The protection of grapevine from the diseases is now particularly focused on the development of environmentally friendly strategies. Although sulphur is not in itself a toxic substance, a large use towards powdery mildew, in organic vineyards especially, may cause problems to environment, health and safety of viticultural workers and plant phytotoxicity. The activity on powdery mildew of sulphur applied at doses reduced up to 50% in tank mixtures with silicates and Equisetum arvense based products, never tested on grapevine, was assessed. Two-year trials were carried out applying the products every 7-9 days in the period of greatest risk for spring ascosporic infections, in two organic vineyards in the Abruzzo region, Italy. The effectiveness towards the disease of the mixtures was demonstrated, often to a greater extent than that of full-dose sulphur, normally used in the vineyards. Furthermore, in vines treated with the mixtures, increases in yield quantity and quality, such as higher contents of soluble solids and lower levels of total acidity, have been shown. Due to the strong efficacy demonstrated on the leaves, silicon-based products + sulphur mixtures can also be recommended in eradicative applications, aimed at reducing the inoculum of the disease. The great activity of the mixtures demonstrated in this study suggests confirmation through further investigations on different cultivars and vine-growing areas at different levels of infection, also testing the effectiveness of individual silicon products against the disease.

This study examined the efficiency of a combined diagnostic approach in which bioamplification of Arizona 861 S1 citron was integrated with RT‒PCR to detect Citrus tristeza virus (CTV) and Hop Stunt Viroid (HSVd) in Citrus plants. The capacity of the combined method to diagnose mixed infections of CTV and HSVd, along with early single infections of both pathogens, was assessed by evaluating the incubation periods and differential detection capabilities between the combined and direct methods. The bioamplification method exhibited high sensitivity (100%) and specificity (100%) for CTV, enabling early detection even in patients with low-titer infections compared to direct RT‒PCR. However, for HSVd, the combined method achieved 50% sensitivity in early infections, highlighting the need for additional replicates to enhance diagnostic reliability. The relative concentrations of pathogens in mixed and simple infections were evaluated; the analysis revealed no significant differences, suggesting minimal interference between CTV and HSVd. This approach allows early detection of CTV but requires further refinement for HSVd diagnosis. These findings underscore the complementary roles of the cost-effectiveness of direct RT‒PCR and the sensitivity of the combined method in implementing effective disease control strategies in citrus crops.

Computational methods are essential to support and advance nuclear technologies due to the hazards of handling and analysing highly radioactive materials such as spent nuclear fuel (SNF). However, many such methods, including those thatcan predict SNF compositions and decay heat parameters, require expensive, proprietary software, alongside significant programming experience and computational power for utilisation, severely limiting availability of data and hampering research throughput. Although some datasets are available, many are incomplete or only cover certain fuel systems for older reactor types. Research investigating new methods for SNF recycling, for example, requires compositional and decay heat data for fuel systems not covered by extant data, though analogous source data may be available. With this in mind, we have developed a simple, accessible, and flexible method for extrapolation of isotopic, elemental, and decayheat compositions for SNF at discharge and following decay storage before recycling, based on an extant dataset. This semi-empirical method uses physical and mathematical first principles and can be performed using software accessible to all researchers. This provides outputs accurate to within 1% of reference values interpolated within the range of available data for isotopic compositions, with sensible extrapolations at higher burnups beyond those reported, withoverall elemental outputs accurate to within 0.1%of expected totals. In this publication, we present the developmental methodology, some sample data, the present limitations, and options for future development and expansion of functionality.

Historical and Endowment Properties are different from Heritage and cultural Properties, as Historical and Endowment properties are governed by a unique set of laws that Waqf recipients must abide by. Property that is entrusted is usually in the form of buildings, land or valuables which in preservation is not limited to time as long as the property can be utilized. Reliable information technology is needed to ensure data security both digitally and physically, while the rapid development of information technology demands information openness and this will be a challenge in itself. The objectives of this study include examining the collection of historical databases and endowments, the relationship between digital data and physical data and management organizations. The method of how to design a query model to display data is then analyzed whether the data conforms to the rules in waqf management. The results are expected to bring up accurate data between digital data and physical data and if there are differences into findings for the next analysis.

Populations with essential hypertension have a high risk of nonalcoholic steatohepatitis (NASH). In this study, we investigated the mechanism that underlies the progression of hypertension-associated NASH by comparing differences in the development of high fat and cholesterol (HFC) diet-induced NASH among three strains of rats, i.e., two hypertensive strains comprising spontaneously hypertensive rats and the stroke-prone spontaneously hypertensive 5/Dmcr, and the original Wistar Kyoto rats as the normotensive control. We investigated histopathological changes and molecular signals related to inflammation in the liver after feeding with the HFC diet for 8 weeks. The diet induced severe lobular inflammation and fibrosis in the livers of the hypertensive rats, whereas it only caused mild steatohepatitis in the normotensive rats. Increased activation of proinflammatory signaling (transforming growth factor-β1/mitogen-activated protein kinases pathway) was observed in the hypertensive strains fed with the HFC diet. In addition, the HFC diet suppressed the nuclear factor erythroid 2-related factor 2 pathway in the hypertensive rats and led to lower increases in the hepatic expression of heme oxygenase-1, which has anti-oxidative and anti-inflammatory activities. In conclusion, these signaling pathways might play crucial roles in the development of hypertension-associated NASH.

This study compared the mineral content and bioactive properties of flowers and fruit coming from wild elderberry plants with those of flowers and fruit harvested from elderberry cultivars grown in an orchard. Elderberry fruit and flowers were analysed for the content of selected minerals, phenolic compounds and anthocyanins and for antioxidant activity. Mineral content was determined by atomic absorption spectrometry method, while antioxidant activity and the content of polyphenols and anthocyanins were determined by spectrophotometric methods. Flowers were found to contain more total ash and to have much higher content of most of minerals, except magnesium, which was present in high concentrations in fruit. Fruit showed significantly higher antioxidant activity than flowers, whereas the total phenolic content varied depending on the growing location / cultivar. The material obtained from selected cultivars growing in an orchard had higher antioxidant activity and polyphenol and anthocyanin content than the material obtained from wild plants. Fruit of the ‘Haschberg’ cultivar and flowers of the ‘Sampo’ cultivar had the best bioactive properties of the studied samples.

Recent evidence suggests that among behavioral-lifestyle factors, adherence to a healthy dietary pattern such as the Mediterranean Diet (MedDiet) is linked not only to better psychological health and mental positive status but also to increased subjective well-being (SWB). Nevertheless, this association has been unexplored among individuals with excessive weight. This study explored whether adherence to the MedDiet and the intake of healthy foods such as fruits and vegetables (FV) are associated with increased happiness and life satisfaction among Spanish adults with overweight or obesity when weight, body image, and body satisfaction are also considered. A convenience sample of adult individuals with excessive weight completed self-reports on the study variables, and weight and BMI were measured by bioimpedance. No evidence of a relationship with SWB indicators was obtained for MedDiet global indicators, probably due to the low adherence to a healthy diet by these individuals. In contrast, FV intake, as a powerful indicator of healthy eating, was associated with life satisfaction when BMI and body image dimensions were considered, among which body satisfaction also had a key role. Moreover, life satisfaction fully mediated the relationship between FV consumption and happiness. Our findings are expected to make a relevant contribution to knowledge on the positive correlates or protective factors for overall well-being in obesity, including dietary habits and body appreciation. Our results may inform obesity management actions focused on inclusive, positive aesthetic models and promoting a healthy lifestyle for happiness in obesity.

We evaluated epidemiological evolution and economic impact of COVID-19 pandemic in the European Union (EU) and worldwide, and the effects of control strategies on them. We collected incidence, mortality, and gross domestic product (GDP) data between the first quarter of 2020 and of 2023. Then, we reviewed the effectiveness of the mitigation and zero-COVID control strategies. The statistical analysis was done calculating the incidence rate ratio (IRR) of two rates and its 95% confidence interval (CI). In the EU, COVID-19 presented six epidemic waves. The sixth one at the beginning of 2022 was the biggest. Globally, the biggest wave occurred at the beginning of 2023. Highest mortality rates were observed in the EU during 2020-2021 and globally at the beginning of 2021. In mitigation countries, mortality was much higher than in zero-COVID countries (IRR= 6.82; CI:6.14-7.60; p<0.001). A GDP reduction was observed worldwide, except in Asia. None of the eight zero-COVID countries presented a GDP growth percentage lower than the EU percentage in 2020, and 3/8 in 2022 (p=0.054). COVID-19 pandemic caused epidemic waves with high mortality rates and a negative impact on GDP. The zero-COVID strategy was more effective in avoiding mortality and potentially had less impact on GDP.

Health issues of children with intellectual disabilities (ID) have gained significant attention as a key focus of China health goals. This study aimed to compare the differences in displacement skills and problem behaviors among children with varying degrees and types of ID, while also exploring their relationship. The study included 90 participants who were children with ID and had completed TGMD-2 displacement skills and Strengths and Difficulties Questionnaire (SDQ) assessments. Covariance, partial correlation, and multiple linear regression analyses were conducted to examine the differences and correlations between these factors. The findings revealed that higher severity of intellectual disability was associated with lower scores in locomotor skills and increased manifestation of problem behaviors. Notably, there were significant variations in locomotor skills and problem behaviors among children with different types of intellectual disabilities. There is a positive correlation between locomotor skills and problem behaviors in children with intellectual disabilities, where locomotor skills can predict the occurrence of problem behaviors. In Conclusion, the research confirms that the development of locomotor skills can have a positive impact on the accompanying problem behaviors of children with developmental disabilities.

Thailand has formulated her climate change policy and updated relevant plans and policies to align with the goal of achieving carbon neutrality and net zero GHG emissions. This study investigates the optimal level of GHG mitigation in Thailand, taking into account the marginal abatement cost (MAC) and social cost of carbon (SCC). It evaluates how energy efficiency and renewable energy technologies influence GHG reduction in the power and industrial sector and illustrates policy recommendations that align with the 2020 to 2050 policy and plan period. The findings indicate that there may be instances where GHG mitigation potential is insufficient to reach the national mile-stone. In such cases, it becomes imperative to leverage all technologies within the marginal abatement cost curve (MACC) and also utilization of the social cost of carbon for policy decision making and meeting the desired goals. In certain scenarios, the adoption of additional technologies or measures may be necessary, such as flexible power generation and deploying carbon capture and storage or hydrogen which are high-cost technologies. Furthermore, preparations should be made for multiple levels of climate change policies and plans beyond 2030.

The use of Hyperspectral (HS) and LiDAR acquisitions has a great potential to enhance mapping and monitoring practices of endangered grasslands habitats, beyond conventional botanical field surveys. In this study we assess the potentiality of Recursive Feature Elimination (RFE) in combination with Random Forest (RF) classification in extracting the main HS and LiDAR features needed to map selected Natura 2000 grasslands along Polish lowland river valleys, in particular alluvial meadows 6440, lowland hay meadows 6510 and xeric and calcareous grasslands 6120. We developed an automated RFE-RF system capable to combine the potentials of both techniques and applied it to multiple acquisitions. Several LiDAR-based products and different Spectral Indexes (SI) were computed and used as input in the system, with the aim of shedding light on the best-to-use features. Results showed a remarkable increase in classification accuracy when LiDAR and SI products are added to the HS dataset, strengthening in particular the importance of employing LiDAR in combination with HS. Using only the 24 optimal features selection generalized over the three study areas, strongly linked to the highly heterogeneous characteristics of the habitats and landscapes investigated, it was possible to achieve rather high classification results (K around 0.7-0.77 and habitats F1 accuracy around 0.8-0.85), indicating that the selected Natura 2000 meadows and dry grasslands habitats can be automatically mapped by airborne HS and LiDAR data. Similar approaches might be considered for future monitoring activities in the context of habitats protection and conservation

Background: Radiotherapy is an important part of the medical therapy concept treating tumors in the head and neck region; however, the impact on the field of dentistry could be im-mense. The objective of this study was to evaluate the microtensile bond strength (µTBS) of uni-versal adhesives and to compare the results of different application modes (etch-and-rinse and self-etch) on irradiated and sound human dentin. Methods: Dentin specimen of 180 extracted human wisdom teeth were divided in two superordinate groups. Ninety teeth received either no irradiation (control group) or the high-level therapeutic dose of 60 Gy (test group) applied frac-tionally (2 Gy/day, 5 days/week, 6 weeks). Samples from each group were randomly divided in-to six subgroups assigned to three established universal adhesives (Futurabond® U, VOCO; AdheSE® Universal, Ivoclar Vivadent; Xeno® Select, Dentsply) in both conceivable application modes: etch-and-rinse and self-etch (n = 15). Bond strength was assessed with a universal testing machine immediately after application and light curing of the adhesive materials. Statistical analysis was performed using two-way ANOVA (p<0.01) and Tukey's test (p<0.05). Results: The effect of dentin irradiation and application mode for the adhesive restoration was found to be significant (p<0.01, ANOVA). In all groups, a decrease of µTBS could be observed when used on irradiated dentin. However, no significant influence of high level radiation on the bond strength of Futurabond® U and AdheSE® Universal in both modes could be evaluated (p>0.05, Tukey´s test). Solely in the case of the adhesive system Xeno® Select, significantly reduced bond strength could be determined in self-etch mode after irradiation (group 60 Xse) compared to the control group (0 Xse) (p<0.05, Tukey´s test). Conclusions: Within the limitations of an in vitro study, some effects of high-level tumor irradiation on the bond strength of universal adhesives can be detected. However, these effects were strongly depending on the used material and application mode.

