Oral cancer represents a significant global public health challenge, contributing substantially to cancer incidence and mortality. Despite established risk factors such as tobacco use and alcohol consumption, early detection remains crucial for effective treatment. This study introduces a novel approach using a transistor-based biosensor system for detecting the P90 (CIP2A) protein. We have tested the presence of CIP2A in human leukoplakia samples that can rise into oral squamous cell carcinoma. The method employs commercially available glucose test strips functionalized with P90 antibodies, providing high sensitivity and a low limit of detection, which is five orders lower than commercial ELISA kits. A specially designed printed circuit board (PCB) facilitates accurate measurements, and the device's performance is optimized through characteristic tests. Human sample testing validates the biosensor's effectiveness in distinguishing samples after cell lysis. This study contributes to advancing accurate and cost-effective diagnostic approaches for oral pre-cancer and cancer tissues.

Wilms tumor (WT), the most prevalent type of renal cancer in children, exhibits overall survival rates exceeding 90%. However, chemotherapy resistance, which occurs in approximately 10% of WT cases, is a major challenge for the treatment of WT, particularly for advanced-stage patients. In this study, we aimed to discover potential mutation markers and drug targets associated with chemotherapy resistance in advanced stage WT. We performed exome sequencing to detect somatic mutations and molecular targets in 43 WT samples, comprising 26 advanced stage WTs, of which 7 cases are chemotherapy-resistant. Our analysis revealed four genes (ALPK2, C16orf96, PRKDC, and SVIL) that correlated with chemotherapy resistance and reduced disease-free survival in ad-vanced-stage WT. Additionally, we identified driver mutations in 55 genes within the chemo-therapy-resistant group, including 14 druggable cancer driver genes. Based on the mutation profile of the resistant WT samples, we propose potential therapeutic strategies involving platinum-based agents, PARP inhibitors, and antibiotic/antineoplastic agents. Our findings provide insights into the genetic landscape of WT and offer potential avenues for targeted treatment, particularly for patients with chemotherapy resistance.

(1) Background: Breast cancer is the leading malignancy worldwide and in Ghana it has a poor overall survival. However, approximately 50% of cases are early stage disease and with advances in breast cancer treatment and improvement in survival, quality of life (QOL) becomes as im-portant as treatment of the disease. (2) Methodology: This was a cross-sectional study of survivors who had breast conserving surgery (BCS), mastectomy only (M) and mastectomy with breast re-construction (BRS) from 2016 to 2020 at a tertiary hospital in Ghana, comparatively assessing their QOL using EORTC QLQ C-30 and EORTC QLQ BR-23. (3) Results: The study participants had an overall Global Health Status (GHS) median score of 83.3 [IQR: 66.7-91.7] with no significant differences between the surgery types. The BRS group had a statistically significant lower median scores for the Functional scale (82.8 and 51.0) and the highest scores for the Symptomatic scale (15.7 and 16.5). Body image was significantly lowest for the BRS group 83.3 [68.8-91.7] and highest 100 [91.7-100] for the BCS group (p < 0.001). (4) Conclusion: There is a need to develop support systems tailored at improving the QOL of breast cancer survivors taking into consideration the type of surgery performed.

Results from the phase III Keynote-024 clinical trial have established Pembrolizumab monotherapy as the first-line standard of care for patients with metastatic NSCLC who have PD-L1 expression ≥ 50%, EGFR and ALK wild-type. However, given the differences between patients treated in routine clinical practice and within a clinical trial, real-world data are needed to confirm the treatment benefit in standard practice. Given the lack of data on large cohorts of patients with long follow-up, we designed a retrospective observational study of patients with NSCLC who were treated with Pembrolizumab, starting from its reimbursement eligibility until December 2020. The primary endpoints were to assess PFS and OS using the Kaplan-Meier method, treatment response and safety. We followed 880 patients (median follow-up: 35.1 months) until February 2022. Median PFS and OS were 8.6 months (95% CI: 7.6-10.0) and 25.5 months (95% CI: 21.8-31.6), respectively. We also found that ECOG PS, PD-L1 expression and smoking habit were prognostic factors for PFS, while age, sex, ECOG PS, smoking habit and histology had an impact on OS. Multivariable analysis confirms prognostic role of PD-L1 for PFS and ECOG for both PFS and OS. 39.9% of patients reported an adverse event, but only 6.3% of patients discontinued therapy due to toxicity. Our results suggest a long-term benefit of Pembrolizumab in the first-line setting as well as a safety profile consistent with the results of Keynote-042. Many collected variables appear to influence clinical outcome, but results from these exploratory unadjusted analyses should be interpreted with caution.

In breast cancer, epithelial-mesenchymal transition (EMT) is positively associated with programmed death ligand 1 (PD-L1) expression and immune escape, and TWIST1 induces EMT and cancer metastasis. However, how TWIST1 regulates PD-L1 and immune evasion is unknown. This study analyzed TWIST1 and PD-L1 expression in breast cancers, investigated the mechanism for TWIST1 to regulate PD-L1 transcription, and assessed the effects of TWIST1 and PD-L1 in cancer cells on the cytotoxicity of CD8+ effector T cells. Interestingly, TWIST1 expression is associated with high-level PD-L1 in triple negative breast cancers (TNBCs). Overexpression and knockdown of TWIST1 robustly upregulates and downregulate PD-L1 expression, respectively. TWIST1 binds to the PD-L1 promoter and recruits the TIP60 acetyltransferase complex in a BRD8-dependent manner to promote PD-L1 expression, which drives immune escape of breast cancer cells by accelerating the exhaustion of CD8+ T cells. Accordingly, knockdown of TWIST1 or BRD8 or blockade of PD-L1 with a PD-L1 antibody significantly enhances CD8+ T cells to inhibit breast cancer cell growth. These results demonstrate that TWIST1 directly induces PD-L1 expression in breast cancer cells to drive immune evasion. Targeting TWIST1, BRD8 or PD-L1 in TNBC should facilitate CD8+ T cell-mediated immune therapy. TWIST1 may also serve as a biomarker for anti-PD-L1 immunotherapy.

We have been encouraging practicing gynecologists to adopt molecular diagnostics tests, PCR, and cancer biomarkers, as an alternative enabled by these platforms to traditional Papanicolaou and colposcopy tests, respectively. An aliquot of liquid-based cytology was used for the molecular test [high-risk HPV types, (HR HPV)], another for the PAP test and still one more for the p16/Ki67 dual stain cytology. A total of 4,499 laboratory samples were evaluated, and we found that 25.1% of low-grade samples and 47.9% of high-grade samples after PAP testing had a negative HR HPV-PCR result. In those cases, reported as Pap-negative, 22.1% got a positive HR HPV-PCR result. Dual staining with the p16/Ki67 biomarkers in samples was positive for HR HPV, and 31.7% were also positive for these markers. Of the PCR results positive for any of these high-risk HPV subtypes, n 68.3% we did not to find evidence for the presence of cancerous cells, highlighting the importance of performing dual staining with p16/Ki67 after PCR, to avoid unnecessary colposcopies. Encountered challenges are a deep-rooted social reluctance in Mexico to abandon traditional Pap smears and the opinion of many specialists, we still believe that colposcopy continues to be a preferred procedure over dual staining protocol.

Background Homologous recombination deficiency (HRD) evolved into a major diagnostic marker in high grade ovarian cancer (HGOC) predicting the response to poly (Adenosine diphosphate-ribose) polymerase inhibitors (PARPi) and also platinum-based therapy. In addition to HRD, the type of peritoneal tumor spread influences treatment response and patient survival; miliary type tumor spread has poorer predicted outcome than non-miliary type tumor spread. Methods Known methods for HRD assessment were adapted for our technical requirements and the Predictive-value Integrated Genomic Instability Score (PIGIS) for HRD assessment evolved as an outcome. PIGIS was validated in HGOC samples from 122 patients. We used PIGIS to analyze whether the type of tumor spread correlated with HRD status and whether this had an impact on survival. Results We demonstrated that PIGIS can discriminate HRD positive from HRD negative samples. Tumors with miliary tumor spread are HRD negative and have a very bad prognosis with a progression free survival (PFS) of 15.6 months and an overall survival (OS) of 3.9 years. However, HRD negative non-miliary spreading tumors in our cohort had a much better prognosis (PFS 35.4 months, OS 8.9 years), similar to HRD positive tumors (PFS 34.7 months, OS 8.9 years). Conclusions Our results indicate that in a predominantly PARPi naïve cohort the type of tumor spread might be a better predictor of response to platinum sensitivity than HRD. It remains to be determined, whether this also applies for sensitivity to PARPi.

Lung cancer is the leading cause of cancer death worldwide therefore studies about the etiological factors and carcinogenesis are important.The aim of the study is to detect the presence and types of Human papilloma virus (HPV) in lung cancer and non-tumoral lung and Epidermal Growth Factor Receptor (EGFR) mutation prevalance in lung cancer with Polymerase Chain Reaction (PCR) method.Fifty patients who were histopathologically diagnosed lung cancer and 7 patients with non-neoplastic lung disease were enrolled in the study. HPV positivity was detected in 75.4% of the patients. The rate of high-risk HPV positivity was 100% in adenocarcinomas, 64.5% in squamous cell carcinomas, and 57% in non-neoplastic lung. HPV 51 was the most frequent type followed by HPV 16 (43.9%). There was no statistically significant relationship between HPV infection and age, gender and smoking history and EGFR mutation. The prevalence of HPV positivity is variable in lung cancer in different studies and this may be due to many factors including HPV detection methods, number of patients, geographic regions. New studies about the role of HPV infection need to be performed in order to obtain information about the use of prophylactic and theurepatic agents in lung cancer.

Alteration in heparan sulfate (HS) biosynthesis has been described to impact a range of pivotal processes involved in cancer progression. HS 3-O-sulfotransferase 3B1 (HS3ST3B1) catalyzes the reaction of 3-O-sulfation within HS chains. Over the past few years, a growing number of studies has reported a tumor-promoting effect of this HS-modifying enzyme in various cancers. Consistent with these studies, we previously reported that HS3ST3B1 overexpression increased survival and resistance to apoptosis in MDA-MB-231 breast cancer (BrCa) cells. In the present study, we further investigated the biological and clinical significance of HS3ST3B1 expression in BrCa. Interrogation of public databases revealed that high expression levels of HS3STB1 are associated with invasive and mesenchymal-like phenotype in BrCa cells and predict poor clinical outcome in BrCA patients with chemotherapy. In vitro, HS3ST3B1 overexpression increased the invasive properties of MDA-MB-231 cells and enhanced chemo-resistance to conventional anticancer drugs. Mechanistically, we found that the advantage given by HS3ST3B1 was linked to the expression and activation of PDGF-Rβ. Silencing the expression of this receptor reversed the effects driven by HS3ST3B1 overexpression. Altogether, our results suggest that HS3ST3B1 may play an important role in the progression of aggressive BrCa and offer a potentially druggable target for therapeutic application.

DNA Topoisomerase IIa (Top2A) is a nuclear enzyme that is a cancer drug target, and there is interest in identifying novel sites on the enzyme to inhibit cancer cells more selectively and to reduce off-target toxicity. The C-terminal domain (CTD) is one potential target, but it is an intrinsically disordered domain, which prevents structural analysis. Therefore, we set out to analyze the sequence of Top2A from 105 species using bioinformatic analysis including the PSICalc algorithm, entropy analysis, and other approaches. Our results demonstrate that large (10th-order) interdependent clusters are found including non-proximal positions across the major domains of Top2A. Further, CTD-specific clusters of 3rd, 4th, and 5th-order were identified that included positions that had been previously analyzed via mutation and biochemical assays. Some of these clusters coincided with positions that when mutated either increased or decreased relaxation activity. Finally, sites of low entropy (i.e., high information content) were identified and mapped as key positions in the CTD. Included in the low entropy sites are phosphorylation sites and charged positions. Together, these results help to build a clearer picture of the critical positions in the CTD and provide potential sites/regions for further analysis.

Background: Penile squamous cell carcinoma (PSCC) is classified into two prognostically distinct types: human papillomavirus (HPV)-associated and HPV-independent. Conversely, the impact of p53 status on prognosis remains controversial. We correlated HPV and p53 status with prognosis in a large series of PSCC patients. p53 was analysed according to a recently described immunohistochemical (IHC) pattern-based framework that includes two normal (scattered, mid-epithelial) and four abnormal patterns (diffuse, basal overexpression, cytoplasmic and null) and closely correlates with TP53 mutational status. Methods: A total of 122 patients with surgically treated PSCC in three hospitals in Barcelona, Spain, were included. Based on HPV in situ hybridization and p16 and p53 IHC expression, the tumors were classified into three molecular types: HPV-associated, HPV-independent/p53 normal, and HPV-independent/p53 abnormal. All patients were followed for at least 22 months (median 56.9 months), and disease-specific survival (DSS) was analysed. Results: Thirty-six tumors (29%) were HPV-associated, 35 (29%) were HPV-independent/p53 normal, and 51 (42%) were HPV-independent/p53 abnormal. Disease-related deaths were observed in 3/36 (8%), 0/35 (0%) and 14/51 (27%) of the patients, respectively (p&lt;0.001). A total of 7/14 deaths in the latter group were patients with tumors showing p53 patterns not recognized in the classical p53 IHC interpretation (basal, null, cytoplasmic). According to our multivariate analysis, HPV-independent/p53 abnormal tumors and advanced stage were associated with impaired DSS (hazard ratio=23.4, 95% confidence interval [CI]= 2.7-3095.3; p=0.001 and 16.3, 95% CI=1.8-2151.5; p=0.008, respectively). CONCLUSION: Compared with patients with HPV-associated and HPV-independent/p53-normal PSCC, patients with HPV-independent/p53 abnormal PSCC have worse clinical outcomes. p53 IHC results define two prognostic categories in HPV-independent PSCC: HPV-independent/p53-normal tumors as low-risk tumors, whereas HPV-independent/p53-abnormal tumors as aggressive neoplasms.

The application of artificial intelligence to point-of-care testing (POCT) disease detection has become a hot research field, in which breath detection which detects the patient's exhaled VOCs combined with sensor arrays of Convolutional Neural Network (CNN) algorithms as a new lung cancer detection is attracting more researchers' attention. However, due to low accuracy, high complexity computation and large number of parameters make the CNN algorithms difficult transplant to the embedded system of POCT devices. A lightweight neural network (LTNet) in this work is proposed to deal with this problem, and meanwhile, achieve high-precision classification of acetone and ethanol gases, which are respiratory markers for lung cancer patients. Compared to currently popular lightweight CNN models such as EfficientNet, LTNet has fewer parameters (32K) and its training weight size is only 0.155 MB. LTNet achieved an overall classification accuracy of 99.06% and 99.14% in the own mixed gas dataset and the University of California (UCI) dataset, which are both higher than that of the five existing models’, and it also offers the shortest training (844.38s and 584.67s) and inference time (23s and 14s) in the same validation set. Compared to the existing CNN models, LTNet is more suitable for resource-limited POCT devices.

