We present a case of adult-onset systemic chronic active EBV disease (CAEBV) in a 40-year-old woman with chronic HBV hepatitis. Initial symptoms resembled a viral illness, progressing to recurrent fever, transaminitis, and anasarca. Investigations revealed high-level EBV viremia and an abnormal T-cell population in liver and bone marrow, indicative of CAEBV. Liver biopsy showed CD3+ T-cells lacking TCRbeta and displaying dim/negative CD5, with elevated EBV-infected T-cells. Next-generation sequencing identified rare variants in CREBBP, SPEN, TP73, and PLCG2, suggesting potential contributions to disease pathogenesis. This case underscores diagnostic challenges and management complexities of adult-onset CAEBV, particularly with underlying chronic HBV infection. Genomic profiling offers crucial insights into the molecular landscape of rare lymphoid malignancies, highlighting the importance of personalized treatment strategies. The distinct immunophenotypic features underscore the heterogeneity in EBV-associated T-cell LPDs, urging further research for optimized clinical management

High dimensional statistical analysis for the yield of large-scale circuits is quite difficult due to expensive simulations, especially for the memory circuits with high sigma requirement (e.g., SRAM). In this paper, we developed an efficient sparse additive model to substitute simulations. To fit high sigma region accurately, the modeling center is moved to near failure boundary searched by scaling the shape of sampling function. To solve the model efficiently, the process variables are grouped by standard cells so that the model can be solved by our developed blockwise greedy algorithm. The experiments on the 28nm memory circuits validate that our method achieves high accuracy and efficiency compared with other state-of-art works.

Digitalization have force emerging markets (EMs) firms operating in resource-constrained environment to adopt market-driven strategies, particularly frugal innovation, to provide affordable, optimize processes and high-value solutions. However, understanding the mechanisms behind developing frugal innovation capability (FIC) at the firm level in diverse EMs remains limited. From the perspective of the Resource-based View, this study added to the existing body of knowledge by exploring how strategic orientation (entrepreneurial orientation (EO) and market orientation (MO)) and organizational ambidexterity (OA) impact the development of FIC in EMs. The study utilized a cross-sectional survey in data collection with 386 valid respondents from Tanzanian manufacturing firms to empirically validate our theoretical predictions. The results show that both EO and MO have strong and positive association with OA and the development of FIC in EMs. In addition, OA partially mediate the relationship of both EO and MO with the development of FIC. Furthermore, our results indicate that MO exerts a more significant impact on the development of FIC than EO in EMs. Managers of manufacturing firms in EMs can use these findings to review their strategic decisions and their exploitative and exploratory approaches to enhance supply chains, develop cost-effective technologies, and produce affordable offerings that cater to the preferences of price-conscious consumers in the digitalization age.

Deep learning methods paired with sidescan sonar (SSS) are commonly used in underwater search and rescue operations for drowning victims, wrecks, and airplanes. However, these techniques are primarily designed to detect mine-like objects and are rarely applied to identifying features in dynamic dredge pit environments, due to a lack of datasets. In this study, we present a Sandy Point Dredge Pit (SPDP) dataset, in which high-resolution SSS data were collected from the west flank of Mississippi bird foot delta of the Louisiana inner shelf. This dataset contains a total of 385 SSS images. We introduce an Effective Geomorphology Classification model (EGC). By ablation studies, we analyze the utility of transfer learning on different model architectures and the impact of data augmentations on model performance. This EGC model will make geomorphic features identification in dredge pit environments quick and efficient which requires extensive experience and professional knowledge. The combination of SSS images and EGC model is a cost-effective and valuable toolkit for hazards monitoring in marine dredge pit environment. The SPDP SSS images dataset, especially the feature of pit wall without rotational slump, is also valuable for other machine learning modelers.