The representation of aerosols in climate-chemistry models is important for air quality and climate change research, but it can require significant computational resources. To overcome this, simpler modules such as modal aerosol modules with three lognormal modes (MAM3) can be used. In this study, the coupling of the Carbon Bond Mechanism, version Z (CBMZ), and MAM3 chemistry modules in WRF-CAM5 was improved by adding biomass-burning emissions to both gas- and particle-phase chemistry and incorporating a conversion mechanism between volatile organic compounds (VOCs) and secondary organic carbons (SOCs). The study conducted six simulations over the western U.S. and northeastern Pacific region and compared the model’s performance with observational benchmarks such as reanalysis, ground-based, and satellite data. The results showed that the model with enhanced chemistry capabilities had a 31% and 58% reduction in root-mean-square errors (RMSE) for black carbon (BC) and organic carbon (OC) surface concentrations, respectively. The earlier release of the WRF-CAM5 version had two deficiencies that were addressed in this study. This research highlights the importance of accurate aerosol representation in climate-chemistry models for improving accuracy and reducing errors in simulations.

We attempted to establish an objective method to accurately evaluate the motility of bull sperm and examined the effects of media for sperm suspensions and frame rates on data of computer-assisted sperm motility analysis (CASA). Sperm incubated in Brackett and Oliphant medium (BO) more clearly showed hyperactivation-like motility than those in synthetic oviductal fluid. Sperm images captured at 150 frames per second (fps) showed a trajectory that was closer to the real pathway than those at other frame rates (30, 50, and 75 fps). We then examined the characteristics of sex-sorted and non-sorted semen using a cluster analysis followed by a discriminant analysis of sperm motility in BO at 150 fps. The results indicated that sex-sorted semen contained sperm with hyperactivation-like motility as the main subpopulation immediately after thawing and this subpopulation decreased after 2-h incubation. The main subpopulation in non-sorted semen had progressive motility that was maintained during incubation. In conclusion, usage of BO for sperm suspensions and capturing sperm motility at 150 fps by CASA were appropriate for evaluating bovine sperm motility. A discriminant analysis using data from a cluster analysis of motile sperm has the ability to accurately describe differences in the structures of sperm motility subpopulations.

Samples of mortar mixtures were prepared substituting the cement Portland (CPC-30R) by 0 (standard), 10 and 15% of fly ash and the structural evolution and compressive strength at 3, 7, 14 and 28 days were determined. The results for standard mortar samples showed the mineralogi-cal species portlandite, calcite, ettringite, iron oxide, silicon oxide and sillimanite. Magnetite was identified in the mixtures of mortars with portland cement substitution by 10% and 15% fly ash. The peaks corresponding to the portlandite, and ettringite showed an increase in their intensities with increasing curing time attributed to the consolidation of mineral species. The SEM tech-nique results showed that the mortar samples without fly ash addition contained mainly port-landite and ettringite while the samples with cement substitution by 10 and 15% of fly ash at 28 days further contained particles of fly ash coated with portlandite and ettringite, particles with a smooth surface and particles of fly ash with signs of attack on its surface. An increase inc was observed when the age of the mortar and the substitution of Portland cement by fly ash were increased from 3 to 28 days and from 0 to 15% respectively. The maximum value of c was reg-istered for the mortar sample with Portland cement substitution by 15% fly ash at 28 days of curing with 17.38 Mpa.

Older adults in low-and middle-income countries experience a disproportionate burden of non-communicable diseases (NCDs). Unintentional injuries are among the major NCDs, and falls are the second leading cause of these injuries and deaths worldwide, including in Thailand. We aimed to culturally adapt the CDC’s Stopping Elderly Accidents, Deaths, and Injuries (STEADI) for Thai older adults and explore the feasibility, appropriateness, and acceptability of using STEADI in primary care via trained community health workers (CHWs) and care managers (CMs). STEADI takes a coordinated care approach that consists of three steps: screening, assessing, and intervening. In Step a, CHWs screened fall risk in 20 community-dwelling older adults using three key questions and found that all of them had fall risk, then CHWs screened with a Stay Independent questionnaire (range 0-14) and found that 100% have high fall risk (total scores 9.7± 2.4). In Step b, CMs assessed balance, vision, footwear, postural hypotension, medications, and CHWs assessed home hazards. They found that 50% had poor balance, 70% took 4+ medications,75% fell on the walkway, and 70% had no bathroom modifications. In Step c, individual participants received fall prevention interventions to mitigate their specific fall risk factors. CHWs and CMs indicated high acceptability (19.20±.1.31 of 20 total), appropriateness (18.80± 1.79 of 20 total), and feasibility (18.60±1.67 of 20 total) of the Thai-STEADI intervention. Our study showed that the community-based multifactorial Thai-STEADI delivered by CHWs and CMs is feasible and acceptable to prevent falls in older adults with limited access to health care.

High purity TiO2 and CuO powders were synthesized by the Pechini method, an inexpensive and easy-to-implement procedure to synthetize metal oxides. The variables of synthesis were the ethylene glycol:citric acid molar ratio and the pH. High reproducibility of the anatase and tenorite phase was obtained for all synthesis routes. The degree of purity of the powders was confirmed by XRD, FTIR, UV-vis absorption and XPS spectra. SEM and TEM images revealed the powders are composed by micrometer grains that can have a spherical shape (only in the TiO2) or formed by a non-compacted nanocrystalline conglomerate. FTIR spectra only vibrational modes associated to the TiO2 or CuO with a nanoparticle behavior. UV-vis absorption spectra revealed the values of maximum absorbance percentage of both systems are reached in the ultraviolet region, with percentages above 83 % throughout the entire visible light spectrum for the CuO system, a relevant result for solar cell applications. Finally, XPS experiments allow the observation of the valence bands and the calculation of the energy bands of all oxides.

The objective of this research was to study the dynamics of moisture and nutrition at the root zone and to quantify the variables linked to efficient water management in avocado orchards of mid and high-lands of Michoacán, México, in typical Andisols of low fertility with (A)C(w2) and C(w2) climates, respectively. Using the FDR (Frequency Domain Reflectometry) technology, the dynamics of soil moisture and salinity were recorded daily at four depths: 0-15, 15-30, 30-45, and 45-60 cm. The soil moisture balance model was used to determine actual evapotranspiration (ETr), crop coefficient (Kc), and water use efficiency (WUE). Results indicated that ETr is 66-73% of the total water at 0-30 cm depth; the fertilizer absorption is limited to 0-30 cm, being negligible at deeper layers. The water use efficiency is 4.4 to 5.6 kg of fruit m-3 of applied water, and the ratio of the water use index (ETr/irrigation sheet applied, ISA) is 0.65-0.70; while the annual avocado Kc is 0.72 in Cutzato and 0.78 in Tiamba. We concluded that avocado has a low water requirement, it does not cause leaching of nutrients and/or water, the absorption of water and nutrients mostly occurs at 30 cm depth, and from a hydrological point of view, the crop is environmentally friendly.

The 2022-2023 Mpox multi-country outbreak, identified in over 110 WHO Member States, revealed a predominant impact on cisgender men, particularly those engaging in sex with men, while less frequently affecting women. This disparity prompted a focused investigation into the gender-specific characteristics of Mpox infections, particularly among women, to address a notable knowledge gap. This review systematically gathers and analyzes scientific literature and case reports concerning Mpox infections in women, covering a broad geographical spectrum including regions such as Buenos Aires, Brazil, Northern California, Colombia, Nigeria, Europe, Vietnam, Spain, Switzerland, and the United States. The analysis delves into various aspects of Mpox in women, including clinical features, epidemiology, psychological impacts, preparedness strategies, and case studies, with particular attention to pregnant women and those with underlying health conditions. Empirical data from multiple studies underscore the unique epidemiological and clinical patterns of Mpox in women. In the United States, a small percentage of Mpox cases were reported among cisgender women, with a notable portion involving non-Hispanic Black or African American, non-Hispanic White, and Hispanic or Latino ethnicities. The primary transmission route was identified as sexual or close intimate contact, with the virus predominantly manifesting on the legs, arms, and genital areas. Further, a study in Spain highlighted significant disparities in diagnosis delays, transmission modes, and clinical manifestations between genders, indicating a different risk profile and disease progression in women. Additionally, a case from Vietnam linked to a new Mpox sublineage in women emphasizes the role of women in the transmission dynamics and the importance of genomic monitoring. This review emphasizes the necessity for inclusive surveillance and research to fully understand Mpox dynamics across diverse population groups, including women. Highlighting gender and sexual orientation in public health responses is crucial for an effective approach to managing the spread and impact of the disease. The findings advocate for a gender-diverse assessment in health services and further research to explore the nuances of Mpox transmission, behavior, and progression among different groups, thereby enhancing the global response to Mpox and similar public health challenges.

Pancreatic β-cell-specific clock knock-out mice develop β cell oxidative-stress and failure, as well as glucose-intolerance. How inflammatory stress affects the cellular clock is under-investigated. Real-time recording of Per2:luciferase reporter activity in murine and human pancreatic islets demonstrated that the proinflammatory cytokine Interleukin-1β (IL-1β) lengthened the circadian period. qPCR-profiling of core clock gene expression in insulin-producing cells suggested that the combination of the proinflammatory cytokines IL-1β and Interferon-γ (IFN-γ) caused pronounced but uncoordinated increases in mRNA levels of multiple core clock genes, in particular of Reverse-erythroblastosis virus α (Rev-erbα), in a dose- and time-dependent manner. The REV-ERBα/β agonist SR9009, used to mimic cytokine-mediated Rev-erbα induction, reduced constitutive and cytokine-induced Brain and muscle arnt-like 1 (Bmal1) mRNA levels in INS-1 cells as expected. SR9009 induced reactive oxygen species (ROS), reduced insulin-1/2 (Ins-1/2) mRNA and accumulated- and glucose-stimulated insulin secretion, reduced cell-viability, and increased apoptosis levels, reminiscent of cytokine toxicity. In contrast low (<5,0 μM) concentrations of SR9009 increased Ins-1 mRNA and accumulated insulin-secretion without affecting INS-1 cell viability, mirroring low-concentration IL-1β mediated β-cell stimulation. Inhibiting nitric oxide (NO) synthesis, the lysine deacetylase HDAC3 and the immunoproteasome reduced cytokine-mediated increases in clock gene expression. In conclusion, the cytokine-combination perturbed the intrinsic clocks operative in mouse and human pancreatic islets and induced uncoordinated clock gene expression in INS-1 cells, the latter effect associated with NO, HDAC3 and immunoproteasome activity.

The essential oils (EOs) obtained from aromatic plants are rich in natural compounds with interesting biological effects. The aim of this study was to evaluate the chemical composition of EOs of Mentha pulegium (MP-EO) and Mentha suaveolens (MS-EO) collected from Morocco, and their antioxidant properties and antibacterial activity against Salmonella enterica and Listeria monocytogenes. The EOs were extracted by hydro-distillation, while the chemical compositions were determined by GC-MS. The antioxidant activity was evaluated by DPPH and FRAP assay. Antibacterial activity was tested with disc diffusion assay; determination of minimum inhibitory concentration, minimum bactericidal concentration and the evaluation of sub-lethally injured cell were also performed. The results of chemical composition showed the presence of compounds not still reported in EOs obtained from these plants. MS-EO was characterized by the best antioxidant and antibacterial activity vs S. enterica and L. monocytogenes respect to MP-EO. The EOs tested in this study were rich in compounds with interesting activities and they could be applied in the medical fields, as well as in food industries as natural preservatives against tested food borne pathogens.

Low-sodium salt substitute (LSSS) has the potential in regulating sodium and potassium intake and has been available in China market for years. However, its real-world use and impact to sodium\potassium intake is unclear. Baseline data of 4000 adult participants who participated in three similar-designed randomized controlled trails were pooled together for this study. Self-reported awareness and use of LSSS were collected using the uniform questionnaire, and the 24-h urinary sodium and potassium excretion was used to estimate their dietary intake. Mixed-effects models were developed to assess the relationship between LSSS and 24-h urinary sodium and potassium excretion. 32.0% of the participants reported awareness of LSSS and 11.7% reported its current use. After adjusting location, sex, age, and education, compared with the group of participants unaware of LSSS, participants who were aware but not using LSSS and those who were using LSSS had a lower 24-h urinary sodium excretion by –356.1(95% CI: –503.9, –205.9) mg/d and –490.6(95% CI: –679.2, –293.7), respectively (p&lt;0.001). No significant difference was found for 24-h urinary potassium excretion and sodium-to-potassium ratio among the three groups (p&gt;0.05). In conclusion, although associated with lower sodium intake, the awareness and real-world use of LSSS are still very low in China.

Recent studies releaved that the high production of reactive oxidative species due to exposure of fine or ultrafine particles are implicated in many chronical respiratory disorders. However, the poor standard of clinical data in sub-Saharan countries makes very difficult the assessment of knowledge of air pollution health impact in urban cities. Objective: the aim of this study was to evaluate distribution of respiratory disorders associated to exposure of air fine and ultrafine particles through changes of some oxidative stress biomarkers among motorbike drivers from two cities of Cameroon Methods: A cross-sectional survey using a standardized questionnaire was conducted in 2019 on 191 motorcycle drivers (MD) working in Douala and Dschang. Then, the activity of superoxide dismutase (SOD) and the level of malondialdehyde (MDA) were measured by colorimetric methods. The data of participants after clustered in Excel Microsoft were analysed and statistically compared using Spss 2.0 software. Results: The motorbike drivers recruited to both cities were aged from 21 to 40, with mean age of 29.93 (± 0.82). The distribution of respiratory disorders as running nose, cold, dry cough, chest discomfort, and breathlessness, was significantly increased among MD in Douala. According to results of biological assays, SOD and MDA, were significantly more increased among MD recruited in Douala, compared to those of Dschang. The change of these oxidative stress markers was significantly correlated with mobilization of neutrophils and Monocytes showing initiation and evolution of subjacent inflammatory reactions, and seemed to be significantly influenced by place of habitation of MD. Conclusion: Through this study it is confirmed the evidence of initiation and evolution of oxidative stress with long-term exposure to air fine or ultrafine particles among active people in Urban cities. Further studies should be conducted with more analysis to provide evidence cellular damage and dysfunction related to chronically exposure to fine air PM among active people in metropolitan of sub-Saharan Africa context.