Research indicates that painful experiences can significantly affect the fear of cancer recurrence among cancer survivors, which is a distressing concern that influences both physiological and psychological recovery. Yet, the role of potential factors and mechanisms in these relationships is not fully known. This cross-sectional study aimed to advance our comprehension of the associa-tions between total pain and the fear of recurrence in post-treatment cancer patients by examining two potential mediators: psychological flexibility and mentalization. Three hundred and thirty-five participants (aged 22 to 88, 49.1% female) who had finished their cancer treatment completed self-report assessments of total pain, fear of recurrence, psychological flexibility, and mentalization. The serial mediation analysis showed that all dimensions of total pain were positively related to the fear of recurrence indirectly through psychological flexibility and mentalization, in serial. Additionally, gender moderated these serial mediational effects. In line with the psychological flexibility model, personal capacities to face difficult internal/external problems and interpret one’s behaviour in motivational terms can counterbalance patients’ negative emotions and feelings related to the illness.

Cancer diagnosis stands at the cusp of a profound transformation, driven by the burgeoning capabilities of Artificial Intelligence (AI) and Machine Learning (ML). This comprehensive review illuminates the extraordinary impact of AI and ML in the field, unraveling their multifaceted roles in the realm of oncology. In the arena of cancer diagnosis, AI and ML serve as invaluable allies, empowering healthcare professionals with unparalleled tools for precision and efficiency. Notably, AI's prowess in analyzing medical images, including radiological scans and pathology slides, elevates the early detection of malignancies to new heights. Coupled with its ability to dissect genomic data, AI tailors therapeutic strategies to the individual, promising optimized treatment outcomes. However, the incorporation of AI and ML into clinical practice necessitates a careful navigation of ethical considerations, data privacy, and regulatory landscapes. Safeguarding patient data, ensuring transparency, and addressing algorithmic biases emerge as pivotal challenges that require vigilant attention. Yet, the future of AI and ML in cancer diagnosis is brimming with promise. The integration of multi-modal data, real-time monitoring, and Explainable AI (XAI) methods holds the potential to enrich diagnostic capabilities and engender patient trust. Global collaboration and data sharing initiatives are fostering the development of robust AI models. Furthermore, AI's role in cancer prevention, identifying high-risk individuals and enabling targeted preventive strategies, is poised to revolutionize healthcare. AI and ML are forging a path toward an era of unparalleled accuracy, efficiency, and personalization in cancer diagnosis. Challenges notwithstanding, these technologies bear the promise of fundamentally reshaping patient care, elevating outcomes, and advancing the fight against cancer. The ongoing exploration and responsible implementation of AI and ML in oncology will be pivotal in harnessing their full potential and paving the way for a brighter future for cancer patients.

Background: Cell proliferation and the cell cycle are fundamental to tumor development, with mitosis playing a crucial role in cell division. Understanding the complexities of the cell cycle and mitosis is critical for cancer research, especially in the context of developing therapeutic strategies. Objective: This review highlights mitotic poisons as potential anti-cancer pharmacotherapeutics, particularly their structural and functional group diversity presenting opportunity for semi-synthesis of new derivatives with multi-target mechanisms relevant for cancer pharmacotherapeutics. Also, the review explores naturally occurring mitotic poisons and inhibitors of microtubule-dependent molecular motors as promising cancer pharmacotherapeutics. Methods: A comprehensive review of literature from 2004 to 2023 was conducted, covering studies on cell proliferation, mechanism of cell cycle regulation, mitosis, cytokinesis, and anti-cancer drug development. The published literature was collected primarily from PubMed, Scopus, Medline, Web of Science Core Collections, Google Scholar and other relevant scientific databases using keywords including but not limited to mitotic poisons and cancer, sources of mitotic poisons, mechanism of mitotic poisons, targets of mitotic poisons and structural diversity of mitotic poisons. The efficacy and limitations of various mitotic poisons and their impact on different cancer types were examined. Recent advancements in targeted therapeutic interventions for various cancers were also explored. Results: The effectiveness and limitations of mitotic poisons, including Taxanes, Epothilones, Colchicine, Vinca alkaloids, Berberine, Laulimalide, and Pseudolaric acid B, were highlighted. Drugs targeting mitotic kinases such as CDKs, Aurora kinases, PLK1, and WEE1 inhibitors were reported. Inhibiting kinesin motor proteins such as Eg5 and KIF15 to interfere with spindle formation and cell division were discussed, along with specific genomic alterations in KIF genes and the discovery of KIFC1 as potential for future research and drug development. Conclusion: Targeting microtubules and mitotic kinases, along with inhibiting kinesin motor proteins, show promise for cancer pharmacotherapeutics. The combination of targeted therapies, patient stratification based on biomarkers (such as low alpha-1 acid glycoprotein and high p63 expression), and exploration of alternative natural sources of mitotic poisons and analogues can significantly advance cancer pharmacotherapy to improve patient outcomes.

Focused microwave breast hyperthermia (FMBH) employs a phased antenna array to perform beamforming that can focus microwave energy at targeted breast tumors. Selective heating of the tumor endows the hyperthermia treatment with high accuracy and low side effects. The effect of FMBH is highly dependent on the applied phased antenna array. This work investigates the effect of polarizations of antenna elements on the microwave focusing results by simulations. We explore two kinds of antenna arrays with the same number of elements using different digital realistic human breast phantoms. The first array has all the elements’ polarization in the vertical plane of the breast while the second array has half elements’ polarization in the vertical plane and the other half in the transverse plane, i.e., cross polarization. In total 96 sets of different simulations are performed, and the results show that the second array leads to a better focusing effect in dense breasts than the first array. This work is very meaningful for the potential improvement of the antenna array for FMBH, which is of great significance for the future clinical applications of FMBH. The antenna array with cross polarization can also be applied in micro-wave imaging and sensing for biomedical applications.

Chromosomal instability (CIN), defined by variations in the number or structure of chromosomes from cell to cell, is recognized as a distinctive characteristic of cancer, associated with the ability of tumors to adapt to challenging environments. CIN has been recognized as a source of genetic variation that leads to clonal heterogeneity (CH). Recent findings suggest a potential association between CIN and CH with the prognosis of BC patients, particularly in tumors expressing the epidermal growth factor receptor 2 (HER2+). In fact, information on the role of CIN in other BC subtypes, including luminal B BC, is limited. Additionally, it remains unknown whether CIN in luminal B BC tumors, above a specific threshold, could have a detrimental effect on the growth of human tumors, or if low or intermediate CIN levels could be linked to a more favorable BC patient prognosis when contrasted with elevated levels. Clarifying these relationships could have a substantial impact on risk stratification and the development of future therapeutic strategies aimed at targeting CIN in BC. This study aimed to assess CIN and CH in tumor tissue samples from ten patients with luminal B BC, and compared them with established clinicopathological parameters. The results of our study show that luminal B BC patients exhibit intermediate CIN and stable aneuploidy, both of which correlated with lymphovascular invasion. These findings suggest that evaluating CIN, CH and aneuploidy could improve risk stratification, the prediction of clinical outcomes and future therapeutic approaches in luminal B BC patients.

Most patients with pancreatic cancer at some point present with symptoms related to exocrine pancreatic insufficiency (EPI). These include diarrhea, abdominal bloating, indigestion, steatorrhea, weight loss, and anorexia. Even though up to 80% of pancreatic cancer patients eventually present with symptoms related to exocrine pancreatic insufficiency, only 21% are prescribed pancreatic enzyme replacement therapy. This treatment is profoundly underutilized in the palliative care of these patients. The objective of this review is to discuss the pharmacology, pharmacokinetics, side effects, available evidence of effectiveness of pancreatic enzyme use for patients with pancreatic cancer, and challenges along with proposed solutions regarding its use. Pancrelipase is an expensive drug, and it is inactive if not taken correctly. The impact of symptoms of EPI can lead to poorer overall well-being. Pharmacists play a crucial role in properly educating patients on the correct use of pancreatic enzyme replacement therapy. Pancreatic enzyme replacement therapy (PERT) is a key strategy in managing symptoms of EPI and can improve quality of life, which is a central focus in palliative care.

The high prevalence of thyroid nodules and increased availability of neck ultrasound have led to an increased incidence of diagnostic thyroid fine needle aspirations, with approximately 20% yielding indeterminate results. The recent availability of molecular tests has helped guide the clinical management of these cases. This paper aims to review and compare three main commercially available molecular cytology platforms in the U.S. – Afirma GSC, Thyroseq GC, and ThyGeNEXT+ThyraMIR. Sequential improvements of the Afirma GSC and Thyroseq GC tests have led to higher positive and negative predictive values, sensitivity, and specificity. Comparative studies revealed similar diagnostic performance between these tests, with considerations for factors such as cost and processing time. Thyroseq GC provides detailed genomic information and specific management recommendations. ThyGeNEXT+ThyraMIR, though less studied, presents promising results, particularly in miRNA analysis for weak driver mutations. Challenges in interpreting results include variations in reporting and the evolving nature of testing platforms. Questions persist regarding cost-effectiveness and the utility of ultrasound characteristics in selecting candidates for molecular testing. While molecular testing has primarily served diagnostic purposes, advancements in understanding genetic alterations now offer therapeutic implications. FDA-approved options target specific genetic alterations, signaling a promising future for tailored treatments.

Cadmium (Cd) is an environmental toxicant of worldwide public health significance. Diet is the main non-workplace Cd exposure source other than smoking. The intestinal absorption of Cd involves the transporters for iron, zinc, copper, and calcium. These metal transporters essentially determine the body burden of Cd because only 0.001-0.005% of Cd accumulated in the body can be excreted in urine each day. The International Agency for Research on Cancer listed Cd as a human lung carcinogen. Current evidence, however, suggests that environmental Cd may increase the prevalence of many types of cancer, notably lung, liver, breast, pancreas, and kidney. A two-year bioassay that mimics a lifelong exposure demonstrates Cd caused neoplasms in multiple tissues of mice. Also, several non-tumorigenic human cell lines underwent malignant cell transformation, when they were exposed to a sublethal dose of Cd for a prolonged time. Cd does not directly damage DNA, but it can profoundly affect gene expression through its interactions with various proteins, and Cd can thus be viewed as a transcription modulator. The present review highlights epidemiological studies that connected an enhanced risk of various neoplastic diseases to chronic exposure to environmental Cd. Special emphasis is on the impact of body iron stores on the absorption rate of Cd, and its implications for breast cancer prevention in highly susceptible subpopulation groups of women. Resistance to cell death and other cancer phenotypes acquired during Cd-induced cancer-cell transformation, under in vitro conditions, are briefly discussed. The potential role for ZnT1 efflux transporter in cellular acquisition of tolerance to Cd cytotoxicity are highlighted.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

De-escalation is currently taking place both in surgical and systemic treatment of breast cancer. The introduction of trastuzumab, the first monoclonal antibody against the HER2 receptor over 20 years ago was a milestone in the treatment of HER2 positive breast cancer and marked the beginning of a new era in targeted tumor therapy. In the sense of de-escalation, omitting non-targeted cytotoxic chemotherapy altogether is often hailed as the ultimate goal of oncological research. Especially in case of small, node-negative, HER2 positive early breast cancer, it remains a challenge for clinicians to establish the safest and most efficient treatment plan while considering the significant potential for toxic side effects associated with chemotherapy and HER2 targeted therapy, and the generally excellent prognosis. In this context, several ongoing studies are currently assessing chemotherapy-free regimens as part of strategies aimed at de-escalating therapy in the field of HER2 positive early breast cancer. Despite promising early results from these studies, combination of anti-HER2 treatment with chemotherapy backbone remains standard of care.

Ganoderma lucidum, commonly known as the "Lingzhi" or "Reishi" mushroom, has long been recognized for its potential health benefits, and medicinal properties in traditional Chinese medicine. In recent years, the emerging field of nanotechnology has opened up new possibilities in order to use the remarkable properties of G. Lucidum at the nanoscale. The unique combination of bioactive compounds present in G. Lucidum, such as triterpenoids, polysaccharides, and peptides, has inspired interest in leveraging their therapeutic potential through nanotechnological approaches. Various nanomaterials, including nanoparticles, nanofibers, and nanocomposites, have been employed to encapsulate and deliver these bioactive components to target cells or tissues, enhancing stability, controlled release, and consequently their bioavailability. Nanotechnology-based strategies have been investigated for the efficient extraction and purification of bioactive compounds from G. Lucidum. The use of nanoscale materials has facilitated the extraction process, enhancing the yield and purity of the active components. Additionally, nanocarriers and nanoformulations have been developed to protect these sensitive bioactive compounds from degradation, ensuring their stability during storage and transportation. The use of G. Lucidum-based nanomaterials has shown promising results in several biomedical applications. Nanoparticles loaded with bioactive compounds derived from G. Lucidum have exhibited potent anticancer activity by targeting cancer cells, inducing apoptosis, and inhibiting tumor growth. Additionally, nanotechnology-based formulations have demonstrated immunomodulatory effects, promoting the activation of immune cells and enhancing the body's defense mechanisms. GL, combined with the potential of nanotechnology, presents an exciting frontier in the development of novel therapeutic and biomedical applications. The utilization of nanomaterials for extraction, delivery, and integration of bioactive compounds from G. Lucidum has shown immense potential for improving drug delivery, tissue engineering, and disease treatment. Further research and development in this interdisciplinary field are warranted to fully exploit the synergistic benefits offered by G. Lucidum, and nanotechnology, ultimately leading to innovative solutions for human health and well-being.

Introduction: Colorectal cancer (CRC) is a disease of colon or rectum the part of digestive system. DNA methylation is a process of gene expression by recruiting protein which involve in gene repression, or inhibiting the binding of transcription factors to DNA. MicroRNAs (miRNAs) have been attracting major interest as potential biomarker in cancer. Hereditary nonpolyposis of colorecta cancer (HNPCC) is a type of genetic change (mutation) in a family. Our aims to do a systematic review on DNA methylation and miRNAs serve as candidate clinical biomarkers in HNPCC. Materials and methods: Electronic databases (Medline, PubMed and Scopus data bases). We searched to identify publication all over the world related colorectal cancer and miRNA. Selection was based on the design (CRC, invasive CRC, Colon or rectum, HNPCC, microRNA, circulating miRNA, non-coding RNA), 87 papers from PubMed and 15 papers from Scopus were selected all over the world. CRC, target antigens, methodologies used for detection and miRNA expression were identified and summarized. Results: A total of 96 articles were searched, 87 articles from scopus and 9 articles from PubMed. 20 duplicates removed and remain 76, 52 excluded after screened the titles and abstracts; and remain 24, 10 full texts articles were excluded with reason, and 14 identifications were included in the studies. Conclusion: The findings of this systematic review showed that DNA methylation and mircroRNA in HNCC patients as a genetic mutation or a promoter in colorectal cancer.