Digital transformation provides new drivers for economic performance growth in enterprises, but can it further improve ESG performance and support sustainable development? Based on the perspective of resources and capabilities, this paper uses the relevant data of 1588 listed companies in strategic emerging industries from 2011 to 2021 to study the differential impact of digital transformation on enterprise ESG performance, and further tests the mediating role of absorptive capacity and the moderating role of regional digital level. The research results indicate that: firstly, digital transformation of enterprises can positively promote the improvement of ESG performance; Secondly, there are significant differences in the impact of digital transformation on the ESG performance of enterprises in terms of property rights and industry characteristics. The ESG performance of state-owned enterprises and high-end equipment manufacturing enterprises is more sensitive to digital transformation; Thirdly, absorptive capacity plays a mediating role between digital transformation and corporate ESG performance; Fourthly, the positive regulation of regional digital level promotes the ESG performance of enterprises through digital transformation. The research conclusion is based on a digital perspective, providing relevant insights for improving the ESG performance of strategic emerging industry enterprises and expanding their ESG development paths.

Color image binarization plays a pivotal role in image preprocessing work, significantly impacting subsequent tasks, particularly in text recognition. This paper concentrates on Document Image Binarization (DIB), aiming to separate a image into foreground (text) and background (non-text content). Through a thorough analysis of conventional and deep learning-based approaches, we conclude that prevailing DIB methods leverage deep learning technology. Furthermore, we explore the receptive fields pre- and post-network training to underscore the Transformer model's advantages. Subsequently, we introduce a lightweight model based on the U-Net structure, enhanced with the Mobile ViT module to better capture global information features in document images. Given its adeptness at learning both local and global features, our proposed model exhibits superior performance on two standard datasets (DIBCO2012 and DIBCO2017) compared to state-of-the-art methods. Notably, our proposed DIB method presents a straightforward end-to-end model devoid of additional image preprocessing or post-processing. Moreover, its parameter count is less than a quarter of the HIP'23 model, which achives best results on three datasets(DIBCO2012, DIBCO2017 and DIBCO2018). Finally, two sets of ablation experiments were conducted to verify the effectiveness of the proposed binarization model.

Urban tree classification is pivotal in urban planning and management, facilitating informed decision-making processes. In this study, we introduce a novel data presentation method termed Pseudo Tree Crown, designed to enhance the accuracy and efficiency of urban tree classification. Leveraging the latest advancements in artificial intelligence (AI), we employ a state-of-the-art classification scheme, PyTorch, to maximize the accuracy of tree classification. Our results demonstrate a robust classification accuracy of over 95% from high spatial resolution imagery from Unmanned Aerial Vehicle (UAV), underscoring our proposed approach’s effectiveness. Moreover, the adaptability of our method renders it applicable to various study areas, highlighting its versatility and potential for widespread implementation in urban planning and management initiatives.

The unknown timing of appropriate initiation of administration has led to controversy over the use of hydrocortisone in the treatment of neonatal sepsis. This study sought to compare the survival rate and NF-κB pathway expression level in newborn mice treated with hydrocortisone at different initiation times after sepsis to find the appropriate administration time window for clinical neonatal sepsis patients. Before building the sepsis model, 36 newborn C57BL/6 mice were randomly divided into six groups with six mice, using quasi-randomization: five treatment subgroups(1 h, 6 h, 12 h, 24 h and 48 h based on the initiation of hydrocortisone therapy) and 1 control group. The survival rate of mice in each group was compared. The expression levels of the NF-κB pathway and inflammatory factors were analyzed and compared among groups. Initiation of hydrocortisone therapy within 12 h of sepsis onset improved the survival of LPS-induced newborn septic mice. Treatment with hydrocortisone over 12 hours reduced the expression level of NF-κB and lowered serum IL-6 and TNF-α levels in cardiopulmonary tissues of mice. Administration of hydrocortisone early in sepsis (within 12 hours) promotes neonatal mouse survival by inhibiting the NF-κB pathway.

The pollution caused by nitrogen dioxide is a major environmental problem in China. This study introduces a new type of atmospheric trace gas remote-sensing instrument, an airborne fiber imaging spectrometer. This spectrometer has a spectral range of 300–410 nm and works in push-broom mode with a 30° field of view on a flight path. Flight experiments were conducted on December 30, 2022 and January 5, 2023, covering heavily polluted areas of east of Beijing and Tangshan. This equipment obtained the density distribution of NO2 over the flight area. The results showed that pollution was mainly concentrated in the Caofeidian area and at the power station in the north, and the main source of pollution was anthropogenic. Satellite and airborne data near the pollution points were compared, and the two datasets showed a positive correlation with a correlation coefficient of 0.78 and 0.7, on the two days, respectively. This study demonstrates the capability of an airborne fiber imaging spectrometer for NO2 regional emission remote sensing and identifying the pollution points.