Chalcones are a class of flavonoids possessing a variety of biological activities, including antimicrobial and antioxidant effects. Therefore, chalcones and their derivatives have potential use in the control of postharvest diseases. In this work, the effects of 2ʹ,4ʹ-dichloro-chalcone on the in vitro growth and in vivo pathogenicity of F. tricinctum and T. roseum were investigated. The results showed that 100 µM of 2ʹ,4ʹ-dichloro-chalcone strongly inhibited mycelial growth and conidial production of F. tricinctum (32.3%) and T. roseum (65.2%) in vitro. This treatment also significantly inhibited the expansion of potato dry rot from F. tricinctum (48.6%) and apple rot spot from T. roseum (36.2%). The incubation of F. tricinctum and T. roseum conidia with this agent for 2 h increased their cell membrane permeability by 25% and 22.5%, respectively and conidial membrane permeability by 41.7 and 65.4%, respectively. This treatment also significantly inhibited the total respiration rate and activated the cyanide-resistant respiratory pathway in both pathogens. Protein immunoblotting showed that the treatment increased alternative oxidase (AOX) levels after 4 h in F. tricinctum and T. roseum by 52.76% and 39.13%, respectively. Conclusion: 100 µM 2ʹ,4ʹ-dichloro-chalcone significantly inhibited mycelial growth and spore production in F. tricinctum and T. roseum in vitro and reduced their pathogenicity in postharvest potato and apple crops. Further analysis indicated that 2ʹ,4ʹ-dichloro-chalcone disrupted the integrity of cell membranes and the mitochondrial respiratory electron transport chain which leaded to ROS burst and oxidative stress, AOXs were induced directly or indirectly, and the cyanide resistant respiratory pathway was activated. The in vitro growth and pathogenicity of F. tricinctum and T. roseum were inhibited.

To investigate switching from brimonidine and ripasudil, and brimonidine or ripasudil to a fixed combination of brimonidine and ripasudil and evaluate the associated efficacy and safety in glaucoma patients. Glaucoma patients undergoing treatment with at least brimonidine and ripasudil (n = 25) or treatment with at least brimonidine or ripasudil (n = 45) were evaluated in this retrospective study. After switching patients taking brimonidine and ripasudil, or brimonidine or ripasudil to a ripasudil/brimonidine fixed-combination ophthalmic suspension (RBFC), intraocular pressure (IOP), superficial punctate keratopathy (SPK) and conjunctival hyperemia were evaluated at baseline and at 4, 12 and 24 weeks. No significant differences in the IOPs were observed at any of the time points after switching from brimonidine and ripasudil to RBFC. However, at 4, 12 and 24 weeks, a significant decrease was observed in the mean baseline IOP from 17.0 ± 4.4 mmHg to 15.7 ± 3.2 mmHg (P < 0.01), 14.3 ± 3.4 mmHg (P < 0.01) and 14.4 ± 4.1 mmHg (P < 0.01), respectively, after switching from brimonidine or ripasudil to RBFC. No significant changes were noted for the SPK score or conjunctival hyperemia at any time points after switching to RBFC. Throughout the 24-week evaluation period, the IOP was maintained after switching from brimonidine and ripasudil to RBFC. However, there was a significant IOP decrease after switching from brimonidine or ripasudil to RBFC. These results demonstrate that RBFC is safe for use in the treatment of glaucoma patients.

Background: COVID-19 has a major impact on businesses, with employee absenteeism resulting in lost productivity and medical costs to employers as well as lost wages and medical costs to employees. The aim of this analysis was to assess the economic impact of workplace COVID-19 vaccination in the United States (US).Methods: A decision tree economic model, populated with US data for the working-age population, estimated the burden of COVID-19 in the workplace (symptomatic infections, long COVID cases, inpatient/outpatient care, absent days) with and without vaccination. Disease burden and impact of seasonal influenza vaccination was studied for context. Results: Without workplace vaccination, an average US business (with 10,000 employees), had an estimated 18,175 absent days from COVID-19, resulting in employer lost productivity costs of $ 5.08 million. Implementing COVID-19 workplace vaccination (at 70% US Healthy People target vaccination rate) prevented an estimated 3,132 absent days, saving employers $ 876,453 in lost productivity costs and $240,633 in medical costs. It also saved employees $ 182,196 in medical costs and $198,250 in lost wages . Seasonal influenza caused around 5,333 absent days, and seasonal influenza vaccination (at 70% coverage) prevented 1,675 absent days, saving employers $ 468,394 in lost productivity and saving employees $ 27,757 in medical costs. Conclusions: COVID-19 remains a burden to US businesses. Implementing COVID-19 workplace vaccination and increasing vaccination coverage rates for COVID-19 and seasonal influenza has the potential to prevent a significant number of absent days, while providing employers and employees with cost savings from averted disease and its consequences.

The mining industry is a fundamental pillar of economic development in Peru, but mine tailings can generate contamination by toxic heavy metals such as Hg, As, Pb, Cd, and Zn, affecting health, flora, and fauna. This research aimed to characterize the physical, chemical, mineralogical, and toxicological properties of active and passive tailings in the Arequipa region of Peru to identify and quantify the presence of these heavy metals. Analytical techniques, such as granulometry, ICP, TCLP, SEM, and EDS were used to obtain detailed information about the characteristics of the tailings. The results showed significant variability in particle size distribution, as well as differences in mineralogical composition, including the presence of valuable and potentially toxic minerals. This study will allow corrective actions to be taken to prevent, minimize, or remediate potential negative impacts in the region.

Dirofilaria immitis and D. repens are the two most widespread and important species of mosquito-borne nematodes, posing a significant threat to veterinary health, particularly affecting canines and felines. While D. immitis causes cardiopulmonary dirofilariasis, D. repens causes subcutaneous infections in dogs and other carnivores. Despite extensive knowledge about the aforementioned parasites, little is known about their natural vectors in Serbia. Thus, the aim of this study was to: i) further map out Dirofilaria sp. hotspots in the Vojvodina Province, ii) detect positive mosquito species which can provide insights in how the nematodes spread and adapt to the environmental conditions, and iii) analyze the blood fed mosquitoes females of species found infected to identify the potential source of parasite infection. A total of 2,902 female mosquitoes were collected across 73 locations during 2021 and 2022. Molecular biology methods, based on conventional PCR, were used to analyze non-blood fed (2,521 specimens) and blood fed (381 specimens) mosquito females, in order to detect filarial nematode presence and identify blood meal sources respectively. When the parasite genome was detected, the amplicon (COI gene, 650 bp fragment) was sent for Sanger sequencing, further confirming the presence of nematodes and species assignation. D. immitis was detected in three Culex pipiens mosquitoes collected in XXXX (location and date), while Setaria tundra was detected in Aedes vexans and Aedes caspius. This work adds two new locations where D. immitis occurs in Vojvodina, and is the first report of S. tundra on the territory of Serbia. Blood meal analysis provided insights into the preferences of mosquitoes that were positive for Dirofilaria sp. and S. tundra.

This research is completed in development of researches devoted to relations between elastic modulus (MoE) and thermal expansivity (CTe) of different materials. This study experimentally confirmed the relation of MoE and CTe for thermosetting polymers and FRPs both under normal and heating temperatures. As the thermosetting polymers, the epoxy compositions were used and glass fiber and mineral additives for FRP. The experiment was based on dilatometric and elastic deformations’ testing. Also, the relaxation model of MoE/CTe was proposed, that is based on physical properties of polymers’ supramolecular structures. The comparative analyzing of MoE/CTes’ different models is done. The most accurate models are determined, and the relaxation model has demonstrated the high accuracy.

Sparkling wines elaborated by means Ancestral method, also called Pét-Nats, are nowadays gaining an increasing share of the market. However, the scientific information about these wines is very scarce. For that reason, the aim of this research was to compare the physicochemical composition and sensory attributes of a representative sampling of commercial sparkling wines elaborated by Ancestral and Traditional methods. Ancestral sparkling wines were more heterogenous than Traditional sparkling wines because some of them showed lower internal pressure, higher turbidity, higher colour intensity and less foamability. These differences would be probably because the ancestral elaboration protocol is not so well defined as in the case of Traditional sparkling wines. However, Ancestral method has the advantage of being able to work with riper grapes and with lower doses of sulphur dioxide.

Demethyleneberberine is an active component extracted from the Chinese herbal drug Cortex Phellodendri. It is also a metabolite of the berberine in animals and humans. However, the pharmacokinetics, tissue distribution and excretion of demethyleneberberine have not been reported. The present study aimed to investigate the pharmacokinetic parameters of demethyleneberberine by developing a method of high-performance liquid chromatography-tandem mass spectrometry (LC-MS/MS). The detection was performed by using positive ion electrospray ionization in multiple reaction monitoring mode. The MS/MS ion transitions were monitored at m/z 324.4→308.3 for demethyleneberberine and 465.5→350.3 for IS. After oral administration of demethyleneberberine in rats and mice, the pharmacokinetics, tissue distribution, and excretion of desmethylberberine in rats and mice were comparatively studied for the first time. The plasma concentration of desmethylberberine reached its peak within 5 min after oral administration in both rats and mice. The bioavailability of rats and mice was comparable, ranging from 4.47% to 5.94%, higher than that of berberine. The total excretion of desmethylberberine in urine, feces and bile is 7.28~9.77%. These findings provide valuable insights into the pharmacological and clinical research on desmethylberberine.

Transcription factors are diverse intracellular proteins facilitating cellular responses to inducing factors via gene expression. Regulatory signalling cascades from the membrane proteins (sensors) to transcription factors (effectors) are paramount to accurate phenotypic display against external factors. This review examines several transcription factors germane to Cryptococcus (C.) neoformans adaptation and survival for human infection. These opportunistic pathogenic single-cell yeasts (fungi) possess several gene duplications and peculiar membrane proteins due to adaptive phenotypes and morphological plasticity. Consequently, hundreds of responsible pleiotropic genes have been studied to understand how these genes are induced, regulated, and coordinated. However, these findings are sparsely converged and interlinked, making it cumbersome to relate one gene to the other or group them by their functions. We reviewed several wide-ranging transcriptional analysis works associated with C. neoformans into comparable phenotypic traits that necessitate adaptation, survival, and human infection. We present a robust work that addresses several transcription factors and their inducing factors. Lastly, we converge, link, and group several of these factors according to their multifunctional expression pattern. We also provide adequate information on certain genes critical to this fungus, which could be explored pharmaceutically in drug targeting for more effective antifungal management.

Serpentine (Mg₃Si₂O₅(OH)₄), like quartz, dolomite and magnesite minerals, is a versatile mineral group characterized by silica and magnesium silicate contents with multiple polymorphic phases. Among the phases composed of antigorite, lizardite, and chrysotile, lizardite and chrysotile are the most prevalent phases in the serpentinites studied here. The ΣLREE/ΣHREE ratios of the samples are between 0.16 and 4 ppm. While Ce shows a strong negative anomaly (0.1–12), Eu shows a weak positive anomaly (0.1–0.3). This indicates that fluid interacts significantly with rock during serpentinization, and Highly Incompatible Elements (HIEs) gradually become involved in the serpentinization process. The large differential thermal analysis (DTA) peak at 810–830 °C is an important sign of dehydration, transformation reactions and thermal decomposition, and is com-patible with H₂O phyllosilicates in the mineral structure losing water at this temperature. In SEM images, chrysotile, which has a fibrous structure, and lizardite, which has a flat appearance, trans-form into talc as a result of dehydration with increasing temperature. Therefore, the sudden tem-perature drop observed in DTA graphs is an indicator of crystal form transformation and CO₂ loss. In this study, the mineralogical and structural properties and the formation of serpentinites were examined for the first time using thermo-gravimetric analysis methods. In addition, the mineralogical and physical properties of serpentinites can be recommended for industrial use as additives in polymers or in the adsorption of organic pollutants. As a result, the high refractory nature of examined serpentine suggests that it is well-suited for applications involving high temperatures. This includes industries such as metallurgy and steel production, glass manufacturing, ceramic production, and the chemical industry.

QTc interval measurement is a widely used screening tool to assess the risk of cardiac diseases, arrhythmias, and is a useful biomarker for pharmacovigilance. However, interpretation of QTc is difficult in neonates due to hemodynamic maturational changes and uncertainties on reference values. To describe trends in QTc values throughout infancy (1 year of life), and to explore the impact of (non)-maturational changes and medicines exposure, a structured systematic review (PROSPERO CRD42022302296) was performed. In term neonates, a decrease was observed over the first week of life, whereafter values increased until two months of age, followed by a progressive decrease until six months. A similar pattern, with longer QTc values was observed in preterms. QTc is influenced by cord clamping, hemodynamic changes, therapeutic hypothermia, illnesses and sleep, not by sex. Cisapride, domperidone and doxapram result in QTc prolongation in neo-nates. Further research in this age category is needed to improve primary screening practices, earlier detection of risk factors and precision pharmacovigilance.