Cancer patients undergoing major interventions face numerous challenges, including the adverse effects of cancer and the side effects of treatment. Cancer rehabilitation is vital in ensuring cancer patients have the support they need to maximise treatment outcomes and minimise treatment-related side effects and symptoms. The Active Together service is a multi-modal rehabilitation service designed to address critical support gaps for cancer patients. The service is located and provided in Sheffield, UK, an area with higher cancer incidence and mortality rates than the national average. The service aligns with local and regional cancer care objectives and aims to improve clinical and quality of life outcomes of cancer patients by using lifestyle behaviour change techniques to address their physical, nutritional, and psychological needs. This paper describes the design and initial implementation of the Active Together service, highlighting its potential to support and benefit cancer patients.

Background: Breast cancer is a commonly diagnosed cancer worldwide. Human MutT homolog 1 (MTH1) is found to be elevated in breast tumors and cancer cells are addicted to MTH1 for sur-vival. Pharmacological inhibition of MTH1 may be potentially beneficial in the treatment of breast cancer. Methods: MA-24 was screened by malachite green colorimetric assay from MTH1 inhibitors and the kinetic characteristics of MA-24 was assessed. Binding features of MA-24 with MTH1 was as-certained through molecular docking, and cytotoxic activity of MA-24 was validated in vitro and in vivo. Target engagement assays, comet assay and western blot confirmed that the intracellular target and mechanism of MA-24. Results: MA-24 with potent antitumor bioactivity both in vitro and in vivo. MA-24 competitively inhibited the MTH1 and further induce DNA strand breaks, leading to increased apoptosis of cancer cells depending on upregulation of cleaved-caspase 3 – cleaved-PARP axis. Especially, MA-24 exhibited a powerful efficacy and safety in vivo (tumor growth inhibition rate: 61.8%). Conclusions: MA-24 possesses a broad spectrum of breast cancer cytotoxicity and offered valuable insights for overcoming the challenges of chemotherapy-related toxicity, which holds great po-tential for further development MA-24 as an anti-cancer drug.

Background: Approximately 75% of all head and neck cancer patients are treated with radiotherapy (RT). RT to the oral cavity results in acute and late adverse events which can be severe and detrimental to a patient’s quality of life and function. The purpose of this study was to explore associations between RT dose to a defined oral cavity organ at risk (OAR) avoidance structure, provider and patient reported outcomes (PROs), opioid use, and hospitalization. Methods: This was a retrospective analysis of prospectively obtained outcomes using multivariable modeling. The study included 196 patients treated with RT involving the oral cavity for a head and neck tumor. A defined oral cavity OAR avoidance structure was used in all patients for RT treatment planning. Validated PROs were collected prospectively. Opioid use and hospitalization were abstracted electronically from medical records. Results: Multivariable modeling revealed the mean dose to the oral cavity OAR was significantly associated with opioid use (p=0.0082) and hospitalization (p=0.0356) during and within 30 days of completing RT. Conclusion: The findings of this study may be valuable in RT treatment planning for patients with tumors of the head and neck region to reduce the need for opioid use and hospitalization during treatment.

Breast cancer is the most common cancer among women worldwide, and estrogen receptor-positive (ER+) breast cancer accounts for a significant proportion of cases. While various treatments are available, endocrine therapies are often the first-line treatment for this type of breast cancer. However, the development of drug resistance poses a significant challenge in managing this disease. ESR1 mutations have been identified as a common mechanism of endocrine therapy resistance in ER+ breast cancer. The first-generation selective estrogen receptor degrader (SERD) fulvestrant has shown some activity against ESR1 mutant tumors. However, due to its poor bioavailability and need for intramuscular injection, it may not be the optimal therapy for patients. Second-generation SERDs have been developed to overcome these limitations. These newer drugs have improved oral bioavailability and pharmacokinetics, making them more convenient and effective for patients. Several oral SERDs are now in phase III trials for early and advanced ER+ breast cancer. This review summarizes the background of oral SERD development, the current status, and future perspectives.

In Caucasians, basal cell carcinoma, a type of non-melanoma skin cancer, is most often found on the nose. This presents challenges for surgeons due to anatomical, functional, and aesthetic concerns. The study aimed to evaluate the distribution of tumor localization, size, morphological subtypes, surgical outcomes, radicality levels, and their correlation with recurrence rates. The research utilized data from the Hygiene Institute Health Information Centre. A retrospective analysis encompassed 343 cases of nasal skin cancer over a four-year period from January 1, 2019, to December 31, 2022. The research cohort comprised 252 female and 91 male participants, averaging 75,2 years old. Tumors were most found on the left sidewall of the nose (25.4%) and the dorsum (24.8%). The infiltrative morphological subtype was predominant (70.8%). Standard surgical excision with fasciocutaneous plastic was the preferred surgical procedure. Radical excision was achieved in 79.0% of lesions, while 16.9% were incompletely excised. Non-radically excised tumors exhibited a significantly higher recurrence rate (24.1%) compared to those with radical excision (6.3%). In nasal reconstruction, diverse surgical techniques are essential for precise adaptation based on factors like tumor characteristics and patient needs. Despite surgeons' careful adherence to excision guidelines, the potential for non-radical procedures cannot be entirely eliminated.

(1) Background: P-cadherin (CDH3) is a transmembrane protein that plays a crucial role in maintaining the structural integrity of epithelial tissue and homeostasis. Its role in carcinogenesis remains a subject of debate, as its behavior can vary depending on the molecular context and the specific tumor cell model under study. In this study, we explored the role of P-cadherin in head and neck squamous cell carcinoma (HNSCC) and the mechanism underlying its function. (2) Methods: We analyzed P-cadherin expression in HNSCC patients using The Cancer Genome Atlas (TCGA) database. For in vitro functional analysis, we conducted proliferation, migration, invasion, and western blot assays after either suppressing or overexpressing P-cadherin. For in vivo functional analysis, we utilized mouse xenograft models. (3) Results: P-cadherin was significantly overex-pressed in tumor samples compared to normal samples in the TCGA-HNSCC cohort. P-cadherin knockdown resulted in decreased proliferation, migration, and invasion compared to control cells, while P-cadherin overexpression increased cell proliferation and migration in HNSCC cells. We discovered that c-Met functioned as an upstream regulator of P-cadherin. Surprisingly, we found that P-cadherin knockdown increased the phosphorylation of c-Met and STAT3. Combining P-cadherin siRNA with the c-Met inhibitor SU11274 resulted in a more effective reduction in HNSCC cell growth, both in vitro and in vivo, compared to either treatment alone. (4) Conclusions: Our study uncovered a previously unknown aspect of P-cadherin-mediated c-Met regulation. The enhanced activation of c-Met/STAT3 following P-cadherin inhibition could be responsible for the survival of resistant tumor cells. Therefore, dual inhibition of P-cadherin and c-Met may be a potentially effective approach for treating HNSCC.

: Nanotechnology has expanded what can be achieved in our approach to cancer treatment. The ability to produce and engineer functional nanoparticle formulations to elicit higher incidences of tumor cell radiolysis has resulted in substantial improvements in cancer cell eradication while also permitting multi-modal biomedical functionalities. These radiosensitive nanomaterials utilize material characteristics, such as radio- blocking/absorbing high-Z atomic number elements, to mediate localized effects from therapeutic irradiation. These materials thereby allow for subsequent scattered or emitted radiation to produce direct (e.g., damage to genetic materials) or indirect (e.g., protein oxidation, reactive oxygen species formation) damage to tumor cells. Using nanomaterials that activate under certain physiologic conditions such as the tumor micro-environment can selectively target tumor cells. These characteristics combined with biological interactions that can target the tumor environment allow for localized, radio-sensitization while mitigating damage to healthy cells. This review explores the various nanomaterial formulations utilized in cancer radiosensitivity research. Emphasis on inorganic nanomaterials showcase the specific material characteristics that enable higher incidences of radiation while ensuring localized cancer targeting based on tumor micro-environment activation. The aim of this review is to guide future research in cancer radiosensitization using nanomaterial formulations and to detail common approaches to radiosensization, as well their relations to commonly implemented radiotherapy techniques.

Next-generation cancer and oncology research needs to take full advantage of the multi-modal structured, or graph, information, with the graph datatypes ranging from molecular structures to spatially resolved imaging and digital pathology to biological networks to knowledge graphs. Graph Neural Networks (GNNs) efficiently combine the graph structure representations with the high predictive performance of deep learning, especially on the large multi-modal datasets. In this review article, we survey the landscape of recent (2020-present) GNN applications in the context of cancer and oncology research, and delineate six currently predominant research areas. Subsequently, we identify the most promising directions for future research. We compare GNNs with graphical models and "non-structured" deep learning, and devise the guidelines for cancer and oncology researchers or physician-scientists asking the question of whether they should adopt the GNN methodology in their research pipelines.

Lung cancer (LC) stands as the foremost cause of cancer-related fatality rates worldwide. Early diagnosis significantly enhances patient survival rate. Nowadays, low dose computed tomography (LDCT) is widely employed on chest as a tool for large-scale lung cancer screening. Nonetheless, a large amount of chest radiographs causes an onerous burden on radiologists. Some computer-aided diagnostic (CAD) tools can provide insights to medical images for diagnosis and augmenting diagnostic speed. However, due to variation in parameter settings across different patients, substantial discrepancies in image voxels persist. We find different voxel-size causing a compromise between model generalization and diagnostic efficacy. This study investigates the performance disparities of diagnostic models trained on original images and LDCT images reconstructed to different voxel-sizes but isotropic. The application is to differentiate a nodule to be benign or malignant. Using 11 features, a support vector machine (SVM) is trained on LDCT images with an isotropic voxel having side-length of 1.5 mm for 225 patients in house. The result yields a favorable model performance with an accuracy of 0.9596 and an area under the receiver operating characteristic curve (ROC/AUC) of 0.9855. In addition to furnish CAD tools for clinical applications, future research is encouraged to include LDCT images from multi-centers.

Introduction and objectives Obstructive sleep apnea (OSA) is defined as a cause of daytime sleepiness, as well as a clinical manifestation of sleep-disordered breathing. In the literature, there are numerous controversial studies regarding the etiology of this condition, but it is universally accepted that a significant role in its onset is played by the reduced activity of the upper airway muscles. Additionally, OSA has been associated with a series of comorbidities, such as type II diabetes, metabolic syndrome, cardiovascular and pulmonary conditions, as well as head and neck tumors, especially oropharyngeal and laryngeal tumors. The purpose of this review is to examine and demonstrate the prevalence of OSA in patients with associated pathologies, especially in patients with head and neck tumors, as well as the role of surgical and non-surgical therapeutic methods in improving the quality of life. Material and methods Taking into consideration the stated objective, a systematic analysis of the available literature was conducted, encompassing PubMed, Medline and Scopus databases. The evaluation was based on several keywords, including head and neck cancer, diabetes, diabetic, overlap syndrome, cardiovascular conditions, laryngeal neoplasm, radiotherapy, chemotherapy, as well as the concept of quality of life in laryngectomized patients and patients with OSA. Results Our results demonstrate the involvement of OSA in the presence of comorbidities and also, an increased incidence of OSA in patients with laryngeal cancer. It is important to note that surgical and post-surgical treatment can play a significant role in triggering OSA in these patients. Conclusions The clinician must recognize the increased prevalence of OSA in patients with head and neck cancer, as well as the coexistence of OSA with certain comorbidities. They should actively engage in early diagnosis and establish optimal treatment methods to improve the quality of life for patients with associated conditions such as head and neck tumors or cardiovascular pathology.

Once discovered, cancer stem cells have become a hot topic in the research of cancer therapy. These cells possess stem cell-like self-renewal and differentiation capacities and are important factors that dominate cancer metastasis, therapy- resistance and recurrence. What's worse, their own characteristics make them difficult to be eliminated. Colorectal cancer is the third most common cancer and the second leading cause of cancer death worldwide. Targeting colorectal cancer stem cells (CRCSCs) can inhibit colorectal cancer metastasis, enhance therapeutic efficacy, and reduce recurrence. Here, we introduced the origin, marker proteins, identification, cultivation and research techniques of CRCSCs, summarized the signaling pathways that regulate the stemness of CRCSCs, such as Wnt, JAK/STAT3, Notch, and Hh signaling pathway. In addition to these, we also reviewed anti-CRCSC drugs targeting signaling pathways，markers，and other regulators in recent years. These will help researchers gain insight into the current agents targeting to CRCSCs, explore new cancer drugs, and propose potential therapy.

Breast cancer is a common malignant tumour and studies have shown that early and accurate detection is crucial for patients. With the maturity of medical imaging and deep learning development, significant progress has been made in breast cancer classification, which greatly improves the accuracy and efficiency of classification. This review focuses on deep learning, migration learning, GAN, and lifelong learning to elaborate and summarise the important roles arising from breast cancer detection. This review also examines the dataset and labeling issues required for breast cancer classification. In conclusion, at the end of the article, we look at future directions for breast cancer classification research, including cross-migration learning, multimodal data fusion, model interpretability, and lifelong learning, and also explore how to provide personalized treatment plans for patients.

Colorectal liver metastases (CRLM) patients combined with hepatic lymph node metastases was a negative prognostic factor associated with outcomes. Up to now, there was still lack of a reliable method to identify the status of hepatic lymph nodes. The aim of this study was to investigate the predictive ability of mono-exponential, bi-exponential, and stretched-exponential diffusion-weighted imaging (DWI) models to distinguish between benign and malignant hepatic lymph nodes in CRLM patients who underwent neoadjuvant chemotherapy prior to surgery. In total, 97 CRLM patients with pathologically proved hepatic lymph node status were included. Various quantitative parameters, including the apparent diffusion coefficient (ADC) from mono-exponential model, D, D*, and f derived from intravoxel incoherent motion (IVIM) model, as well as DDC and α from stretched-exponential model (SEM), were measured. Multivariate analysis revealed that the pre- treatment DDC value and the short diameter of the largest lymph node after treatment were independent predictors of metastatic hepatic lymph nodes. A nomogram combining these two factors demonstrated excellent performance in distinguishing between benign and malignant lymph nodes in CRLM patients, with an area under the curve (AUC) of 0.873. Therefore, the nomogram can serve as a preoperative assessment tool for determining the status of hepatic lymph nodes and aiding in the decision-making process for surgical treatment in CRLM patients.

