Sensitive and precise nucleic acid detection is critical for clinical diagnostics and biotechnological advancements. Diagnostic in infectious disease field is very unique from diagnosing any other disease, that is time is of the essence; in outbreaks people die even with each passing hour in some cases, if the correct diagnosis wasn't make; for example Zika in particularly is a very challenging virus to diagnose, because it's in very few numbers of copies in the infected person, so it need high sensitive diagnostic approach to spot it, In particular, the advanced tools SHERLOCKv2 and DETECTR, give almost an immediate detection of attomolar amounts of pathogenic nucleic acids with specificity similar to that of PCR but with slight technical settings and that will guide the correct intervention for the patient. SHERLOCKv2 and DETECTR technologies are game changers for our ability to identify infectious disease and rapid detection of tumor DNA or cancer-related viruses with ultra-sensitive tests that don’t require a lot of complicated processing to go through. In this paper, we will review cutting-edge infectious disease diagnosis by CRISPR-Cas systems.

Recent evidence suggests the existence of shared neural resources for rhythm processing in language and music. Such overlaps could be the basis of the facilitating effect of regular musical rhythm on spoken word processing previously reported for typical children and adults, as well as adults with Parkinson’s disease and children with developmental language disorders. The present study builds upon these previous findings by examining whether musical rhythmic priming also influences visual word processing, and the extent to which such cross-modal priming effect of rhythm is related to individual differences in musical aptitude and reading skills. EEG was recorded while participants listened to a rhythmic tone prime, followed by a visual target word with a stress pattern that either matched or mismatched the rhythmic structure of the auditory prime. Participants were also administered standardized assessments of musical aptitude and reading achievement. ERPs elicited by target words with a mismatching stress pattern showed an increased fronto-central negativity. Additionally, the size of the negative effect correlated with individual differences in musical rhythm aptitude and reading comprehension skills. Results support the existence of shared neurocognitive resources for linguistic and musical rhythm processing, and have important implications for the use of rhythm-based activities for reading interventions.

To this day, use of oily eye drops and non-invasive retinal delivery remains a major challenge. Oily eye drops usually cause ocular irritation and interfere with normal function of the eye, while ocular injections for retinal drug delivery cause significant adverse effects and a high burden on the healthcare system. Here the authors report a novel topical Non-Invasive Ocular Delivery Platform (NIODP) through the periorbital skin for high efficiency anterior and posterior ocular delivery in a non-human primate model (NHP). A single dose of about 7mg JV-MD2 (omega-3 DHA) via the NIODP reached the retina at Cmax of 111µg/g and the cornea at Cmax of 66µg/g. NIODP also delivered JV-DE1, an anti-inflammatory agent in development for dry eye diseases, as efficiently as eye drops did to anterior segments of NHP. The topical NIODP seems to transport drug candidates through the cornea pathway to the anterior and via the conjunctiva/sclera pathway to the posterior segments of the eye. The novel NIODP method has the potential to reshape the landscape of ocular drug delivery, especially for oily eye drops and retinal delivery, where the success of treatment lies in the ocular tolerability and bioavailability of drugs in the target tissue.

NF-κB is a central mediator of inflammation, response to DNA damage and oxidative stress. As a result of its central role in so many important cellular processes, NF-κB dysregulation has been implicated in the pathology of important human diseases. NF-κB activation causes inappropriate inflammatory responses in diseases including rheumatoid arthritis (RA) and multiple sclerosis (MS). Thus, modulation of NF-κB signaling is being widely investigated as an approach to treat chronic inflammatory diseases, autoimmunity and cancer. The emergence of COVID-19 in late 2019, the subsequent pandemic and the huge clinical burden of patients with life-threatening SARS-CoV-2 pneumonia led to a massive scramble to repurpose existing medicines to treat lung inflammation in a wide range of healthcare systems. These efforts continue and these efforts continue to be con-troversial. Drug repurposing strategies are a promising alternative to de-novo drug development, as they minimize drug development timelines and reduce the risk of failure due to unexpected side effects. Different experimental approaches have been applied to identify existing medicines which inhibit NF-κB that could be repurposed as anti-inflammatory drugs.

The proliferation of SARS-COV-2 through enhanced viral replication and its subsequent triggering of cytokine storm, are some of the hallmark phenotypes in severe COVID-19 patient cases. Cyclosporine, an immunosuppressant drug and Selinexor, an inhibitor of nuclear transporter protein, both have been successfully demonstrated to be effective against SARS-COV-2 infection by targeting those functions individually. However, the highly multifactorial pathology of SARS-COV-2 infection hinders any mono-therapeutic strategy to become an optimal option. In this study, we assess the potential efficacy of the Cyclosporine-Selinexor combination on an integrated interactome by adopting a network-medicine-based repositioning technique, where disease proximity, functional proximity and their topological separation are evaluated, followed by a robust statistical significance test. Results have shown that both drug target modules are highly proximal to the SARS-COV-2 disease modules in terms of network topology and functional associations, in a statistically significant manner, individually. Functional enrichment of both drug modules and SARS-COV-2 infected modules has shown that two drugs target the functions related to viral replication and cytokine storm during infection. Moreover, a high degree of network separation been those two drug target modules has been observed, revealing ``complementary exposure`` patterns, rendering this drug combination as an effective one against SARS-COV-2 infection. We hope that our results will encourage researchers to further investigate the potency of Cyclosporine and Selinexor combination in vivo or in vitro, and ultimately lead that up to clinical trials to treat SARS-COV-2 patients.

The primary purpose of this study was to determine the prevalence of drug-drug interaction (DDI) and duplicate therapy in chronic patients in a completely random study population engaged in digital health apps. In this cross-sectional study, polypharmacy checks for 100 completely anonymous patients were analyzed for the occurrence of DDIs and duplicate therapy. Logistic regression models were used to identify factors associated with DDIs and duplicate therapy. DDIs and duplicate therapy prevalence were 34% and 33%, respectively. Chi-Square test discovered a significant association between the DDIs and duplicate therapy variables. Logistic regression models showed a strong association between the number of medications taken and higher odds of DDIs occurring in our population only. In conclusion, our study shows that polypharmacy is a determining factor for the occurrence of unwanted DDIs, and the prevalence of duplicate therapy and DDIs is around 33%, increasing an issue regarding patient safety and its burden to the healthcare system.

The link between language processing and motor systems has been the focus of increasing interest to Cognitive Neuroscience. Some classical papers studying Event Related Potentials (ERPs) induced by linguistic stimuli have found differences in electrophysiological activity when comparing action and non-action words; more specifically, a bigger p200 for action words. On the other hand, a series of studies have validated the use of a grip force sensor (GFS) to measure language-induced motor activity during both isolated words and sentence listening, finding that action words induce an augmentation in the grip force around 250-300 ms after the onset of the stimulus. The purpose of the present study is to combine both techniques to assess if the p200 is related to the augmentation of the grip force measured by a GFS. We measured ERP and GFS changes elicited by listening to action and non-action words while maintaining an active grasping task in 10 healthy subjects. Our results show that the amplitude of the p200 in central electrodes is correlated to the augmentation in the GFS around 300 ms induced by linguistic stimuli. To our knowledge, this is the first study where the electrophysiological activity and the changes in the grip force induced by auditory language processing are put together, opening new venues of interpretation for the sensorimotor interaction in language processing.

Multiple myeloma (MM) accounts for about 10 to 15% of all diagnosed hematologic malignancies and about 1-2% of all cancer cases. Approximately 80-90% of MM patients develop bone disease and the changes rarely regress. It is only possible to stop or slow their progression. A major role in bone destruction in MM is attributed to the Wnt signaling pathway, and its action can be modified by various types of interventions including training and diet. Therefore, the aim of this project was to evaluate the effects of a Nordic Walking (NW) training cycle and intermittent fasting (IF) on the levels of selected bone turnover markers associated with the Wnt pathway in patients with MM. Results from 35 patients divided into training (NW and IF NW) and non-training (IF and control) groups were included in the analysis. A 6-week training cycle involving 60-minute workouts 3 times a week was conducted. Body mass and composition and the levels of: vitamin D, calcium and phosphorus, beta2-microglobulin and albumin were examined before and after completion of training cycle. Markers of bone turnover were also determined: sclerostin (SOST), Dickkopf-related protein 1 (DKK-1), osteoprotegrin (OPG), osteopontin (OPN) and Tartrate-resistant acid phos-phatase 5b (TRACP 5b). There was no negative effect of IF or combined training and fasting on the nutritional status of the patients (the level of albumines was unchanged). Both training groups showed an increase in serum concentrations of the active metabolite of vitamin D (IF NW and NW: p=0.001 and p=0.022, re-spectively). The change in the concentration of this vitamin negatively correlated with the con-centration of TRACP 5b (r=-0.413, p=0.014). Evaluating the concentrations of markers related to bone turnover, a reduction in the concentrations of SOST (time: p=0.026, time vs. group: p=0.033) and TRACP 5b (time: p

There are dozens of approved, investigational and experimental antiviral agents. Many of these agents cause serious side effects, which can be revealed only after drug administration. Identification of the side effects prior to drug administration is challenging. Here we describe an ex vivo approach for studying immuno- and neuro-modulatory properties of antiviral agents, which could be associated with potential side effects of these therapeutics. The approach combines drug toxicity/efficacy tests and transcriptomics, which is followed by cytokine and metabolite profiling. We demonstrated the utility of this approach with several examples of antiviral agents. We also showed that the approach can utilize different immune stimuli and cell types. It can also include other omics techniques, such as genomics and epigenomics, to allow identification of individual markers associated with adverse reactions to antivirals with immuno- and neuro-modulatory properties.

Online transportation services, initially presented as an innovative employment approach by categorizing workers as 'independent contractors', have come to be recognized for their exploitative nature. The notion of 'flexibility' suggests that workers have the autonomy to tailor their hours and location according to their income goals. However, this disguises the true situation for informal workers who lack rights and protections. This study delves into these issues from a psychological standpoint to uncover the mental and emotional interplay between the motivations and exploitation experienced by online drivers affiliated with multiple platforms. The study adopts a qualitative methodology with a phenomenological lens. Data was gathered through thorough interviews, observations, and document analysis, with Interpretative Phenomenological Analysis (IPA) employed as the data analysis technique. The study's participants were five male multi-platform online drivers from the Special Region of Yogyakarta, ranging in age from 18 to 64, and had been associated with at least two platforms for more than a year. The findings highlight two primary themes: firstly, the decision to join multiple platforms is chiefly driven by economic reasons, including a decline in orders, daily earnings, bonus incomes, and the conclusion of the initial profitable phase. Secondly, the exploitative conditions are linked to the platforms' algorithms, which exert control and influence the psychological state of the drivers. Nonetheless, the participants have developed effective strategies to manage fatigue, anxiety, and stress.

Pancreatic cancer is an intractable disease with the worst prognosis of all cancers. The currently used treatment regimens do not significantly impact patient survival, and therefore, effective treatment strategies are urgently needed. Drug repurposing, which identifies new indications for existing and approved drugs, has proven to be a promising approach to anti-cancer drug discovery. Indeed the antihelmintic drug, pyrvinium pamoate has shown promise as an anti-pancreatic cancer drug, but to date, the inhibition of mitochondrial function is the only mechanism of action described in pancreatic cancer. This study showed, using pancreatic cancer 2D cell cultures and 3D spheroids, that pyrvinium pamoate exhibited short- and long-term cytotoxicity, inhibited epithelial-to-mesenchymal transition and cell invasion and migration. Mechanistically, pyrvinium pamoate induced DNA damage, inhibited the PI3K/AKT cell survival pathway, and triggered cell cycle arrests, as well as apoptotic and autophagic cell death. Importantly, pyrvinium pamoate acted synergistically with the first-line drug, gemcitabine in 2D and 3D pancreatic cancer cell culture models. This study provided evidence that pyrvinium pamoate is effective as a single agent and in combination with gemcitabine for the treatment of pancreatic cancer.

Our bodies produce a host of electrophilic species that can label specific endogenous proteins in cells. The signaling roles of these molecules are underactive debate. However, in our opinion it is becoming increasingly likely that electrophiles can rewire cellular signaling processes at endogenous levels. Attention is turning more to understanding how nuanced electrophile signaling in cells is. In this perspective, we describe recent work from our laboratory that has started to inform on different levels of context-specific regulation of proteins by electrophiles. We discuss the relevance of these data to the field, and to the broader application of electrophile signaling to precision medicine development, beyond the traditional views of their pleiotropic cytotoxic roles.

