exhibited increased weight gain (55.8% vs 29.2%; P< 0.001) and albuminuria (10384.04 ng/ml vs 5845.45 ng/ml; P<0.001) compared to controls. The HFD group exhibited early stages of ORG lesions, with a predominance of mesangial matrix increase and podocyte hypertrophy (PH). These lesions correlated with differentially expressed (DE) genes and miRNAs. Functional analysis showed that four DE miRNAs in the kidneys of the HFD group negatively regulated the PTEN gene, which promotes podocyte endocytosis of lipids in ORG. Among these four miRNAs, miR-205 was upregulated in the urine of the HFD group. HFD-fed Wistar rats developed early stages of ORG, with a specific targetome of miRNAs and gene expression. The upregulation of miR-205 in the kidney and its isolation in urine are associated with lipid endocytosis in podocytes, which could become a plausible biomarker of the early stages of ORG and lead to future therapeutic research.

Objective To investigate nailfold capillary parameters in community-dwelling individuals aged over 60 years who have hypertension and do not exercise regularly. Furthermore, the study examined the correlations between capillary function and other health-related indicators. Design A single- center pilot trial Setting Faculty of Health, Tsukuba University of Technology, Japan Participants hypertensive community-dwelling elderly people Intervention Microcirculation was observed before and 1 min after arm-curl exercise by means microscopy of capillary with non-exercised limb. Additionally, we examined other health-related indicators. Outcome measures: Acute effects of reperfusion on nailfold density, flow, and diameters. Secondary outcomes included the correlations between microvascular parameters and other health-related indicators. We hypothesized that brief exercise could enhance microcirculation reperfusion and correlate with other health-related parameters.　 Results: There were 20 participants with a mean (SD) age of 67.1 (5.8) years. The capillary flow rate changed from 2.3±6.7 to 2.7±0.2 log µm/s (P

.Background: Negative outcomes associated with medications (NOM) and drug-related problems (DRP) significantly impact individuals with kidney replacement therapy (KRT) given the complexities of managing kidney disease and associated comorbidities. The present study aims to assess the frequency of NOMs/DRPs among KRT patients and identify contributing factors. Methods: A cross-sectional study was conducted at the Virgen de las Nieves University Hospital (Granada, Spain), involving 117 outpatient adults with KRT. Data were collected from February 2021 to July 2023 using electronic records, semi-structured interviews (Dáder Method), and discussions with nephrology specialists. NOMs/DRPs were identified following treatment guidelines. Binary logistic regression determined associated factors (p-value < 0.05). Results: Across 117 patients, 2,436 NOMs and 3,303 DRPs were identified, averaging 20.82 NOMs and 28.23 DRPs per patient. Prevalent NOMs included untreated conditions (58.95%), quantitative ineffectiveness (35.43%), and non-quantitative safety problems (5.13%). Dominant DRPs were undertreated conditions (37.63%), wrong dose/posology/length (33.00%), risk of adverse drug reactions (ADR) (16.14%), and non-adherence (6.87%). Patients with ADR, undertreated condi-tions, and anemia were associated with quantitative ineffectiveness. Risk of ADR and vitamin D deficiency/insufficiency correlated with non-quantitative safety problems. Conclusions: KRT pa-tients exhibited a substantial prevalence of NOMs/DRPs. Further research is needed to deepen our understanding of these complexities for improved patient care.

Background: Micronutrient deficiencies are common at the time of cancer diagnosis and are associated with worse prognosis. Little is known about them in cancer rehabilitation. Methods: Data from routine health related quality of life (HRQOL) were analyzed at an inpatient cancer rehabilitation center. Rehabilitation patients completed the EORTC QLQ-C30 questionnaire before and after multidisciplinary rehabilitation treatment, and three month after discharge. Selenium and zinc status was measured in whole blood at these three time points. In case of selenium deficiency up to 600 µg selenium per day as sodium selenite was supplemented. Results: A total of 271 patients (breast, colon, and pancreatic cancer) were included in the analysis. There was clinically meaningful improvement in many domains of the EORTC QLQ-C30 during rehabilitation. However, effect often waned in the three months after. Prevalence for selenium deficiency varied between 34 to 90 percent depending on cancer type (breast &lt; colon &lt; pancreas). In contrast, zinc deficiency was rare. Daily selenium supplementation of 600 µg was more efficient to correct selenium deficiency compared to 300 µg selenium per day. Rehabilitation and increasing selenium status after rehabilitation were associated with improved global quality of life, physical and emotional functioning, and fatigue. In cancer patients with decreasing selenium status, values of global quality of life, physical and emotional functioning, and fatigue were back to the values at the beginning of rehabilitation. Conclusions: Selenium deficiency is common in cancer patients admitted to a cancer rehabilitation clinic. Selenium supplementation during rehabilitation effectively corrected selenium deficiency in most cases. The positive effects of rehabilitation persisted longer, when selenium status did not decrease after rehabilitation.