Recent studies suggest that PEBP1/RKIP and YY1, despite having distinct molecular functions, may interact and mutually influence one another's activity. They exhibit reciprocal control over each other's expression through regulatory loops, prompting the hypothesis that their interplay could be pivotal in cancer advancement and resistance to drugs. To delve into this interplay's functional characteristics, we conducted a comprehensive analysis using bioinformatics tools across a range of cancers. Our results confirm the association between elevated YY1 mRNA levels and varying survival outcomes in diverse tumors. Furthermore, we observed differing degrees of inhibitory or stimulatory effects of these two genes in various cancer pathways, along with correlations between their mRNA expression and immune infiltration. Additionally, YY1/PEBP1 expression (or methylation) displayed connections with genomic alterations across cancer types. Notably, we uncovered links between YY1/PEBP1 and different indicators of immunosuppression, such as immune checkpoint blockade response, and T-cell dysfunction/exclusion levels, across different patient groups. Overall, our findings underscore the significant role of the interplay between YY1 and PEBP1 in cancer progression, influencing genomic changes, tumor immunity or the tumor microenvironment. Additionally, these two gene products appear to impact the sensitivity of anticancer drugs, opening new avenues for cancer therapy.

Background: Epithelial-mesenchymal transition (EMT) is a biological process where epithelial cells lose their adhesive properties and gain invasive, metastatic, and mesenchymal properties. Maintaining the balance between epithelial and mesenchymal stage is essential for tissue homeo-stasis. Many of the genes promoting mesenchymal transformation has been identified; however, our understanding of the genes responsible for maintaining the epithelial phenotype is limited. Our objective was to identify genes responsible for maintaining the epithelial phenotype and in-hibiting EMT. Methods: RNA seq was performed using an vitro model of EMT. CTGF expres-sion was determined by qPCR and Western blot analysis. Knockout of CTGF was done using the CTGF sgRNA CRISPR/CAS9. Tumorigenic potential was determined using NCG mice. Results: Knocked-out of CTGF in epithelial ovarian cancer cells leads to the acquisition of functional characteristics associated with the mesenchymal phenotype such as Anoikis resistance, cytoskel-eton remodeling, increased cell stiffness, and acquisition of invasion and tumorigenic capacity. Conclusions: We identified CTGF is an important regulator of the epithelial phenotype, and its loss is associated with early cellular modifications required for EMT. We describe a novel role for CTGF, regulating cytoskeleton and the extracellular matrix interactions necessary for conserva-tion of epithelial structure and function. These findings provide a new window to understand the early stages on mesenchymal transformation

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Breast cancer is the most common malignancy in women worldwide. The pathogenesis of this disease is closely related to the estrogen receptor alpha subtype (ERα). Therefore, it is of great importance to develop effective inhibitors of ERα activity for the treatment of breast cancer. In this paper, we propose a novel ensemble machine learning model for quantitative structure-activity relationship of anti-breast cancer drugs, which can effectively predict drug activity in small samples with multiple characteristic variables. To avoid the problem of over-fitting caused by low-correlation independent variables, the scoring mechanism of random forest was improved by incorporating three relevance indicators, including the maximum mutual information number, Pearson correlation coefficient and distance correlation coefficient, and 20 optimal molecular descriptors were selected. The Bayesian hyperparameter optimization method was used to optimize the parameters of multiple linear regression (MLR), support vector regression (SVR), and extreme gradient boosting (XGBoost), respectively. The AdaBoost strong learner was constructed by combining the weak learner with the weighted linear addition method. The results show that the proposed ensemble learning model has the best prediction performance compared to the three basic learner models and the CNN-LSTM combination prediction model. The root mean square error was reduced by 7.60%-26.51%. The mean relative error was reduced by 6.46%-30.92%. Goodness of fit increased by 9.57%-36.94%. Finally, the biological activities of 50 candidate compounds for ERα inhibitors were predicted, and it was found that 4-[2-benzyl-1-[4-(2-pyrrolidin-1-ylethoxy)phenyl]but-1-enyl]phenol had an excellent biological activity value pIC50, which had the potential to be an ERα inhibitor. The model proposed in this paper has good prediction accuracy, which can provide an effective reference for the discovery and development of anti-breast cancer drugs.

Frontal Temporal Dementia (FTD) is a neurological disorder known to have less therapeutic options. So far only a few biomarkers are available for FTD that can be used as potential comorbidity targets. To this end, in the present study we aim to identify potential biomarkers or susceptible genes for FTD that show comorbidities with diseases such as COVID-19 and Breast Cancer. Gene expression Omnibus datasets containing FTD expression profiles from African American and white ethnicity background were included in our study. In FTD samples of GSE193391 dataset, we identified 305 DEGs with 168 genes being up-regulated and 137 genes being down-regulated. We conducted comorbidity analysis for COVID-19 and Breast cancer followed by analysis of potential drug interactions, pathogenicity, analysis of genetic variants and functional enrichment analysis. Resulting genes AKT3, GFAP, ADCYAP1R1, VDAC1, and C4A showed significant transcriptomic alterations in FTD and significant comorbidity status with COVID-19 and Breast cancer. Functional pathway analysis revealed that these comorbid genes were significantly enriched in the pathways such as glioma, JAK/STAT signaling, systematic lupus erythematosus, neurodegeneration-multiple diseases and neuroactive ligand-receptor interaction. Overall, from these results, we concluded that these genes could be recommended as potential therapeutic targets for the treatment of comorbidities in FTD.

A comprehensive lipid profile was analyzed in patients with non-small cell lung cancer (NSCLC) using nanoflow ultrahigh-performance liquid chromatography-electrospray ionization-tandem mass spectrometry. The study investigated 297, 202, and 166 lipids in saliva, plasma, and fecal samples, respectively, comparing NSCLC patients to healthy controls. Lipids with significant changes (&gt;2-fold, p&lt;0.05) were further analyzed in each sample type. Both saliva and plasma exhibited similar lipid alteration patterns in NSCLC, but saliva showed more pronounced changes and fecal lipids had weak correlation with those of saliva and plasma. Total triglycerides (TGs) increased (&gt;2–3 folds) in plasma and saliva but decreased in fecal samples. Three specific TGs (50:2, 52:5, and 54:6) were significantly increased in NSCLC across all sample types. A common ceramide species (d18:1/24:0) decreased in both plasma and saliva but increased in fecal samples. Additionally, phosphatidylinositol 38:4 decreased by approximately 2-fold in plasma and saliva. Phosphatidylserine 36:1 was selectively detected in saliva and showed a subsequent decrease, making it a potential biomarker for predicting lung cancer. The study identifies 27 salivary, 10 plasma, and 16 fecal lipids as candidate markers for NSCLC by statistical evaluations. Moreover, it highlights the potential of saliva in understanding changes in lipid metabolism associated with NSCLC.

Perfluorohexane sulfonate (PFHxS) is a widely detected replacement for legacy long-chain perfluoroalkyl substances (PFAS) in the environment and human blood samples. Its potential toxicity led to its recent classification as a global regulated persistent organic pollutant. Although animal studies have shown a positive association between PFHxS levels and hepatic steatosis and hepatocellular hypertrophy, the link with liver toxicity, including end-stage liver cancer, remains inconclusive. In this study, we examined the effects of PFHxS on the proliferation of human hepatocellular carcinoma (HCC) cells, Hep3B and SK-Hep1. Cells were exposed to different PFHxS concentrations for 24–48 hr to assess viability and 12–14 days to measure colony formation. Viability of both cell lines increased at PFHxS concentrations <200 μM, decreased at >400 μM, and were highest at 50 μM. Colony formation increased at <300 μM and decreased at 500 μM PFHxS. Consistent with the effect on HCC proliferation, PFHxS increased expression of proliferating cell nuclear antigen (PCNA) and cell-cycle molecules (CDK2, CDK4, cyclin E, and cyclin D1). In summary, PFHxS exhibited a biphasic effect on HCC cell proliferation, promoting survival and proliferation at lower concentrations and being cytotoxic at higher concentrations. This suggests that PFHxS potentially exacerbates HCC progression.

Aortic valve stenosis and malignancy frequently coexist and share the same risk factors as atherosclerotic disease. Data reporting the prognosis of patients with severe aortic stenosis and cancer are limited. Tailoring the correct and most optimal care for cancer patients with severe aortic stenosis is complex. Cancer patients may be further disadvantaged by aortic stenosis if it interferes with their treatment by increasing the risk associated with oncologic surgery and compounding the risks associated with cardiotoxicity and heart failure (HF). Nowadays, several therapeutic options are available for aortic valve stenosis (surgical valve replacement , transcatheter valve implantation, balloon valvuloplasty, or medical therapy), but in presence of malignancy, the use of one of these versus the others should be decided on a case-by-case approach, depending on cancer stage and associated treatment, expected outcome, comorbidities and after an accurate physical examination and Doppler-echocardiography which are the key tools for diagnosing and evaluating aortic stenosis. The current review considers the available data on the association between aortic stenosis and cancer, and therapeutic options.

Lysophosphatidic acid (LPA) is a promising biomarker candidate to screen for ovarian cancer (OC) and potentially stratify and treat patients according to disease stage. LPA is known to target actin-binding protein gelsolin that is a key regulator of actin filament assembly. Previous studies have shown that the phosphate headgroup of LPA alone is inadequate to bind to the short chain of amino acids in gelsolin known as the PIP2-binding domain. Thus, the molecular-level detail of the mechanism of LPA binding is poorly understood. Here, we model LPA binding to the PIP2-binding domain of gelsolin in the gelsolin-actin complex through extensive ten microsecond atomistic molecular dynamics (MD) simulations. We predict that LPA binding causes a local conformational rearrangement due to LPA interactions with both gelsolin and actin residues. These conformational changes are a result of the amphipathic nature of LPA, where the anionic phosphate, polar glycerol and ester groups, and lipophilic aliphatic tail mediate LPA binding via charged electrostatic, hydrogen bonding, and van der Waals interactions. The negatively-charged LPA headgroup binds to the PIP2-binding domain of gelsolin-actin while its hydrophobic tail is inserted into actin, creating a strong LPA-insertion pocket that weakens the gelsolin–actin interface. The computed structure, dynamics, and energetics of the ternary gelsolin–LPA–actin complex confirms that a quantitative OC assay is possible based on LPA-triggered actin release from the gelsolin-actin complex.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Background: This study assessed the nephrotoxicity of oral BRAF inhibitors (BRAFi), regorafenib (REG) and encorafenib (ENC), in metastatic colorectal cancer (mCRC), through an analysis of re-ports from the US Food and Drug Administration's Adverse Event Reporting System (FAERS) da-tabase. Methods: A descriptive and disproportional analyses were performed for all reports with ENC and REG as the primary suspect. Results: A total of 379 reports had at least one renal ADR, mainly related to REG (93.1%). Potential safety signals for REG particularly included chromaturia (n = 44; ROR = 12.00, CI 95% = 8.92-16.16; IC = 2.36, IC025-IC075 = 2.06-2.66), hydronephrosis (10; 8.70, 4.67-16.19; 1.85, 1.23-2.47), nephrotic syn-drome (7; 5.73, 2.73-12.03; 1.47, 0.73-2.21), renal impairment (53; 4.16, 3.17-5.45; 1.39, 1.12-1.66), dys-uria (19; 3.06, 1.95-4.81; 1.06, 0.61-1.52), renal failure (38; 1.66, 1.20-2.28; 0.49, 0.17-0.81), and acute kidney injury (AKI) (43; 1.46, 1.08-1.97; 0.37, 0.07-0.67). For ENC, consistent disproportionalities were observed for AKI (n = 11; ROR = 3.79, CI 95% = 2.09-6.90; IC = 1.32, IC025-IC075 = 0.72-1.91) and dysuria (4; 6.50, 2.43-17.39; 1.86, 0.88-2.85). Conclusions: These findings highlighted some not extensively reported renal ADRs that required further investigations to better characterize the safety profile of BRAFi in patients with mCRC.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

Breast cancer (BC) is the most common malignancy and the second cause of cancer specific death in women from high-income countries. More than 70% of all breast cancer are hormone receptor-positive BC, and elevated estrogen circulating in blood has been proved to be a strong risk for BC development. This is due to its contribution to enhance proliferation of cancerous cells, angiogenesis and metastasis stimulation and therapy resistance. The estrogen (E) metabolism–gut microbiome axis is functional with underlying individual variations in E levels. It is reasonable that the estrobolome (bacterial genes whose products are capable of metabolizing E) could contribute to the risk of hormone-driven malignancies including BC and may serve as a potential biomarker and target. Gut microbial β -glucuronidase (GUS) enzymes have been suggested to be involved in the estrobolome. Furthermore, bacterial GUS enzymes within the gastrointestinal tract have been postulated to contribute to hormone breast cancer. In this review, we discuss the recent knowledge about the role of GUS enzyme in the pathogenesis of breast cancer. We focus on the role of GUS in (i)-the microbioma and estrogen metabolism, (ii) diet, estrobolome, and the BC development, (iii) other activities of the bacterial β-glucuronidase, and (iv) the new molecular target for BC therapeutic application.

Locally advanced rectal cancer (LARC) has traditionally been treated with trimodality therapy consisting of neoadjuvant radiation +/- chemotherapy, surgery and adjuvant chemotherapy. There is currently a clinical need for biomarkers to predict treatment response and outcomes, especially during neoadjuvant therapy. Liquid biopsy in the form of circulating tumour cells (CTCs) and circulating nucleic acids in particular microRNAs (miRNA) are novel, highly stable and clinically relevant regulators of disease. We studied a prospective cohort of 52 patients with LARC, and obtained samples at baseline, during treatment, and post-treatment. We enumerated CTCs during chemoradiation at these three time-points, using the IsofluxTM CTC Isolation and detection platform. We then subjected the isolated CTCs to miRNA expression analyses, using a panel of 106 miRNA candidates. We identified CTCs in 73% of patients at baseline, and numbers fell during treatment and miRNA expression profiles also changed during treatment. Between baseline and during treatment (week 3) time-points three microRNAs (hsa-miR-95, hsa-miR-10a and hsa-miR-16-1*) were highly differentially expressed. Importantly, hsa-miR-19b-3p and hsa-miR-483-5p were found to correlate with good response to treatment. The latter (hsa-miR-483-5p) was also found to be differentially expressed between good responders and poor responders. They represent potential predictive biomarkers and a potential miRNA-based treatment strategy. In this study, we demonstrate that CTCs are present and can be isolated in the non-metastatic early stage cancer setting, and their associated miRNA profiles can potentially be utilized to predict treatment response.