Lung cancer (LC) is one of the leading causes of cancer occurrence and mortality worldwide. Treatment of patients with advanced and metastatic LC presents a significant challenge as malignant cells use different mechanisms to resist chemotherapy. Drug resistance (DR) is a complex process that occurs due to a variety of genetic and acquired factors. Identifying the mechanisms underlying DR in LC patients and possible therapeutic alternatives for more efficient therapy is a central goal of LC research. Advances in nanotechnology resulted in the development of targeted and multifunctional nanoscale drug constructs. The possible modulation of the components of nanomedicine, their surface functionalization, and encapsulation of various active therapeutics provide promising tools to bypass crucial biological barriers. These attributes enhance the delivery of multiple therapeutic agents directly to the tumor microenvironment (TME), resulting in reversal of LC resistance to anticancer treatment. This review provides a broad framework for understanding the different molecular mechanisms of DR in lung cancer; presents novel nanomedicine therapeutics aimed to improve the efficacy of treatment of various forms of resistant LC; outlines current challenges in using nanotechnology for reversing DR; and discusses the future directions for clinical application of nanomedicine in management of LC resistance.

The up-and-coming microfluidic technology is the most promising platform for designing anti-cancer drugs and new point-of-care diagnostics. Compared to conventional drug screening methods based on Petri dishes and animal studies, drug delivery in microfluidic systems has many advantages. For instance, these platforms offer high throughput drug screening, require a small amount of samples, provide an in vivo-like microenvironment for cells, and eliminate ethical issues associated with animal studies. Multiple cell cultures in microfluidic chips could better mimic the 3D tumor environment using low reagents consumption. The clinical experiments have shown that combinatorial drug treatments have a better therapeutic effect than monodrug therapy. So many attempts were performed in this field in the last decade. This review highlights the applications of microfluidic chips in anti-cancer drug screening and systematically categorizes these systems as a function of sample size and combination of drug screening. Finally, it provides a perspective on the future of the clinical applications of microfluidic systems for anti-cancer drug development.

Overexpression of BRF2, a selective subunit of RNA polymerase III, has been shown to be crucial in the development of several types of cancers, including breast cancer and lung squamous cell carcinoma . Predominately, BRF2 acts as a central redox-sensing transcription factor (TF) and is involved in rescuing oxidative stress (OS) -induced apoptosis. Here, we showed a novel link between BRF2 and DNA damage response. Due to the lack of BRF2 specific inhibitors, through virtual and molecular dynamics screening, we identified potential drug candidates that interfere with BRF2-TATA-binding Protein (TBP)-DNA complex interactions based on binding energy, intermolecular, and torsional energy parameters. We experimentally tested Bexarotene as a potential BRF2 inhibitor. We found that Bexarotene (Bex) treatment resulted in a dramatic decline in oxidative stress (Tert-butylhydroquinone (tBHQ))-induced levels of BRF2 and consequently, lead to a decrease in cellular proliferation of cancer cells which may in part be due to drug pretreatment induced reduction of ROS generated by the oxidizing agent. Our data thus, provide the first experimental evidence that BRF2 is a novel player in DNA damage response pathway and Bexarotene can be used as a potential inhibitor to treat cancers with the specific elevation of oxidative stress.

Background: drugs provide a significant benefit; however, their use implies an intrinsic potential danger, with the possibility to cause unwanted effects. These effects are known as adverse drug reactions (ADRs). Post-marketing drug safety surveillance detects unknown risks that have not been identified in clinical trials and it is necessary to monitor marketed medications under real-life practice. Due to the scarce information about fixed combination of ciprofloxacin 0.3% / dexamethasone 0.1% (SDO), we performed a drug safety surveillance study. (2) Methods: A prospective non-controlled drug safety surveillance study was conducted in Peruvian population. A total of 236 patients prescribed SDO were included derivates from 12 sites. Patients' standardized information was collected through two phone calls, including demographics, medical history, prescribing patterns of SDO, concomitant medication, and ADRs in detail. The ADRs were classified by causality and severity, followed by outcome measures to identify new risk. (3) Results: 236 patients prescribed with SDO participated in the study and 220 were included. A total of 82 ADRs/220 patients were reported after the use of SDO, presenting a ratio 0.37 ADR/patient. The most frequent ADR with SDO administration was eye irritation (30%). The totality of the ADR was classified as non-serious, and the 97.5% (n=80) was classified as mild and 2.5% as moderate (n=2). No cases under the severe category were identified. (4) Conclusion: No new risks were found in the population where this study was conducted.

Despite available global efforts and funding, Tuberculosis (TB) continues to affect a considerable number of patients worldwide. Policy makers and stakeholders set clear goals to reduce TB incidence and mortality, but the emergence of multidrug-resistant TB (MDR-TB) and extensively drug-resistant TB (XDR-TB) complicate the reach of these goals. Drug-resistance TB needs to be diagnosed rapidly and accurately to effectively treat patients, prevent the transmission of MDR-TB, minimise mortality, reduce treatment costs and avoid unnecessary hospitalisations. In this narrative review, we provide a comprehensive overview of laboratory methods for detecting drug resistance in MTB, focusing on phenotypic, molecular and other drug susceptibility testing (DST) techniques. We found a large variety of methods used, with the BACTEC MGIT 960 being the most common phenotypic DST and the Xpert MTB/RIF being the most common molecular DST. We emphasise the importance of integrating phenotypic and molecular DST to address issues like resistance to new drugs, heteroresistance, mixed infections and low-level resistance mutations. Notably, most of the analysed studies adhered to the outdated definition of XDR-TB and did not consider the pre-XDR definition, thus posing challenges in aligning diagnostic methods with the current landscape of TB resistance.

Apathy is a fundamental neuropsychiatric symptom of Korsakoff’s syndrome (KS) and has also been reported in patients with alcohol use disorder with no (AUD) or less severe cognitive disorders (ALC). However, research on the nature of apathy is limited in these groups. Aim of this study was to examine the multidimensional nature of apathy in patients with KS, ALC and AUD. Moreover, we examined differences between apathy ratings by patients and their professional caregivers, and related apathy to everyday functioning and overall cognition. Twenty-four patients with KS, 24 patients with ALC and 21 patients with AUD participated in this study. Apathy was measured using the Apathy Motivation Index (AMI), which distinguishes behavioral, emotional and social apathy. Both patients and professional caregivers reported social apathy as most prominent symptom, compared to behavioral and emotional apathy. Apathy ratings did not differ across the three patient groups. Discrepancies between patient and caregiver ratings were observed in patients with KS and ALC, with more severe apathy reported by caregivers. Caregiver-reported behavioral and social, but not emotional, apathy was related to everyday functioning. These results show that apathy is present in a substantial proportion of patients with alcohol addiction with or without cognitive impairments.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Age-related macular degeneration (AMD) is a leading cause of irreversible blindness world-wide. We recently reported that polyethylene glycol (PEG) can activate the alternative pathway of the complement system and induce choroidal neovascularization (CNV) in mice. Currently, no other investigator has demonstrated CNV after PEG injection in the mouse eye. The aim of this article is twofold: we review the histologic changes in mouse retina and retinal pigmented epithelium (RPE) after treatment with PEG, and we summarize a model of wet and dry AMD pathogenesis in mice through subretinal PEG treatment of RPE cells and retinal layers. We injected (subretinal) male C57BL/6 mice with 2 μL of solution containing 0.5 mg and 1.0 mg of PEG or PBS in control groups. Eyes were harvested at day 1, 3 and 5 after injection and processed for analysis. Sections were immunohistochemically stained for complement component C3, mem-brane attack complex (MAC), and cytokeratin 18. Light and laser confocal microscopy was used for image capturing. PEG increased deposition of C3 and MAC on RPE cells and on all retinal layers after 1.0 mg injection. PEG induced loss of cellular contacts between RPE cells and migration of RPE cells in the subretinal space at day 1 after PEG injection. After 0.5 mg PEG injection, increased size of RPE cells was detected at day 3 and 5. Apoptotic bodies were observed in outer nuclear layer at day 3 and 5 after 0.5 mg PEG treatment. RPE cells with dark cytoplasm and condensed chromatin were observed. Higher doses of PEG induce CNV, encouraged RPE cell proliferation and death, and damage photoreceptors in mice. This simple and fast model may be useful to explore the pathogenesis of both dry and wet AMD.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

With a highly efficient optical absorption capability, bismuth selenide (Bi2Se3) nanomaterial can be used as an outstanding photothermal agent for anti-tumor treatment and shows promise in the field of nanotechnology-based biomedicine. However, little research has been done on the relevant mechanism underlying the photothermal killing effect of Bi2Se3 nanomaterial. Herein, the photothermal effects of Bi2Se3 nanoparticles on A549 cells were explored with emphasis put on autophagy. Firstly, we characterized the structure and physicochemical property of the synthesized Bi2Se3 and confirmed their excellent photothermal conversion efficiency (35.72%), photostability, biocompatibility and ability of photothermal killing on A549 cells. Enhanced autophagy was detected in Bi2Se3-exposed cells under an 808 nm laser. Consistently, an elevated expression ratio of LC3-II to LC3-I, a marker of autophagy occurrence, was induced in Bi2Se3-exposed cells upon NIR irradiation. Meanwhile, the expression of cleaved-PARP was increased in the irradiated cells dependently on the exposure concentrations of Bi2Se3 nanoparticles. Pharmacological inhibition of autophagy by 3-methyladenine (3-MA) further strengthened the photothermal killing effect of Bi2Se3. Meanwhile, stress-related signaling pathways including p38 and SAPK/JNK were activated coupled with the attenuated PI3K/Akt signaling. Our study figures out that autophagy and the activation of stress-related signaling pathways were involved in the photothermal killing of cancerous cells by Bi2Se3, which provides a more understanding of photothermal nanomaterials.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The recent covid crisis has proven important lessons for academia and industry regarding digital reorganization. Among fascinating lessons from these times is the huge potential of data analytics and artificial intelligence. The crisis exponentially accelerated the adoption of analytics and artificial intelligence, and this momentum is predicted to continue into the 2020s and over. Moreover, drug development is a costly and time-consuming business, and only a minority of approved drugs return the revenue that exceeds the research and development costs. As a result, there is a huge drive to make drug discovery cheaper and faster. With modern algorithms and hardware, it is not too surprising that the new technologies of artificial intelligence and other computational simulation tools can help drug developers. In only two years of covid research, many novel molecules have been designed/identified using artificial intelligence methods with astonishing results in terms of time and effectiveness. This paper will review the most significant research on artificial intelligence in the de novo drug design for COVID-19 pharmaceutical research.

As the global population ages, the prevalence of neurodegenerative diseases has become a major public health concern. The adoption of a less sedentary lifestyle has been shown to have a beneficial effect on cognitive decline, but the molecular mechanisms responsible are less clear. Here we provide a detailed analysis of the complex molecular, cellular, and systemic mechanisms underlying age-related cognitive decline and how lifestyle choices influence these processes. A review of the evidence from animal models, human studies, and postmortem analyses emphasizes the importance of integrating physical exercise with cognitive, multisensory, and motor stimulation as part of a multifaceted approach to mitigating cognitive decline. We highlight the potential of these non-pharmacological interventions to address key aging hallmarks—such as genomic instability, telomere attrition, and neuroinflammation—and underscore the need for comprehensive and personalized strategies to promote cognitive resilience and healthy aging.

Abstract: Sarcopenia poses a significant challenge to public health and can severely impact the quality of life of aging populations. Despite extensive efforts to study muscle degeneration using traditional animal models, there is still a lack of effective diagnostic tools, precise biomarkers, and treatments for sarcopenia. Zebrafish models have emerged as powerful tools in biomedical research, providing unique insights into age-related muscle disorders like sarcopenia. The advantages of using zebrafish models include their rapid growth outside of the embryo, optical transparency during early developmental stages, high reproductive potential, ease of husbandry, compact size, and genetic tractability. By deepening our understanding of the molecular processes underlying sarcopenia, we may develop novel diagnostic tools and effective treatments that can improve the lives of aging individuals affected by this condition. This review aims to explore the unique advantages of zebrafish as a model for sarcopenia research, highlight recent breakthroughs, outline potential avenues for future investigations, and emphasize the distinctive contributions that zebrafish models offer. Our research endeavors to contribute significantly to addressing the urgent need for practical solutions to the impact of sarcopenia on aging populations, ultimately striving to enhance the quality of life for individuals affected by this condition.

The current 2019-2021 marine pharmacology literature review provides a continuation of previous reviews covering the period 1998 to 2018. Preclinical marine pharmacology research during 2019-2021 was published by researchers in 42 countries and contributed novel mechanism of action pharmacology for 171 structurally characterized marine compounds. The peer-reviewed marine natural products pharmacology literature reported antibacterial, antifungal, antiprotozoal, antituberculosis,and antiviral mechanism of action studies for 49 compounds, 87 compounds with antidiabetic and anti-inflammatory activities as well as affecting the immune and nervous system, while another group of 51 compounds demonstrated novel miscellaneous mechanisms of action, which upon further investigation, may contribute to several pharmacological classes. Thus, in 2019-2021, a very active preclinical marine natural product pharmacology pipeline provided novel mechanism of actions as well as new lead chemistry for the clinical marine pharmaceutical pipeline targeting the therapy of several disease categories.