Elevated antimony concentrations in aqueous environments from anthropogenic sources is becoming of global concern, here iron oxides are known to strongly adsorb aqueous antimony species with different oxidation states, but the effect of silica on the removal characteristics is not well understood despite being a common component in the environment. In this study, ferrihydrite was synthesized at various Si/Fe molar ratios to investigate its adsorption and co-precipitation behaviors with aqueous antimony anionic species, Sb(III) and Sb(V). The XRD analyses of the precipitates showed two broad diffraction features at approximately 35° and 62° 2θ, which are characteristic of 2-line ferrihydrite, no significant shifts in peak positions in the ferrihydrite regardless of the Si/Fe ratios. The infrared spectra showed a sharp band at ~990 cm⁻¹, corresponding to asymmetric stretching vibrations of Si-O-Fe bonds which increased in intensity with increasing Si/Fe molar ratios. Further, the surface charge on the precipitates became more negative with increasing Si/Fe molar ratios. The adsorption experiments indicated that Sb(V) was preferentially adsorbed at acidic conditions and decreased dramatically with increasing pH while the adsorption rate of Sb(III) ions was independent of pH, however, the presence of silica suppressed the adsorption of both Sb(III) and Sb(V) ions. The results showed that Sb(III) and Sb(V) ions were significantly inhibited by co-precipitation with ferrihydrite even in the presence of silica by isomorphous substitution in the ferrihydrite crystal structure.

Fingerhuthia africana Lehm belongs to family Poaceae, is an erect perennial grass used traditionally to cure different diseases. The current study was carried out to find the bioactive compounds by GC-MS, elemental analysis through atomic absorption spectrophotometry, proximate analysis by AOAC, genotoxic activity through comet assay, antioxidant activity through DPPH and antidiarrheal activity through castor oil induce diarrhea followed by charcoal meal on mice model. GC-MS chromatogram represents different compounds detected in the crude extract. Major pharmacological bioactive compounds are 4H-Pyran-4-one, 2,3-dihydro-3,5-dihydroxy-6-methyl-; 4-Methyl itaconate; .alpha.-Terpineol; 1,2,3-Propanetriol, 1-acetate; Benzofuran, 2,3-dihydro-; Caryophyllene oxide; Hinesol; n-Hexadecanoic acid; 9,12-Octadecadienoic acid (Z,Z)-, methyl ester; Hexadecanoic acid and methyl ester. Elemental analysis of stem, leaves and roots of the plant show the presence of (macro and micro) nutrients such as Ca, Mg, K, Na, Cu, Pb, Zn, Mn, Fe, Cd and Co were absent in all parts. Proximate analysis of different parts revealed the presence of moisture contents (8.57%), ash (9.77%), fats contents (5.96%), fibers contents (45.03%), protein (3.62%), carbohydrates (39.71%) and Gross energy (Kcal/100g) (220.10). The ethanolic extract show dose-dependent genoprotective potential (127.38 ± 1.16), (83.28 ± 0.65), and (44.08 ± 1.40) at 50, 75, and 100 mg/100 ml, respectively, as compared to the methanolic extract which show genotoxic activity (85.13 ± 1.23) at high dose. After 90 minutes at a concentration of 300 (g/ml), methanolic extract demonstrated the greatest antioxidant potential (79.5%), followed by aqueous extract (76.5%). The methanolic extract of F. africana demonstrated antidiarrheal efficacy, with the maximum inhibition of charcoal movement (83.78%) occurring at a dosage of 300 mg/kg, followed by doses of 200 and 100 mg/kg, 73.26% and 59.56%, respectively. The current research highlights that the plant contains a substantial quantity of micro and macro nutrients, possesses high nutritional value, and exhibits pharmacological activities. These properties render the plant suitable for developing remedies to treat various therapeutic diseases.

The synergetic features of a three-component photoinitiating systems (A/B/C) based on the measured data and proposed mechanism of Liu et al (Polymers, 2020, 12(6), 1394) are analyzed. The co-initiators/additives B and C have dual functions of : (i) regeneration of photoinitiator A and (ii) generation of extra radicals. The synergic effects lead to higher conversion of free radical polymerization (FRP) and cationic polymerization (CP). The key factors and rate constants influencing the conversion efficacy are explored by analytic formulas. Enhancing strategies for various photopolymerization systems are summarized including one component (or monomer) and one-wavelength, two-component and one, two and three-wavelength, and three-component, one-wavelength system. The synergetic effects for higher monomer conversion can be achieved by co-initiators for extra radicals and multiple wavelengths for reduced oxygen-inhibition. Co-initiator B, however, might also reduces the CP radical produced by initiator C. The conversion rate of FRP is proportional to the square root of the light intensity (I), absorption (b) and the initiator initial concentratios (A0, B0, C0), whereas CP is proportional to the linear power of a parameter defined as P=bIA0C0, a stronger dependence than FRP. The CP conversion is governed by a steady-state value proportional to P, and a rate fucntion defining the depletion rate of [A][C], or the increasing rate of the conversion profile. The measured results of Liu et al (Polymers, 2020, 12(6), 1394) are well analyzed and matching the predicted features of our modeling. The specific systems analyzed are: benzophenone derivatives (A) ethyl 4-(dimethylamino)benzoate (B), and (4-tert-butylphenyl)iodonium hexafluorophosphate (C) under a UV (365 nm) LED irradiation; and monomers of trimethylolpropane triacrylate (TMPTA, for FRP) and (3,4- epoxycyclohexane)methyl 3,4-epoxycyclohexylcarboxylate (EPOX, for CP).

Good child protection systems and processes require reliable and accurate data. A retrospective study of the case records of 452 children referred to a major UK children’s tertiary centre for suspected child maltreatment was undertaken to determine whether routinely collected data on a child’s journey through the child protection system, together with a study of related multidimensional factors, can be used to develop an enhanced dataset to protect children in the UK and in other countries. Child maltreatment was substantiated in 65% of referred cases, with the vast majority of referrals coming from children living in the most deprived neighbourhoods in the country. Domestic violence and abuse, and the child’s previous involvement with statutory bodies was associated with case substantiation. Physical abuse predominated, with soft tissue injuries, including dog bites, and burns. Burns were related almost exclusively to supervisory neglect. There were also cases of medical neglect. Emotional abuse was associated with exposure to domestic violence and abuse, and to self-harm. The strengths and weaknesses for single centre data systems were explored, concluding with a recommendation to establish an agreed national and international minimum data set to protect children from maltreatment.

This study investigates the impact of water stress on grapevines, specifically examining the role of rootstocks and aquaporins. Two experiments on potted plants were conducted in central Chile during the summer, under conditions of high water demand, involving various rootstock genotypes and combinations of Cabernet Sauvignon (CS) grafted onto rootstocks. Significant differences were observed among plants in terms of stem water potential, stomatal conductance, and growth rate. Notably, the CS/CS combination consistently displayed the slowest growth rate, regardless of the irrigation treatment. The study also analyzed the expression levels of plasma membrane intrinsic proteins (PIPs) and tonoplast intrinsic proteins (TIPs) aquaporins in the leaves of grafted plants. Specifically, VvPIP2;2 aquaporins showed reduced expression after 14 days without irrigation, whereas VvTIP1;1 and VvTIP2;1 expression levels correlated positively with gs responses in grafted plants, suggesting their role in modulating water content in leaves under water stress. TIP aquaporins likely play a significant role in the differential responses of CS plants towards nearly isohydric or anisohydric behaviour. The CS/CS combination exhibited near isohydric behavior, correlating with lower TIP aquaporin expression, while the combination of CS onto 1103P and 101-14 showed higher expression, indicating anisohydric behavior. The findings suggest that grafted plants are more resilient to water stress, supporting the idea that rootstocks can mitigate the effects of water stress on the scion

The synergic features and enhancing strategies for various photopolymerization systems are reviewed by kinetic schemes and the associated measurements. The important topics include: (i) photo crosslinking of corneas for the treatmnet of corneal deseases using UVA-light (365 nm) light and riboflavin as the photosensitizer; (ii) synergic effects by a dual-function enhancer in a 3-initiator system; (iii) synergic effects by a 3-initiator C/B/A system, having an electron-transfer and oxygen-mediated energy-transfer pathways; (iv) copper-complex (G1) photoredox catalyst in G1/Iod/NVK systems for free radiical (FRP) and cationic photopolymeriation (CP); (v) radical-mediated thiol-ene (TE) photopolymerizations; (vi) superbase photogenerator based-catalyzed thiol−acrylate Michael (TM) addition reaction; and the combined system of TE and TM usinghual wavelength; (vii) dual-wavelength (UV and blue) controlled photopolymerization confinement (PC); (viii) dual-wavelength (UV and red) selectively controlled 3D printing; and (ix) 3-wavelength selectively controlled in 3D printing and additive manufacturing (AM). With minimum mathematics, we present ( for the first time), the synergic features and enhancing strategies for various systems of multi-commponents, initiators, monomers, and under one- two- and there-wavelength light. Therefore, this Review provides not only the bridging between modeling and measurements, but also guidances for further experimantal stuides and new applications in 3D printings and additive manufacturing (AM), based on the innovative concepts (kinetics/schemes).

High temperatures (HT) and high hydrostatic pressures (HHP) are characteristic of deep-sea hydrothermal vents and other deep crustal settings. These environments host vast and diverse microbial populations, yet only a small fraction of those populations have been successfully cultured. This is due, in part, to the difficulty of sampling while maintaining these in situ conditions and also replicating those high-temperature and high-pressure conditions in the laboratory. In an effort to facilitate more HT-HHP cultivation, we present two HT-HHP batch culture incubation systems for cultivating deep-sea vent and subsurface (hyper)thermophilic microorganisms. One HT-HHP system can be used for batch cultivation up to 110 MPa and 121°C, and requires sample decompression during subsampling. The second HT-HHP system can be used to culture microorganisms up to 100 MPa and 160°C with variable-volume, pressure-retaining vessels that negate whole-sample decompression during subsampling. Here, we describe how to build cost effective heating systems for these two types of high-pressure vessels, as well as the protocols for HT-HHP microbial batch cultivation in both systems. Additionally, we demonstrate HHP transfer between the variable-volume vessels, which has utility in sampling and enrichment without decompression, laboratory isolation experiments, as well as HHP filtration.

Abstract: Fanconi anemia (FA), a chromosomal instability syndrome, is caused by inherited pathogenic variants in any of 22 FANC genes, that cooperate in the FA/BRCA pathway. This pathway regulates the repair of DNA interstrand crosslinks (ICLs) through homologous recombination. In FA proper repair of ICLs is impaired, and accumulation of toxic DNA double strand breaks occurs. In order to repair this type of DNA damage, FA cells activate alternative error-prone DNA repair pathways, that may lead to the formation of gross structural chromosome aberrations of which radial figures are the hallmark of FA and their segregation during cell division are the origin of subsequent aberrations like translocations, dicentrics and acentric fragments. The deficiency in DNA repair has pleiotropic consequences in the phenotype of patients with FA, including developmental alterations, bone marrow failure and an extreme risk to develop cancer. The mechanisms leading to the physical abnormalities during embryonic development have not been clearly elucidated, however FA has features of premature aging with chronic inflammation mediated by pro-inflammatory cytokines, that results in tissue attrition, selection of malignant clones and cancer onset. Moreover, the effect of the FA/BRCA pathway in germinal cells, evidenced by infertility in patients with FA attests of chromosomal instability and cell death also occurring in the germinal compartment.

Background: Excessive sun exposure is a significant risk factor for various skin conditions, including sunburn, premature aging, and skin cancer. This study aims to assess the awareness, attitudes, and practices regarding sun exposure and sunscreen use among college students in Saudi Arabia. Methodology: A cross-sectional study was conducted with 388 college students from various disciplines. Data were collected using a structured questionnaire covering demographic information, knowledge, and practices related to sun exposure and sunscreen use. Descriptive statistics, chi-square tests, and multivariate logistic regression analysis were employed to analyze the data. Results: The study comprised 53.9% females, with the majority aged 18-23 years. Formal education on sun exposure dangers was lacking for 43.0% of participants. The most recognized consequences of excessive sun exposure were sunburn (80.6%) and skin cancer (74.4%). Intermediate knowledge of sun exposure effects was most common (40.7%). Sunscreen use was inconsistent, with 27.3% never using it during peak sunlight hours. Factors influencing sunscreen use included weather conditions and healthcare provider recommendations. Males were significantly less likely to use sunscreen. First-year students and participants without formal education on sun exposure were less likely to use sunscreen regularly. Conclusion: Despite awareness of the risks associated with excessive sun exposure, sunscreen use among college students in Saudi Arabia is inconsistent and influenced by various factors, including gender and education level. These findings highlight the need for enhanced educational initiatives to promote regular sunscreen use and other sun protection behaviors to mitigate the risk of skin conditions associated with sun exposure.

Potential of co-digestion mixing thickened secondary sludge (TS) from extended aeration wastewater treatment plant and locally available substrates (whey, grease and septage) has been studied using three steps. The first step was a batch test to determine biological methane potential (BMP) of different mixtures of the three co-substrates with TS. The second step has been carried out with lab-scale reactors (20 L) simulating anaerobic continuous stirred tank reactors fed by three mixtures of co-substrates determined according to previous step results. Modelling using ADM1 as a mechanistic model was applied in the third step to help understanding the co-digestion process. According to BMP step, septage used as co-substrate has a negative effect on performance and addition of 10 to 30% grease or 10% whey would lead to a higher production of biogas and with an increase of the methane content. The results from the reactor showed less evi-dence of the positive effects observed with the BMP assay. Protein and lipid fractions of particu-late biodegradable COD are important variables for digester stability and methane production as predicted by modelling. Results of simulations with ADM1 model adapted to co-digestion confirmed that this model is a powerful tool to optimize the process of biogas production.