Canine mammary tumors (CMTs) are among the most common disease in female dogs and share similarities with human breast cancer, which have placed these animals as a model of study in comparative oncology. Metabolic reprogramming is one of them and is known as a hallmark of carcinogenesis whereby cells undergo adjustments to supply the high bioenergetic and biosynthetic demands of rapidly proliferating cells. However, such alterations are also vulnerabilities that may serve as therapeutic strategies which have been tested mostly in human clinical trials, but poorly explored in CMTs. In this dedicated review, we compilated the metabolic changes described for CMTs emphasizing the metabolism of carbohydrates, amino acids, lipids, and mitochondrial function. We observed here key factors associated with the presence and aggressiveness of CMTs, such as the increase in glucose uptake followed by enhanced anaerobic glycolysis via upregulation of glycolytic enzymes, changes in glutamine catabolism due to overexpression of glutaminases, raise in fatty acid oxidation and distinct effects depending on the lipid saturation, in addition to mitochondrial DNA which is a hotspot for mutations. Therefore, more attention should be paid to this topic given that targeting metabolic fragilities could improve the outcome of CMTs.

D-type cyclins encode G1/S cell cycle checkpoint proteins, that play a crucial role in defining cell cycle exit and progression. Precise control of cell cycle exit is vital during embryonic development, with defects in the pathways regulating intracellular D-type cyclins resulting in abnormal initiation of stem cell differentiation in a variety of different organ systems. Furthermore, stabilisation of D-type cyclins is observed in a wide range of disorders characterised by cellular over-proliferation, including cancers and overgrowth disorders. In this review, we will summarise and compare the roles played by each D-type cyclin during development and provide examples of how their intracellular dysregulation can be an underlying cause of disease.

Esophageal cancer is a formidable challenge in the realm of cancer treatment. Conventional methods such as surgery, chemotherapy, and immunotherapy have demonstrated limited success rates in managing this disease. In response, targeted drug therapies have emerged as a promising strategy to improve outcomes for patients. These therapies aim to disrupt specific pathways involved in the growth and development of esophageal cancer cells. This review explores various drugs used to target specific pathways, including cetuximab and monoclonal antibodies (gefitinib) that target the epidermal growth factor receptor (EGFR), trastuzumab that targets human epidermal growth factor receptor 2 (HER-2), drugs targeting the vascular endothelial growth factor receptor (VEGFR), mTOR inhibitors, and cMET inhibitors. Additionally, the article discusses the impact of drug resistance on the effectiveness of these therapies, highlighting factors such as cancer stem cells, cancer-associated fibroblasts, immune-inflammatory cells, cytokines, hypoxia, and growth factors. While drug targeting approaches do not provide a complete cure for esophageal cancer due to drug resistance and associated side effects, they offer potential for improving patient survival rates.

Cancer is a devastating disease, causing tremendous morbidity and mortality each year. Cancer can be considered as a genetic disease in the sense that instabilities in protooncogenes and tumor suppressor genes are among the hallmarks of cancer progression and metastasis. However, a particular cancer can express different proteins in different patients, making cancer a heterogeneous disease. This heterogeneity in part influences treatment resistance and failure. Therefore, it is crucial to understand the mechanism by which cancer cells develop and enhance resistance to different agents. This review aims to present the general paradigm and recent updates on cancer cell resistance to different antitumor agents. It demonstrates that tumor resistance results from a myriad of factors, including tumor microenvironment, supporting immune cells, and cancer stem cells. This interaction contributes to cancer cells overcoming the therapeutic effects of different classes of antitumor agents, such as cytotoxic chemotherapeutics, targeted agents, and immunotherapies. With the development of advanced molecular analysis, specialized genomic assessment has assisted clinicians and researchers in choosing selected agents combating cancer cells. Together, this approach can potentially reduce treatment toxicity, health system burden, and financial costs while improving patient quality of life. Understanding the exact mechanism of drug resistance in cancer cells can open the way to new effective and less toxic therapeutics.

(1) Background: Metastasis is a complex process in which the primary cancer cells spread to a distant organ or organs, creating a secondary tumour location, which in many patients leads to treatment failure and death. The aim of the present study was to assess the association of endothelial markers (i.e., sP-selectin, sE-selectin and von Willebrand factor) with the leptin-to-adiponectin ratio (LAR) and to perform an analysis of the predictive value on the survival of patients with luminal A and B invasive breast cancer (IBrC). (2) Methods: The trial included 70 previously untreated women with a median age of 54.5 years and a median tumour size of 1.5 cm. The concentrations of pre- and post-treatment endothelial markers, leptin, and adiponectin were evaluated with specific ELISA kits. The median duration of follow-up was 68.5 months (interquartile range (IQR) = 59–72 months) with a recurrence rate of 15.71%. (3) Results: Regardless of the treatment pattern, endothelial marker concentrations and the LAR increased after treatment. The follow-up showed a significantly higher relapse rate in patients with IBrC who had higher pre-treatment sP-selectin and post-treatment LAR levels. A post-treatment LAR of 0.83 ng/mL with a sensitivity of 88.9% and specificity of 57.9% was established as the optimal cut-off value for distinguishing patients with or without disease recurrence. Additionally, a higher risk of breast cancer relapse was associated with a lower post-treatment sP-selectin concentration. (4) Conclusions: Our results showed mainly that pre-treatment sP-selectin levels and post-treatment LAR may have a value as prognostic indicators and may contribute to predicting the future outcome in patients with early-stage IBrC.

The appearance of brain metastasis is the most serious complication of breast cancer with mostly fatal outcomes. To reach the brain, tumor cells need to pass the blood-brain barrier (BBB). The molecular mechanisms underlying penetration of the BBB are largely unknown. Previously we found that tumor-infiltrating T lymphocytes enhance the development of brain metastasis of estrogen receptor-negative (ER-) breast cancer. In the current study, we investigate the contribution of T lymphocytes and the IFN- pathway in enabling breast cancer cells to pass the in vitro BBB. CD8+ cells display the strongest stimulatory effect on breast cancer cell passage. We show that inhibition of the IFN- receptor in MDA-MB-231 breast cancer cells, or neutralization of soluble IFN-, impairs the in vitro trespassing of breast cancer cells. Importantly, we validated our findings using gene expression data of breast cancer patients. CXCL-9,-10,-11/CXCR3 axis, dependent on IFN- signaling activity, was overexpressed in primary breast cancer samples of patients who developed brain metastasis. The data support a role for T-lymphocytes and the IFN- pathway in the formation of brain metastasis of ER- breast cancer, and offer targets to design future therapies for preventing breast cancer cells to cross the BBB.

Recent reports suggest that dysregulation of lipid metabolism is a key feature of the most invasive cancers. To identify potential biomarkers of tumor aggressiveness, we compared the proteomes of two experimental models of malignant mesothelioma in rats exhibiting different invasive properties. Quantitative changes between the most invasive, M5-T1, versus the least invasive, F4-T2, first led to a list of 424 proteins. A second step, cross-comparing this list with 433 proteins distinguishing invasive vs non-invasive tumors, led to identifying 88 proteins that specifically increased and 157 that decreased, respectively, characterizing the most aggressive M5-T1 tumor. Among the 15 mitochondrial proteins found in these lists, the very long-chain specific acyl-CoA dehydrogenase, encoded by the Acadvl gene and involved in fatty acid beta oxidation, appeared to play an important role in the metabolic reprogramming of the tumor microenvironment. Immunohistochemical staining of tumor sections confirmed increased expression of Acadvl in the M5-T1 tumor. Finally, the dramatic increase and decrease, observed in 25 and 17 proteins, respectively, suggested the existence of a strong link between mitochondrial events and modifications of the extracellular matrix, immune cell components or other subcellular compartments. These findings highlight some important aspects of the tumor microenvironment changes linked to aggressiveness.

It was found that patients with comorbidities of obesity and diabetes have a high risk of breast cancer occurrence and face worse breast cancer outcomes. Though several reports showed the reinforced link between obesity, diabetes, and prediabetes with breast cancer, the underlying molecular mechanism is still unknown. The present study aimed to investigate the underlying molecular link between increased risks of breast cancer due to coincident diabetes or obesity using a spontaneous obese rat model with impaired glucose tolerance (WNIN/GR-Ob rat). A single dose of solubilized DMBA suspension (40 mg/kg body weight) was orally administered to the animals at the age of 60 days to induce breast tumors. The tumor incidence, latency period, tumor frequency, and tumor volume were measured. Histology, immunohistochemistry, and immunoblotting were performed to evaluate the tumor morphology and expression levels of signal molecules. It was observed that the onset of breast tumor and latency period per tumor development were early in GR-Ob rats compared to respective lean rats. It was found that 62% of obese rats were bearing tumors, and in comparison, only 21% of the lean animals developed breast tumors. Overexpression of ER, PR, Ki67, and p53 markers was observed in tumor tissues of obese rats in comparison with lean rats. The levels of the hallmarks of cell proliferation and angiogenesis involved in IGF-1/PI3K/Akt/GSK3β/β-catenin signaling pathway molecules were upregulated in obese rat breast tumors compared to lean rats. Furthermore, obesity with prediabetes is associated with changes in IGF-1 signaling and acts on PI3K/Akt/GSK3β/β-catenin signaling, which results in quick cell proliferation and development of breast tumors in obese rats than the lean rats. These results indicate that the onset of the tumor and its development was faster in a spontaneous obese rat model with impaired glucose tolerance than their lean counterparts, with a higher percentage of tumor incidence.

Colon cancer is a common malignancy of digestive tract and has high incidence and mortality worldwide. As a normal flora in the human gastrointestinal tract, lactic acid bacteria have been proved to have health benefits, such as immune-regulation, anti-infection, and anti-tumor. In the present study, the inhibitory effects of 19 heat-inactivated plant-derived lactic acid bacteria on human colon cancer cell HCT116 were investigated. The results showed that heat-inactivated plant-derived lactic acid bacteria strain 729 had the strongest inhibitory effect on HCT116 cells among all tested bacteria. Treatment with heat-inactivated bacteria strain 729 could inhibit the proliferation of HCT-116 cells in dose-dependent manner, with 54.52% inhibition at a final concentration of 1×10⁸ CFU/mL. Moreover, the heat-inactivated bacteria strain 729 could block the cell cycle, induce apoptosis, and promote cellular ferroptosis by downregulating the expression of GPX4 and xCT at protein level. According to the 16S rDNA sequencing, the plant-derived lactic acid bacteria strain 729 was Lactobacillus plantarum. Collectively, the results indicates that lactic acid bacteria strain 729 may be developed as special ingredients targeting colon cancer, but further in vivo studies are required.

Erectile dysfunction (ED) is a common and feared complication of radical prostatectomy (RP) for prostate cancer. Recently, tissue engineering is being attempted for post-prostatectomy ED, with controlled interactions between cells, growth factors, and extracellular matrix (ECM) being important for nerve regeneration's structural integrity. In this study, we evaluated the effects of biomechanical ECM patch on human bone marrow-derived mesenchymal stem cells (hBMSCs) morphology and behavior in bilateral cavernous nerve injury (BCNI) rat model. The ECM patch, made of decellularized human fibroblast-derived ECM (hFDM) and a biocompatible polyvinyl alcohol (PVA) hydrogel, was tested with human bone marrow-derived mesenchymal stem cells (hBMSCs) on a bilateral cavernous nerve injury (BCNI) rat model. In vitro analysis showed that the hFDM/PVA + hBMSCs patches significantly increased neural development markers. In vivo experiments demonstrated that the rats treated with the hFDM/PVA patch had higher ICP/MAP ratio, a higher ratio of smooth muscle to collagen, increased content of nNOS, higher levels of eNOS protein expression, and a higher cGMP level compared to the BCNI group. These results indicate that the hFDM/PVA patch is effective in promoting angiogenesis, smooth muscle regeneration, and nitrergic nerve regeneration, which could contribute to improved erectile function in post-prostatectomy ED.

Colorectal cancer remains one of the most commonly diagnosed cancers. Advanced rectal cancer patients receive neoadjuvant radiochemotherapy as well as surgery and suffer under reduced health-related quality of life due to various side effects. We were interested in the role of the COVID-19 pandemic and how it affected those patients’ quality of life. A total of 489 advanced rectal cancer patients from the University Hospital Erlangen in Germany were surveyed between May 2010 and March 2022 and asked to fill out the EORTC QLQ-C30 and QLQ-CR38 questionnaire over eight different time points: in the beginning, during and after radiochemotherapy, right before surgery and in yearly intervals after surgery for up to four years. Answers were converted to scores to compare the COVID-19 period to the time before March 2020 focusing on the follow-ups, the developments over time – including by sex and age - and the influence of the TNM cT-stage. Overall, a trend of impaired functional and symptom scores was found across all surveys with few significances (body image -10.6 percentage points (pp) after one year; defecation problems +13.5 pp, insomnia +10.2 pp and weight loss +9.8 pp after three years; defecation problems +11.3 pp after four years). cT4-stage patients lost significantly more weight than their cT1-3-stage counterparts (+10.7 to 13.7 pp). Further studies should be conducted to find possible causes and develop countermeasures for future major infectious diseases.

In the last two decades many detailed full transcriptomic studies on complex biological samples have been published and included in large gene expression repositories. These studies primarily provide bulk expression signal for each sample, including multiple cell-types mixed within the global signal. The cellular heterogeneity in these mixtures does not allow the activity of specific genes in specific cell types to be identified. Therefore, inferring relative cellular composition is a very powerful tool to achieve a more accurate molecular profiling of complex biological samples. In recent decades, computational techniques have been developed to solve this problem by applying cell deconvolution methods, designed to decompose cell mixtures into their cellular components and calculate the relative proportions of these elements. Some of them, only calculate the cell proportions (supervised methods), while other deconvolution algorithms can also identify the gene signatures specific for each cell type (unsupervised methods). In these work, five deconvolution methods (CIBERSORT, FARDEEP, DECONICA, LINSEED and ABIS) were implemented and used to analyze blood and immune cells, and also cancer cells, in complex mixture samples (using three bulk expression datasets). Our study provides three analytical tools (corrplots, cell-signature plots and bar-mixture plots) that allow a thorough comparative analysis of the cell mixture data. The work indicates that CIBERSORT is a robust method optimized for the identification of immune cell-types, but not as efficient in the identification of cancer cells. We also observed that LINSEED is a very powerful unsupervised method that provides precise and specific gene signatures for each of the five main immune cell-types analyzed: neutrophils and monocytes (in the myeloid lineage), B-cells, NK cells and T-cells (in the lymphoid lineage).