This paper explores the transformative impact of computational pharmaceutics, integrating AI, multi-scale modeling, quantum computing, AI-driven drug discovery, and blockchain frameworks. Molecular dynamics simulations provide insights into atomic behaviors crucial for drug design. Quantum computing reduces computational costs for simulating protein-drug interactions. AI and Graph Neural Networks accelerate drug discovery and personalized medicine. Blockchain frameworks facilitate secure pharmacogenetic data sharing. These advancements revolutionize drug development, offering unprecedented efficiency, innovation, and personalized treatments.

The treatment of peptides has played an important role in clinical practice since the discovery of insulin therapy in the 1920s. Over 60 peptide drugs are approved in the United States (US and other regional mar-kets, and peptides continue to undergo drug discovery steadily. Peptide research and development has lev-eraged a wider range of structures known from other plant sources, via pharmacology and medicinal molecular biology, beyond its conventional focus on individual endogenous peptides. We build a comprehensive database of peptides that have met scientific studies with more than 150 constantly evolving peptides. Here we provide a simple overview of the peptide-based drug therapy environment, comprising evolutionary points of view, structural properties, operational thresholds, and explanation of the therapeutic area.

ABSTRACT Introduction: Traditional penile venous surgery and enhancement have been controversial. Based on De Novo penile fibrovascular assembly, we report on penile venous stripping (PVS) and factual penile girth enhancement (FPGE). Methods: From 2013 to 2023, 18 men underwent PVS and FPGE, all confirmed with veno-occlusive dysfunction (VOD). PVS involves the stripping of erection-related veins. FPGE was performed along the tunica albuginea bilaterally; then, the two tunic defects were repaired with a 70.0x30.0 mm venous stripe and covered with either autologous venous walls (AVW, n=10) or Surgiform (SF, n=8). The penile girth was measured, and radio-opaque contrast was used. The abridged 5-item version of the International Index of Erectile Function (IIEF-5) score and the Erection Hardness Scale (EHS) were used yearly during follow-up via the Internet. Results: The follow-up period was 5.3±1.5 years. Radiopacity was consistently enhanced. Although there was indifference between AVW and SF, there was a significant improvement (both P＜0.01) in IIEF-5 and EHS scores (9.7±2.8 vs. 20.8±2.3; 1.7±0.6 vs. 3.2±0.2, respectively). Both the diameters of the glans and penile shaft increased (28.0±2.3mm and 28.3±2.1mm vs 35.3±2.2mm and 36.3±2.1mm respectively). The satisfaction rate was 81.3% (13/16). Conclusions: This novel combination of PVS and FPGE is promising, although a larger sample size is needed for further validation.

Carbon nanodots (CNDs) have garnered significant attention as viable drug delivery vehicles in recent years, especially in the field of phytomedicine. Although there is much promise for therapeutic applications with phytomedicine, its effectiveness is frequently restricted by its low solubility, stability, and bioavailability. This paper offers a thorough synopsis of the developing field of phytomedicine drug delivery based on CND. It explores CND synthesis processes, surface functionalization strategies, and structural and optical characteristics. Additionally, the advantages and difficulties of phytomedicine are examined, with a focus on the contribution of drug delivery methods to the increased effectiveness of phytomedicine. The applications of CNDs in drug delivery are also included in the review, along with the mechanisms that underlie their improved drug delivery capabilities. Additionally, it looks at controlled release methods, stability augmentation, and phytomedicine loading tactics onto CNDs. The potential of polymeric carbon nanodots in drug delivery is also covered, along with difficulties and prospective directions going forward, such as resolving toxicity and biocompatibility issues. In summary, the present review highlights the encouraging contribution of CNDs to the field of drug delivery, specifically in enhancing the potential of phytomedicine for therapeutic purposes.

In northern Thailand, the problem of small particulate matter happens every year, with the pri-mary source being agricultural weed burning and wildfire. The tourism industry is strongly impacted and has been the spotlight for the past few years. Thus, the study aims to investigate the effect of small particulate matter on tourism and related SMEs in Chiang Mai, Thailand. The data was collected from 286 entrepreneurs in the tourism and related SMEs sectors. The data was analyzed using data mining and association rule techniques. The study revealed that small particulate matter has a considerable impact on customer factors, especially the number of customers has decreased. Operational factors and prod-uct/service factors are also affected by the dust in the form of adjustments to keep the business running and the protection of the health of employees and customers. Certainly, financial factors are affected by the small particulate matter situation, both lower revenues and higher costs.

Daphne wolongensis described on the basis of a few known individuals was investigated in the wild, in Baoxing Valey, Sechuan. Its status of valid species was verified morphologically and genetically. Three newly found populations were compared to the closely related species Daphne retusa, D. tangutica, D. longilobata, D. acutiloba, D. sureil, to clones available in cultivation and selected cultivars. The high bootstrap values indicate a good level of genetic differentiation between each of the studied species. The hypothesis whether D. wolongensis is a hybridogenous species was rejected, it is a well-defined independent species. Based on morphological and genetic data, it seems likely that another species, D. limprichtii can be a mountain form of D. tangutica. Variability of populations in Wolong gives a good opportunity to select genotypes with a higher or better performance of combination of traits. From 51samples collected in Wolong it was possible to select the top ten different types as genetic resources for breeding. Daphne wolongensis, in the visited sites of Wolong area, occupies less than 1 km2. Together with isolated finds, the number of found individuals is less than 500 and the area is not larger than 10 km2, thus it falls to the IUCN category of “Critically Endangered” plants.

Infectious illnesses have always posed a threat to human health, with tuberculosis being a major concern. The use of various medications and antibiotics in the fight against such TB has led to the emergence of drug-resistant tuberculosis, which has become increasingly difficult to manage. While there have been a few studies and proposed conceptual models on how to manage and prevent various drug-resistant TB mutations and lineages, a model aimed at limiting and con-trolling such mutations in rural areas burdened with tuberculosis is lacking. This study seeks to map a model that is to be used to bridge the gap by facilitating the exchange of knowledge among healthcare professionals in healthcare facilities, diagnostic laboratories, and research institutes, particularly for underprivileged communities in the Eastern Cape. The model will also serve as a guide to monitor and evaluate epidemiological TB management plans.

Increasing environmental distress is associated with a growing asthma incidence and, with no treatments available, montelukast (MTK) – an antagonist of the cysteinyl leukotrienes receptor 1 – is widely used in the management of symptoms among adults and children. Recently, new molecular targets have been identified and MTK has been proposed for repurposing in other therapeutic applications, with several ongoing clinical trials. The proposed applications include neuroinflammation control, which could be explored in some neurodegenerative disorders, such as Alzheimer’s and Parkinson’s diseases (AD and PD). However, this drug has been associated with an increasing number of reported neuropsychiatric adverse drug reactions. Besides, and despite being on the market since 1998, MTK metabolism is still poorly understood and the mechanisms underlying neuropsychiatric ADRs remain unknown. We review the role of MTK as modulator of leukotriene pathways and systematize the knowledge about MTK metabolism. Known toxic effects of MTK are discussed, and repurposing applications are presented comprehensively, with a focus on AD and PD.

Many approaches have been developed over time to counter the bioavailability limitations of poorly soluble drugs. With advances in nanotechnology in recent decades, science and industry have been approaching this issue through the formulation of drugs as nanocrystals, which consist of pure drugs and a minimum of surface active agents required for stabilization. They are carrier-free submicron colloidal drug delivery systems with a mean particle size in the nanometer range, typically between 10 and 800 nm. By reducing particle size to nanoscale, the particle surface area available for the molecule dissolution in the direction of dissolution medium is increased, and thus bioavailability is enhanced. This approach has proven successful, as demonstrated by the number of such drug products on the market. R&D and industry have offered many technological solutions to reduce the particle size to nanoscale, and also devised solutions for the handling of particle of nanodimensions, such as methods to accurately measure nanoparticle size and techniques to prevent physicochemical and stability related problems, such as aggregation. The present work provides an overview of the more recent achievements in improving the bioavailability of poorly soluble drugs according to their administration route, and describes the methods developed to overcome physicochemical and stability related problems.

Garment sector has crucial working field in Turkey.It has also very high risky occupational health conditions and safety.The objective of this study is to define level of job level, work-related stress’ symptoms, social support and coping mechanisms of garment workers and to determine any related factors.This study is descriptive and cross-sectional. The study population comprised garment workers in the 16-65 age range. The data was collected by Assessment Form, The Brief Stress Coping Profile and Brief Job Stress Questionnaire. The level of work-related stress was statistically higher among the workers who had chronic disease, low economic, education status and poor quality of sleep. Psychological and physical physiological reactions to stress were found higher among women workers and those with chronic disease.It also was seen that job stress scores had a meaningful relationship with “emotional expression involving others” (r =.20) and “Avoidance and suppression” coping profile (r =.16; p <.01).Psychological symptom scores were found to have a low level of meaningful relationship with “Seeking help for solution” (r =-.08), “changing point of view” (r=.13) and “emotional expression involving others” coping profiles (r=.21). Work-related stress causes many health and behavioral problems. Work related reasons and coping profiles have powerful effects on stress.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] &gt; 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p &lt; 0.05) in scores by health/bonding groups. Convergent validity was supported (r &gt; 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

(1) Background: Hemispherotomy is the generally accepted treatment for hemispheric drug resistant epilepsy (DRE). Lateral or vertical approaches are performed according to the surgeon's preference. Multiples technical variations have been proposed since Delalande first described his vertical technique. We propose a sub-insular variation of the vertical parasagittal hemispherotomy (VPH) and describe our case series of patients operated on with this procedure. (2) Methods: a continuous series of patients operated on by the senior author (CR) with the modified sub-insular VPH was retrospectively analyzed. We report the demographic pre-operative characteristics, epilepsy and functional outcome as well as the surgical complications.(3) Results: Twenty-five patients were operated on between August 2008 and August 2023, twenty-three of them have at least a 3-month follow-up. On this last group 86,3% of patients were seizure-free. Only two patients developed post-operative hydrocephalus (8.7%), all patients with autonomous preoperative walk and 86,3% of the total series were able to walk without assistance (86.3%) and perform adapted social activities at last follow-up.(4) Conclusion: The modified vertical parasagittal sub-insular hemispherotomy is a successful surgical technique for hemispheric DRE with seizure freedom rates similar to the biggest series reported in the literature. Compared to other series, patients operated with our modified technique had a lower rate of postoperative hydrocephalus and excellent long-term motor and cognitive outcome.

Europium (Eu)-doped fluorapatite (FA) nanorods has a similar biocompatibility with hydroxyapatite (HA) in terms, attracted much attention as cell imaging biomaterials due to their luminescent property. Here, we will discuss the new feature of europium doped fluorapatite (Eu-FA) nanorods as anticancer drug carrier. Eu-FA nanorods was prepared using a hydrothermal method. The morphology, crystal structure, fluorescence and composition are investigated. The specific crystal structure, enabling an effective loading of drug molecules. Doxorubicin (DOX), used as an anticancer model drug, was shown to be effectively loaded onto the surface of the nanorods. The DOX release was fairly pH-dependent, occurring more rapidly at pH 5.5 than pH 7.4 was observed. The intracellular penetration of the DOX-loaded Eu-FA nanorods (Eu-FA/DOX) can be imaged in situ due to the self-fluorescence property. Treatment of melanoma A375 cells with Eu-FA/DOX elicited a more effective apoptosis rate than direct DOX treatment. Overall, Eu-FA show great promise for tracking and treating tumor, may potentially useful as a multifunctional carrier system to effectively load and sustainably deliver drugs.

BackgroundThe present review summarizes the state-of-the-art of in silico methods and techniques that are the most useful in drug discovery, their relationship with data science, as well as the successful application of data science, machine learning (ML) and artificial intelligence (AI) applications. A meta-analysis of the various technologies available is furthermore proposed as a guideline for the non-expert, reader relative to the several subject areas is also discussed in this article. The scope of this meta-analysis is to rank the enlisted technologies by their field of applications and to depict the latter according to knowledge accessibility, from students to experts.Method The search strategy utilized for this review first produced a general collection of 900 papers without duplications, which were subsequently streamlined and divided into two independent collections: the top 300 most-cited papers of all time (since 2000) and the papers with the highest interest for a systematic review analysis (high-impact exciting papers). Results In Part 1, we discuss the most cited and quality 97 articles in these top 300 papers most relevant to the field of in silico drug discovery. The different disciplines are listed according to their industrial and economic incurred to society, independently from the “metric” results of how many new drug approvals (NDAs) each discipline has generated to date.ConclusionBig data, the ensemble of known items stored in publicly available databases, has improved our understanding of the many fates of a potential drug candidate during its development and even after its commercialization. Moreover, the combination of new screening techniques and “omics” with old drugs has led to a new paradigm in which the unknown knowledge of any biological molecule and its cellular structure, now plays an important role as a target for a series of yet-to-be-developed drugs: the chemical space. Furthermore, leveraging big data, data science, ML, and AI can revolutionize drug discovery by swiftly analyzing massive datasets, predicting efficacy and safety profiles, streamlining development, cutting costs, and boosting success rates for new drugs. AI also speeds up the search for promising drug candidates, advancing innovative therapies.