: Molecular targeting strategies have been used for years to control cancer progression and are often based on targeting various enzymes involved in metabolic pathways. Keeping that in mind, it is essential to know the role of each enzyme in a particular metabolic pathway. In this review, we are providing in-depth knowledge of various enzymes such as ceramidase, sphingosine kinase, sphingomyelin synthase, dihydroceramide desaturase, and ceramide synthase, which are associated with multiple types of cancer that depend on ceramide metabolism. Focus has also been given to discussing physicochemical properties of well-studied inhibitors of natural products origin and their related structures for these enzymes. Targeting ceramide metabolism exhibited promise in mono and combination therapies at preclinical stages to prevent cancer progression and paved the way for the significance of sphingolipid metabolism in cancer treatments. Targeting ceramide metabolizing enzymes will help the medicinal chemist to design potent and selective small molecules for treating cancer progression at various levels.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

To date, the impact of COVID-19 vaccination on formerly menstruating women remains unknown. For this reason, a retrospective observational cross-sectional study was conducted (N= 548) using an online survey. General characteristics, medical history, and adverse events following COVID-19 vaccination were recorded. In comparison with the first dose, significantly higher percentages of respondents experienced menstrual-related disturbances (dose 1: 38.5% vs. dose 2: 44.8%; McNemar=9.15; mid P-value=0.002), as well as the simultaneous occurrence of two or more of these symptoms (dose 1: 11.2% vs. dose 2: 15.3%; McNemar=13.53; mid P-value=0.044) after receiving the second one. Among them, those related with the length and flow stand out, being of long-term nature in about 17-20% of cases. Interindividual factors influencing this unexpected event after receiving the dose 1 may include weight (AOR 1.02, CI 95% 1.01–1.03, P&lt;.001), perimenopause (AOR 2.28, CI 95% 1.37–3.77, P=.001), pre-existing diagnoses of non-autoimmune rheumatic/articular conditions (AOR 0.31, CI 95% 0.10–1.00, P=0.05), hormonal contraceptive use (AOR 0.25, CI 95% 0.07-0.82, P=0.02), suffering from other vaccine side effects − such as arm pain (AOR 0.61, CI 95% 0.39–0.95, P=0.03), headache (AOR 0.53, CI 95% 0.35 – 0.80, P=.003), swollen glands (AOR 0.29, CI 95% 0.15 – 0.60, P=.001) and nauseas (AOR 0.35, CI 95% 0.14 – 0.86, P=0.02) – and the number of previous pregnancies (AOR 2.70, CI 95% 1.54 – 4.76, P=.001). Formerly menstruating women may experience long-term menstrual-related disturbances following COVID-19 vaccination.

Tyrosine kinase inhibitors (TKI) and immune checkpoint inhibitors (ICI) significantly improve the outcomes of patients with advanced clear cell renal cell carcinoma (ccRCC), but high-grade toxicities can occur, particularly during combination therapy. Herein, we report a patient with advanced metastatic ccRCC, who developed grade 4 cholestasis during combined therapy with nivolumab and cabozantinib. After the exclusion of common disorders associated with choles-tasis and a failure of corticosteroids (CS), a liver biopsy was performed that demonstrated severe ductopenia. Consequently, a diagnosis of vanishing bile duct syndrome related to TKI and ICI administration was made, resulting in CS discontinuation and ursodeoxycholic acid administra-tion. After a 7-months follow-up, liver tests had returned to normal values. Immunological studies revealed that our patient had developed robust T-cells and macrophages infiltrates in his lung metastasis, as well as in skin and liver tissues at the onset of toxicities. At the same time, peripheral blood immunophenotyping revealed significant changes in T-cell subsets suggesting their potential role in the pathophysiology of the disease.

Grapevine is one of the most relevant crops in the world being used for economically important products such as wine. Yet, relevant grapevine cultivars are heavily affected by diseases such as the downy mildew disease caused by Plasmopara viticola. Improvements on grapevine resistance are made mainly by breeding techniques where resistance traits are introgressed into cultivars with desired grape characteristics. However, there is still a lack of knowledge on how resistant or tolerant cultivars tackle the P. viticola pathogen. In this study, using a shotgun proteomics LC-MS/MS approach, we unravel the protein modulation of a highly tolerant grapevine cultivar, V. vinifera ‘Regent’, in the first hours post inoculation (hpi) with P. viticola. At 6 hpi, proteins related to defence and to response to stimuli are negatively modulated while at 12 hpi there is an accumulation of proteins belonging to both categories. The co-occurrence of effector-triggered susceptibility (ETS) and effector-triggered immunity (ETI) is detected at both time-points, showing that these defence processes present high plasticity. The results obtained in this study unravel the tolerant grapevine defence strategy towards P. viticola and may provide valuable insights on resistance associated candidates and mechanisms, which may play an important role in the definition of new strategies on breeding approaches.

The 2030 Agenda sets out seventeen Sustainable Development Goals (SDGs). The educational goal is to promote the education of citizens on sustainable development, among other things. Educating today's digital citizens on sustainability means training them for justice and social activism, commitment and political engagement. However, research into the subject shows a lack of consistency in the education of university students. This paper presents a study of students of Education, on education on sustainability through the practice of active and critical digital citizenship. A quasi-experimental method was used to learn about the behaviours of digital citizens, and intervention was carried out by means of an SDG-focused workshop and observation of the final level of commitment. The results show a positive level of commitment and digital activism around content related to sustainable development, which can be addressed from the university syllabus in a cross-curricular way.

Deregulation of cell growth and development lead to cancer, a severe condition that claims millions of lives worldwide. Targeted or selective approaches used during cancer treatment determine the efficacy and outcome of the therapy. In order to enhance specificity and targeting and better treatment options for cancer, novel and alternative modalities are currently under development. Photodynamic therapy has the potential to eradicate cancer and combination therapy would yield even greater outcomes. Nanomedicine-aided cancer therapy shows enhanced specificity for cancer cells and minimal side-effects coupled with effective cancer destruction both in vitro and in vivo. Nanocarriers used in drug-delivery systems are well able to penetrate cancer stem cell niche, simultaneously killing cancer cells and eradicate drug-resistant cancer stem cells, yielding therapeutic efficiency up to 100 fold against drug-resistant cancer in comparison with free drugs. Safety precautions should be considered when using Nano-mediated therapy as the effects of extended exposure to biological environments are still to be determined.