This work demonstrates that microbial fuel cells (MFCs), optimized for energy recovery, can be used as an effective tool to detect the presence of antibiotics in water-based environments. MFCs directly convert chemical energy of organic matter in electrical energy thanks to electroactive biofilms. The efficiency of the conversion process can be significantly affected by the presence of contaminants acting as toxicants for the biofilm. In the present work, we demonstrate that MFCs can successfully detect the presence of antibiotic residues in water and water-based electrolytes associated to the food industry, especially using honey as a new and more complex electron donor. The effectiveness of MFCs to sense antibiotics is here demonstrated for tetracycline that was added to both water and water/honey electrolytes with a minimum concentration close to 3.5 μg⁄kg. MFCs not only efficiently detect the presence of tetracycline in both the electrolytes, but also recover the same performance after each cycle of exposure, showing to a be very robust and reliable technology for both biosensing and energy recovery.

Papain-like lysosomal cysteine proteases include 11 human cysteine cathepsins which act as endopeptidases and/or exopeptidases. They are involved in numerous physiological and pathological processes. Among them, only cathepsins B, H, C, and X/Z exhibit exopeptidase activity. Their activities are tightly regulated in various ways to prevent potentially hazardous effects on the cell. In this review, we focus on the structural and functional aspects of these four cysteine cathepsins and their role in neurodegeneration and cancer. Neurodegenerative disorders of aging share an endolysosomal dysfunction and accumulation and spread of oligomeric forms of neurotoxic proteins. The accumulation of various protein aggregates activates the microglia, thus inducing the activation and release of cysteine cathepsins and proinflammatory cytokines, leading to neurodegeneration. In cancer, cysteine cathepsins participate in tumor progression and metastasis. Tumor–stromal crosstalk leads to activation of the stroma and overexpression and secretion of proteolytic enzymes, triggering extracellular matrix degradation and the release of soluble factors. Activated stromal cells (i.e., macrophages, fibroblasts, mast cells) secrete additional growth factors, cytokines, and chemokines that are responsible for the regulation of processes leading to tumor progression and metastasis. Therefore, a better understanding of the role of cysteine cathepsins in neurodegeneration and cancer could lead to novel targeted therapeutic approaches.

Alternaria alternata is a saprophyte and is also known to cause many opportunistic infections in humans. Alternaria infections are important factors of morbidity and mortality in im-mune-compromised and solid organ transplant (SOT). Sensitivity to the airborne fungus Alter-naria alternata is also believed to be a common cause of allergic asthma. Therapies are limited by the lack of knowledge about the role of individual fungal gene products and symptoms in im-mune-compromised and transplant patients. This review summarizes the published case studies on Alternaria alternata infections in transplant patients.

Rail, as the cleanest and greenest high-volume transport, has a central role in the decarbonizing, and it is expected to become the backbone of future mobility in the world. It is worthy to highlight that rail generates the lowest CO2 emissions and energy consumption in operation with respect to the other transportation modes but during construction and maintenance phases CO2 emission, energy consumption and other environmental impacts are significant and need to be carefully assessed and properly mitigated. This paper, based on an extensive literature review, provides a comprehensive framework of trends and challenge in railway sustainability. Attention is focused on track and related materials, maintenance strategies, and methods of assessment of the sustainability. Results show that improvement of materials and practices used in construction and appropriate strategies in maintenance, supported by effective monitoring of the state of the track, can reduce the negative effects on the environment and society and contributes to make this transportation mode greener. Proper methods for the assessment of the sustainability, (LCA, Circularity Index) help to quantify the potential of environmental enhancement of different solutions and constitute effective and indispensable tools in the decision-making process.

In this article, we consider the relationship between the brain and the immune system in the context of the Orch OR (Orchestrated Objective Reduction) theory of consciousness. Orch OR is a theory that postulates that consciousness arises from quantum computations occurring inside microtubules. The immune system is capable of acquiring, learning, and remembering information, thus showing all the attributes of natural intelligence. We argue that the immune system also has the attribute of consciousness and can gain access to an amount of information greater than what is accessible to the brain since it is not constrained by brain's reducing valve that is responsible for cognitive bottlenecks. We also describe the role of meditation and religious chanting in affecting the brain and immune system. We speculate that some effects of religious chanting on the immune system may not be mediated by the brain. Finally, we examine the role of the immune system in connecting with the consciousness embedded in the universe.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

In the light of current justified international concerns about pollution caused by both greenhouse gases and by current agricultural practices, as well as the management of livestock manure, zeolite rocks with a prevalent zeolite content (a mineral endowed with peculiar chemical-physical properties), are widely used worldwide. They have a high extraction potential and represent an effective and scientifically proven means of pollution control. Moreover, based on the results of countless laboratory and field experiments, zeolitites (in particular Italian chabazite) rich in potassium (K) but low in sodium (Na) and with high drainage and water retention properties, have an effective potential for environmental protection, reduction of fertilizers and irrigation water, and increase of agronomic production. In agriculture and horticulture, in particular, the permanent correction of agricultural soils and growing media with appropriate amounts of zeolitites makes it possible to reduce the input of synthetic fertilizers and water as well, in order to substantially increase yields in quantity and quality. However, there are few scientific articles describing the use of zeolite in agriculture and its benefits for farmers. This review is aimed at gaining a better insight into the application of zeolitites in agriculture, particularly in difficult climatic situations, and to provide more information on how these minerals can ensure both the reduction of the use of fertilizers and the increase of plant protection. In addition, details and explanations are provided on the term 'zeolitite' used in order to ensure higher quality agricultural products.

This qualitative study unveils the intricate interplay between blended learning, language and literature learning, internationalization, and the development of 21st century skills within the realm of higher education. Set against the backdrop of the environment of St. Michael's College in Iligan City, this exploration seeks to unravel the profound significance and transformative implications of these educational dimensions. By delving into the rich perspectives and experiences of 30 college students, this study addresses critical gaps in the literature and sheds light on the potential of these integrated elements. Guided by a robust theoretical framework that amalgamates renowned scholars' insights on blended learning, language acquisition, internationalization, and 21st century skills, the study employs a qualitative research design, employing interviews, observations, and document analysis. The findings illuminate the dynamic nature of blended learning, empowering students with enhanced engagement, flexibility, and accessibility in language and literature education. The incorporation of diverse literary texts and cultural perspectives fosters intercultural competence and global awareness. Moreover, the study underscores the cultivation of critical 21st century skills through immersive learning experiences. Drawing upon the insights gained, the study provides practical recommendations for educators and curriculum designers to harness the potential of blended learning, foster diversity in literary texts, and facilitate the application of 21st century skills. Recognizing the inherent limitations, including the specific context of St. Michael's College and the modest sample size, this study encourages future research to explore broader contexts and diverse participant cohorts. Overall, this illuminating study contributes to the scholarly discourse on integrating blended learning, language and literature learning, internationalization, and 21st century skills in college education. It beckons educators and policymakers to embark on a transformative journey, nurturing an enlightened future where students are equipped with the competencies to navigate the complexities of the 21st century.

Significant attribute selection in machine learning is one of the key aspects aimed at simplifying the problem and reducing its dimensionality, and consequently speeding up computation. This paper proposes new algorithms for selecting not only relevant features but also for evaluating and selecting a subset of relevant objects in a dataset. Both algorithms are mainly based on the use of a fuzzy approach. The research presented here yielded preliminary results of a new approach to the problem of selecting relevant attributes and objects, and, in fact, to selecting appropriate ranges of their values. Detailed results obtained on the Sonar dataset show the positive effects of this approach. Moreover, the observed results may suggest the effectiveness of the proposed method in terms of identifying a subset of truly relevant attributes from among those identified by traditional feature selection methods.

In the depths of inquiry, where thoughts unfurl like tendrils of smoke, this qualitative study ventures into the enigmatic realms of diaspora, migration, and the elusive brain drain within the tapestry of the Philippines. It is a journey guided by a sturdy theoretical framework, traversing the multifaceted dimensions of society, culture, and psyche. Here, the lens expands beyond the confines of economics, delving into the essence of these phenomena, seeking profound insights that dance beneath the surface. Through meticulous analysis of empirical data, hidden truths emerge, illuminating the intricate dynamics of diaspora, the intricate patterns of migration, and the intricate threads that shape migration decisions. Moreover, it peers into the intricate tapestry of impacts that diaspora and migration have on both sending and receiving societies, casting a beam of understanding upon their social, economic, and cultural implications. The study, in its wisdom, extends its reach to offer valuable policy recommendations, serving as a compass for stakeholders and decision-makers. It emphasizes the pivotal importance of harnessing the vast potential held within diaspora, fostering social integration, and bridging the gaps in knowledge that lie in wait. In its entirety, this research harmonizes with the existing body of knowledge, blending seamlessly with the symphony of understanding, and ignites the path towards evidence-based strategies that pave the way for sustainable development and the well-being of societies near and far.

In order to better understand the extent to which global climate variability is linked to the frequency and intensity of heat waves and overall changes in temperature throughout the United States (US), correlations between long-term monthly mean, minimum, and maximum temperatures measured at sites throughout the contiguous US and low-frequency variability of multiple climate indices (CIs) are analyzed over the period 1948 to 2018 using correlation analysis. The Pearson’s correlation coefficient is used to assess correlation strength, while Leave-One-Out Cross-Validation and a bootstrapping technique (p-value) are used to address potential serial and spurious correlation and assess the significance of each correlation. Three parameters defined the sliding windows over which surface temperature and CI values were averaged: window size, lag time between the temperature and CI windows, and the beginning month of the temperature window. A 60-month sliding window size and 0 lag time resulted in the strongest correlations overall; beginning months were optimized on an individual site basis. Strong (r &gt;= 0.60) and significant (p-value &lt;= 0.05) correlations were identified. The Western Hemisphere Warm Pool (WHWP) and El Niño/Southern Oscillation (ENSO) exhibited the strongest links to temperatures in the western US, tropical Atlantic sea surface temperatures to temperatures in the central US, the WHWP to temperatures throughout much of the eastern US, and atmospheric patterns over the northern Atlantic to temperatures in the Northeast and Southeast. The final results were compared to results from previous studies focused on precipitation and coastal sea levels. Regional consistency was found regarding links between the northern Atlantic and overall weather and coastal sea levels in the Northeast and Southeast as well as on weather in the upper Midwest. Though the MJO and WHWP revealed dominant links with precipitation and temperature, respectively, throughout the West, ENSO revealed consistent links to sea levels and surface temperatures along the West Coast. These results help focus future research regarding specific mechanisms of climate variability that appear the exhibit strong links to US regional weather and sea level variability and prediction.

Delve into the ebb and flow of human ingenuity as the researcher traces the evolution of writing from papyrus to pixels. Discover how humble instruments like quill pens and typewriters have propelled human into the digital frontier, forever reshaping the art of expression in the modern age. This article examines the evolution of writing tools from traditional pen and paper to digital writing in the modern age. It explores the development of writing materials such as papyrus, parchment, and paper, as well as the invention of writing tools including quill pens, fountain pens, and typewriters. The rise of digital writing tools, including word processing software and smartphones, is also discussed, along with their benefits such as increased efficiency and productivity, enhanced collaboration and sharing capabilities, and greater accessibility and flexibility. However, the article also highlights the challenges of writing in the digital age, including the impact of digital distractions on writing focus and quality, the issue of online plagiarism and copyright infringement, and the potential loss of traditional writing skills. The article concludes with recommendations for educators, school administrators, students, and researchers to strike a balance between digital and traditional writing practices, to embrace digital writing tools while preserving traditional writing skills, and to understand the importance of the evolution of writing. The theoretical frameworks of Social Construction of Technology (SCOT) Theory, Media Ecology Theory, and Activity Theory are also discussed in relation to the evolution of writing tools. Overall, this article provides valuable insights into the history, benefits, and challenges of writing in the digital age, as well as suggestions for navigating the future of writing and its tools.

The exceptional Jordan algebra is the algebra of $3 \times 3$ Hermitian matrices with octonionic entries. It is the only one from Jordan’s algebraic formulation of quantum mechanics which is not equivalent to the conventional formulation of quantum theory. It has often been suggested that this exceptional algebra could explain physical phenomena not currently explained by the conventional approach, such as values of the fundamental constants of the standard model of particle physics, and their relation to gravitation. We show that this is indeed the case; and this also unravels the connection between general relativity and the weak force. The exceptional Jordan algebra also predicts a new U(1) gravitational interaction which modifies general relativity, and which provides a theoretical basis for understanding the Modified Newtonian Dynamics (MOND).

(1) Background: This paper investigates the epidemiological risk related to temperature before and during COVID-19 in Italy; (2) Methods: Deaths in 2015-2019 and temperatures were correlated. Excess and COVID-19 deaths were examined to estimate the relationships with temperatures; (3) Results: Annual deaths were higher during the cold months (+45,000, SD = 4,700, S = 21). The scenario worsened during COVID-19. Mortality was higher during minimum temperature periods, although the curve moderately rose in the warmest months (r = -0.75, 95% CI = [-0.87; -0.56], S = 23). COVID-19 deaths showed a decreasing seasonality. Monthly excess deaths during COVID-19 were high (+4,200, IQR = [2,800; 8,000], S = 28) with a doubt of seasonality. COVID-19 mortality was correlated with regional latitude (r = 0.86, 95% CI = [0.68; 0.94], S = 20). Discrepancies between COVID-19 and excess deaths were found. The exposed population was subject to aging; (4) Conclusions: The epidemiological risk in Italy is seasonal and geographically dependent. Low and very high temperatures can lead to mortality peaks. Therefore, COVID-19 and any other epidemiological risk must be evaluated in light of this evidence. Health systems need to be strengthened during cold and extremely hot periods. Future research should investigate these phenomena at the causal level.