A superparamagnetic graphene oxide based drug carrier Fe3O4@SiO2/N–rGO was prepared through surface modification, material doping, and composite methods. This carrier has a large number of active sites, suitable for loading anticancer drugs, It can increase the drug load. Currently, the widely used drug in clinical use is epirubicin hydrochloride (EPI). The graphene based complex has a pH sensitive property and exhibits a pH sensitive property at pH=4.3. The release efficiency (RE) is 77.4%, making it suitable for drug release in cancerous acidic liquids. The physicochemical properties of drug carriers were studied using X–ray diffraction, Raman spectroscopy, and Fourier transform infrared spectroscopy. Electrochemical signals confirm that the anticancer drug EPI acts on the graphene plane through hydrogen bond interactions and π – π stacking.

Patient access to new oncology drugs in Canada is only possible after navigating multiple sequential systemic checkpoints for national regulatory approval, health technology assessment (HTA) and collective government price negotiation. These steps delay access and prevent health care providers from being able to prescribe optimal therapy. Eighteen Canadian oncology clinicians from the medicine, nursing and pharmacy professions met to develop consensus recommendations for defining reasonable government performance standards around process and timeliness to improve Canadian cancer patients’ access to best care. A modified Delphi methodology was used to confirm strong consensus on 30 questions involving five themes: accountability, disparities, endpoints, timeliness, and cost-effectiveness. It was agreed that greater transparency is required across regulatory and HTA processes. Health professionals in oncology are frustrated for their patients because they are unable to deliver the modern guideline-supported therapies they want to provide due to delays in approval or funding. Canadian patients and their health care providers request improvements in timely access to life-saving therapeutics in line with other countries. Clinicians expect urgent improvements in our health systems to give our patients their best chance of survival.

The emergence of resistance to first-line antimalarial drugs calls for development of new therapies for drug-resistant malaria. The efficacy of quinoline-based antimalarial drugs has prompted the development of novel quinolines. A panel of 4-aminoquinoline hydrazone analogues were tested on Plasmodium falciparum strains: IC50 values after a 48-hour cycle ranged from 0.60 - 49 µM, while the 72-hour cycle ranged from 26-219 nM on the multi-drug resistant K1 strain. Time-course assays were carried out to define the activity of the lead compounds which inhibited over 50 % growth in 24 hours and 90% growth in 72 hours. Cytotoxicity assays with HepG2 cells showed IC50 values of 0.87-11.1 M, whereas in MDBK cells IC50 values ranged from 1.66-11.7 M. High selectivity indices were observed for the lead compounds screened at 72 hours on P. falciparum. Analyses of stage-specificity revealed that the ring stage of the parasite life cycle were most affected. Based on antimalarial efficacy and in vitro safety profiles, lead compound 4-(2-benzylidenehydrazinyl)-6-methoxy-2-methylquinoline 2 was progressed to drug combination studies for the detection of synergism, with a combinatory index of 0.599 at IC90 for the combination of with artemether, indicating a synergistic antimalarial activity. Compound 2 was screened on different strains of P. falciparum (3D7, Dd2) which maintained similar activity to K1, suggesting no cross-resistance between multi-drug resistance and sensitive parasite strains. In vivo analysis with 2 showed suppression of parasitaemia with P. yoelii NL treated mice (20 mg/kg and 5 mg/kg).

Orthodontic appliances may cause discomfort for patients. It could influence person‘s psychological well–being. The aim was to examine psychological health of patients wearing orthodontic appliances. It is important to analyze well-being of patients during orthodontic treatment because it is started in a young age and it may affect one’s psychological health. Therefore, for doctors and patients it is important to understand and take every aspect of the treatment into consideration when deciding when to start the treatment and what appliance to choose. 339 patients answered anonymous questionnaire. They were divided into four groups according to their age and type of appliance. Main reasons to seek treatment were crooked teeth and bad bite. Statistically signifi-cant difference was between women and men as women seeked treatment because of crooked teeth, meanwhile men indicated bad bite as main reason. 48.7% of subjects noted that they were feeling good during treatment, however, 4% of all patients noted that they were feeling bad. 45% of subjects stated that they felt unhappy at least sometimes. 43% of subjects felt stress. Even though patients indicated various negative aspects on their well-being during treatment, for the majority of the subjects end results significantly increased their psychological well-being.

In this study was found that these cancers were attributable to risk factors such as cigarette smoking, second-hand smoke, alcohol intake, excess body weight, diet, and six cancer-associated infections. Several databases were reviewed including PUBMED, Google scholar, and Web of Science. The facts suggest that a number of individuals present risk factors for cancer, which can be modifiable.

Accumulating evidences demonstrate that the host genome's epigenetic modificationsare essential for living organisms to adapt extreme conditions.DNA methylation, covalent modifications of histone, andinter-association of non-coding RNAs facilitate the cellular manifestation ofepigenetic changes in the genome. Out of various factors involved in the epigenetic programming of the host, miRNA (microRNA) and LncRNA (Long non-coding RNA) are new generationnon-coding molecules that influence a variety of cellular processes like immunity, cellular differentiation, and tumor development. During tumor development, temporal changes in miRNA/LncRNA rheostat influence sterile inflammatory responses accompanied by the changes in the carcinogenic signalling in the host. At the cellular level, this is manifested by the up-regulation of Inflammasome and inflammatory pathways, which promotes cancer-related inflammation. In view of this, we discuss the potential of lncRNA and miRNA directed interventions in regulating inflammation and tumor development in the host.

Fire-related deaths are issues for forensic pathologists particularly in ascertaining if death occurred before or during fire. The authors highlight a unique bronchiolar epithelial cytological clue (nuclear heat-induced elongation) determined by active inhalation of hot gases and fumes, not yet described in the literature at distal small airways level.

This study presents a meta-analysis of studies that investigate the effectiveness of chitosan administration on lifestyle-related disease in murine models. A total of 34 published studies were used to evaluate the effect of chitosan supplementation. The effect sizes for various items after chitosan administration were evaluated using the standardized mean difference. Using Cochran’s Q test, the heterogeneity of effect sizes was assessed, after which a meta-ANOVA and –regression test was conducted to explain the heterogeneity of effect sizes using the mixed-effect model. Publication bias was performed using Egger’s linear regression test. Among the items evaluated, blood triglyceride and HDL-cholesterol showed the highest Q statistics and I2 values, respectively. Other than blood HDL-cholesterol, total cholesterol, and triglyceride in feces, most items evaluated showed a negative effect size with high significance in the fixed- and random-effect model (p<0.0001). In the meta-ANOVA and -regression test, administering chitosan and resistant starch was revealed to be most effective in lowering body weight. In addition, chitosan supplementation proved to be an effective solution for TNF-α inhibition. In conclusion, chitosan has been shown to be somewhat useful in improving symptoms of lifestyle-related disease. Although there are some limitations in the results of this meta-analysis due to the limited number of animal experiments conducted, chitosan administration nevertheless shows promise in enhancing the quality of human life.

The aim of this cross-sectional study was to assess the perceived medication-related burden among patients with multiple non-communicable diseases (NCDs), and to investigate the association between perceived burden and adherence to medication therapy. Medication-related burden was measured in three primary care clinics in Qatar using the Living with Medicines Questionnaire (LMQ) among adults with diabetes, with or without other comorbidities. Adherence was measured using the Adherence to Refills and Medications Scale (ARMS). Two hundred ninety-three eligible patients participated in the study. Majority of participants reported experiencing minimum (66.6%) to moderate (24.1%) medication-related burden. There was a significant positive correlation between the medication-related burden (measured by the LWQ) and medication adherence (measured by ARMS) (rs (253) = 0.317, p <0.0005). The duration of diabetes diagnosis, adherence score, marital status, employment status, and presence diagnosis of hypertension were significant predictors of medication burden. A considerable proportion of the patients in this study have reported experiencing medication-related burden. Healthcare providers should seek strategies to address this burden especially among patients with risk factors of cardiovascular diseases, non-adherent to their medication therapy, living alone, or non-employed.

Infectious illnesses have always posed a threat to human health, with tuberculosis being a major concern. The use of various drugs in the fight against such TB has led to the emergence of drug-resistant tuberculosis, which has become increasingly difficult to manage. While there have been a few studies and proposed conceptual models on how to manage and prevent various drug-resistant TB mutations and lineages, a model aimed at limiting and controlling such mutations in rural areas burdened with tuberculosis is lacking. This study seeks to map a model that is to be used to bridge the gap by facilitating the exchange of knowledge among healthcare professionals in healthcare facilities, diagnostic laboratories, and research institutes, particularly for underprivileged communities in the Eastern Cape. The model information is based on three published manuscripts; therefore, this is a follow-up study. The model will also serve as a practical guide to monitor and evaluate epidemiological TB management plans.

Background: Poisoning constitutes an important part of morbidity and mortality among environmental emergencies that can be prevented, frequent in childhood, requiring rapid diagnosis and treatment. This study aimed was to examine the epidemiological, clinical and therapeutic characteristics of drug and corrosive poisonings in terms of children. Materials and Methods: Between January 2010 and December 2018, 1678 patients between the ages of 1-16 who applied to the emergency department with drug and corrosive poisoning were included in the study. The patients were divided into three groups as 1-5, 6-11 and over 12 years of age, and the substances with known pharmacological agents were divided into 10 groups. The Zargar Classification (7) was used to determine the degree of damage caused by corrosive substances in the esophagus. Results: The mean age of the patients was 8.32 ± 3.23 years (1-15 years). The girl/boy ratio of the cases was 1.18 / 1 and 54.3% were girls. 18.9% of the cases were under five years of age, 61% were between 6-11 years and 20% were older than 12 years. 94.6% of the patients were poisoned by drugs and 5.4% of them were poisoned due to non-drug reasons. Accidental poisoning was most commonly seen in children aged 6-11 and suicides were seen in children older than 12 years. It was found that 62.2% of the poisonings were accidental and 37.8% were suicidal. The most common causes of poisoning were analgesics and paracetamol exposure as a pharmacological agent. Mortality was found to be most common in 1-5 years age group and accidental poisonings. Accidental poisoning was common in girls and suicidal poisoning was common in boys. Grade 3 damage was found endoscopically in all of the mortalities due to corrosive substances. Conclusion: It was found that accidental poisoning was observed in children under five years of age, suicides were observed in children older than 12 years and the most important cause of mortality was due to corrosive substances. Cause-specific rapid diagnosis and treatment will contribute to the reduction of morbidity and mortality.

Institutionalized older adults often face complex medication regimens, increasing their risk of adverse drug events due to polypharmacy, overprescribing, medication interactions or the use of Potentially Inappropriate Medications (PIM). However, data on medication use and associated risks in this population remain scarce. This pilot study aimed to characterize the sociodemographic, clinical and pharmacotherapeutic profiles and the use of PIM among institutionalized elders residing in Residential Structures for Elderly People (ERPI) in the Faro municipality, located in the Portuguese region of the Algarve. We conducted a cross-sectional study in a non-randomized sample of 96 participants (mean age: 86.6 ±7.86 years) where trained researchers reviewed medication profiles and identified potentially inappropriate medications using the EU(7)-PIM list. Over 90% of participants exhibited polypharmacy (≥5 medications), with an average of 9.1 ± 4.15 medications per person. About 92% had potential drug interactions, including major and moderate interactions. More than 86% used at least one potentially inappropriate medication, most commonly central nervous system drugs. This pilot study demonstrates that institutionalized older adults may be at high risk of potential medication-related problems. Implementing comprehensive medication review programs and promoting adapted prescribing practices are crucial to optimize medication use and improve the well-being of this vulnerable population.

Covid-19 is one of humanity’s biggest threat in the 21st century with WHO figures reporting 636 million cases and up to 6.6 million deaths globally. SARS-CoV-2, the virus that causes the Covid-19 disease, is characterized by high mutation which contributes to its rapid spread. While several vaccines have been produced to minimize the severity of the coronavirus and diverse treatment regimens have been approved by the US FDA under Emergency Use Authorization (EUA), SARS-CoV-2 viral mutations continue to derail the efforts of scientists as the emerging variants evade the recommended therapies. Nonetheless, diverse computational models exist that offer an opportunity to overcome the barriers involved in developing new drugs. In this review, the focus is on the use of various virtual screening techniques like molecular docking, molecular dynamics simulations, QSAR, pharmacophore modeling, and homology modeling in repurposing SARS-CoV-2 therapeutics. The results have been promising from the computer-aided drug design (CADD) studies in suggesting potential compounds for treatment of Covid-19 and helping in bringing the pandemic under control.