Here, we consider a closed composite system consisting of a primary system where the chemical reaction occurs and is located in a p, T reservoir. In the ideal isentropic case (thermodynamic process), the change in the internal energy of the composite system (due to a chemical reaction) is wholly converted into useful work - maximum useful work. Irreversibility - a measure for the degradation of useful work - in a closed system generates entropy, i.e., the thermodynamic process is no longer isentropic. Applying the principle of maximum entropy and minimum internal energy to a part of the system's total volume and applying the elements of the system's volume for which the law of local equilibrium applies useful work and irreversibility can be defined. Suppose the primary system is viewed as a set of black box volume elements in which a chemical reaction occurs. In that case, the criterion of an isentropic process or a process with entropy generation becomes the Gibbs-Duham equation. It has been proven that De Donder's equation of entropy production of a chemical reaction is a particular form of Calen's equation –TdST = dUT where dST is the differential change of total entropy and dUT is the differential change of total internal energy of the composite system.

Exposure to quasi-electrostatic field induced currents is a hazard of live-line transmission work. These steady-state induced currents are typically less than 1 mA, and their sensory effects range from imperceptible to painful depending on the person and conditions such as contact area and duration. Permanent injury from these currents is unlikely but they can distract workers, increasing the risk of injury from falls or other dangers. Identifying contact current severity and training workers can help reduce risk of accidents. Measuring induced currents along a climbing route is time consuming and simulation is challenging because of geometric complexity of the worker, transmission structure, conductor bundles, and electric fields in the climbing space. This research explores calculation of worker contact current using a recently developed adaptation of the charge simulation method. The method uses Fourier principles to improve computational efficiency when explicitly modeling all bundle subconductors. The research also examines reasonable simplifications for modeling lattice structures and human geometry. Calculated results compare well to measured currents for a worker climbing a 400 kV lattice structure. This indicates the method is a practical option for calculating the severity of steady-state contact currents. A simple calculation is suggested for estimating these currents.

Telemedicine and remote survey of physiological parameters may significantly increase the health and safety of people working in extreme environmental conditions, like firefighters, maintain rescuers, soldiers, and others. We highlight this problem and give an overview of the historical development and the actual status of systems available. Ruggedized systems, as small, lightweight, and flexible as possible, are needed to optimize the goal of increasing occupational health and safety of persons at risk and maximizing their performance during missions.

Organophosphate pesticides (OPs) are toxic substances that contaminate aquatic environments, interfere with the development of the nervous system, and induce Neurodevelopmental Toxicity (NDT) in animals and humans. The canonical mechanism of OP neurotoxicity involves the inhibi-tion of acetylcholinesterase (AChE), but other mechanisms non-AChE are also involved and not fully understood. We used network toxicology and molecular docking to identify molecular targets and toxicity mechanisms common to OPs. Targets related to diazinon-oxon, chlorpyrifos oxon, and paraoxon OPs were predicted using the Swiss Target Prediction and PharmMapper databases. Targets related to NDT were compiled from GeneCards and OMIM databases. In order to construct the protein-protein interaction (PPI) network, the common targets between OPs and NDT were imported into the STRING. Networks topological analyses identified EGFR, MET, HSP90AA1, and SRC as hub nodes common to the three OPs. Using Reactome pathway and gene ontology we found that signal transduction, axon guidance, cellular responses to stress, and glutamatergic signaling activation play key roles in OP-induced NDT.

This research analyzed South Korean companies’ adoption of remote work during the COVID-19 pandemic, by focusing on the dual labor market structure comprising of the primary (large corporations) and the secondary sectors (small and medium enterprises (SMEs)). Companies in the dual labor market were classified as per firm size. We used Statistics Korea’s August supplementary data from the Economically Active Population Survey, covering 2017–2020. This empirical study analyzed the factors affecting remote work in 2020, after the outbreak of the pandemic. The results showed that the probability of large corporations introducing remote work during the pandemic increased by a significantly larger margin than for small and medium-sized firms. This suggests that the polarization within the dual labor market structure between large corporations and SMEs also spilled over into companies’ adoption of remote work, which was initially introduced to prevent the spread of the pandemic. Additionally, the polarization in the use of digital technology is likely to persist even after the pandemic. Hence, based on our analysis of remote work adoption in the dual labor market, this study examined the system and factors of labor-management relations contributing toward such polarization and presented policy directions for the current labor market structure.

The present paper brings to the fore issues relating to the meaning and construction of ethics in online team communication by exploring the discursive strategies that contribute to the construction of a team’s sense of duty and individual virtuousness. The study relies on a complex toolkit which includes ethnolinguistics, sociolinguistics, discourse and conversation analysis. Data consist in a one-day interaction unit as part of a larger set of real communication exchanges (ca. 34,000) over a time period of six months, observation notes, as well as unstructured interviews. Our empirical analysis has revealed that individual virtuousness and sense of duty are actually interrelated. A virtuous team climate leads team members to share positive perceptions about the team, which in turn increases team commitment. Furthermore, we argue that the blurring of private and professional life not only allows for the enactment of ethic-driven discourse strategies that result in enhanced cooperation and improved team performance but also for high levels of interconnectivity and improved social interaction. The results of the analysis supplement organisational literature based on ethics-centred observations on the effectiveness of virtual work, and show how a discourse-driven approach can provide tools for further theorisations about the practices and the ecology of digital communication.