This paper discussed the concept of quality assurance (QA) in higher education and its implications to higher education institutions (HEIs) and the possible challenges. The study evaluated literature concerning QA in Zambia and elsewhere. The findings of the study show that QA is implemented through external and internal mechanisms such as accreditation, registration, institutional auditing, and the use of external examiners, self-evaluation, and peer reviews. The QA implications to HEIs in Zambia are that there is a need for accreditation of academic programmes with the Higher Education Authority (HEA) by HEIs. Further, HEIs should establish QA units to spearhead quality issues, reactive, and introduce the use of external examiners to ensure quality. The challenges identified in the implementation of QA in HEIs include inadequate funding, infrastructure, shortage of qualified academic staff, and lack of standalone QA units in some HEIs. In this regard, it has been recommended among other things, government improve funding in public HEIs, construct infrastructure, HEIs establish QA units, and recruit and retain qualified academic staff to ensure the quality of education.

Physical roots, exemplifications and consequences of periodic and aperiodic ordering (represented by Fibonacci series) in biological systems are discussed. The role and physical and biological roots of symmetry and asymmetry appearing in biological patterns is addressed. Generalization of the Curie-Neumann Principle as applied to biological objects is presented, briefly summarized as: “asymmetry is what creates a biological phenomenon”. The “up-bottom approach” and “bottom up” approaches to the explanation of symmetry in organisms are presented in detail. The “up-bottom approach”, implies that the symmetry of the biological structure follows the symmetry of media in which this structure is functioning; the “bottom-up” approach, in turn, adopt that the symmetry of biological structures emerges from the symmetry of molecules constituting the structure. A diversity of mathematical measures applicable for quantification of ordering in biological patterns is introduced. The continuous, Shannon and Voronoi measures of symmetry/ordering and their application to biology objects are addressed. The fine structure of the notion of “ordering” is discussed. Informational/algorithmic roots of ordering inherent for the biological systems are considered. Ordered/symmetrical patterns provide economy of biological information, necessary for algorithmic description of a biological entity. Application of the Landauer principle bridging physics and theory of information to the biological systems is discussed.

Hilbert arithmetic in a wide sense, including Hilbert arithmetic in a narrow sense consisting by two dual and anti-isometric Peano arithmetics, on the one hand, and the qubit Hilbert space (originating for the standard separable complex Hilbert space of quantum mechanics), on the other hand, allows for an arithmetic version of Gentzen’s cut elimination and quantum measurement to be described uniformy as two processes occurring accordingly in those two branches. A philosophical reflection also justifying that unity by quantum neo-Pythagoreanism links it to the opposition of propositional logic, to which Gentzen’s cut rule refers immediately, on the one hand, and the linguistic and mathematical theory of metaphor therefore sharing the same structure borrowed from Hilbert arithmetic in a wide sense. An example by hermeneutical circle modeled as a dual pair of a syllogism (accomplishable also by a Turing machine) and a relevant metaphor (being a formal and logical mistake and thus fundamentally inaccessible to any Turing machine) visualizes human understanding corresponding also to Gentzen’s cut elimination and the Gödel dichotomy about the relation of arithmetic to set theory: either incompleteness or contradiction. The metaphor as the complementing “half” of any understanding of hermeneutical circle is what allows for that Gödel-like incompleteness to be overcome in human thought.

This paper aims to raise awareness on certain interoperability issues as we intend to shape industry 5.0 in order to enable a human-centric resilient society. We advocate that the need of sharing small and specific data will become more intensive as AI-based solutions will become more pervasive. Consequently, dataspaces should be carefully designed to address this need. We advance the conversation by presenting a case study from HR demonstrating how to predict the possibility of an employee experiencing attrition. Our experimental results show that we need more than 500 samples for developing a machine learning model to be sufficiently capable to generalize the problem. Consequently, our experimental results show the feasibility of the idea. However, in small and medium sized companies this approach cannot be implemented due to the limited number of samples. At the same time, we advocate that this obstacle may be overcome if multiple companies will join a shared dataspace, thus raising interoperability issues

Arguments of Mises and Hayek, who opposed the planned economy (PE), are used in the paper as a starting point for establishing the objective area of effective application of the PE. The abstract model of PE, based on the definitions of Mises and Hayek, leads to the conclusion that for the effective use of PE, it must be a part of mixed economy and it must produce a limited amount of essential goods of irreducible demand. These goods must be distributed among all members of society free of charge, evenly, without competition. Examples of a mixed economy are given that meet this requirement. Calculations of the personal benefit in the transition to a mixed model of the economy have been carried out. The positive and negative qualities of the planned and market methods of organization are considered. Mixed economy model combines these qualities in optimal construction. An analytical framework has been introduced for the construction of product characterization curves. Such curves provide criteria for determining the efficiency of manufacturing of this product in a planned economy. The general economic prerequisites for the usability of the PE are clarified. The applicability and advantages of the PE for the organization of the universal basic income (UBI) system are demonstrated. The possibility of using PE to solve the problem of guaranteed employment is mentioned.

This article explores the lack of unanimity regarding the nomenclature used to refer to the field of research that explores the intersection between art and science. A series of examples of nomenclatures and the context in which they are applied are listed and referenced. The diverse terminology reflects the heterogeneity, transdisciplinarity, and complexity of a research field in full expansion.

Machine learning (ML) is growing in popularity for various particle accelerator applications including anomaly detection such as faulty beam position monitor or RF fault identification, for non-invasive diagnostics, and for creating surrogate models. ML methods such as neural networks (NN) are useful because they can learn input-output relationships in large complex systems based on large data sets. Once they are trained, methods such as NNs give instant predictions of complex phenomenon, which makes their use as surrogate models especially appealing for speeding up large parameter space searches which otherwise require computationally expensive simulations. However, quickly time varying systems are challenging for ML-based approaches because the actual system dynamics quickly drifts away from the description provided by any fixed data set, degrading the predictive power of any ML method, and limits their applicability for real time feedback control of quickly time-varying accelerator components and beams. In contrast to ML methods, adaptive model-independent feedback algorithms are by design robust to un-modeled changes and disturbances in dynamic systems, but are usually local in nature and susceptible to local extrema. In this work, we propose that the combination of adaptive feedback and machine learning, adaptive machine learning (AML), is a way to combine the global feature learning power of ML methods such as deep neural networks with the robustness of model-independent control. We present an overview of several ML and adaptive control methods, their strengths and limitations, and an overview of AML approaches. A simple code for the adaptive control algorithm used here can be downloaded from: https://github.com/alexscheinker/ES_adaptive_optimization

Tests of selection based on population differentiation were performed on two highly polygenic traits important for success and quality of life: body height and educational attainment (EA). Polygenic scores (PGS) of EA and height, computed across three public genomic databases revealed differences between populations (1000 Genomes, HGDP, gnomAD) that matched the average IQ and height of ethnic groups (r ~0.9). A moderately strong correlation between latitude and EA PGS (r= 0.67) implies the effect of climate (seasonality or winter temperature) on selection for cognitive ability. The effect of latitude was reduced (β= 0.28) but remained significant after adding the sub-continental group variable to the regression model.The global Fst index revealed population differentiation at height and EA loci, significantly deviating from random SNPs. Substantial Linkage Equilibrium (LD) Decay between YRI and CEU was found (r= 0.6) but there was no correlation between LD decay and population differences in polygenic scores for EA (r= 0.015, p= 0.45), and slight inflation of height PGS difference due to LD decay (r= -0.04, p= 0.0315). Selecting the SNPs most robust to LD decay (r>0.8) resulted in larger PGS gaps for EA, but smaller for height. Finally, it is shown that PGS differences are more sensitive to the significance of GWAS loci than Fst, reflecting the major limitations of Fst as an index of selection.

Global economy, financial markets and technology are on the verge of moving to a new stage of development – information society. Three major world countries the US, Russia and China will play a leading role in this process. However, the specific development path will depend on many factors, including the stability of legal systems, security of computer and financial technologies, the effectiveness of legislation. The focus of this article is to assess the current condition of the economy the major countries, to identify trends and methods of stabilization of legal systems on the basis of balance of rights and obligations of the business, suggest some methods of objective evaluation of the impact factors of the total taxes, fixed costs and the legal system dynamics on financial indicators.

Greenhouse have to provide optimal climate conditions for healthy plant growth and high production. Heating of greenhouses is required for an efficient and reliable production specially during winter time in Turkey. However, even in the temperate zones, heating costs has a great portion in the total production costs. Coal is preferred as a fuel in the greenhouse heating in provinces of Turkey where there is no geothermal energy. In this study, the heating requirements and fuel cost (fossil and geothermal energy) for Antalya, Afyon, Kütahya, Denizli, and Aydın provinces in the Aegean and Mediterranean region have been identified based on long term meteorological data. The calculations were made for two model greenhouses located in an area with 1 ha representing modern greenhouses of the regions. The first is a gothic roofed plastic model greenhouse and the second is a gable roofed polycarbonate model greenhouse. According to the results of calculations, total annual heatingrequirement values ranged from 6,096,283 (for Antalya) to 20,359,946 MJ/ha (for Afyon) for the plastic greenhouse wheras these values ranged from 3,187,074 (for Antalya) to 10,643,972 MJ/ha (for Afyon) for the polycarbonate greenhouse.

Corona Virus disease 2019 (COVID-19) is a new strain of coronavirus that causes respiratory illnesses with a start of flu like symptoms. This disease is fatal and is spread all over the world. The Scientist are working day and night to find vaccine or a cure. World Health Organisation has declared COVID-19 as pandemic [1]. In the view of the pandemic many treatments are being tried on the patients and various treatment modalities are being followed, the traditional medicine has shown a major role to manage this disease. The traditional medicines include the use of herbs, nutrition and spices that are freely available in Asian countries. These are used in day to day life by Asian population [2]. In this paper we have compiled and reviewed the role of various herbs and spices such as Oregano, Ashwagandha, Ginseng, Basil, Sage, Curcumin, Fenugreek, Ginger and Garlic in building immunity and also in curing pathogenic invasions based on evidence based researches. As there is no cure available for COVID-19 till now so supportive therapy is playing a major role for the patients to fight with this pandemic. The AYUSH ministry has also promoted the use of above herbs for a patient suffering from this disease. The corona virus is present in respiratory system as shown by different studies and it has different strains. The guidelines laid by the ICMR and WHO shows that use of herbs, spices and nutrients can be helpful to manage this virus by increasing the immunity in patients. Hence we are not claiming any cures but the herbs and spices used in day to day life are very much effective in management of COVID-19. World Health Organisation (WHO) has recognised the use of alternative and traditional medicine in the management of COVID-19 but the herbs should be used in prescribed amounts and overdose of them can be harmful for health [1,3]. Therefore the present article will enlighten the readers about the role of herbs, spices and nutrients in improving the conditions in COVID-19.

The loss of integrity and adverse effect on mechanical properties can be concluded as attributing miro/macro-mechanics damage in structures, especially in composite structures. Damage as a progressive degradation of material continuity in engineering predictions for any aspects of initiation and propagation requires to be identified by a trustworthy mechanism to guarantee the safety of structures. Besides the materials design, structural integrity and health are usually prone to be monitored clearly. One of the most powerful methods for the detection of damage is machine learning (ML). This paper presents the state of the art of ML methods and their applications in structural damage and prediction. Popular ML methods are identified and the performance and future trends are discussed.

The research progress of nano-hydroxyapatite and its composite biomaterials, which are widely used, is summarized. The preparation techniques and applications of nano-hydroxyapatite and its composites in tissue engineering scaffolds, sustained and controlled release drug carriers, targeting drug delivery and environmental functional materials show that nano-hydroxyapatite and its composites will have good prospects in the field of biomedicine. The nano-hydroxyapatite composite biomaterial is a first phase or multi-phase material added to the nano-hydroxyapatite to obtain a favorable histological reaction, satisfactory strength and rigidity, and to synthesize a scaffold material for tissue regeneration. As a scaffold for guiding bone tissue regeneration, nano-hydroxyapatite composite material can also be used as a targeted drug release system for drug delivery system. It has good biocompatibility and degradability and has become a research hotspot in bone tissue engineering. The complex is expected to be applied to medical diagnostic fields such as tumor cell detection and nano biological probes.

Loyalty is one of the greatest intangible assets that any organization can possess and improving client loyalty is a primary marketing goal that can have a significant financial impact on any business. This quantitative study examined the mediating role of communication on the relationship between satisfaction and loyalty (attitudinal and behavioral) in veterinary clinics, along with the moderating roles of trust, commitment, perceived value, and relational characteristics. Responses collected from 351 pet-owners through social media were analyzed using descriptive and inferential statistics. The results show that attitudinal loyalty (AL) has a strong positive relationship with communication at multiple points in a veterinary clinic whereas the relationship with behavioral loyalty was not as clear. Additional findings suggest that AL, which is influenced by trust in the veterinarian, communication from staff members and commitment, has a strong positive relationship with behavioral intentions, increases the number of products and services that a pet-owner consumes at his or her primary veterinary clinic, and attenuates the role of cost in receiving veterinary care. These findings can help veterinary clinic owners and managers in developing and implementing relationship strategies that improve pet-owner loyalty. The article that follows is a synopsis of the author’s dissertation.

The article addresses the function of (post)colonial nostalgia in a context of multidirectional memory (Rothberg 2009) in contemporary Europe. How can different cultural memories of the Second Word War be put into respectful dialogue with each other? The text is based on a contrapuntal reading (Said 1994) of British and Egyptian popular narratives, using a qualitative content analysis of 10 British tv documentary films about the North Africa Campaign, and data from qualitative interviews collected during ethnographic fieldwork in Alexandria and Cairo, Egypt, during visits 2013--2015. The study highlights considerable differences between the British and Egyptian narratives, but also significant similarities regarding the use and function of nostalgia. In addition, the Egyptian narrative expresses a profound cosmopolitan nostalgia and a longing for what is regarded as Egypt’s lost, modern Golden Age, identified as the decades before the nation’s fundamental change from western-oriented monarchy to Nasser’s Arab nationalist military state. The common elements between the two national narratives indicate a possibly fruitful way to open up for a shared popular memory culture about the war years, including postcolonial aspects.