This study investigated the relationship between fundamental movement skills (FMSs) and health-related fitness (HRF) among first and second graders in South Korean elementary schools. It aimed to provide foundational data for developing physical education programs tailored to the motor development stages and fitness levels of younger elementary school students. In October 2023, FMSs (jumping, running, hopping, static balance, dynamic balance, overhand throwing, and kicking) and HRF (muscular strength, cardiorespiratory endurance, and flexibility) were evaluated among 291 first and second graders. The collected data were analyzed through frequency and multiple regression analyses performed using the SPSS software. The results revealed that higher scores in jumping and hopping are associated with greater muscular strength, cardiorespiratory endurance, and flexibility. Running had no significant effect on HRF elements. Higher scores in static balance (single-leg stance) were associated with increased muscular strength, cardiorespiratory endurance, and flexibility, but dynamic balance (balance beam walking) did not have a significant effect. Higher scores in overhand throwing were associated with greater muscular strength and cardiorespiratory endurance, but kicking did not show a significant association. Overall, these findings emphasize the importance of prioritizing jumping and static balance in physical education for the well-rounded health development of first and second graders.

The growth of the wind power sector has been marked by environmental, economic, and political drivers. Its starring role is also visible in the emergence of the so-called “green jobs”. Notwithstanding, its evolution ought not to compromise issues related to occupational risks. This exploratory study examines psychosocial risks in the operation and maintenance of onshore wind turbines in a leading Portuguese company. We conducted interviews with main stakeholders (Human Resources, OHS professionals, and team leaders); developed an “activity diary” for the operation and maintenance technicians to describe their activity and perceived impacts on health, complemented with collective interviews; and applied the Work and Health Survey. The results revealed particular risks and health impacts: working under adverse weather conditions; working at heights and in confined spaces; spending long work hours inside of the nacelles to achieve an optimum balance between favorable wind slots to intervene and avoiding additional trips up and down the wind turbines without lifts (70m-120m); and the feeling of early ageing. At a time when these workers are striving for recognition of their profession as a “rapid wear profession”, it is a key moment to discuss these results to guarantee sustainable conditions for future generations of workers.

The study aimed to identify clinical pharmacology patterns of prescribed and taken medications in older cardiovascular patients using electronic health records (EHRs) (n = 704) (2019–2022). Medscape Drug Interaction Checker was used to identify pairwise drug-drug interactions (DDIs). Prevalence rates of DDIs were 73.5% and 68.5% among taken and prescribed drugs, respectively. However, total number of DDIs was significantly higher among prescribed medications compared with the list of taken drugs (p < 0.05). Serious DDIs comprised 16% and 7% of all DDIs among prescribed and taken medications, correspondingly (p < 0.05). Median DDI numbers between prescribed versus taken medications were Me = 2, IQR 0-7 and Me = 3, IQR 0-7 per record, respectively. Prevalence of polypharmacy was significantly higher among prescribed medications compared with taken medications (p < 0.05). Women were taking significantly more drugs and had higher rates of polypharmacy and DDIs (p < 0.05). No sex-related differences were observed in the list of prescribed medications. ICD code U07.1 (COVID-19, virus identified) was associated with the highest median DDI number per record. Further research is warranted to improve EHR structure, patient engagement in reporting adverse drug reactions, and genetic profiling of patients to avoid potentially serious DDIs.

In February 2004, the Food and Drug Administration (FDA) was the first to approve the combination of cisplatin (CDDP) and pemetrexed (PEM) as standard first-line chemotherapy for untreated, unresectable malignant pleural mesothelioma (MPM). However, after that approval, no progress was made in the standard first-line treatment of MPM for almost 15 years. Positive results from a phase 3 study (Mesothelioma Avastin Cisplatin Pemetrexed Study: MAPS) verifying the effect of bevacizumab, an anti-angiogenesis agent added to CDDP/PEM for unresectable MPM, were published in The Lancet in December 2015; however, this did not lead to approval by national drug regulatory agencies. Furthermore, no second-line treatment was established for cases refractory to CDDP/PEM. In August 2018, the Pharmaceuticals and Medical Devices Agency of Japan was the first in the world to approve monotherapy with nivolumab, an immune checkpoint inhibitor (ICI), for previously unresectable, advanced, or recurrent MPM. Following Japan, in October 2020, the FDA approved the combination of nivolumab and ipilimumab for the treatment of previously untreated, unresectable MPM. In this article, we review the transition of drug treatment for MPM, in light of the historical background, focusing on the benefits of ICIs.

Protein 53 (P53) shows different functions either to support or to contrast malignant growth. P53 history tells that discoveries of molecular features have contributed to the emergence of P53 functions. Conversely, the shift of paradigms demonstrates that P53 functions coexist even if are in conflict with one another. Since 1979, five paradigms have been assembled then deconstructed by taking into account P53 functions of viral protein, oncogene, tumor suppressor gene, transcription factor, apoptotic factor. By summarizing the past five disassembled P53 paradigms, in this investigation the current paradigm involving P53 in the modulation of a composite bio-morphological entity namely, tumor immune microenvironment (TIME) is analyzed. The aims of this investigation were to provide an overview of solid and validated knowledge occurring in all P53 paradigms and to determine P53 abilities to modify TIME through manipulation of viruses. As a result, definitive P53 evidence concerns its genetic localization, amino acids composition, its isoforms and subcellular expression in organelles. P53 “mutome” assembles all mutations affecting this complex protein. Lastly, both categories of tumor promoting and non-oncogenic viruses related to P53 were scrutinized. In conclusion, paradigms teach that P53 is undruggable because its drugs inevitably target all P53 functions.

A brand-new approach to the understanding of breast cancer (BC) is urgently needed. In this contribution, the etiology, pathogenesis, and treatment of this disease is approached from the new pH-centric anticancer paradigm. Only this Unitarian perspective based upon that the hydrogen ion (H+) dynamics of cancer, allows understanding and integrating the many dualisms, confusions, and paradoxes of the disease. The new H+-related wide range model can embrace under a unique frame of mind the many aspects of the disease and at the same time therapeutically interfere with most, if not with all, the hallmarks of cancer known to date. The pH-related armamentarium available for the treatment of BC here reviewed may be beneficial for all types and stages of the disease. In this vein, we have attempted a mega synthesis of traditional and new knowledge in the different areas of breast cancer research and treatment based upon the wide range approach afforded by the hydrogen ion dynamics of cancer. The concerted utilization of a pH-related drugs nowadays available for the treatment of breast cancer is advanced.

Gastric cancer is an aggressive disease with increasing global incidence in recent years. Human epidermal growth receptor 2 (HER2) is overexpressed in approximately 10-20% of gastric cancers. The implementation of targeted therapy against HER2 as part of the standard of care treatment in metastatic disease has improved the prognosis of this subset of patients. However, gastric cancer still has high mortality rates and urgently requires new treatment strategies. The combination of immunotherapy with HER2-targeted therapies has shown synergistic effects in preclinical models, being the rationale behind exploring this combination in clinical trials in locally advanced and metastatic settings. Additionally, the irruption of antibody-drug conjugates and other novel HER2-targeted agents has led to the development of numerous clinical trials showing promising results. This review presents the molecular mechanisms supporting the use of HER2-targeted drugs in combination with immunotherapy and provides an overview of the therapeutic scenario of HER2-positive disease. We focus on the role of immunotherapy but also summarize emerging therapies and combinations under clinical research that may change the standard treatment in HER-2 positive disease in the future.

Emotional dysfunction, including flat affect and emotional perception deficits, is a specific symptom of schizophrenia disorder. We used a modified multimodal odd-ball paradigm with fearful facial expressions accompanied by congruent and non-congruent sounds to investigate the impairment of emotional perception and reaction to other people's emotions. We analyzed subjective assessments and ERP data for emotionally charging congruent and non-congruent stimuli in patients with schizophrenia and healthy peers. The results showed the deficit of multimodal perception of fearful stimuli in patients with schizophrenia compared to healthy controls. The amplitude of N50 was significantly higher in subjects of the control group for non-congruent stimuli than congruent and did not differ in patients with schizophrenia. The dynamics of P100 and N200 components confirmed the impaired sensory gating in patients with schizophrenia. The lower amplitude of P3a could be associated with deficits in verbal memory and attention, less emotional arousal, or incorrect interpretation of emotional valence as specific features of patients. The difficulties in identifying the incoherence of facial and audial components of emotional expression could be significant in understanding the psychopathology of schizophrenia.

(1) Background: The purpose of this study was therefore to analyze the predictive capacity of the three variables (impulsivity, sensation-seeking and drug use) in aggressors and victims of violence. (2) Methods: The design is cross-sectional quasi-experimental. A sample of 822 students aged 13 to 18 who had filled in an ad hoc questionnaire, the State Impulsivity Scale and the Sensation-Seeking Scale, was used for this. (3) Results: The results show that aggressors had high levels of gratification, automatism, attentional factor, disinhibition and susceptibility to boredom, and use alcohol and/or tobacco. The variables that could predict involvement as an aggressor in peer conflict are use of alcohol, smoking, high levels of gratification, automatism and attentional factors and a high degree of disinhibition and susceptibility to boredom. The disinhibition is the best predictor of aggressor. (4) Conclusions: Thus having available empirical evidence that facilitates detection of predictive variables for participation in violence is going to favor the design of effective education intervention for reducing risk behavior.

Introduction: Osteoarthritis (OA) and age-related degeneration (ARD) are stimulants for the development of the fabella in the knee joint. This meta-analysis updates previous studies and reviews on the prevalence of the fabella in OA or ARD knee joints. In addition, it provides a quantitative estimation of the fabellar prevalence in knees having OA and ARD. Methodology: Twenty studies comprising of data from 11,056 knee joints were included in the analysis, consisting of 6,819 Knees of OA subjects (including those with age more than 40 years) and 4,237 knees of non-OA subjects (including less than 40years) knees, respectively. 2,434 knees had fabellae present in OA subjects (including more than 40years), and 844 fabellae were present in non-OA subjects (including less than 40years). The Odds and Risk Ratios were calculated. Sensitivity analysis and cumulative analysis were conducted to assess the robustness of the findings. Results: Prevalence of fabella was found to be higher in OA knees, where the Risk Ratio of developing fabella was 2.50 (2.07-3.01). Compared with this, the Risk Ratio for the incidence of fabella in OA with ARD knee was 1.84 (1.66-2.03). The bilateral occurrence of fabella was more common than unilateral. The risk of developing fabella in individuals aged less than forty-year was 63% less than individuals aged more than forty years. Conclusion: OA and ARD would increase the prevalence of fabella by 84%, thus acting as stimulants and risk factors for ossified fabella.

Currently, drug screening is primarily based on human cell culture for initial high-throughput screening, and subsequently, rodent model to confirm the biological effects. However, the mammalian system is known for time-consuming and highly-cost to be difficult to perform high-throughput drug screening, which exists a critical gap between in vitro cell-based models and the in vivo mammalian models. Therefore, the zebrafish could bridge this gap in preclinical toxicity screening along the drug development pipeline because of its efficiency. We aimed to develop an in vivo zebrafish platform for rapid drug screening. Zebrafish, due to its high genomic conservation with mammals and rapid development and differentiation, it has many advantages, such as short life span, large number of offspring and low cost, easy manipulation for generating transgenic species, to serve as animal model for disease-based research. In 96-well microplates, zebrafish embryos were incubated with small molecular compounds that affected bone mineralization. The level of osteogenic mineralization was evaluated by fluorescent dye staining and quantified by image analysis software. Quantitative real time-PCR (qRT-PCR) was performed to evaluate the biological pathways involved in bone metabolism at the molecular level. The system was validated by demonstrating that response to alendronate and Dorsomorphin in zebrafish. In our study, we screened for 24 compounds within the CYCU-1120~1152 chemical library and identified 3 compounds, pentamidine (CYCU-1140), BML-267 (CYCU-1147), and alendronate (CYCU-1152), increased embryonic mineralization; while 6 compounds, RWJ-60475 (CYCU-1126), levamisole HCL (CYCU-1128), tetramisole HCL (CYCU-1129), fenvalerate (CYCU-1132), NSC-663284 (CYCU-1138), and BML-267ester (CYCU-1148), were inhibitory to bone mineralization. We also found that alendronate enhanced the level of bone mineralization by inhibiting osteoclast-related genes. To sum up, our research showed that zebrafish may have potential to be a drug-screening and mechanism-analysis platform for bone mineralization.