Despite recent developments in monitoring and visualizing construction progress, the data exchange between construction jobsite and office lacks automation and real-time recording. To address this issue, a near real-time construction work inspection system called iVR is proposed; this system integrates 3D scanning, extended reality, and visual programming to visualize interactive onsite inspection for indoor activities and provide numeric data. iVR comprises five modules: iVR-location finder (finding laser scanner located in the construction site) iVR-scan (capture point cloud data of jobsite indoor activity), iVR-prepare (processes and convert 3D scan data into a 3D model), iVR-inspect (conduct immersive visual reality inspection in construction office), and iVR-feedback (visualize inspection feedback from jobsite using augmented reality). An experimental lab test is conducted to validate the applicability of iVR process; it successfully exchanges required information between construction jobsite and office in a specific time. This system is expected to assist Engineers and workers in quality assessment, progress assessments, and decision-making which can realize a productive and practical communication platform, unlike conventional monitoring or data capturing, processing, and storage methods, which involve storage, compatibility, and time-consumption issues.

Purpose - The purpose of the study is to investigate the missing link between leadership style and job satisfaction among Mongolian public sector employees. This study reiterates the mediating role of organizational climate (OC) and work style (WS) in a new proposed model. Methodology - The questionnaire is designed by a synthesis of existing constructs in the current relevant literature. The research sample consisted of 143 officers who work in the primary and middle units of territory and administration of Mongolia. Factor analysis, reliability test, collinearity test, and correlation analyses confirm validity and reliability of the model. Multiple regression analysis, using Structural Equation Modeling (SEM), tests the hypotheses of the study. Practical implications - This study has several important implications for studies related to organizational behavior and job satisfaction. Furthermore, the implications of findings are beneficial to organizations aiming at improving policies and practices related to organizational behavior and human resource management. Regulators and supervisors of private or public organizations aiming to increase the level of their employees’ job satisfaction will also benefit from the findings. Therefore, this study’s new proposed model can be the basis of fundamental research to build a better human resource policy. Although leadership style is an influential factor for job satisfaction, this study identifies the mediating missing links between leadership style and employees’ job satisfaction. Findings: The findings of this research indicate that organizational climate and work style complement and fully mediate the relationship between leadership style and job satisfaction. Appropriate leadership style is most effective when it matches organizational climate as well as employees’ work style. Furthermore, suitable organizational climate will increases the level of job satisfaction. If work style of employees is respected and taken into consideration, leadership style can find its way into job satisfaction. Originality/value - This study is the first to understand the motivators of job satisfaction in government sector of Mongolia. This study suggests valuable findings for executive officers, junior and primary unit’s officers of register sector of government in Mongolia. The findings of this study help managers and executives in their effort to develop and implement successful human resource strategies.

Precision and accuracy estimation is an important index used to reflect the measurement performance and quality of a measurement system. To reveal the significance and connotations of the precision and accuracy estimation index of a close-range photogrammetry system, several common precision and accuracy estimation methods used in close-range photogrammetry are explained from a theoretical perspective, and the mechanism of the internal coincidence precision estimation and the external coincidence accuracy estimation are deduced, respectively. Through detailed experimental design and testing, the validity and reliability of the proposed precision and accuracy estimation methods are verified, which provides strong evidence for the quality control, optimisation, and evaluation of the measurement results from a close-range photogrammetry system. At the same time, it has significance for the further development of precision and accuracy estimation analysis of close-range photogrammetry systems.

The United Nations Convention on the Rights of Persons with Disabilities (hereafter CRPD) has provided a radical imperative for the reform of mental health and capacity legislation around the world. The interpretation of the CRPD has been controversial, ranging from complete abolition of detention, forcible treatment and substitute decision making, to acceptance that elements of these measures need to be retained but based on non-discriminatory criteria, additional safe-guards and a comprehensive shift towards supported decision-making. While the potential ef-fects of the CRPD on mental health social work and social work generally are considerable given their shared commitment towards social justice, to date there has been no review of research evi-dence exploring their relationship. In addressing this knowledge gap, this study held a prelimi-nary discussion with practitioners and academics at the European Association of Social Work Mental Health Special Interest Group in Amsterdam 2022, followed by a scoping literature re-view on the question: What impact, if any, has the CRPD had on social work practice? The review produced four main findings: impact on legislation; positive impact on practice; limited impact on practice; and impact on social work education and research. In sum, while there were some positive indications of social work and mental health social work practice being influenced by the CRPD, these were scant. Barriers to change included tendencies among some social workers to practise substitute decision-making, in part related to resourcing and policy contexts, and under-standings of disability aligned to individualised/medical rather than social perspectives. The results indicate that legal reform on its own is insufficient to impact social work practice, and that realising the potential of the CRPD will necessitate good quality training, as well as improv-ing social workers’ knowledge of the human rights of people with mental impairment.