Dietary iron assimilation is critical for health and essential to prevent iron deficient states and related comorbidities, such as anemia. The bioavailability of iron is limited, while its absorption and metabolism are tightly controlled to keep body iron stores within a relatively narrow range. Genetic inactivation of the iron hormone hepcidin causes hereditary hemochromatosis, an endocrine disorder of iron overload characterized by chronic hyperabsorption of dietary iron, with deleterious clinical complications if untreated. The impact of high dietary iron intake and elevated body iron stores in the general population is not well understood. Herein, we summarize epidemiological data suggesting that high intake of heme iron, which is abundant in meat products, poses a risk factor for metabolic syndrome pathologies, cardiovascular diseases, and some cancers. We discuss clinical relevance and potential limitations of data from cohort studies, as well as the need to establish causality and elucidate molecular mechanisms.

In recent years, new therapies have been developed based on molecules that target mo-lecular mechanisms involved in both the initiation and maintenance of the oncogenic process. Among these molecules are the poly (ADP-ribose) polymerase 1 (PARP1) inhibitors. PARP1 has emerged as a target with great therapeutic potential for some tumor types, drawing attention to this enzyme and resulting in many small molecule inhibitors of its enzymatic activity. Thus, many PARP inhibitors are currently in clinical trials for the treatment of homologous recombina-tion (HR)-deficient tumors, BRCA-related cancers, taking advantage of synthetic lethality. In ad-dition, several novel cellular functions unrelated to its role in DNA repair have been described, including post-translational modification of transcription factors, or acting through pro-tein-protein interactions as a co-activator or co-repressor of transcription. Previously, we report-ed that this enzyme may play a key role as a transcriptional co-activator of an important compo-nent of cell cycle regulation, the transcription factor E2F1. Here, we show that PARP inhibitors, which interfere with its activity in cell cycle regulation, do so without affecting its enzymatic function.

Background Cancer is one of the most concerning public health issues in the world. One of cancer hallmarks wildly accepted is sustaining proliferative signaling, which involved most of the cell cycle biological activities. Centromeric histone, Centromere Protein A (CENPA), a variant of canonical histone H3, plays an essential role in selective chromosome segregation in the cell cycle. However, so far, a systematic pan-cancer bioinformatic analysis has not been done yet. Methods We accessed genome, transcriptome, and clinical information from open databases. The genetic alteration, mRNA expression, functional enrichment, stemness, mutation association, expression in cell populations and cellular locations, cell cycle association, survival association of CENPA, and immune association were analyzed. A prognostic model for glioma patients was constructed as an example application of CENPA as a biomarker. Drugs targeting CENPA in cancer cells were also screened and predicted by the CENPA correlation of drug sensitivity and protein-ligand docking. Results CENPA had low gene mutation in cancers. CENPA was overexpressed in almost all cancer types in TCGA compared to their normal control. CENPA was highly expressed in the nucleus of malignant cells. CENPA was associated with the cell cycle of cancer cells. CENPA is a biomarker for the cell cycle G2 phase in cancer cells. CENPA was a diagnostic and prognostic biomarker across multiple cancer types. The prognosis of glioma with CENPA was reliable and can be applied with other prognostic factors. CENPA was associated with the immune microenvironment. Drugs CD-437, 3-Cl-AHPC, Trametinib, BI-2536, and GSK461364 were predicted to target CENPA in cancer cells. Conclusion CENPA was a cell cycle biomarker in cancers with diagnostic and prognostic value.

This study was performed to synthesize multimodal radiopharmaceutical designed for the diagnosis and treatment of prostate cancer. To achieve this goal, Super Paramagnetic Iron Oxide (SPIO) nanoparticles were used as a platform for targeting molecule (PSMA-617) and for complexation of two scandium radionuclides, 44Sc for PET imaging and 47Sc for radionuclide therapy. TEM and XPS images showed that the Fe3O4 NPs have a uniform cubic shape and a diameter from 38 to 50 nm. The Fe3O4 core are surrounded by SiO2 and an organic layer. The saturation magnetization of the SPION core was 60 emu/g. However, coating the SPIONs with silica and polyglycerol reduces the magnetization significantly. The obtained bioconjugates were labeled with 44Sc and 47Sc, with a yield higher than 97%. The radiobioconjugate exhibited high affinity and cytotoxicity towards the human prostate cancer LNCaP (PSMA+) cell line, much higher than for PC-3 (PSMA-) cells. High cytotoxicity of the radiobioconjugate was confirmed by radiotoxicity studies on LNCaP 3D-spheroids. In addition, the magnetic properties of the radiobioconjugate should allow for its use in guide drug delivery driven by magnetic field gradient.

Apoptosis, also known as the programmed death of cells, is responsible for maintaining the homeostasis of tissues and this function is carried out by caspases. The process of apoptosis is carried out via two distinct pathways: the extrinsic pathway, which is governed by death receptors, and the intrinsic pathway, also known as the mitochondrial pathway. The BCL-2 protein family encoded by the BCL-2 gene, located at the 18q21.33 chromosomal location, is in charge of regulating the intrinsic pathway, which is responsible for inducing cell death via the permeabilization of the mitochondrial membrane and the release of apoptosis - inducing components. The BCL-2 homology (BH1, BH2, BH3, BH4) domains of this family proteins are crucial for their functioning and their common BH domains allow interactions between members of the same family and can also serve as indications of pro- or anti-apoptotic activity. A direct correlation may be shown between the overexpression of BCL-2 and the postponement of cell death. It has been determined that a change in the expression of BCL-2 is the root cause of a variety of malignancies, including lung, breast, melanoma, and chronic lymphocytic leukemia, Multiple Sclerosis, Diabetes. In this review, we discuss the therapeutic potential of regulating BCL-2 family connections and their relevance to health and disease.

Glioblastomas (GBM) are most common, primary brain tumors in adults. Despite advances in neurosurgery, radio- and chemotherapy, the median survival of GBM patients is 15 months. Recent large-scale genomic, transcriptomic and epigenetic analyses have shown the cellular and molecular heterogeneity of GBMs, which hampers the outcomes of standard therapies. We have established 13 GBM-derived cell cultures from fresh tumor specimens and characterized them molecularly using RNAseq, immunoblotting and immunocytochemistry. Evaluation of proneural (OLIG2, IDH1R132H, TP53 and PDGFRα), classical (EGFR) and mesenchymal markers (CHI3L1/YKL40, CD44 and phospho-STAT3), as well as expression of pluripotency (SOX2, OLIG2, NESTIN) and differentiation (GFAP, MAP2, β-Tubulin III) markers revealed the striking inter-tumor heterogeneity of primary GBM cell cultures. Upregulated expression of VIMENTIN, N-CADHERIN and CD44 at mRNA/protein levels suggested increased epithelial to mesenchymal transition (EMT) in most studied cell cultures. The effects of temozolomide (TMZ) or doxorubicin (DOX) were tested in three GBM-derived cell cultures with different methylation status of the MGMT promoter. Amongst TMZ- or DOX-treated cultures the strongest accumulation of apoptotic markers: caspase 7 and PARP were found in WG4 cells with methylated MGMT suggesting that its methylation status predicts vulnerability to both drugs. As many GBM-derived cells showed high EGFR levels, we tested the effects of AG1478, an EGFR inhibitor, on downstream signaling pathways. AG1478 caused decreased levels of phospho-STAT3, thus inhibition of active STAT3 augmented antitumor effects of DOX and TMZ in cells with methylated and intermediate status of MGMT. Altogether, our findings show that GBM-derived cell cultures mimic the considerable tumor heterogeneity and identifying patient-specific signaling vulnerabilities can assist in overcoming therapy resistance, by providing personalized combinatorial treatment recommendations.

Abstract. Marek's disease virus is an oncogenic avian herpesvirus and the problem of oncogenicity of this virus for humans remains unexplored. This pathology appeared in broiler chickens of 30 days and older, that is from now on the contact with poultry meat carries the risk of infecting people. This article analyzes the risks of the emergence of the epidemic potential of the Marek's disease virus in the Russian Federation taking into account the characteristics of modern pig and poultry farming. It was found that COVID 19 can serve as an additional factor in reducing the resistance of the population to herpesvirus infections. The COVID 19 epidemic is accompanied by folic acid deficiency which also increases the risk of contamination of diseases associated with DNA viruses, including an extended risk of animal viruse infection. Since, according to our estimates, Marek's disease occurred in at least 25% of broiler poultry farms in the Russian Federation, a possible expand in mortality from neoplasms of the reproductive system for the Russian Federation as a whole can contribute to the dynamics of oncological diseases of reproductive organs and breast cancer. Since 2011 a contagious form of intestinal pathology, vesicular enteritis, has widely spread at poultry farms in the Russian Federation. During periods of extending incidence of vesicular enteritis, we recorded cases of inflammation of the facial nerves and subfebrile temperature in contact persons, bursts of oncological diseases in veterinary personnel (ovarian cancer, breast cancer), abnormal and synchronous increases in the incidence of infectious larengotracheitis and Marek's disease in chickens under the age of 40 days which requires additional monitoring studies.

The current study aimed to investigate the antitumor effects and potent mechanism of cytokine-induced killer (CIK) cells combined with irreversible electroporation (IRE) via an in vitro function assay in an in vivo Panc02 cell–bearing mouse model. We established an in vitro culture assay for CIK cells and determined the proportions of different peripheral lymphocytes. The antitumor effect of the combination of IRE and CIK cells in a Panc02 pancreatic-cancer (PC) subcutaneous-xenograft model was investigated; tumor size and mouse survival rates were recorded. We used flow cytometry (FCM) to analyze the proportion of intratumoral lymphocytes, the expression of chemokine receptors, and the proliferative activity of CIK cells. The proportion of cells that were positive for clusters of differentiation 3 and 8 (CD3+CD8+) and the proportion of CD3+CD56+ cells were both significantly increased after 21 days of in vitro culture. Combined IRE/CIK cell treatment significantly inhibited tumor growth and increased the survival rate of Panc02 cell–bearing mice. Furthermore, infiltration of lymphocytes into tumor tissue was significantly increased by this combination therapy compared with the untreated group or monotherapy group. In addition, IRE significantly enhanced the expression of chemokine receptors elicited by, and the proliferative activity of, CIK cells. In conclusion, IRE combined with CIK cells showed superior antitumor efficacy in a PC subcutaneous-xenograft model, which we attributed to the promotion of lymphocytic infiltration, as well as to upregulation of chemokine receptor expression and of regulators of CIK cell proliferation.

Previously, we reported that MTH1 inhibitors TH588 and TH1579 selectively induce oxidative damage and kill Ras expressing or transforming cancer cells, as compared to non-transforming immortalized or primary cells. While this explains the impressive anti-cancer properties of the compounds, the molecular mechanism remains elusive. Oncogenes induce replication stress, re-sulting in under replicated DNA and replication continuing into mitosis, where TH588 and TH1579 treatment cause toxicity and incorporation of oxidative damage. Hence, we hypothesized that oncogene-induced replication stress explains the cancer selectivity. To test this, we overex-pressed c-Myc in human epithelial kidney cells (HA1EB), resulting in increased proliferation, polyploidy and replication stress. TH588 and TH1579 selectively kill c-Myc overexpressing clones, enforcing the cancer cell selective killing of these compounds. Moreover, the toxicity of TH588 and TH1579 in c-Myc overexpressing cells is rescued by transcription, proteasome or CDK1 inhibitors, but interestingly not by nucleoside supplementation. This suggest that cancer selectivity is unrelated oncogene-induced replication stress. We conclude that the molecular toxi-cological mechanisms how TH588 and TH1579 kill c-Myc overexpressing cells have several com-ponents and involves MTH1-independent proteosomal degradation of c-Myc itself, c-Myc driven transcription and CDK activation, and is likely unrelated to oncogene-induced replication stress.

Background: Oral cancer (OC) is serious health concerning issue that has a high fatality rate. The oral cavity has seven kinds of OC, including the lip, tongue, and floor of the mouth, as well as the buccal, hard palate, alveolar, retromolar trigone, and soft palate. The goal of this study is to look into new biomarkers and important pathways that might be used as diagnostic biomarkers and therapeutic candidates in OC. Methods: Publicly available repository the Gene Expression Omnibus (GEO) was responsible to collect OC-related datasets. GSE74530, GSE23558, and GSE3524 microarray datasets were collected to apply analysis. Minimum cut-off criteria of |log fold-change (FC)| > 1 and adjusted p < 0.05 were applied to figure out the up-regulated and down-regulated differential expression genes (DEGs) from the three datasets. After that only common DEGs in all three datasets were collected to apply further analysis. Gene ontology (GO) and Pathway analysis were implemented to explore the functional behaviors of DEGs. Then protein-protein interaction (PPI) networks were built to identify the most performed genes, clustering algorithm was also implemented to identify complex parts of PPI. TF-miRNA networks were also constructed to study deeply about OC-associated DEGs. Finally, top gene performers from PPI networks were used to apply drug signature analysis. Results: After applying filtration and cut-off criteria 2508, 3377, and 670 DEGs were found for GSE74530, GSE23558, and GSE3524 respectively, and 166 common DEGs were found in every dataset. The GO annotation remarks that most of the DEGs were associated with the terms of type I interferon signaling pathway. The pathways of KEGG reported that the common DEGs are related to the Cell cycle and Influenza A. The PPI network holds 88 nodes and 492 edges and CDC6 had the highest number of connections. 4 clusters were identified from the PPI. Drug signatures doxorubicin and resveratrol showed high significance according to the hub genes. We anticipate that our bioinformatics research will aid in the definition of the pathophysiology and the development of new therapies for OC.

From the formalism of the thermodynamics of irreversible processes and the theory of complex systems, characterization of longevity and aging and its relationship with the emergence and evolution of cancer was carried out. It was found that: 1. The rate of entropy production can be used as an index of robustness, plasticity, the aggressiveness of cancer, and as a measure of biological age; 2. The aging process, as well as the evolution of cancer, goes through what we have called “biological phase transition”; 3. The process of metastasis, which occurs through epithelial-mesenchymal transition (EMT), appears as a phase transition far from thermodynamic equilibrium and exhibits Shilnikov chaos-like dynamic behavior. This dynamic guarantees the robustness of the process and, in turn, its unpredictability; 4. It was shown that as the ferroptosis process is strengthened, the complexity of the dynamics associated with the emergence and evolution of cancer decreases. The theoretical framework developed contributes to a better understanding of the biophysical-chemical phenomena of longevity and aging and their relationship with cancer.