There are guidelines on lactation following maternal analgo-sedative exposure, but these do not consider the effect of maternal fasting, nor fluid abstention on human milk macronutrient composition. We therefore performed a structured search (PubMed) on ‘human milk composition’ and screened title, abstract and full paper on ‘fasting’ or ‘abstention’ and ‘macronutrient composition’ (lactose, protein, fat, solids, triglycerides, cholesterol). This resulted in 6 papers and one abstract related to religious fasting (n=129 women) and observational studies in lactating women (n=23, healthy volunteers, fasting). These data reflect two different ‘fasting’ patterns: an acute (18-25h) model in 71 (healthy volunteers, Yom Kippur/Ninth of Av) women and a chronic fasting (Ramadan) model in 81 women. Changes were most related to electrolytes and were moderate, with almost no changes in macronutrients during acute fasting. We therefor conclude that neither short term fasting nor fluid abstention (18-25h) affect human milk macronutrient composition, so that women can be reassured when this topic were raised during consulting. Besides the nutritional relevance, this also matters as clinical research samples – especially to estimate analgo-sedative exposure by lactation - are commonly collected after maternal procedural sedation, associated with maternal fasting and physiology-based pharmacokinetic (PBPK) models assume stable human milk composition.

Abstract Octreotide is the first synthetic peptide hormone, consisted of eight amino acids, that mimics the activity of somatostatin, a natural hormone in the body. During the past decades, advanced instrumentation and crystallographic software established X-ray Powder Diffraction (XRPD) as a valuable tool for extracting structural information of biological macromolecules. The latter was demonstrated by the successful structural determination of octreotide at a remarkably high d-spacing resolution (1.87 Å) (PDB code: 6vc1). This study focuses on the response of octreotide to different humidity levels and temperatures, with a particular focus on the stability of the polycrystalline sample. XRPD measurements were accomplished employing an Anton Paar MHC-trans humidity-temperature chamber installed within a laboratory X’Pert Pro diffractometer (Malvern Panalytical). The chamber is employed to control and maintain precise humidity and temperature levels of samples during XRPD data collection. Pawley analysis of the collected data sets revealed that the octreotide polycrystalline sample is remarkably stable and no structural transitions were observed. The compound retains its orthorhombic symmetry (space group: P212121, a = 18.57744(4) Å, b = 30.17338(6) Å, c = 39.70590(9) Å, d~ 2.35 Å). However, a characteristic structural evolution in terms of lattice parameters and volume of the unit-cell is reported mainly upon controlled relative humidity variation. In addition, an improvement of signal-to-noise ratio in the XRPD data under a cycle of dehydration/rehydration is reported. These results underline the importance of considering the impact of environmental factors, as humidity and temperature, in the context of structure-based drug design, thereby contributing to the development of more effective and stable pharmaceutical products.

Plants respond to drought by major reprogramming of gene expression enabling the plant to survive this threatening environmental condition. One major upstream signal inducing this multifaceted process is the phytohormone abscisic acid (ABA). In this report, we investigate the drought response in barley plants (Hordeum vulgare, cv. Morex) at both epigenome and transcriptome levels. Leaves of barley plants after 10 days of drought treatment, when soil water content was decreased by about 40%, were compared to well-watered controls. Due to the drought treatment, chlorophyll content and photosystem II-efficiency were decreased by about 10% and some known drought-related genes were already induced. Global ChIPseq analyses were used to identify genes where histones 3 associated with promoter or gene body were modified with euchromatic K4 trimethylation or K9 acetylation during drought. Using stringent exclusion criteria, 129 genes loaded with H3K4me3 and 2008 genes loaded with H3K9ac in response to drought were identified, indicating that H3K9 acetylation reacts to drought more sensitive than H3K4 trimethylation. Comparison with differentially expressed genes enabled to identify those genes, which are loaded with the euchromatic marks and are induced in response to the drought treatment. The results show that a major part of these genes is involved in ABA-signaling and related pathways. Intriguingly, two members of the protein phosphatase 2C family (PP2Cs), which are involved in the central regulatory machinery of ABA signaling, were also identified by this approach.

The present study was conducted to evaluate the effects of dietary supplementation of tea polyphenol （TP） on serum hormone, serum enzyme activity, antioxidant-related and immune-related gene expression of laying hens under heat stress. A total of 288 Chinese yellow chicken (186 days old) were randomly distributed among two treatments, each of which included 6 replicates of 24 hens. Dietary treatments were that the basal diet was supplemented with 200 mg / kg tea polyphenol. The study lasted for 7 weeks, including 1 week of adaptation and 6 weeks of the formal test. The content of high-density lipoprotein cholesterol (HDL-C) and total protein (TP) in serum significantly decreased by dietary supplementation with tea polyphenol. Dietary tea polyphenol supplementation improved serum superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) enzyme activity and decreased serum malondialdehyde (MDA) content in treatments compared to the control. However, supplementation of tea polyphenol did not affect the activity of serum catalase (CAT). The results indicated that long-term feeding of tea polyphenols help to increase the amount of hormones (FSH, E2) associated with reproduction in laying hens and thus improve egg production. It also improved the immune function of laying hens in high temperature environments. Adding tea polyphenols to the diet can significantly increase the serum IgG, IgM content of the laying hens and can upregulate the IgA content. Dietary supplementation of tea polyphenols in the laying hens significantly increased the expression of antioxidant enzyme-related genes (SOD, CAT and GPX1) in the liver. Moreover, the addition of tea polyphenols significantly increased the expression of immune-related genes (Interferon-γ (INF-γ), Interleukin 2 (IL-2) and Interleukin 4 (IL-4)) in the spleen. It is concluded that addition of tea polyphenols has a positive effect on antioxidant activity and immune function of laying hens.

Antibody-drug conjugates (ADCs), a groundbreaking advancement in cancer therapy, synergistically combine the precision of monoclonal antibodies with the potent destruction capabilities of cytotoxic drugs, signifying a new era in the targeted oncological treatments. This comprehensive paper delves into the evolving field of antibody-drug conjugates (ADCs) and their pivotal role in cancer therapy. We have conducted an in-depth exploration of the structural components of ADCs, including target antigens, monoclonal antibodies, chemical linkers, and cytotoxic payloads, each playing a crucial role in determining the efficacy and safety profile of these novel therapies. A detailed market analysis reveals the leading pharmaceutical companies shaping the ADC landscape, reflecting the growing interest and potential in this therapeutic approach. We further dissect the engineering intricacies of ADCs, focusing on their ability to target specific cancer cell antigens while minimizing off-target effects, thus offering a more focused treatment with reduced systemic side effects compared to traditional chemotherapy. This approach holds promise in a heightened therapeutic index and decreased toxicity. The mechanisms and effector functions of ADCs are explored, highlight- ing their multifaceted strategy in combating cancer. We include a comprehensive look at how ADCs operate from initial blood circulation to the induction of apoptosis in cancer cells. We also review several key ADCs currently in use or under investigation, offering insights into their unique mechanisms of action, pharmacokinetics, and clinical implications. The discussion extends to drug creation modalities, focusing on innovative conjugation techniques that enhance ADC homogeneity and therapeutic efficacy. In conclusion, the paper underscores the transformative potential of ADCs in the realm of cancer treatment, marking a shift towards more precise and targeted therapeutic approaches. By offering a thorough analysis of ADC technology, this paper sheds light on the prospects of these groundbreaking therapies in the ongoing fight against cancer.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Curcumin (CUR) is a phytochemical with potent anticancer activities as demonstrated by both preclinical and clinical studies. CUR bioformulations, including loading in biodegradable polymers, have been explored to increase CUR’s solubility and chemical stability, control its release, and improve its delivery to cancer cells. In this study, copolymers comprising poly (L-lactide)-poly (ethylene glycol)-poly (L-lactide) (PLA-PEG-PLA) and poly (ethylene glycol)-poly (L-lactide)-poly (ethylene glycol) (PEG-PLA-PEG) were designed and synthesized to assess and compare their curcumin delivery capacity and inhibitory potency on MCF-7 breast cancer cells. Molecular dynamics simulations indicated that PLA-PEG-PLA has a higher propensity to interact with the cell membrane and more negative free energy, suggesting it is the better carrier for cell membrane penetration. Our characterization indicated that the microsphere copolymers were synthesized successfully. Of the two formulations, PLA-PEG-PLA experimentally exhibited better results, with an initial burst release of 17.5%, followed by a slow, constant release of the encapsulated drug up to 80%. PLA-PEG-PLA-curcumin showed a significant increase in cell death in MCF-7 cancer cells (IC50 = 23.01 ± 0.85 µM) based on the MTT assay. These data were consistent with gene expression studies of Bax, Bcl2, and hTERT which showed that PLA-PEG-PLA-CUR induced apoptosis more efficiently in these cells. Our study integrates in vitro and in silico approaches to identify an optimal co-polymer for the delivery of CUR to cancer cells.

Background/Objectives: Cardiovascular diseases are one of the leading causes of morbidity and mortality worldwide. Health-related quality of life is crucial to assess the impact of cardiovascular diseases and to guide therapeutic strategies. The Short Form 36 Health Survey and the RAND 36-Item Health Survey questionnaires are common tools for measuring health-related quality of life in patients with cardiovascular disease, but their reliability may vary according to the population studied. The aim of this study is to compare the reliability of the SF-36 and the RAND-36 in a population with cardiac pathology, addressing the question of which of these instruments offers a more consistent and useful measurement in this specific group. Methods: Cross-sectional observational study carried out at the University Hospital of Burgos (Spain). 413 patients with cardiovascular pathology referred to the Cardiac Rehabilitation Unit were included. Patients with incomplete data or who did not participate in the program were excluded. Internal consistency (Cronbach’s alpha), item-total correlation and reliability and a half-half analysis were performed. Results: Both questionnaires showed similar and adequate reliability for patients with cardiovascular pathology. Internal consistency, as measured by Cronbach’s alpha, was above 0.80 for most dimensions, supporting its robustness. Significant inter-item and inter-dimension correlations were found in both scales, except in some specific cases in the dimension ‘Physical Functioning’. The half-half analysis confirmed the good reliability of both scales. Conclusions: Both the SF-36 and the RAND-36 are highly reliable tools for assessing health-related quality of life in patients with cardiovascular disease. The results may have significant implications for clinical practice, helping in the selection of health-related quality of life monitoring instruments and in the evaluation of the efficacy of therapeutic interventions.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

This study explored intraindividual multidimensional profiles integrating psychosocial factors, namely, body image and satisfaction, weight-related self-stigma, positivity, and happiness, and behavioural-lifestyle factors, namely, adherence to a healthy diet, among Spanish adults with overweight or obesity. We further aimed to investigate the association of excess weight (i.e., measured body mass index, BMI) with the abovementioned multidimensional configurations. A convenience sample of adult individuals with excessive weight completed self-reports regarding the study variables, and their weight and height were measured. With a perspective centred on the individual, a cluster analysis established three distinct intraindividual psychosocial and diet-related profiles: a group of healthy individuals with excess weight; a group of individuals who were negatively affected by their excessive weight and showed the most distressed profile; and a group of dysfunctional individuals who seemed to be excessively unrealistic and optimistic regarding their excessive weight and unhealthy lifestyles. Furthermore, individuals in the affected cluster had higher obesity. The results showed that there are specific psychosocial and lifestyle profiles in the adult population with excess weight and that there are relationships among psychological, behavioural, and body-composition factors. For clinical application purposes, it is important to account for the heterogeneity within individuals who are obese.

Antimicrobial peptides (AMPs) have emerged as a promising solution to tackle bacterial infections and combat antibiotic resistance. However, their clinical application has been hindered by their vulnerability to protease degradation and toxicity towards mammalian cells. To overcome these challenges, our study aims to develop a method to enhance the stability and safety of AMPs, applicable to effective drug-device combination products. KR12 antimicrobial peptide was chosen and in order to further enhance its delivery and efficacy, HIV TAT protein-derived cell-penetrating peptide (CPP) was fused to form CPP-KR12. A new product, CPP-KR12@Si, was developed by forming silica nanoparticles with self-entrapped CPP-KR12 peptide using the biomimetic silica precipitability due to its cationic nature. Peptide delivery from CPP-KR12@Si to bacteria and cells was delivered at a slightly delayed rate with improved stability against trypsin treatment and a reduction in cytotoxicity over CPP-KR12. Finally, the antimicrobial potential of CPP-KR12@Si/bone graft substitute (BGS) combination product was demonstrated, which is coated with CPP-KR12 in the form of nanoparticles on the surface of BGS. Self-entrapped AMP in silica nanoparticles is a safe and effective AMP delivery method that will be useful for developing a drug/device combination product for tissue regeneration.