Background: The chin tuck maneuver has been suggested to increase suprahyoid muscle activation, but a method to measure the strength of the chin tuck maneuver has not been established. We developed a method to measure the strength of the chin tuck maneuver (chin tuck strength) and examined the reliability and validity of chin tuck strength measurement in community-dwelling older adults. Subjects and Methods: The participants were 233 older adults aged ≥65 years without dysphagia or physical disability. Chin tuck strength was measured twice consecutively using the developed device, and reproducibility was analyzed using intraclass correlation coefficients (ICCs). In addition, maximum tongue pressure, oral diadochokinesis, grip strength, knee extension strength, and the timed up and go test (TUGT) were measured as indices of swallowing-related muscle function and appendicular muscle function. The associations of chin tuck strength with swallowing-related muscle function and appendicular muscle function were analyzed statistically. Results: The ICCs for chin tuck strength were 0.82 (95% confidence interval [CI]: 0.73-0.88) in males and 0.87 (95%CI: 0.70-0.93) in females. Chin tuck strength was significantly associated with maximum tongue pressure, grip strength, knee extension strength, and TUGT. Conclusions: This study suggests that chin tuck strength is a reliable and valid assessment of swallowing-related muscle strength.

This study assesses the impact of nurse-originated changes in central venous catheter (CVC) management on the incidence of central line-associated bloodstream infections (CLABSI) and catheter-related bloodstream infections (CRBSI). It is a single-center retrospective cohort study conducted at an urban, tertiary referral, and academic center serving pediatric patients. The study cohort comprised 236 patients and 323 CVCs seen between 2012 and 2022. CLABSI and CRBSI were defined according to the Centers for Disease Control and Prevention definitions. Oncology nurse leaders developed CVC-specific educational modules for CLABSI prevention. All relevant information during the CVC maintenance period was noted in the patient's CVC logbook. 24 (7%) cases of confirmed CLABSI were identified. The incidence of CVC-related infections was 0.32 cases per 1000 catheter days. The incidence decreased by 40% between the first and second three-year study period. Documented exit-site infection was reported in 32 (10%) cases. The correlation between exit-site infection and CLABSI was found in 9 (28%) cases. Our CVC-related infection rates are significantly lower than the incidence reported by the Italian Association of Pediatric Hematology and Oncology, which settles at 3-5 cases per 1000 catheter days. Our data confirm the effectiveness of local CVC management guidelines in preventing CVC-related infectious complications.

Backgorund and Objectives: In this study, we aimed to evaluate and compare the changes in visual and structural outcomes in patients with intravitreal aflibercept (IVA)-resistant neovascular age-related macular degeneration (nAMD) switched to either intravitreal brolucizumab (IVBr) or intravitreal faricimab (IVF) injections in a clinical setting. Materials and Methods: This obser-vational clinical study included 20 eyes of 20 patients switched to brolucizumab and 15 eyes of 14 patients switched to faricimab for aflibercept-resistant nAMD. We measured the structural outcome (central macular thickness (CMT)) and the visual outcome (best-corrected visual acuity (BCVA); logMAR) as follows: just before the most recent IVA injection (B0), one month after the most recent IVA injection (B1), just before the first IVBr or IVF injection (A0), one month after (A1) and three months after (A3) the first IVBr or IVF injection. Results: BCVA showed significant im-provement at A1 (0.25 ± 0.34) and at A3 (0.19 ± 0.24) compared to A0 (0.38 ± 0.35) in IVBr group (p = 0.0156, p = 0.0166, respectively). CMT (μm) was significantly thinner at A1 (IVBr; 240.55 ± 51.82, IVF; 234.91 ± 47.29) and at A3 (IVBr; 243.21 ± 76.15, IVF; 250.50 ± 72.61) compared to at A0 (IVBr; 303.55 ± 79.18, IVF; 270.33 ± 77.62) in IVBr group (A1; p = 0.0093, A3; p = 0.0026) and in IVF group (A1; p = 0.0161, A3; p = 0.0093). There was no significant difference in BCVA and CMT improvement observed between two groups at any time point (p > 0.05 for all). Conclusion: Switching from aflibercept to either brolucizumab or faricimab has a significant anatomical ef-fect on eyes with aflibercept-resistant nAMD and both treatments appear to be effective short-term treatment options. There is a trend towards greater visual improvements and reductions in CMT with brolucizumab.

Depression is diagnosed when a specific set of symptoms appear over a defined period with a certain intensity. According to the DSM-5, Major Depressive Disorder (MDD) is diagnosed when five or more symptoms are present over a two-week period. Depression, a debilitating mental health disorder affecting millions worldwide, poses a complex challenge for researchers and clinicians. In children and adolescents, depression can result in negative outcomes such as substance abuse, academic problems, risky sexual behavior, physical health issues, impaired social relationships, and a thirty-fold increased risk of suicide. This paper presents the findings of a study that evaluated the effectiveness of Cognitive Behavioral Therapy (CBT) alone and CBT combined with selective ser-otonin reuptake inhibitors (SSRIs) in a remediation program. The study included 16 children and adolescents with depression (8 males and 8 females) and 16 typically developing peers (8 males and 8 females) aged 9 to 15 years (M = 11.94, SD = 2.02). Baseline evaluations using Event-Related Po-tentials (ERPs), the Children Depression Inventory (CDI), and reaction time tests showed that participants with depression had cognitive deficits in attention and memory, indicated by longer P300 latencies. After undergoing remediation with either CBT alone or CBT combined with med-ication, the children and adolescents with depression exhibited lower CDI scores and shorter P300 latencies and reaction times compared to before remediation and relative to the control group.