Triple-negative breast cancer (TNBC) is characterized by an active immune response. We evalu-ated intratumoral interrelation between FOXP3+ tumor-infiltrating lymphocytes and other cy-tokines in TNBC. Network analysis refined cytokines significantly correlate with FOPX3 in TNBC. Treatment response and prognosis imformation of patients and survival data from the TGCA and METABRIC databases were analyzed according to refined cytokines. Interleukin (IL)-33 was sig-nificantly expressed by TNBC cell lines than luminal cell lines (log2 fold change: 5.31, p <0.001) and IL-33 and TGFB2 showed a strong correlation with FOXP3 in the TNBC cell line. Immunohisto-chemistry demonstrated IL-33 high group was a significant predictor of complete response of neoadjuvant chemotherapy (odds ratio (OR) 4.12, p<0.05) and a favorable survival compared to IL-33 low group (OR 6.48, p<0.05) in TNBC. Survival data from TGCA and METABRIC revealed that FOXP3 was a significantly favorable marker in IL-33 high group com-pared to the low IL-33 low group (hazard ratio (HR) 2.1, p=0.02), and IL-33 high/TGFB2 high subgroup showed significant favorable prognosis in the FOXP3 high group compared to the FOPX3 low group in TNBC (HR 3.5, p=0.01). IL-33 and TGFB2 were key cytokines of intratumoral interrelation among FOXP3 in TNBC.

Papillary thyroid cancer (PTC) is the most common endocrine malignancy which diagnosis and recurrences still challenge clinicians. New perspectives to overcome those issues could come from the study of extracellular vesicles (EVs) populations and content. Here, we aimed to elucidate the heterogeneity of EVs circulating in tumor and the changes in their microRNA content during cancer progression. Using a mouse model expressing BRAF^V600E, we isolated and characterized EVs from thyroid tissue by ultracentrifugations and elucidated their microRNA content by small RNA sequencing. Cellular origin of EVs was investigated by ExoView and that of deregulated EV-microRNA by qPCR on FACS-sorted cell populations. We found that PTC released more EVs bearing epithelial and immune markers, as compared to healthy thyroid, and that changes in EV-microRNAs abundance were mainly due to their deregulated expression in thyrocytes. Pathway analysis showed that the more abundant EV-microRNAs could impact on immune processes. Altogether, our work provides a full description of in vivo-derived EVs produced by, and within, normal and cancerous thyroid. We elucidated the global EV-microRNAs signature, the dynamic loading of microRNAs in EVs upon BRAF^V600E induction, and their cellular origin. Thyroid tumor-derived EV-microRNAs could support the establishment of a permissive immune microenvironment.

Background: A growing number of clinical practice guidelines (CPGs) with regards to non-pharmacological interventions for breast cancer survivors are available. However, given the limitations in guideline development methodologies and inconsistency of recommendations, it remains uncertain how best to design and implement such non-pharmacological strategies to tailor interventions for breast cancer survivors with varied health conditions, healthcare needs, and preferences. Aim: To critically appraise and summarise available non-pharmacological interventions for symptom management and health promotion that can be self-managed by breast cancer survivors based on the recommendations of the CPGs. Methods: Clinical practice guidelines which were published between January 2016 and September 2021 and described non-pharmacological interventions for breast cancer survivors were systematically searched in six electronic databases, nine relevant guideline databases, and five cancer care society websites. The quality of the included CPGs was assessed by four evaluators using the Appraisal of Guidelines for REsearch and Evaluation, second edition tool. Content analysis was conducted to synthesise the characteristics of the non-pharmacological interventions that were recommended by the included CPGs, such as the intervention’s form, duration and frequency, level of evidence, grade of recommendation, and source of evidence. Results: Fourteen CPGs were identified and analysed. Of the 14 CPGs appraised, only five were rated as high quality. The domain with the highest standardised percentage was “scope and purpose” (84.61%), while the “applicability” domain had the lowest standardised percentage (51.04%). Five guidelines were assessed as “recommended”, seven were rated as “recommended with modifications”, and the remaining two were considered “not recommended”. Regarding the content analysis, physical activity/exercise, meditation, hypnosis, yoga, music therapy, stress management, relaxation, massage, and acupressure were the common self-managed non-pharmacological interventions recommended by the 14 CPGs. Physical activity/exercise was the only self-managed non-pharmacological intervention that was mostly recommended for psychological and physical symptom management by the included CPGs. However, there were significant disparities in terms of level of evidence and grade of recommendation in the included CPGs. Conclusion: The recommendations for the self-managed non-pharmacological interventions were varied and limited among the 14 CPGs, and some were based on medium- and low-quality evidence. More rigorous methods are required to develop high-quality CPGs in order to guide clinicians in offering high-quality and tailored breast cancer survivorship care.

Skin cancer is an exquisite disease globally nowadays. Because of the poor contrast and apparent resemblance between skin and lesions, automatic identification of skin cancer is complicated. The rate of human death can be massively reduced if melanoma skin cancer can be detected quickly using dermoscopy images. In this research, an anisotropic diffusion filtering method is used on dermoscopy images to remove multiplicative speckle noise and the fast-bounding box (FBB) method is applied to segment the skin cancer region. Furthermore, the paper consists of two feature extractor parts. One of the two features extractor parts is the hybrid feature extractor (HFE) part and another is the convolutional neural network VGG19 based CNN feature extractor part. The HFE portion combines three feature extraction approaches into a single fused feature vector: Histogram-Oriented Gradient (HOG), Local Binary Pattern (LBP), and Speed Up Robust Feature (SURF). The CNN method also is used to extract additional features from test and training datasets. This two-feature vector is fused to design the classification model. This classifier performs the classification of dermoscopy images whether it is melanoma or non-melanoma skin cancer. The proposed methodology is performed on two ordinary datasets and achieved the accuracy 99.85%, sensitivity 91.65%, and specificity 95.70%, which makes it more successful than previous machine learning algorithms.

More than twenty-five years ago the Global Solar UV index (UVI) has been introduced as a simple means of visualizing the intensity of ultraviolet radiation and to alert people to the need for sun protection. In our survey among directors of 436 kindergartens in southern Germany we investigated the level of awareness and knowledge about the UVI as well as the practical consequences for sun protection in kindergartens. Less than half of the directors (n=208, 47.7%) had ever heard of the UVI, and only a small minority of them (n=34, 8.7%) used the daily UVI information to adapt sun protective measures in their kindergartens. Detailed knowledge about the UVI was a rarity among the respondents. The proportion of respondents with self-perceived detailed UVI knowledge was five times higher than actual knowledge assessed by an in-depth structured interview using open-ended questions about the UVI (14.2% vs. 2.8%). No clear relationship of UVI awareness, knowledge, and use to directors' age and gender was found. The UVI-related variables also showed no association with directors' knowledge of risk factors for skin cancer and their attitudes towards tanned skin. Overall, the results paint a sobering picture regarding the penetration of the UVI into sun protection policies of German kindergartens. Future public health campaigns should target increasing awareness and understanding of the UVI as well as its importance for sun protection of children.

We performed Bayesian network meta-analysis (NMA) to suggest frontline treatments for patients with high PD-L1 expression (at least 50%). A total of 5,237 patients from 22 studies were included in this NMA. In terms of progression-free survival, immune checkpoint inhibitors (ICIs) plus bevacizumab plus chemotherapy had the highest surface under the cumulative ranking curve (SUCRA) value (98.1%), followed by ICI plus chemotherapy (82.9%). In terms of overall survival (OS), dual immunotherapy plus chemotherapy had the highest SUCRA value (79.1%), followed by ICI plus bevacizumab plus chemotherapy (73.4%). However, there was no significant difference of survival outcomes among treatment regimens combined with immunotherapy. Moreover, ICI plus chemotherapy failed to reveal a significant OS superiority to ICI monotherapy (hazard ratio = 0.978, 95% credible internal: 0.771-1.259). In conclusion, this NMA indicates that ICI plus chemotherapy with/without bevacizumab might to be the best options in terms of OS for NSCLC with high PD-L1 expression. Considering there was no significant difference of survival outcomes among treatment regimens incorporating immunotherapy and ICI plus chemotherapy failed to show significant survival benefits over ICI monotherapy, however, ICI monotherapy may be reasonable as first-line treatment for advanced NSCLC with high PD-L1 expression and no targetable aberrations.

Studies have shown that STK11 mutation plays a critical role in affecting the lung adenocarcinoma (LUAD) tumor immune environment. By training an Inception-Resnet-v2 deep convolutional neural network model, we were able to classify STK11-mutated and wild type LUAD tumor histopathology images with a promising accuracy (per slide AUROC=0.795). Dimensional reduction of the activation maps before the output layer of the test set images revealed that fewer immune cells were accumulated around cancer cells in STK11-mutation cases. Our study demonstrated that deep convolutional network model can automatically identify STK11 mutations based on histopathology slides and confirmed that the immune cell density was the main feature used by the model to distinguish STK11-mutated cases.

Within phototherapy, a grand challenge in clinical cancer treatments is to develop a simple, cost-effective, and biocompatible approach to treat this disease using ultra-low doses of light. Carbon-based materials (CBM), such as graphene oxide (GO), reduced GO (r-GO), graphene quantum dots (GQDs), and carbon dots (C-DOTs), are rapidly emerging as a new class of thera-peutic materials against cancer. This mini-review summarizes the progress in lasts years re-garding the applications of CBM in photodynamic (PDT) and photothermal (PTT) therapies for tumor destruction. The current understanding of the performance of modified CBM, hybrids and composites, is also addressed. This approach seeks to achieve an enhanced healing action by im-proving and modulating the properties of CBM to treat various types of cancer. Metal oxides, organic molecules, biopolymers, therapeutic drugs, among others, have been combined with CBM to treat cancer by PDT, PTT, or synergistic therapies.

Complete pathologic response (pCR) predicts the long-term outcome of neoadjuvant treated (NAC) breast cancer (BC) but is reached in <10% of hormone-receptor-positive patients. Biomarkers able to guide adjustment or interruption of an ineffective therapy are desired. Here, we evaluated whether shifts in the serum concentration of thymidine kinase 1 (sTK1) during NAC could be utilized as a biomarker. In the PROMIX trial, women with localized HER2- BC received neoadjuvant epirubicin/docetaxel in six cycles. sTK1 was measured with an ELISA in 54 patients at cycles 1-4 and in a total of 131 patients before and 48h after cycle 1. The prognostic significance of the results was evaluated by log-rank tests of Kaplan–Meier estimates. Treatment resulted in a 2-fold increase of sTK1 before and 3-fold increase 48h after the cycles, except for the first cycle, where half of patients reacted with a decrease (post/pre sTK1- ratio <1.12) and the other half reacted with an increase (ratio >1.12). OS rates in ER+ patients with ratios of >1.12 and <1.12 were 97.7% and 78% (p=0.005), respectively, and DFS rates were 90.7% and 68% (p=0.006), respectively. Thus, response of sTK1 at the first cycle of chemotherapy could be used both as an early biomarker for guidance of chemotherapy and for the study of inherent tumor chemo-sensitivity, which could predict long-term outcome prior to therapy.

Abstract: Perihilar cholangiocarcinoma (phCC) is the most common type of cholangiocarcinoma, accounting for approximately 60 % of cases, followed by the distal and then the intrahepatic forms. There is not a staging system that allows comparation of all series and extract some conclusions to increase the long-survival rate in this dismal disease. The extension of the resection, which theoretically dependes on the type of phCC, is not closed subject. As surgery is the only known way to achieve a cure, many aggressive approachs have been adopted. Despite extended liver resections and even vascular resections, margins are positive in around one third of patients. In the past two decades, with advances in diagnostic and surgical techniques, the surgical outcomes and survival rates have gradually improved, although variability is the rule, with morbidity and mortality rates ranging from 14% to 76% and from 0% to 19%, respectively. Extended hepatectomies and portal vein resection even right hepatic artery reconstruction for the left side tumors are frequently needed. Salvage procedures when arterial reconstruction is not feasible, as well as hepatopancreatoduodenectomy, are still under evaluation too. In this article, we discuss the aggressive surgical approach to phCC focused on vascular resection. Disparate results on the surgical treatment of phCC made it impossible to reach clear-cut conclusions.

Background: Ovarian cancer (OC) represents the eighth most common cancer and the fifth leading cause of cancer-related deaths among the female population. In the advanced setting, chemotherapy represents the first-choice treatment, despite a high recurrence rate. In the last ten years, immunotherapy based on immune checkpoint inhibitors (ICIs) has profoundly modified the therapeutic scenario of many solid tumors. We sought to summarize the main findings regarding the clinical use of ICIs in the OC. Methods: We searched the PubMed, Embase, and Cochrane Databases, and conference abstracts from international congresses (such as ASCO, ESMO, SGO) for clinical trials, focusing on ICIs both as monotherapy and as combinations in the advanced OC. Results: 20 studies were selected, of which 16 were phase I or II and 4 phase III trials. ICIs targeting PD1 (nivolumab, pembrolizumab), PD-L1 (avelumab, atezolizumab, durvalumab), and CTLA4 (ipilimumab, tremelimumab) were employed. No significant survival improvement was achieved; conversely, early terminations due to futility or toxicity were recorded. Combinations with chemotherapy, anti-VEGF, and, overall, PARP-inhibitors seem feasible and enhance the response rate and survival, notwithstanding a worse safety profile. Conclusions: The identification of biomarkers with a predictive role for ICIs’ efficacy is mandatory. Moreover, genomic and immune profiling of the OC might lead to an improved treatments selection and design of tailored trials.

Due to their well-defined plasmonic properties, gold nanorods (GNRs) can be fabricated with optimal light absorption in the near-infrared region of the electromagnetic spectrum, which make them suitable for cancer-related theranostic applications. However, their controversial safety profile, as a result of surfactant stabilization during synthesis, limits their clinical translation. We report a facile method to improve GNR biocompatibility through the presence of sodium dodecyl sulfate (SDS). GNRs (120 x 40 nm) were synthesized through a seed-mediated approach, using cetyltrimethylammonium bromide (CTAB) as a cationic surfactant to direct the growth of nanorods and stabilize the particles. Post-synthesis, SDS was used as an exchange ligand to modify the net surface charge of the particles from positive to negative while maintaining rod stability in an aqueous environment. GNR cytotoxic effects, as well as the mechanisms of their cellular uptake, were examined in two different cancer cell lines, Lewis lung carcinoma (LLC) and HeLa cells. We not only found a significant dose-dependent effect of GNR treatment on cell viability but also a time-dependent effect of GNR surfactant charge on cytotoxicity over the two cell lines. Our results promote a better understanding of how we can mediate the undesired consequences of GNR synthesis byproducts when exposed to a living organism, which so far has limited GNR use in cancer theranostics.