Background: Previously, our laboratory has provided evidence that pre-administration of the antioxidant, lipoic acid covalently bonded to various naturally occurring antioxidants, enhanced neuroprotective capacity compared to the administration of lipoic acid on its own. The naturally occurring compound scopoletin, a coumarin derivative, has been shown in various in vitro studies to have both antioxidant and anti-inflammatory mechanism of actions. To date, the effect of scopoletin on neuronal cell death in an in vivo model of ischemia or ischemia-reperfusion has not been investigated. Therefore, the present investigation was designed to determine if scopoletin on its own, or a co-drug consisting of lipoic acid and scopoletin covalent bond, named UPEI-400, would be capable of demonstrating a similar neuroprotective efficacy. Methods: Using a rodent model of stroke in male rats (anesthetized with Inactin®; 100 mg/kg, iv), the middle cerebral artery was permanently occluded for 6 hours (pMCAO), or in separate animals, occluded for 30 min followed by 5.5 hrs of reperfusion (ischemia/reperfusion; I/R). Results: Pre-administration of either scopoletin or UPEI-400 significantly decreased infarct volume in the I/R model (p<0.05), but not in the pMCAO model of stroke. However, UPEI-400 was ~1000 times more potent as compared to scopoletin on its own. The optimal dose of UPEI-400 was then injected during the occlusion and at several time points during reperfusion and significant neuroprotection was observed for up to 150 mins following the start of reperfusion (p<0.05). Conclusion: The data suggest that synthetic combination of scopoletin with lipoic acid (UPEI-400) is a more effective neuroprotectant that either compound on their own. Also, since UPEI-400 was only effective in a model of I/R, it is possible that it may act to enhance neuronal antioxidant capacity and/or upregulate anti-inflammatory pathways to prevent the neuronal cell death.

The study evaluates the toxic effects of acute and sub-acute oral administration of methanol extracts of Geophila obvallata in rats. During acute study, a dose of 1600, 2900 and 5000 mg/kg bw of extract was orally administered to rats. Rats were observed for signs of toxicity for two weeks. During sub-acute study (28 days), the extract, at doses of 100, 500 and 1000 mg/kg bw were administered orally to rats while control rats were given only tap water. At the end of the study, samples were collected for analyses. In acute toxicity studies, the extract did not induce death after single dose administration. Hence, the LD50 was estimated above 5000mg/kg. The results of sub-acute toxicity study show that no significant changes were observed in the body weights, organ weights, kidney function and organ histology. There were significant changes in hematology and biochemical indices investigated at elevated doses of 500 and 1000 mg/kg bw compared to the control. GOE may be considered non-toxic at a dose of 100 mg/kg with promising applications in drug therapy.

Post-operative chemotherapy is still required for the treatment of glioblastoma (GBM), and nanocarrier-based drug delivery has been identified as one of the most effective methods. However, the blood-brain barrier (BBB) and non-specific delivery to non-tumor tissues can significantly limit drug accumulation in tumor tissues and cause damage to nearby normal tissues. This study describes a targeted cancer therapy approach that uses AS1411 aptamer-conjugated nanospheres, 100-300 nm in size, loaded with doxorubicin (Dox) to selectively identify tumor cells overexpressing nucleolin (NCL) proteins. The study demonstrates that the active target model, which employs aptamer-mediated drug delivery, is more effective than nonspecific enhanced permeability and maintenance (EPR)-mediated delivery and passive drug delivery in improving drug penetration and maintenance in tumor cells. Additionally, the study shows the potential for anticancer effects through 3D spheroidal and in vivo GBM xenograft models. The DNA-protein hybrid nanospheres utilized in this study offer numerous benefits, such as efficient synthesis, structural stability, high drug loading, dye labelling, biocompatibility, and biodegradability. When combined with nanospheres, the 1411 aptamer has been shown to be an effective drug delivery carrier for precisely targeting tumors. This combination has the potential to produce anti-tumor effects in active targeted therapy of GBM.

Frontotemporal lobar degeneration (FTLD) belongs to a heterogeneous group of highly complex neurodegenerative diseases and represents the second cause of presenile dementia in individuals under 65. Frontotemporal-TDP is a subgroup of frontotemporal dementia characterized by the aggregation of abnormal protein deposits, predominantly transactive response DNA-binding protein 43 (TDP-43), in the frontal and temporal brain regions. These deposits lead to progressive degeneration of neurons resulting in cognitive and behavioral impairments. Limbic age-related encephalopathy (LATE) pertains to age-related cognitive decline primarily affecting the limbic system which is crucial for memory, emotions, and learning. Though distinct, emerging research suggests a potential overlap in pathogenic processes, with some cases of limbic encephalopathy displaying TDP-43 pathology. Genetic factors play a pivotal role in both disorders. Mutations in various genes, such as progranulin (GRN) and chromosome 9 open reading frame 72 (C9orf72), have been identified as causative in frontotemporal-TDP. Similarly, specific genetic variants have been associated with an increased risk of developing LATE. Understanding these genetic links provides crucial insights into disease mechanisms and the potential for targeted therapies.

Background: Research has consistently shown increased drug use among lesbian, gay, bisexual, transgender, intersex, queer/questioning, and asexual (LGBTQIA+) individuals. This is particularly the case among LGBTQIA+ adolescents. Substance use within this vulnerable community can propagate mental health issues leading to psychiatric disorders, self-harm and even suicide. Therefore, the objective of this scoping review was to evaluate the determinants of drug use among LGBTQIA+ adolescents. Methods: A comprehensive search of mainly primary research was conducted using several databases. Peer-reviewed articles published between 2018 and 2023 were included. The scoping review was conducted using the framework outlined by Joanna Briggs Institute (JBI) and reported using the Preferred Reporting Items for Systematic Reviews and Meta-Analyses- Extension for Scoping Reviews (PRISMA-ScR) statement. Results: A total of 29 articles (including 400194 participants) were included in the analysis. The articles reported that the main determinants of drug use among LGBTQIA+ adolescents include homelessness, peer-peer interactions, mental health, and protective factors. The articles reported that mental health issues, which are mainly triggered by rejection, were the main determinants of drug use among LGBTOIA+ adolescents. Conclusion: Findings from this scoping review provide relatively reliable evidence that homelessness, mental health, peer-peer interactions, and protective factors are the main determinants of illicit drug use among LGBTQ+ adolescents. Rigorous studies that include large sample sizes, and systematic reviews are needed to further confirm these findings and assist in developing interventions to combat the unusually high level of drug use among this group.

Background &amp; Aim: Drug sustainability (DS) is a surrogate marker for treatment efficacy. We aimed to compare the DS of two main biologics used to treat moderate-to-severe ulcerative colitis (UC), infliximab (IFX) and vedolizumab (VDZ), in a real-world setting. Methods: We conducted a retrospective cohort study at a tertiary medical center in Israel. We included patients treated between Dec 1st, 2017, and May 1st, 2021, who were followed for up to 300 weeks. DS was defined as corticosteroid, surgical, and hospitalization-free treatment. Results: 217 patients with UC were included. VDZ had a significantly longer median DS of 265.6 weeks compared to IFX's 106.5 weeks (p=0.001) in treatment-naïve patients, even when adjusting for disease severity (HR 0.55 95 CI 0.3-0.98, p=0.042). In treatment-experienced patients, DS was comparable between IFX and VDZ (p=0.593). Conclusion: VDZ showed significantly longer DS in treatment-naïve patients with UC compared to IFX, also when adjusted for disease severity. There was no difference in DS between VDZ and IFX in treatment-experienced patients and patients switching from one drug to another. VDZ may be a suitable first-line treatment for biologic-naïve patients with moderate-to-severe UC.

The worldwide outbreak of SARS-CoV-2 in early 2020 caused numer- ous deaths and unprecedented measures to control its spread. We employed our Computational Analysis of Novel Drug Opportunities (CANDO) multiscale therapeutic discovery, repurposing, and design platform to identify small molecule inhibitors of the virus to treat its resulting indication, COVID-19. Initially, few experimental studies existed on SARS-CoV-2, so we optimized our drug candidate prediction pipelines using results from two independent high-throughput screens against prevalent human coronaviruses. Ranked lists of candidate drugs were generated using our open source cando.py software based on viral protein inhibition and proteomic interaction similarity. For the former viral protein inhibition pipeline, we computed interaction scores between all compounds in the corresponding candidate library and eighteen SARS-CoV proteins using an interaction scoring protocol with extensive parameter optimization which was then applied to the SARS-CoV-2 proteome for prediction. For the latter similarity based pipeline, we computed interaction scores between all compounds and human protein structures in our libraries then used a consensus scoring approach to identify candidates with highly similar proteomic interaction signatures to multiple known anti-coronavirus actives. We published our ranked candidate lists at the very beginning of the COVID-19 pandemic. Since then, 51 of our 276 predictions have demonstrated anti-SARS-CoV-2 activity in published clinical and experimental studies. These results illustrate the ability our platform to rapidly respond to emergent pathogens and provide greater evidence that treating compounds in a multitarget context more accurately describes their behavior in biological systems.

Drug-resistant tuberculosis (DR-TB) is still a major public health concern in South Africa. Mutations in M. tuberculosis can cause varying levels of phenotypic resistance to anti-TB medications. There have been no prior studies on gene mutations and the genotyping of DR-TB in the rural Eastern Cape Province; hence we aimed to identify DR-TB mutations, genetic diversity and allocated lineages among patients in this area. Using Xpert® MTB/RIF, we assessed the rifampin-resistance of sputum samples collected from 1157 patients suspected of having tuberculosis. GenoType MTBDR plus VER 2.0 was used for the detection of mutations causing resistance to anti-TB medications. The next step was to spotlight type 441 isolates. The most prevalent rifampin resistance-conferring mutations were in rpoB codon S531L, in INH-resistant strains, katG gene at codon S315TB and the inhA gene at codon C-15TB had highest mutations; 54.5% and 24.7%, respectively. In addition, 24.6% of strains showed mutations in both the rpoB and inhA genes, while 69.9% of strains showed mutations in both the katG and rpoB genes. Heteroresistance was seen in 17.9% of all cases in the study. According to spoligotyping analysis, Beijing families predominated. Investigating the evolutionary lineages of M. tuberculosis isolates can be done using the information provided by the study's diversity of mutations. In locations where these mutations have been discovered, decision-making regarding standardization of treatment regimens or individualized treatment may be aided by the detection frequency of rpoB, katG, and inhA mutations in various study areas.

The target of an antibody plays a significant role in the success of antibody-based therapeutics and diagnostics, and to an extent, that of vaccine development. This importance is focussed on the target binding site – epitope, where epitope selection as a part of design thinking beyond traditional antigen selection using whole cell or whole protein immunisation can positively impact success. With purified recombinant protein production and peptide synthesis to display limited/selected epitopes, intrinsic factors that can affect the functioning of resulting antibodies can be more easily selected for. Many of these factors stem from the location of the epitope that can affect accessibility of the antibody to the epitope at a cellular or molecular level, direct inhibition of target antigen activity, conservation of function despite escape mutations, and even non-competitive inhibition sites. Through the incorporation of novel computational methods for predicting antigen changes to model-informed drug discovery and development, superior vaccines and antibody-based therapeutics or diagnostics can now be more easily designed to mitigate failures. With detailed examples, this review highlights the new opportunities, factors and methods of predicting antigenic changes for consideration in sagacious epitope selection.

Amyloids result from the aggregation of several unrelated proteins, due to either specific mutations or promoting intra- or extra-cellular conditions. Structurally, they are rich in intermolecular β-sheets and are the causative agents of several diseases, both neurodegenerative and systemic. It is believed that the most toxic species are small aggregates, referred to as oligomers, rather than the final fibrillar assemblies. Their mechanisms of toxicity are mostly mediated by aberrant interactions with the cell membranes, with resulting derangement of membrane-related functions. Much effort is being put in the search for natural antiamyloid agents, and/or in the development of synthetic molecules. Actually, it is well documented that the prevention of amyloid aggregation results in several cytoprotective effects. Here, we portray the state of the art in the field. Several natural compounds are effective antiamyloid agents, notably tetracyclines and polyphenols. They are generally non-specific, as documented by their partially overlapping mechanisms, and the capability to interfere with the aggregation of several unrelated proteins. Among rationally designed molecules, we mention the prominent examples of β-breakers peptides, whole antibodies and fragments thereof, and the special case of drugs contrasting transthyretin aggregation. In this framework, we stress the pivotal role of the computational approaches. When combined with biophysical methods, in several cases they have helped clarify in detail the protein/drug modes of interaction, which make it plausible that more effective drugs will be developed in the future.