This study explores the multifaceted influence of litter size, maternal care, exercise, and aging on rats' neurobehavioral plasticity and dentate gyrus microglia dynamics. Body weight evolution revealed a progressive increase until maturity, followed by a decline during aging, with larger litters exhibiting lower weights initially. Notably, exercised rats from smaller litters displayed higher body weights during mature and aged stages. Dentate gyrus volumes showed no significant differences among groups, except for aged sedentary rats from smaller litters, which exhibited a reduction. Maternal care varied significantly based on litter size, with large litter dams showing lower frequencies of caregiving behaviors. Behavioral assays highlighted the detrimental impact of a sedentary lifestyle and reduced maternal care/large litters on spatial memory, mitigated by exercise in aged rats from smaller litters. Microglial dynamics in the layers of dentate gyrus revealed age-related changes modulated by litter size and exercise. Exercise interventions mitigated microgliosis associated with aging, particularly in aged rats. These findings underscore the complex interplay between early-life experiences, exercise, microglial dynamics, and neurobehavioral outcomes during aging.

Until recently, no disease-specific health-related quality of life (HRQoL) instrument existed for pediatric traumatic brain injury (TBI). In this revalidation study, the psychometric properties and the validity of the final German version of the 35-item QOLIBRI-KID/ADO questionnaire were examined in 300 children and adolescents. It is the first self-reported TBI-specific instrument for measuring pediatric HRQoL in individuals aged 8–17 years. The six-factor model fits the data adequately. Internal consistencies were excellent for the total score and satisfactory to excellent for the scale scores. Intraclass correlations indicated good test-retest reliability. Construct validity was supported by overlaps between the QOLBRI-KID/ADO and the PedsQL, which measures generic HRQoL. Discriminant validity indicated that HRQoL was significantly lower in older children and girls, and in those with anxiety, depression, and post-concussion symptoms than in comparison groups, replicating the results of the questionnaire’s first development study. Our results suggest that the QOLIBRI-KID/ADO is a valid and reliable multidimensional instrument for assessing disease-specific HRQoL after pediatric TBI in clinical and research settings, which can additionally be used across the lifespan in combination with the adult version. This may help to improve care, treatment, daily functioning and HRQoL after TBI.

Chemo-resistance is a substantial challenge in the realm of cancer treatment that requires exploring new therapeutic approaches for effective mitigation. Achieving this goal requires examination of the molecular mechanisms involved in both tumor growth and therapeutic interventions. The potential of NRF2 (Nuclear factor E2-related factor 2) in addressing resistance to chemotherapy across diverse cancer types highlights its value as a promising therapeutic approach based on cancer characteristics. Manipulating the NRF2 signaling pathway has a dual impact, offering promise for both preventing and treating cancer, as well as inhibiting carcinogenesis. The influence of the NRF2/KEAP1 pathway on the progression of tumor formation and resistance to drugs has been well-documented. The interplay between the NRF2 signaling pathway and processes such as endoplasmic reticulum (ER) stress, unfolded protein response (UPR), and autophagy plays a crucial protective role. A deeper understanding of NRF2's role in the modulating these pathways is necessary to develop novel approaches for improving chemotherapeutic efficacy. This article discusses the significance of the NRF2-KEAP1 pathway in preventing/promoting cancer and resistance mechanisms to various chemotherapeutic agents, with a focus on the complementary effects of antioxidants via NRF2-mediated signaling pathways. This study aims to provide a molecular basis for targeting NRF2 via inhibitors/activators as promising therapeutic strategies to overcome chemo-resistance.

We compared the functional and morphologic effects in the loading dose between patients with treatment-naïve neovascular age-related macular degeneration treated with either intravitreal aflibercept (IVA) or intravitreal faricimab (IVF) injection in clinical settings. This retrospective study included 30 eyes from 28 patients who started IVA treatment between June and September 2022 and 30 eyes from 29 patients who started IVF treatment between October 2022 and March 2023. The mean best corrected visual acuity (BCVA) significantly improved from pre-treatment after loading dose in the IVA group (from 0.46 ± 0.46 to 0.36 ± 0.37, p=0.0047) and not in the IVF group (from 0.46 ± 0.41 to 0.44 ± 0.45, p=0.60). The mean central retinal thickness (CRT) significantly improved in both groups. The proportion of eyes with residual exudative change was greater in the IVF group than in the IVA group at 2 months after the first treatment. (p=0.026) We further analyzed the patients who obtained complete resolution of exudative changes after the loading dose. The IVA group had a significant improvement in BCVA, whereas the IVF group did not p=0.0047 and 0.20, respectively) Although IVA and IVF significantly improved the CRT, the BCVA improved significantly in IVA group and not in IVF group.

Frontotemporal lobar degeneration (FTLD) belongs to a heterogeneous group of highly complex neurodegenerative diseases and represents the second cause of presenile dementia in individuals under 65. Frontotemporal-TDP is a subgroup of frontotemporal dementia characterized by the aggregation of abnormal protein deposits, predominantly transactive response DNA-binding protein 43 (TDP-43), in the frontal and temporal brain regions. These deposits lead to progressive degeneration of neurons resulting in cognitive and behavioral impairments. Limbic age-related encephalopathy (LATE) pertains to age-related cognitive decline primarily affecting the limbic system which is crucial for memory, emotions, and learning. Though distinct, emerging research suggests a potential overlap in pathogenic processes, with some cases of limbic encephalopathy displaying TDP-43 pathology. Genetic factors play a pivotal role in both disorders. Mutations in various genes, such as progranulin (GRN) and chromosome 9 open reading frame 72 (C9orf72), have been identified as causative in frontotemporal-TDP. Similarly, specific genetic variants have been associated with an increased risk of developing LATE. Understanding these genetic links provides crucial insights into disease mechanisms and the potential for targeted therapies.