Background: The effect of rice bran arabinoxylan compound (RBAC), a plant-based immunomodulator, on the quality of life (QoL) in cancer patients and underlying physiological pathways remains unclear. Trial design: The RBAC-QoL study is a double-blind, randomised, controlled pilot feasibility study. The aim is to determine RBAC’s effects on QoL and the associated action mechanisms. Primary outcomes are the EORTC QLQ-C30 functional, symptom, and global QoL scores with inflammatory, nutritional, and cytokine parameters as secondary and exploratory outcomes. Methods: Recruitment targets adults diagnosed with solid organ tumours (≥ stage II) undergoing active treatment in several outpatient centres in New South Wales, Australia. Interventions are RBAC or matched placebo at 3g/day for 24 weeks allocated through stratified randomisation with participants, oncologists, and data collectors blinded. Data is collected from five study visits six weeks apart. The trial is ongoing. An interim intention-to-treat analysis was performed using repeated measure ANOVA with pairwise comparisons where statistical significance is observed and adjusted with covariates. Results: Global QoL scores from currently available data (n = 16; RBAC = 7, placebo = 9) were statistically different between groups (F[1,8] = 8.6, p = 0.019, eta2[g] = 0.267). Pairwise comparisons found significant differences at week 6 (p = 0.032, Cohen’s d = 1.454) and marginally at week 12 (p = 0.069, d = 1.427). Age-adjusted analysis showed a continuous upward trend in QoL improvement over time with RBAC, while the placebo group did not deviate from baseline QoL. Significant elevations of serum white blood cell count (week 18) and total protein (weeks 12 and 18) were detected in the RBAC group compared to placebo. The total protein levels correlated highly with white blood cell count (Pearson’s r = 0.539, p < 0.001) and moderately with the global QoL scores (r = 0.338, p = 0.01). No intervention-related adverse events were reported in both groups. Conclusions: RBAC improves QoL beyond placebo during active cancer treatment, possibly through the immuno-nutritional pathway. These findings are preliminary but valuable for future research. Funding and registration: Daiwa Pharmaceutical Co., Ltd, Japan; BioMedica Nutraceuticals Pty Ltd., Australia. ANZCTR Reg No: ACTRN12619000562178p.

Chronic wounds are a major health problem because of delayed healing and cause hardships for the patient. The infection present in these wounds plays a role in delayed wound healing. Silver wound dressings have been used for decades, beginning in the 1960s with silver sulfadiazine for infection prevention for burn wounds. Since that time, there has been a large number of commercial silver dressings that have cleared FDA approval. In this review, we examine the literature involving in vitro, in vivo, and clinical studies with commercial silver dressings and attempt to glean the important characteristics of these dressings in treating infected wounds. The primary presentation of the literature is in the form of detailed tables. The narrative part of the review focuses on the different types of silver dressings, including the supporting matrix, the release characteristics of the silver into the surroundings, and their toxicity. Though there are many clinical studies of chronic and burn wounds using silver dressings that we discuss, it is difficult to compare the performances of the dressings directly because of the differences in the study protocols. We conclude that silver dressings can assist in wound healing, though it is difficult to provide general treatment guidelines.

Roundabouts need capacity and safety improvements compatible with manual-driven, not only with autonomous vehicles. The signaling and control of roundabouts must evolve and incorporate current technologies. For that, we approach roundabouts as synchronous switches of vehicles. This paper describes Synchronous Roundabouts with Rotating Priorities, a roundabout control system based on vehicle platoons arriving at the roundabout at speed identical to the roundabout and within the time slot assigned to their entry, avoiding conflicts and stops, thus increasing roundabout capacity and safety. Signaling is visual for human drivers and also wireless for connected and autonomous vehicles. We evaluate analytically and with simulations roundabouts of different radius for several values of the average distance between vehicles. Average delays are 28,7 % lower, with negligible dispersion. The capacity improvements depend on design parameters: in our set is moderate for small roundabouts but goes up to 70-100 % for short distances and medium and large roundabouts.

Synthetic polymer-based gradient foams have considered as promising category of functionally graded materials with unique properties. In this study, the carbon dioxide (CO₂) foaming technology has used for PET-PEN (Polyethylene Terephthalate - Polyethylene Naphthalate) copolymer towards porous functional materials with thermal insulation with reasonable mechanical strength. Through scanning electron microscope based morphological characterization, a potential to fabricate gradient foam structures with micro-pores has identified. It has shown that variation of post-foaming temperature can tune the pore size distribution although the very high post-foaming temperature tends to cause structural instability. Thermal measurement data set the limits of operation, confirmed by simultaneous differential scanning calorimeter and thermo-gravimetric analysis. Mechanical stress and thermal conductivity also has measured to find rationale of thermal insulation with reasonable mechanical strength and to elucidate the actual 3D grid foam of copolymer.

Peas are among the most widely consumed legumes and are of great benefit for human nutrition. Sowing and cultivation techniques are known to affect the yield and the quality of the seeds. Existing studies investigating the nutritional properties of the seeds from plants cultivated using different methods are continue to be of significant value. However, changes in the climate in recent years are presumed to have affected the optimum sowing dates for grain yield and quality. This study in-vestigates the effects of sowing peas at different sowing dates on the yield of the seed and on its nutrient content, as determined by certain quality traits (parameters). The experiment was con-ducted at the Aydin Adnan Menderes University Faculty of Agriculture in Turkey during the 2021-2022 and 2022-2023 pea production seasons. Specifically, it examined the yield of the seed (fresh/dry), its saponin and phenolic matter content and its amino acid composition in the case of five pea cultivars (Deren, Misya, Irmak, Karina, Local) sown at three different sowing times (November 15, November 30, December 15). The study found that the effects of sowing date on grain yield and quality characteristics were significant. However, the varieties' reactions to sowing dates were found to be different. The highest fresh seed yield (3.27 t ha-1) was obtained from samples sown at the second sowing date, while the highest dry yield (1.85 t ha-1) came from samples sown at the third sowing date. The cultivars also had a statistically significant effect on the yields. The highest fresh seed yields were obtained from the Misya (2.88 t ha-1) and Local (2.81 t ha-1) varieties, while the highest dry yields were obtained from samples of Local (1.76 t ha-1) and Irmak (1.73 t ha-1). In terms of sowing dates, the highest protein (27.75%) was obtained from the first sowing date, and the protein content decreased in the following dates. Misya was the cultivar from which the highest protein content (28.77%) was obtained. In the study, higher yields were obtained from the second and third sowing dates, while the first sowing time resulted in higher protein and amino acid composition. Similar to the protein content, the composition of almost all amino acids increased on the first sowing date. In addition, it was established that the saponin and phenolic substance contents of seeds varied with the sowing date.

Diverse development models, including waterfall development, iterative development, and agile development, have been put forth and implemented across real-world contexts. When engaging in discussions on project management, the examination and exploration of development models assume paramount importance and are integral. This paper embarks upon an investigation and scrutiny of these development models, culminating in the proposition of "Quasi" Development Models: Quasi-Waterfall and Quasi-Agile.

In this paper, a distinction is first made between environmental, sustainable and green chemistry; the last two are then examined in relation to the more general problem of the environmental education. A brief historical digression on the STS (Science, Technology and Society) movement tries to dissect the reasons why chemistry is seen by the general public as a problem, not as a decisive resource for the realization of the ecological transition. Although sustainable and green chemistry can be decisive in overcoming the insularity of chemical disciplines in the high school, it fails to effectively embed itself in educational practices. Specific operational goals, supporting a real scientifical and technological literacy in sustainable and green chemistry, can help chemical educators. They are provided at the end of an examination of the founding axes of sustainable and green chemistry, according to the criteria of scientific and technological literacy.

Proactivity is a particularly important attribute of knowledge-intensive organizations, where the work required to increase the potential of knowledge-intensive employees is crucial. A priority challenge for these firms is also to understand the increasing importance of the functioning of cognitive mechanisms leading to increased knowledge workers' well-being following the implementation of the psychological contract. The aim of this article is to identify the relationship between inclusive leadership, the fulfillment of the psychological contract, two dimensions of well-being: workplace and life well-being and knowledge workers' proactivity. Based on survey data collected through the CAWI method from 1.000 knowledge workers employed in Polish companies in the business services sector, the research hypotheses were tested using a stepwise equation modelling (SEM) technique, leading to a model containing all the main constructs. The results obtained indicate that inclusive leadership positively impacts the fulfillment of the psychological contract. Furthermore, the fulfillment of the psychological contract positively affects proactive working behavior with and the wellbeing of knowledge workers. Along with proactive work behavior, two dimensions of well-being, were examined as outcome variables. The analysis also shows that knowledge-intensive organizations, intending to build the proactivity of their employees and nurture a high level of well-being in their lives and in the workplace, should take care to fulfil the expectations and obligations of the psychological contract. However, one way to achieve this is for managers to use an inclusive management style, which supports an atmosphere of a safe working environment in a diverse setting and leads to employees feeling comfortable sharing their opinions and ideas. The study of inclusive leadership in the context of knowledge-intensive organizations provides human resource professionals and employee man-agers with important insights into how inclusive leadership can effectively contribute to the psychological contract, which will consequently lead to proactive work behavior and also improve employees' workplace and life well-being.

The G2 gas cloud motion data and the scarcity of observations on the event horizon-scale distances have challenged the comprehensiveness of the central supermassive black hole model. In addition, the Planck Legacy 2018 release has preferred a positively curved early Universe with a confidence level higher than 99%. This study investigates the impact of the background curvature and its evolution over the conformal time on the formation and morphological evolution of central compact objects and the consequent effect on their host galaxies. The formation of a galaxy from the collapse of a supermassive gas cloud in the early Universe is modeled based on interaction field equations as a 4D relativistic cloud-world that flows and spins through a 4D conformal bulk of a primordial positive curvature considering the preference of the Planck release. Owing to the curved background, this scenario of galaxy formation reveals that the core of the galaxy undergoes a forced vortex formation with a central event horizon leading to opposite vortices (traversable wormholes) that spatially shrink while evolving in the conformal time. It indicates that the galaxy and its core are formed in the same process whereas the surrounding gas clouds form the spiral arms due to the frame-dragging induced by the fast-rotating core. It demonstrates that the accretion flow onto the central supermassive compact object only occurs at the central event horizon of the two opposite vortices while their other ends eject the relativistic jets. This can elucidate the relativistic jet formation and explain the G2 gas cloud motion if its orbit is around one of the vortices but at a distance from the central event horizon. The gravitational potential of the early curved bulk could contribute to galaxy formation while the present spatial flatness deprives the potential of bulk which could lead to galaxy quenching. The formation of a galaxy and its core simultaneously could explain the growth of the supermassive compact galaxy core to a mass of ~10⁹ M_⊙ at just 6% of the current Universe age.

We are in amidst of COVID-19 pandemic. Since Dec 2019, severe acute respiratory corona virus (SAR-CoV-2) has infected more than half a billion people killing nearly 7 million people worldwide. Now the BA.5 variant of SARS-CoV-2 is causing mayhem and driving the global surge. Epidemiologist are aware of the fact that this virus is capable of escaping immunity and likely to infect the same person multiple times despite adequate vaccination status. Elderly people of age more than 60 years and those with underlying health conditions are considered as high-risk who are likely to suffer complications and death. While it is tempting to frame complications and mortality from COVID-19 as a simple matter of too much of a virulent virus in too weak of a host, much more is at play here. Framing the pathophysiology of COVID-19 in the context of the Chrousos and Gold model of the central stress response system can shed insight into its complex pathogenesis. Understanding the mechanisms by which pharmacologic modulation of the central stress response system via administration of clonidine and/or dexamethasone may offer an explanation as to why a viral pathogen can be well tolerated and cleared by one host while inflaming and killing another.

Due to the rising dependency on digital technology, cybersecurity has emerged as a more prominent field of research and application that typically focuses on securing devices, networks, systems, data and other resources from various cyber-attacks, threats, risks, damages, or unauthorized access. Artificial Intelligence (AI), also referred to as a crucial technology of the current Fourth Industrial Revolution (Industry 4.0 or 4IR), could be the key to intelligently dealing with these cyber issues. Various forms of AI methodologies, such as analytical, functional, interactive, textual as well as visual AI can be employed to get the desired cyber solutions according to their computational capabilities. However, the dynamic nature and complexity of real-world situations and data gathered from various cyber sources make it challenging nowadays to build an effective AI-based security model. Moreover, defending robustly against adversarial attacks is still an open question in the area. In this paper, we provide a comprehensive view on "Cybersecurity Intelligence and Robustness", emphasizing multi-aspects AI-based modeling and adversarial learning that could lead to addressing diverse issues in various cyber applications areas such as detecting malware or intrusions, zero-day attacks, phishing, data breach, cyberbullying and other cybercrimes. Thus the eventual security modeling process could be automated, intelligent, and robust compared to traditional security systems. We also emphasize and draw attention to the future aspects of cybersecurity intelligence and robustness along with the research direction within the context of our study. Overall, our goal is not only to explore AI-based modeling and pertinent methodologies but also to focus on the resulting model's applicability for securing our digital systems and society.