(1) Background: Mouse-mammary tumor virus (MMTV) might play a role in the etiology of some breast cancers in humans. The purpose of our study was to identify MMTV DNA sequences in breast tissue samples from breast cancer patients operated in our regional center from Romania. (2) Methods: We have selected 75 patients with non-metastatic breast cancer treated with curative intent and searched with PCR the MMTV-like DNA sequence in the breast cancer tissue and normal breast tissue obtained from the same patients. (3) Results: None of the examined samples was positive for MMTV-like target sequences on PCR. (4) Conclusions: We could not prove that MMTV plays a role in the etiology of breast cancer in our patient group. This finding is similar to findings of other geographically related research groups and might be due to the fact that only the Mus musculus domesticus mouse species was proven to carry infectious MMTV, but not the Mus musculus musculus species, which is specific to South-Eastern Europe and some parts of Asia.

Objective: To investigate the protein expression levels of cyclin‑dependent kinase subunit 2 (CKS2) and cluster of differentiation (CD) 47 in gastric cancer (GC) and their clinical significances. Methods: A total of 126 GC patients who underwent radical resection were selected as study subjects. Additionally, 32 patients with benign gastric tumor, 42 patients with low-grade intraepithelial neoplasia (LGIEN), and 49 patients with high-grade intraepithelial neoplasia (HGIEN) who underwent surgery were selected as the control groups. Immunohistochemistry was used to detect the expression of CKS2 and CD47 in surgical specimens. We statistically analyzed the clinical significance of the expression of the two factors. Results: (1) The positivity rates for CKS2 in benign gastric tumor tissue, LGIEN tissue, HGIEN tissue, and GC tissue gradually increased, i.e., 6.3% (2/32), 30.9% (13/42), 38.8% (19/49), and 60.3% (76/126), respectively, and the positivity rates for CD47 were 18.8% (6/32), 38.1% (16/42), 46.9% (23/49), and 65.9% (83/126), respectively. (2) High expression of CKS2 and CD47 were associated with tumor diameter, Lauren classification, number of lymph node metastases, and TNM stage. In addition, the immunohistochemical scores for CKS2 and CD47 were positively correlated (r=0.625, P=0.000). (3) The median follow-up time of 126 patients was 46.5 months, and the overall survival rate was 40.5% (51/126). Survival analysis showed that compared with that in the CKS2 (-) group, the overall survival rate for patients in the CKS2 (+) group was significantly worse (25.0% vs 64.0%, 2=15.67, P=0.000) and that compared with the CD47 (-) group, the CD47 (+) group had significantly worse overall survival (30.1% vs 60.5%, 2=15.67, P=0.000). (4) The overall survival rates of CKS2(+)CD47(+) group, CKS2(+)CD47(-) group, CKS2(-)CD47(+) group, and CKS2 (-)CD47 (-) group were 20.0%(13/65), 58.3%(7/12), 57.1%(8/14), 65.7% (23/35), respectively, the prognosis of patients in CKS2(+)CD47(+) group was significantly poor. Conclusion: High expression levels of CKS2 and CD47 were closely related to the occurrence of GC and can be used as independent risk factors to assess the prognosis of patients.

The aim of this study was to determine whether a rowing training program improved the quantity and quality of physical activity and quality of life in female breast cancer survivors (stage I - 4.35%; II - 30.43%; III - 52.17%; and IV - 8.7%) diagnosed 6.57 ± 5.02 years previously, who had undergone a subsequent intervention (preservation 53.52%; total mastectomy 39.13% and double mastectomy 4.35%) and had a current mean age of 53.70 ± 7.88 years. The participants (N = 30) engaged in a 12-week training program, each week comprising three sessions and each session lasting 60-90 minutes. An anthropometric evaluation was performed before and after the program. The short form of the International Physical Activity Questionnaire (IPAQ-SF) and the Short Form 36 Health Survey (SF-36) were also administered. The results showed statistically significant improvements in levels of physical activity and in the dimensions of quality of life. We can conclude that a 12-week rowing training program tailored to women who have had breast cancer increases physical activity levels, leading to improved health status and quality of life.

Dietary factors play an important role in shaping the gut microbiome which, in turn, regulates the molecular events in colonic mucosa. The composition and resulting metabolism of the gut microbiome have been implicated in the development of colorectal cancer (CRC). Diets low in dietary fibers and phytomolecules as well as other lifestyle-related factors may predispose to CRC. Emerging evidence demonstrates that the predominance of microbes, such as Fusobacterium nucleatum, can predispose the colonic mucosa to malignant transformation. Dietary and lifestyle modifications have been demonstrated to restrict the growth of potentially harmful opportunistic organisms. In this study, we aim to present evidence regarding the relationship of dietary factors to the gut microbiome and development of CRC.

The aim of this study was to determine whether a rowing training program improved the quantity and quality of physical activity and quality of life in female breast cancer survivors (stage I - 4.35%; II - 30.43%; III - 52.17%; and IV - 8.7%) diagnosed 6.57 ± 5.02 years previously, who had undergone a subsequent intervention (preservation 53.52%; total mastectomy 39.13% and double mastectomy 4.35%) and had a current mean age of 53.70 ± 7.88 years. The participants (N = 30) engaged in a 12-week training program, each week comprising three sessions and each session lasting 60-90 minutes. An anthropometric evaluation was performed before and after the program. The short form of the International Physical Activity Questionnaire (IPAQ-SF) and the Short Form 36 Health Survey (SF-36) were also administered. The results showed statistically significant improvements in levels of physical activity and in the dimensions of quality of life. We can conclude that a 12-week rowing training program tailored to women who have had breast cancer increases physical activity levels, leading to improved health status and quality of life.

Germline mutations in predisposition genes account for only 20% of all familial colorectal cancer (CRC) and the remaining genetic burden may be due to rare high-to-moderate-penetrance germline variants that are not explored. With the aim of identifying such potential cancer predisposing variants, we performed whole exome sequencing on three CRC cases and three unaffected members of a Polish family and identified two novel heterozygous variants; a coding variant in APC down-regulated 1 gene (APCDD1, p.R299H) and a non-coding variant in the 5’ untranslated region (UTR) of histone deacetylase 5 gene (HDAC5). Sanger sequencing confirmed the variants segregating with the disease and Taqman assays revealed 8 additional APCDD1 variants in a cohort of 1705 familial CRC patients and no further HDAC5 variants. Proliferation assays indicated an insignificant proliferative impact for the APCDD1 variant. Luciferase reporter assays using the HDAC5 variant resulted in an enhanced promoter activity. Targeting of transcription factor binding sites of SNAI-2 and TCF4 interrupted by HDAC5 variant showed a significant impact of TCF4 on promoter activity of mutated HDAC5. Our findings contribute not only to the identification of unrecognized genetic causes of familial CRC but also underline the importance of 5´UTR variants affecting transcriptional regulation and the pathogenesis of complex disorders.

Conformal radiotherapy is a primary treatment in head and neck cancer, which putative adverse effects depend on relatively low doses of radiation delivered to increased volumes of normal tissues. Systemic effects of such treatment include radiation-induced changes in serum lipid profile, yet dose- and volume-dependence of these changes remain to be established. Here we analyzed levels of choline-containing phospholipids in serum samples collected consecutively during the radiotherapy used as the only treatment modality. The LC-MS approach applied in the study enabled the detection and quantitation of 151 phospholipids, including (lyso)phosphatidylcholines and sphingomyelins. No statistically significant differences were found in the pre-treatment samples from patients with different location and stage of cancer. To compensate for potential differences between schemes of radiotherapy the biologically effective doses were calculated and used in the search of correlations with specific lipid levels. We found that the levels of several phospholipids depended on the maximum dose delivered to the gross tumor volume and total radiation energy absorbed by the patient’s body. Increased doses correlated with increased levels of sphingomyelins and reduced levels of phosphatidylcholines. Noteworthy, serum phospholipid levels were associated mainly with volumes of normal tissues irradiated with relatively low doses (i.e., total accumulated dose 20 Gy), which indicated the importance of such effects on the systemic response of the patient’s organism to IMRT.

In patients with presumed pancreatic ductal adenocarcinoma (PDAC), biomarkers that may open for personalised, risk-adapted treatment are lacking. The study analysed the impact of circulating tumour cells (CTCs) on the patterns of recurrence and survival in 98 patients resected for PDAC with 5-10 years of follow-up. Preoperative samples were analysed by the CellSearch® system for EpCAM+/DAPI+/CK+/CD45- CTCs. CTCs were detected in 7 of the 98 patients. CTCs predicted a significantly shorter median DFS of 3.3 vs. 9.2 months and a median CSS of 6.3 vs. 18.5 months. Relapse status was confirmed by imaging for 87 patients. Of these, 58 developed distant metastases (DM) and 29 cases isolated local recurrence (ILR) as first event. All patients with CTCs experienced DM. pN-status and histological grade &gt;2 were other independent risk factors for DM, but only CTCs predicted significantly shorter cancer-specific, disease-free and post-recurrence survival. We conclude that CTC presence in resected PDAC patients predicted early distant metastasis and impaired survival. The impact of CTCs was comparable to that of histopathological risk factors and exceeded the effect size of other preoperative parameters. Thus, preoperative CTCs alone or in combination with histopathological factors may guide initial treatment decisions in patients with resectable PDAC in the future.

Sporadic colorectal cancer (CRC) develops through distinct molecular events. Loss of 18q chromosome is a conspicuous event in the progression of adenoma to carcinoma. There is limited information regarding the molecular effectors of this event. Earlier, we had reported ATP8B1 as a novel gene associated with CRC. ATP8B1 belongs to the family of P-type ATPases (P4 ATPase) that primarily function to facilitate the translocation of phospholipids. In this study, we attempt to implicate ATP8B1 gene located on chromosome 18q as a tumor suppressor gene. We studied indigenous patient data and confirmed the reduced expression of ATP8B1 in tumor samples. CRC cell lines were engineered with reduced and enhanced levels of ATP8B1 which provided a tool to study its role on cancer progression. Forced reduction of ATP8B1 expression either by CRISPR/Cas9 or shRNA was associated with increased growth and proliferation of CRC cell line - HT29. In contrast, overexpression of ATP8B1 resulted in reduced growth and proliferation of SW480 cell line. We generated a network of genes that are downstream of ATP8B1. Further, we provide predicted effect of modulation of ATP8B1 levels on this network and possible effect on fatty acid metabolism related genes. These results provide evidence in support of ATP8B1 being a tumor suppressor that may affect fatty acid metabolism in CRC.

Fibroblasts, the most abundant cells in the connective tissue, are key modulators of the extracellular matrix (ECM) composition. These spindle-shaped cells are capable of synthesizing various extracellular matrix proteins and collagen. They also provide the structural framework (stroma) for tissues and play a pivotal role in the wound healing process. While they are maintainers of the ECM turnover and regulate several physiological processes, they can also undergo transformations responding to certain stimuli and display aggressive phenotypes that contribute to disease pathophysiology. In this review, we focus on the metabolic pathways of glucose and highlight metabolic reprogramming as a critical event that contributes to the transition of fibroblasts from quiescent to activated and aggressive cells. We also cover the emerging evidence that allows us to draw parallels between fibroblasts in autoimmune disorders and more specifically in rheumatoid arthritis and cancer. We link the metabolic changes of fibroblasts to the toxic environment created by the disease condition and discuss how targeting of metabolic reprogramming could be employed in the treatment of such diseases. Lastly, we discuss Systems Biology approaches, and more specifically, computational modelling, as a means to elucidate pathogenetic mechanisms and accelerate the identification of novel therapeutic targets.

There is a major clinical need for accurate biomarkers for prostate cancer prognosis, to better inform treatment strategies and disease monitoring. Current clinically recognised prognostic factors, including prostate-specific antigen (PSA) levels, lack sensitivity and specificity in distinguishing aggressive from indolent disease, particularly in patients with localised intermediate grade prostate cancer. There has therefore been a major focus on identifying molecular biomarkers that can add prognostic value to existing markers, including investigation of DNA methylation, which has a known role in tumorigenesis. In this review, we will provide a comprehensive overview of the current state of DNA methylation biomarker studies in prostate cancer prognosis, and highlight the advances that have been made in this field. We cover the numerous studies into well-established candidate genes, and explore the technological transition that has enabled hypothesis-free genome-wide studies and the subsequent discovery of novel prognostic genes.

Although oncolytic viruses are currently being evaluated for cancer treatment in clinical trials, systemic administration is hindered by many factors that prevent them from reaching the tumor cells. When administered systemically, mesenchymal stem cells (MSCs) target tumors, and therefore constitute good cell carriers for oncolytic viruses. Methods: MSCs were primed with trichostatin A under hypoxia, which upregulated the expression of CXCR4, a chemokine receptor involved in tumor tropism, and coxsackievirus and adenovirus receptor that plays an important role in adenoviral infection. After priming, MSCs were loaded with conditionally replicative adenovirus that exhibits limited proliferation in cells with a functional p53 pathway and encodes Escherichia coli nitroreductase (NTR) enzymes (CRAdNTR) for targeting tumor cells. Results: Primed MSCs increased tumor tropism and susceptibility to adenoviral infection, and successfully protected CRAdNTR from neutralization by anti-Adenovirus antibodies both in vitro and in vivo, and specifically targeted p53-deficient colorectal tumors when infused intravenously. Analyses of deproteinized tissues by UPLC-MS/QTOF revealed that these MSCs converted the co-administered prodrug CB1954 into cytotoxic metabolites, such as 4-hydroxylamine and 2-amine, inducing oncolysis and tumor growth inhibition without being toxic for the host vital organs. Conclusion: This study shows that the combination of oncolytic viruses delivered by MSCs with the activation of prodrugs is a new cancer treatment strategy that provides a new approach for the development of oncolytic viral therapy for various cancers.

Lung cancer is known as lung carcinoma. It is a disease which is malignant tumor leading to the uncontrolled cell growth in the lung tissue. Lung Cancer disease is one of the most prominent cause of death in all over world. Early detection of this disease can assist medical care unit as well as physicians to provide counter measures to the patients. The objective of this paper is to approach an automated tool that takes influential causes of lung cancer as input and detect patients with higher probabilities of being affected by this disease. A neural network classifier accompanied by cross-validation technique is proposed in this paper as a predictive tool. Later, this proposed method is compared with another baseline classifier Gradient Boosting Classifier in order to justify the prediction performance.