The health of inmates living in a restricted environment are affected by oral health behaviours and is related to their oral health-related quality of life (OHRQoL). We investigated oral health behaviours and oral symptoms among male inmates and analysed factors related to OHRQoL. Three hundred and seventy-six male inmates in two prisons were investigated using a self-reported questionnaire. The survey items included oral health behaviours, oral symptoms, self-esteem, and OHRQoL level. We analysed cross-correlations and factors related to OHRQoL. Toothbrushing after lunch and dinner was practiced by 83.5% of male inmates. ‘Food impaction’ was experienced by 45.4%. The OHRQoL level among male inmates was low, at 39.90 points. A hierarchical multiple regression model that controlled for general characteristics identified the following OHRQoL factors, in order of significance: trouble biting/chewing (β = -0.307), toothache (β = -0.154), temporomandibular joint disorder (β = -0.099), and periodontal health (β = 0.089). Self-esteem and OHRQoL were not significantly correlated. To ensure oral health in male inmates, the results of this study suggests that an oral health education programme, as well as provision of adequate dental care services, is required to increase appropriate oral health practice rates.

Background: Increasing number of long-term gastrointestinal (GI) cancer survivors highlights the importance of understanding factors that contribute to their health-related quality of life (HRQoL). We investigated the risk factors of HRQoL, in-cluding demographics, clinical characteristics, and social and behavioral determinants of health (SBDH). Methods: Adult GI cancer survivors (n = 3,201) in the BRFSS surveys from 2014-2021 (except for 2015) were analyzed. Unadjusted/adjusted logistic regression was used. Results: The majority were female (54%) and White (78%), with a median age of 67. Survivors who were 65 years or older, diagnosed with colorectal cancer, or who had fewer comorbidities were more likely to report significantly better HRQoL. Significant social factors of poor HRQoL were being unmarried, racial and ethnic minorities, low socioeconomic status, and poor health care access. Significant behavioral factors of poor HRQoL were lack of physical activity, heavy alcohol consumption, and current smoking, with lack of physical activity being the most significant factor. Conclusions: The SBDH have a critical role in HRQoL. Future studies are warranted to develop a tailored survivorship intervention, such as physical rehabilitation and to ex-plore machine learning/artificial intelligence predictive models to identify cancer sur-vivors at a high risk of developing poor HRQoL.

Polycystic ovary syndrome (PCOS) usually comes along with metabolic disturbances attributed to androgen excess and obesity, but the contribution of each has not been defined, and the occurrence of metabolic disturbances is frequently not investigated. We evaluated 99 PCOS and 41 non-PCOS women. Clinical biomarkers of glucose-, liver-, and endothelial-related metabolic alterations were measured; participants were categorized into four groups according with obesity (OB) and hyperandrogenemia (HA) statuses: Healthy (no-HA, lean), HA (HA, lean), OB (no-HA, OB), and HAOB (HA, OB). Metabolic disturbances were highly frequent in PCOS women (70%). BMI correlated with all biomarkers, while free testosterone (FT) only with glucose- and hepatic-related indicators. Despite insulin sensitivity and liver enzymes were associated with FT, women with obesity exhibited lower M [coeff = 8.56 – 0.080(FT) –3.71(Ob); p &lt;0.001)] and higher aspartate aminotransferase (coeff = 26.27 + 0.532(FT) + 8.08(Ob); p = 0.015)] than lean at the same level of FT. Women with obesity exhibited greater risk of metabolic disorders than lean, independently of hyperandrogenemia. Clinicians are compelled to search for metabolic alterations in PCOS women; obesity must be handled in all cases, but hyperandrogenemia needs to be managed also in those with glucose- or liver-related disturbances.

(1) Background: This article reviews the available scientific literature on drug-related problems and negative outcomes associated with medications identified by medication review with follow-up for end-stage renal disease and discussed with the physicians; (2) Methods: A systematic review was conducted of the scientific literature retrieved from the following databases: MEDLINE (via PubMed), Web of Science, SCOPUS, Cochrane Library: The Cochrane Central Register and Control Trials (CENTRAL) and Literatura Latinoamericana y del Caribe (LILACS), Medicina en Español (MEDES), and the SciELO bibliographic database (collection of scientific journals). The following terms were used as descriptors and searched in free text: "end-stage renal disease", "medication review", and "drug-related problems” and “negative outcomes associated with medication". The following limits were applied: "humans" and "adults (more than 18 years)”; (3) Results: A total of 59 references were recovered and after applying inclusion/exclusion criteria, 16 articles were selected. Of these selected articles, 15 provided information on drug-related problems and only 1 on negative outcomes associated with medications; (4) Conclusions: It can be concluded that drug-related problems and negative outcomes associated with medication affect patients with end-stage renal disease, mainly those receiving renal replacement therapy. More evidence is needed, especially on negative outcomes associated with medication.