Hyphal and germling fusion is a common phenomenon in ascomycetous fungi. Due to the formed hyphal network, this process enables coordinated development, interaction with plant hosts and efficient nutrient distribution. Recently, our lab showed a positive correlation of germling fusion with the formation of penetrating hyphopodia on maize leaves outgoing from Colletotrichum graminicola oval conidia. To investigate the probable interconnectivity of these processes, we have generated a deletion mutant in Cgso, which homologs are essential for cellular fusion in other fungal species. Indeed, plant infection studies combined with microscopy revealed a significant decrease in symptom development of the ∆Cgso mutant on maize leaves. However, hyphopodia development was not affected, indicating that both processes are not directly connected. Instead, we were able to link the decreased symptom development to a reduced formation of acervuli, asexual fruiting bodies of C. graminicola, which give rise to falcate conidia. Monitoring of a fluorescent labelled autophagy marker eGFP-CgAtg8 revealed a high autophagy activity in hyphae surrounding acervuli. Since the ∆Cgso mutant shows no hyphal fusions at these sites, we conclude that efficient nutrient transport of degraded cellular material by hyphal fusions enables proper acervuli maturation and symptom development on leaves.

The digital world has a wealth of data, such as Internet of Things (IoT) data, business data, health data, mobile data, urban data, security data, and many more, in the current age of the Fourth Industrial Revolution (Industry 4.0 or 4IR). Extracting knowledge or useful insights from these data can be used for smart decision-making in various applications domains. In the area of data science, advanced analytics methods including machine learning modeling can provide actionable insights or deeper knowledge about data, which makes the computing process automatic and smart. In this paper, we present a comprehensive view on "Data Science'' including various types of advanced analytics methods that can be applied to enhance the intelligence and capabilities of an application through smart decision-making in different scenarios. We also discuss and summarize ten potential real-world application domains including business, healthcare, cybersecurity, urban and rural data science, and so on by taking into account data-driven smart computing and decision making. Based on this, we finally highlight the challenges and potential research directions within the scope of our study. Overall, this paper aims to serve as a reference point on data science and advanced analytics to the researchers and decision-makers as well as application developers, particularly from the data-driven solution point of view for real-world problems.

We try to solve three decades-old physics challenges. List all elementary particles. Describe dark matter. Describe mechanisms that govern the rate of expansion of the universe. We propose new modeling. The modeling uses extensions to harmonic oscillator mathematics. The modeling points to all known elementary particles. The modeling suggests new particles. Based on those results, we do the following. We explain observed ratios of dark matter amounts to ordinary matter amounts. We suggest details about galaxy formation. We suggest details about inflation. We suggest aspects regarding changes in the rate of expansion of the universe. We interrelate the masses of some elementary particles. We interrelate the strengths of electromagnetism and gravity. Our work seems to offer new insight regarding applications of harmonic oscillator mathematics. Our work seems to offer new insight regarding three branches of physics. The branches are elementary particles, astrophysics, and cosmology.

Increased proliferation of IT services in all sectors has reinforced the adoption and diffusion across all levels of education and training institutions. However, lack of awareness of and knowledge about the key challenges and opportunities of elearning, seem to allude policymakers, resulting in low adoption or increased failure rate of many e-learning projects. Our study tries to address this problem through a review of relevant literature in e-learning. Our goal was to draw from the existing literature, insights into the opportunities and challenges of e-learning diffusion, and the current state-of-research in the field. To do this, we employed a systematic review of literature on some of the salient opportunities and challenges of e-learning innovation for educational institutions. These results aimed to inform policymakers and suggest some interesting issues to advance the research and adoption and diffusion of e-learning. Moreover, the bibliometric analysis shows that the field is experiencing high research attraction among scholars. However, several research areas in the field witnessed relatively low research paucity. Based on these findings, we discussed topics for possible future research.

We develop and apply new physics theory. The theory suggests specific unfound elementary particles. The theory suggests specific constituents of dark matter. We apply those results. We explain ratios of dark matter amounts to ordinary matter amounts. We suggest details about galaxy formation. We suggest details about inflation. We suggest aspects regarding changes in the rate of expansion of the universe. The theory points to relationships between masses of elementary particles. We show a relationship between the strength of electromagnetism and the strength of gravity. The mathematics basis for matching known and suggesting new elementary particles extends mathematics for harmonic oscillators.

In the second half of the 19th century a wave of modernisation, industrialisation and urbanisation swept the Nordic countries, catapulting what had until then been lagging and primarily rural countries into modernity. These major upheavals, however, also plunged the Nordic countries into a profound social and cultural crisis resulting from their consciousness of their own backwardness vis-a-vis the countries on the European continent, as well as the recognition that a nostalgic nationalism recalling a mythical past had become obsolete in the industrial age. In response to this crisis, a life reform movement emerged that was based on Arts and Crafts movements as well as various artistic and literary reform movements and—equally absorbing rural traditions and progressive social ideas—tried to establish a new national everyday culture. In this article, the two key terms coined by Ellen Key, “Festive Customs” (‘festvanor’) and “Everyday Beauty” (‘vardagsskönhet’)—the programmatic core of the Nordic life reform movement—are analysed and illustrated in various typical manifestations. It also examines to what extent the Nordic life reform movement with these two key concepts as its core agenda found expression in arts and crafts, in painting as well as in the architecture of the late nineteenth and early twentieth century and contributed to the progress of social and cultural renewal.

The quality and safety of fermented milk products, which make up a sizeable portion of human nutrition, are greatly influenced by both the milk itself and the starting cultures employed to ferment it. Lactic acid bacteria (LAB) create a variety of metabolites throughout the fermentation process, altering the organoleptic properties of the substrates. The final product’s nutritional value and digestibility are enhanced by fermentation of the raw materials, which also adds vitamins, vital amino acids, and fatty acids. The quality and safety of fermented milk products, which make up a sizeable portion of human nutrition, are greatly influenced by both the milk itself and the starting cultures employed to ferment it. The inhibition of the growth of pathogenic microbes, which lowers the likelihood of the emergence of foodborne diseases, is another crucial function of LAB. A variety of pathogenic bacteria are frequently present in raw (unpasteurized) milk, and other raw materials; these pathogenic bacteria should be removed during the fermentation process. As a result, a variety of LAB metabolites, such as hydrogen peroxide, organic acids, and bacteriocins, function as bio preservative agents, enhancing food safety and lengthening the shelf life of the finished products.

Smart Living, an increasingly prominent concept, entails incorporating sophisticated technologies in homes and urban environments to elevate the quality of life for citizens. A critical success factor for Smart Living services and applications, from energy management to healthcare and transportation, is the efficacy of human action recognition (HAR). HAR, rooted in computer vision, seeks to identify human actions and activities using visual data and various sensor modalities. This paper extensively reviews the literature on HAR in Smart Living services and applications, amalgamating key contributions and challenges while providing insights into future research directions. The review delves into the essential aspects of Smart Living, the state of the art in HAR, and the potential societal implications of this technology. Moreover, the paper meticulously examines the primary application sectors in Smart Living that stand to gain from HAR, such as smart homes, smart healthcare, and smart cities. By underscoring the significance of the four dimensions of Context Awareness, Data Availability, Personalization, and Privacy in HAR, this paper serves as a valuable resource for researchers and practitioners striving to advance Smart Living services and applications.

This paper analyzes Chipotle Mexican Grill’s public relations strategy in response to the 2015 E. coli outbreak that severely impacted its reputation and financial standing. The company’s delayed initial response exacerbated the crisis, leading to a significant decline in stock prices and consumer trust. However, through leadership changes, enhanced safety protocols, strategic marketing campaigns, and customer loyalty programs, Chipotle gradually rebuilt its image and began to recover financially. The paper explores the short- and long-term effects of the crisis on Chipotle and outlines key lessons for companies facing similar PR challenges, emphasizing the importance of swift crisis management, transparency, and proactive communication in restoring public confidence.

Environmental responsibility is crucial in both consumption and production processes. Increasing environmental concerns of societies require eco-innovative and nature-based solutions (NBS) for entrepreneurs. Young people's intentions as potential innovators and entrepreneurs on eco-entrepreneurship with mediating effects have not been investigated is a shortcoming in the literature. This study was conducted with 920 respondents from a public university (Düzce University) students to determine the underlying motivations of eco-entrepreneurship intentions using structural equation modeling (SEM) and bootstrap methodology. SEM results show that environmental concerns have a positive direct effect (β=0.62) on students’ eco-entrepreneurship intention. This study can serve the several sustainable development goals (SDGs) making suggestions for the efficient and effective use of production factors in terms of environmentally responsible behavior. Study results provide data for sustainable business applications and eco-innovative thinking. Study results intend the direction of modern environmental governance, policy makers and SEM developers.

This study examines the association between dietary saturated fatty acid (SFA) intake and leukocyte telomere length (LTL) using data from the National Health and Nutrition Examination Survey (NHANES) 1999-2002. Telomeres, protective repeats of DNA at the ends of chromosomes, play a crucial role in cellular aging. Their length is shortened over time and is influenced by various factors, one of which is diet. The present study's objective was to evaluate whether increased SFA consumption is associated with shorter LTL. The analysis, conducted on a large, nationally representative sample of 6646 adults, revealed an inverse association between dietary SFAs and LTL. When examined further, this association was found to be significant in women, but not in men. Serum C-reactive protein (CRP) levels were tested as a potential mediator in this relationship, but no such mediation was found. These findings support the role of dietary factors in modulating cellular aging. However, further research is warranted to elucidate the underlying mechanisms driving the overall association, as well as the gender-specific effects observed.

The Environmental interactions contributed to the processes of settlement and development of the first settlers at southern Peru 15,000 BC. The determination of this process is based on paleoclimatic studies at southern Peru and ethnoarchaeological evidence. The determination of this process is based on paleoclimatic studies of southern Peru and ethnoarchaeological evidence; establishing as a result of this analysis the hypothesis of environmental interaction and territorial occupation of the first hunter-gatherer populations until their consolidation, dominating the geographical space from Tacna. The Disruptive disaster events and their effects on climate during the Peruvian Paleolithic resulted in the origin of local societies that shaped the Tiawanaku societies of the early horizon at Southern Peru and Northern Chile.

Substances that can modify the androgen receptor pathway in humans and animals are entering the environment and food chain with the proven ability to disrupt hormonal systems and leading to toxicity and adverse effects on reproduction, brain development, and prostate cancer, among others. State-of-the-art databases with experimental data of human, chimp, and rat effects by chemicals have been used to build machine learning classifiers and regressors and evaluate these on independent sets. Different featurizations, algorithms, and protein structures lead to dif- ferent results, with deep neural networks (DNNs) on user-defined physicochemically-relevant features developed for this work outperforming graph convolutional, random forest, and large featurizations. The results show that these user-provided structure-, ligand-, and statistically-based features and specific DNNs provided the best results as determined by AUC (0.87), MCC (0.47), and other metrics and by their interpretability and chemical meaning of the descriptors/features. In addition, the same features in the DNN method performed better than in a multivariate logistic model: validation MCC = 0.468 and training MCC = 0.868 for the present work compared to evalu- ation set MCC = 0.2036 and training set MCC = 0.5364 for the multivariate logistic regression on the full, unbalanced set. Techniques of this type may improve AR and toxicity description and predic- tion, improving assessment and design of compounds. Source code and data are available at https://github.com/AlfonsoTGarcia-Sosa/ML

Results: A total of 6270 individuals were assessed (1615 severe and 4655 non-severe patients). The median age was 63 (95% CI: 49-74) and 47 (95% CI: 19-63) years in the severe and non-severe groups, respectively. Moreover, about 41% of patients had comorbidities. Severity was higher in patients with history of cerebrovascular disease: OR 4.85 (95% CI: 3.11-7.57). The odds of being in severe group increase by 4.81(95% CI: 3.43-6.74) for history of cardiovascular disease (CVD). This was 4.19 (95% CI: 2.84-6.19) for chronic lung disease and 3.18, 95% CI: 2.09-4.82 for cancer .The odds ratio of a diabetes and hypertension were 2.61 (95% CI: 2.02-3.3), and 2.37( 95% CI: 1.80-3.13) respectively.

Nanoporous films of Eu-doped organosilicate glass (OSG) have been synthesized using sol-gel technology and spin-coating, employing evaporation-induced self-assembly (EISA), on silicon wafers. The Eu doping is achieved by dissolution of Eu(NO3)3·6H2O in the precursor solution. The deposited films are characterized by using Fourier transform infrared (FTIR) spectroscopy, ellipsometric porosimetry (EP), X-ray photoelectron spectroscopy (XPS) and photoluminescence spectroscopy. It is observed that Eu doping makes the films more hydrophilic and reduces the pore size and open porosity. The reduction Eu3+ → Eu2+ occurs in the pores of OSG films, which is confirmed by depth profiling XPS. However, Eu3+ still presents on the film’s top surface. Presence of Eu3+ and Eu2+ gives characteristic luminescence emission in the range of 600‒630 nm (Eu3+) and 290‒400 nm (Eu2+). The Eu2+/Eu3+ concentrations ratio depends on CH3 groups concentration in the films. Moreover, concentration of Eu2+ ions in the pores can be reduced by exposure in inductively coupled (ICP) oxygen plasma. The observed shift of the luminescence spectra towards the UV region, in comparison to previously reported Eu-doped organosilicate films, can be attributed to the energy transfer occurring between the host material and Eu2+ ions.

This paper uses a Vector Autoregression (VAR) model and linear regression to analyze the effects of aggressive monetary policies (such as RRR cuts and interest rate reductions) and fiscal measures (like government bond issuance) on household wealth in China, with a focus on housing assets. A comparative analysis with Japan is conducted to explore the transmission mechanisms and the policies’ impacts on housing prices, wealth distribution, and economic growth. The findings highlight the significant role of monetary and fiscal interventions in shaping the housing market dynamics across different economic contexts.