Toxoplasma gondii is a protozoan and the etiologic agent of toxoplasmosis causes high mortality in immunocompromised individuals and newborns. Despite the medical importance of toxoplasmosis, few drugs are available for its treatment, which are associated with side events and parasite resistance. Here, we show a screening of molecules present in Covid-Box as a way of discovering new hits with anti-T. gondii activity. Covid-Box contains 160 molecules with known or predicted activity against SARS-CoV-2. Our analysis selected 23 Covid-Box molecules that can inhibit the tachyzoite forms of the RH strain of T. gondii in vitro by more than 70% at 1 µM after seven days of treatment. The inhibitory curves showed that most of these molecules inhibited the proliferation of tachyzoites with IC50 values below 0.80 µM; Cycloheximide and (-)-Anisomycin were the most active drugs, with IC50 values of 0.02 μM. Cell viability assays showed that the compounds are not toxic at active concentrations, and most are highly selective for parasites. Overall, all 23 compounds were selective, and for three of them (Apilimod, Midostaurin, and Salinomycin), this is the first report of activity against T. gondii. To better understand the effect of the drugs, we analyzed the effect of six of them on the ultrastructure of T. gondii using transmission electron microscopy. The main changes observed in parasite morphology after treatment with the selected drugs were changes in cell division and parasite organelles.

Xpert MTB/RIF is rapid molecular diagnostic tool capable of simultaneously detecting Mycobacterium tuberculosis and rifampicin resistance. This study aimed to access the diagnostic precision of Xpert MTB/RIF assay to detect pulmonary and extra-pulmonary tuberculosis and to evaluate the performance for the detection of rifampicin resistance. Of 37695 samples, 7156(18.98%) were tuberculosis positive, 509(7.11%) were rifampicin-resistant. The sensitivity, specificity, PPV, NPV, Diseases prevalence and accuracy of Xpert MTB/RIF assay for PTB were 99.87% (95%CI:99.75-99.94), 99.92%(95%CI:99.88-99.95), 99.71%(95%CI:99.54-99.82),99.97%(95%CI:99.93-99.98),21.38% (95%CI:20.92-21.86),and 99.91%(95%CI:99.87-99.94), respectively. For EPTB, the sensitivity, specificity, PPV, NPV, Diseases prevalence and accuracy of Xpert MTB/RIF assay accounted for 99.45% (95%CI:98.73-99.82),99.84%(95%CI:99.73-99.92),98.70%(95%CI:97.73-99.25),99.93% (95%CI:99.84-99.97),10.64%(95%CI:9.99-11.31),and 99.80%(95%CI:99.68-99.88), respectively. Despite its high sensitivity for detecting tuberculosis and rifampicin resistance, Xpert MTB/RIF had contradictory results for 20.5% of cases among patients with negative smear results and 54.9% of cases among patients with a high risk of Multidrug-resistant tuberculosis. Of 47 fluoroquinolone-resistant, 16.56% (26/157) of Multidrug-resistant tuberculosis isolates and 4.02% (20/498) isoniazid-resistant are fluoroquinolone-resistant, a characteristic distribution leading to about 17.2% of fluoroquinolone resistance events and relevant marker gyr-A mutations in MDR tuberculosis isolates. Further, our study indicated that increased fluoroquinolone resistance among Rifampicin-resistant and isoniazid-resistant tuberculosis endangers the success of newly endorsed MDR-TB regimens.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Feline infectious peritonitis (FIP) is a severe and invariably fatal disease affecting both domestic and wild felines with limited effective therapeutic options available. By considering the significant immunomodulatory effects of vitamin E observed in both animal and human models under physiological and pathological conditions, we have provided a full in-silico investigation of vitamin E and related compounds and their effect on the crystal structure of feline infectious peritonitis virus 3C-like protease (FIPV-3CLpro). This work revealed the β-tocotrienol and δ-tocotrienol analogues as inhibitor candidates for this protein, suggesting their potential as possible drug compounds against FIP or their supplementary use with current medicines against this disease.

Glioblastoma (GB), even though not frequent, is an extremely aggressive brain tumor, with a strong impact on patient outcomes, in terms of both length and quality of life. The protocol estab-lished by Stupp and coworkers in 2005, based on radiotherapy and temozolomide chemotherapy, after maximum safe surgical resection, remains the gold standard for GB treatment. However, it is evident nowadays that the extreme GB intratumoral and intertumoral heterogeneity, invasive-ness and recurrence are not compatible with a routinary and unfortunately uneffective treatment. In this review article, we summarize the principal challenging issues in finding new valuable therapies for GB and focus on the impact that extracellular vesicle (EV) research and exploitation can have in the field. EVs are natural particles delimited by a lipidic bilayer and full of functional cellular content, released and uptaken by cells as key means of cell communications. Moreover, being stable in body fluids, well-immunotolerated, able to cross physiological, inter-species, and inter-kingdom barriers, and to target specific cells, releasing inherent or externally loaded functionally active molecules, EVs can be potentially ideal allies in fighting GB and assuring to GB patients a better prognosis. Here we report the main results obtained until now, focusing on both EV sources and molecular cargo used in the different functional studies, mainly in vivo. Finally, we perform a SWOT analysis reporting both the main advantages and the pitfalls of developing EV-based GB therapeutic strategies to highlight the main directions to explore for realizing the promise of EV exploitation for GB treatment.

Background: Convectional methods for drug delivery often faces setbacks due to systemic distribution, short half-life and degradation of therapeutics and therefore reduce concentrations of drug available to target tissue. Nanotheranostic provide a novel method for treating and diagnosing diseases Methodology: collection and review of relevant literatureResult: while nanotheranostic offer advantage of personalized medicine and often combines diagnosis and therapy using single molecular approach, nuclear medicine relies on radioactive isotopes to diagnosed and destroys cancer cells. In both cases, nanocarriers such as lipid-based, polymer-based, drug-conjugate, inorganic nanoparticles are used to deliver drugs/probes/isotopes to target site, generating images and thereafter chemotherapy/radiotherapy begins.Conclusion: Nanotheranostic plays important role in diseases diagnostic, therapy, imaging, monitoring of disease progression / response through the use of nanocarriers. This is made possible through nanoparticles/nanocarriers that delivers drug to the target tissues/cells.

Polymeric particles made up of biodegradable and biocompatible polymers such as poly(lactic-co-glycolic acid) (PLGA) are promising tools for several biomedical applications including drug delivery. Particular emphasis is placed on the size and surface functionality of these systems as they are regarded as the main protagonists in dictating the particle behavior in vitro and in vivo. Current methods of manufacturing polymeric drug carriers offer a wide range of achievable particle sizes, however, they are unlikely to accurately control the size while maintaining the same production method and particle uniformity, as well as final production yield. Microfluidics technology has emerged as an efficient tool to manufacture particles in a highly controllable manner. Here, we report on tuning the size of PLGA particles at diameters ranging from sub-micron to microns using a single microfluidics device, and demonstrate how particle size influences the release characteristics, cellular uptake and in vivo clearance of these particles. Highly controlled production of PLGA particles with ~100 nm, ~200 nm and >1000 nm diameter is achieved through modification of flow and formulation parameters. Efficiency of particle uptake by dendritic cells and myeloid-derived suppressor cells isolated from mice is strongly correlated with particle size and is most efficient for ~100 nm particles. Particles systemically administered to mice mainly accumulate in liver and ~100 nm particles are cleared slower. Our study shows the direct relation between the particle size varied through microfluidics and the pharmacokinetics behavior of particles, which provides a further step towards the establishment of a customizable production process to generate tailor-made nanomedicines.

This study explores the multifaceted influence of litter size, maternal care, exercise, and aging on rats' neurobehavioral plasticity and dentate gyrus microglia dynamics. Body weight evolution revealed a progressive increase until maturity, followed by a decline during aging, with larger litters exhibiting lower weights initially. Notably, exercised rats from smaller litters displayed higher body weights during mature and aged stages. Dentate gyrus volumes showed no significant differences among groups, except for aged sedentary rats from smaller litters, which exhibited a reduction. Maternal care varied significantly based on litter size, with large litter dams showing lower frequencies of caregiving behaviors. Behavioral assays highlighted the detrimental impact of a sedentary lifestyle and reduced maternal care/large litters on spatial memory, mitigated by exercise in aged rats from smaller litters. Microglial dynamics in the layers of dentate gyrus revealed age-related changes modulated by litter size and exercise. Exercise interventions mitigated microgliosis associated with aging, particularly in aged rats. These findings underscore the complex interplay between early-life experiences, exercise, microglial dynamics, and neurobehavioral outcomes during aging.

This study explored intraindividual multidimensional profiles integrating psychosocial factors, namely, body image and satisfaction, weight-related self-stigma, positivity, and happiness, and behavioural-lifestyle factors, namely, adherence to a healthy diet, among Spanish adults with overweight or obesity. We further aimed to investigate the association of excess weight (i.e., measured body mass index, BMI) with the abovementioned multidimensional configurations. A convenience sample of adult individuals with excessive weight completed self-reports regarding the study variables, and their weight and height were measured. With a perspective centered on the individual, a cluster analysis established three distinct intraindividual psychosocial and diet-related profiles: a group of healthy individuals with excess weight; a group of individuals who were negatively affected by their excessive weight and showed the most distressed profile; and a group of dysfunctional individuals who seemed to be excessively unrealistic and optimistic regarding their excessive weight and unhealthy lifestyles. Furthermore, individuals in the affected cluster had higher obesity. The results showed that there are specific psychosocial and lifestyle profiles in the adult population with excess weight and that there are relationships among psychological, behavioural, and body-composition factors. For clinical application purposes, it is important to account for the heterogeneity within individuals who are obese and to individualize the interventions, with a focus from weight change to individual's overall well-being.

The lungs of tuberculosis (TB) patients contain a spectrum of granulomatous lesions ranging from solid and well vascularized cellular granulomas, to avascular caseous granulomas. In solid granulomas, current therapy kills actively replicating (AR) intracellular bacilli, while in low vascularized caseous granulomas the low oxygen tension stimulates aerobic and microaerophilic AR bacilli to transit into non-replicating (NR), drug-tolerant, extracellular stages. These stages, which do not have genetic mutations and are often referred to as persisters, are difficult to eradicate due to low drug penetration inside caseum and mycobacterial cell walls. The sputum of TB patients contains also viable bacilli called differentially detectable (DD) cells that, unlike persisters, grow in liquid, but not in solid media. This review provides a comprehensive update on drug combinations killing in vitro AR and drug-tolerant bacilli (persisters and DD cells), and sterilizing Mycobacterium tuberculosis-infected BALB/c and caseum-forming C3HeB/FeJ mice. These observations have been important for testing new drug combinations in noninferiority clinical trials, in order to shorten duration of current regimens against TB. In 2022, the World Health Organization, based on one of this trial, supported the use of a 4-month regimen for treatment of drug-susceptible TB as a possible alternative to the current 6-month regimen.

Rheumatoid arthritis (RA) is a systemic autoimmune disease characterized by swelling in at least one joint. Owing to an overactive immune response, extra-articular manifestations are observed in certain cases, with interstitial lung disease (ILD) being the most common. Rheumatoid arthritis-associated interstitial lung disease (RA-ILD) is characterized by chronic inflammation of the interstitial space, which causes fibrosis and the scarring of lung tissue. Controlling inflammation and pulmonary fibrosis in RA-ILD is important because they are associated with high morbidity and mortality. Pirfenidone and nintedanib are specific drugs against idiopathic pulmonary fibrosis and have shown efficacy against RA-ILD in several clinical trials. Immunosuppressants and disease-modifying antirheumatic drugs (DMARDs) with antifibrotic effects have also been used to treat RA-ILD. Immunosuppressants moderate the overexpression of cytokines and immune cells to reduce pulmonary damage and slow the progression of fibrosis. DMARDs with mild antifibrotic effects target specific fibrotic pathways to regulate fibrogenic cellular activity, extracellular matrix homeostasis, and oxidative stress levels. Therefore, specific medications are required to effectively treat RA-ILD. In this review, the commonly used RA-ILD treatments are discussed based on their molecular mechanisms and clinical trial results. In addition, a computational approach is proposed to develop specific drugs for RA-ILD.

Artificial Intellignece (AI) is a platform lending immense assistance in discovering and developing drugs and thus, various such approaches have been developed with the intent of simplifying and improving biomedical operations such as drug repurposing and drug discovery. In the past decade, AI-based investigation of nanomedicines, as well as non-nanomedicines has reached the clinical level. In semblance with the traditional methods of therapy, nanomedicine therapy is employed at limited doses. The study of a variety of drugs resulted in the conclusion that the effect of each drug is variable for every patient and, evaluating that perfect drug combination manually is a time-consuming as well as an inefficient treatment method. Therefore, the use of AI simplifies and reduces the time consumption in determining the perfect customized drug combination for nano-therapy. The area with the most potential for meeting this reality is to optimize the drug and dosage parameters. It is a universally known fact that cancer is dangerous and unique because of the exacting challenges it poses during treatment and, to achieve a better treatment, the therapeutic effect on each patient must be delineated even if the volume of data generated is massive. The article aims at analyzing the AI technologies that help yield results much quicker, make the analyses simple, and efficient.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.