Background: According to metacognitive theory, Cognitive–Attentional Syndrome (CAS) is a transdiagnostic factor and main mechanism of psychopathology maintenance. The main goal of this study was to examine whether CAS predicted symptoms of stress and trauma-related symptomatology in the first months of the COVID-19 pandemic and three months later. Methods: Initially 1,792 participants were recruited online via social media; data was collected at two time points. Measures included the Cognitive–Attentional Syndrome Questionnaire, Adjustment Disorder – New Module 20, the International Trauma Questionnaire, and additional measures. Results: Structural equation modeling was conducted in order to determine relations between reported stressors, CAS, and symptomatology. At both time points, CAS was a significant mediator between stressors and symptoms of adjustment disorder. Despite the decrease in the intensity of adjustment disorder symptoms between waves, it was a significant predictor of other psychopathology at both time points, except for traumatic stress. Conclusions: The findings confirm the assumption that CAS is a transdiagnostic factor of psychopathology, and has a mediating role in the relationship between stressors and adjustment disorder and co-occurring symptomatology. The effect was particularly significant in the initial phase of the pandemic, which was highly stressful for many people.

Neovascular age-related macular degeneration (nAMD) leads to visual impairment if not treated timely. Intravitreal anti-VEGF drugs have revolutionized nAMD treatment in two decades. We evaluated visual outcomes of anti-VEGF treatment in nAMD. A real-life population-based cohort study. Data included parameters for age, sex, age at the diagnosis, laterality, chronicity, symptoms, visual outcomes, lens status, and history of intravitreal injections. A total of 1088 eyes (827 patients) with nAMD were included. Visual acuity was stable or improved in 984 eyes (90%) after an average 36±25 months follow-up. Bevacitzumab was the first-line drug in 1083 (99.5%) eyes. Vision improved ≥15 ETDRS letters in 377 (35%), > 5 ETDRS letters in 309 (28%) and was stable (±5 ETDRS letters) in 298 (27%) eyes after anti-VEGF treatment. The loss of 5-<15 ETDRS letters in 44 (4%) and ≥15 ETDRS letters in 60 (6%) eyes was noted. At the diagnosis of nAMD, 110 out of 827 patients (13%) fulfilled the criteria of visual impairment, whereas 179 patients (22%) were visually impaired after the follow-up. Improvement or stabilization in vision was noted in 90% of the anti-VEGF-treated eyes with nAMD. In addition, anti-VEGF agents are crucial in diminishing nAMD-related visual impairment.

Forestry workers play a crucial role in implementing forest management programs, but their outdoor work exposes them to rising temperatures caused by global climate change, which poses potential health risks related to heat. This study focuses on Indonesian forestry workers and examines the relationship between their knowledge of heat-related issues, risk perception, and precautionary behavior in dealing with increasing workplace heat exposure. Developing effective precautionary behavior is essential for preventing heat-related health disorders and promoting health protection programs. To facilitate a comprehensive comparison of the three variables, interviews were conducted with two groups of outdoor workers, comprising 210 forestry workers and 215 paddy farmers. The findings indicate that increasing knowledge about heat-related issues promotes precautionary behavior, and risk perception acts as a mediator between knowledge and behavior. Additionally, the study highlights that the emotion of "dread" intensifies perceived risk and predicts positive behavior change. To enhance heat-related knowledge, exploring the potential use of a "fear" tone is important. In conclusion, comprehensive strategies need to be implemented to promote precautionary behavior among vulnerable forestry workers, particularly manual laborers.

Cause-Related Marketing (CRM) has emerged as a new concept that links CSR activities to marketing, enabling corporations to pursue both building company-consumer partnership and gaining sustainable mutual benefits that are elicited from the partnership. Among various cause-related marketing activities, on-line cause-related advertising is the most commonly used one. The purpose of this study is to examine the effects of on-line cause-related advertising and moderating role of ethical consumption propensity. In particular, this study intends to contribute to successful development of on-line cause-related advertising strategy by focusing on the relationship between the four factors: customers' perception of on-line cause-related advertising, brand-consumer relationship, brand attachment and loyalty. The results of this study are as follows: First, customers' perception of on-line cause-related advertising was related positively to consumer-brand- relationship. Second, brand-consumer relationship was related positively to brand attachment and customer loyalty. Third, brand attachment was related positively to customer loyalty. Furthermore, from the consumer’s psychological viewpoint, ethical consumption propensity had a significant moderating effect to between customers' perception of cause-related advertising and brand-consumer relationship as well as brand attachment. The results of this study may contribute to the existing literature as an new empirical attempt to examine the effect of the on-line cause-related advertising.

TomoBreast hypothesized that hypofractionated 15 fractions/3 weeks image-guided radiation therapy (H-IGRT) can reduce lung-heart toxicity, as compared with normofractionated 25-33 fractions/5-7 weeks conventional radiation therapy (CRT). 123 women with stage I-II operated breast cancer were randomized to receive CRT (N=64) or H-IGRT (N=59). The primary endpoint used a four-items measure of the time to 10% alteration in any of patient self-reported measure, physician clinical evaluation, echocardiography or lung function tests, analyzed by intention-to-treat without exclusion. Results found comparable survivals, but H-IGRT significantly reduced the toxicity measured by lung diffusion capacity and alveolar volume as compared with CRT, G1 in 53% (31/59) versus 72% (44/61) patients, P=0.006; G2, 29% versus 48%, P=0.020. H-IGRT significantly reduced the risk of composite cardio-pulmonary alteration at 5 years, 10.2% versus 26.7%, P=0.024. In conclusion, TomoBreast is a proof-of-concept that image-guided radiation-therapy can improve the overall balance of lung-heart outcomes in breast cancer adjuvant therapy. Furthermore, the significance of the findings supports the efficacy of a small trial size design, which can be critical when clinical research resources are limited.