Rapidly and accurately extracting tobacco plant information can facilitate tobacco planting man-agement, precise fertilization and yield prediction. In karst plateau of southern China, tobacco plant identification is affected by large ground undulations, fragmented planting areas, complex and diverse habitats and uneven plant growth. This study took a tobacco planting area in Gui-zhou Province as the research object and used DJI UAVs to collect UAV visible light images. Considering plot fragmentation, plant size, presence of weeds and shadow masking, this area was classified into eight habitats. The datasets of different habitats were constructed to train the U-Net model. The results show that (1) the overall precision, recall, F1-score and IOU of tobacco plant information extraction were 0.68, 0.85, 0.75 and 0.60, respectively. (2) The precision was the highest for the subsurface-fragmented and weed-free habitat and the lowest for the smooth-tectonics and weed-infested habitat. (3) The weed-infested habitat with smaller tobacco plants can cause blurred images, reducing the plant identification accuracy. This study verified the feasibility of the U-Net model for tobacco single-plant identification in complex habitats. Decomposing complex habitats to establish the sample set method is a new attempt to improve crop identification in complex habitats in karst mountainous areas.

Graphene quantum dots (GQDs) possess the photosensitive absorption for photoelectrochemical hydrogen evolution owing to special band structures. Whereas they usually confront with photo-corrosion or undesired charge recombination during photoelectrochemical reactions. Hence, we establish the heterojunction between GQDs and MoSe2 sheets via hydrothermal process for improved stability and performance. Photoanodic water splitting with hydrogen evolution boosted by heteroatom doped N,S-GQDs/MoSe2 heterojunction has been attained due to the abundant active sites, promoted charge separation and transfer kinetics with reduced energy barriers. Diphasic 1T and 2H MoSe2 sheets hybridized quantum dots contribute to the Schottky heterojunction, which can play a key role in expedited carrier transport to inhibit accumulative photo-corrosion and increase photocurrent. Heteroatom dopants lead to favored energy band matching, bandgap narrowing, stronger light absorption and high photocurrent density. The external quantum efficiency of doped heterojunction has been elevated twofold over that of the non-doped pristine heterojunction. Modification of graphene quantum dots and MoSe2 heterojunction demonstrate a viable and adaptable platform toward photoelectrochemical hydrogen evolution processes.

Abstract: There are a large number of cross-linked chemical bonds such as tight disulfide bonds, hydrogen bonds,and salt bonds in keratin, which makes it difficult to break the structural stability of the protein using conventional methods. The degradation of feather waste using keratinases produced by microorganisms has the advantage of being efficient and environmentally friendly. In this study, 23 strains capable of producing transparent circles were obtained via preliminary screening with skim milk as the sole carbon and nitrogen source, and 9 strains capable of degrading feathers were obtained via rescreening with feathers as the sole carbon and nitrogen source. Finally, through the determination of enzyme activity, the strain CY-A with a high ability to degrade feathers was obtained. The strain was identified as Bacillus tequilensis via morphological observation, physiological and biochemical identification, and 16 S rRNA molecular biology. The keratinase gene (bta) of Bacillus tequila was cloned, and its full-length gene sequence was 1110 bp, containing an open reading frame of 1089, encoding 369 amino acids (GeneBank accession number OR733336). The physicochemical properties, secondary structure, and tertiary structure of the recombinant protein were analyzed using bioinformatics tools such as ProtParm, SOPMA, MEGA, and SWISS-MODELS. It was found that the relative molecular mass was 37.953 kD and that the isoelectric point was 8.48. The protein was a hydrophilic protein. The keratinase bta gene was ligated to the expression vector pET28a(+) using T4 ligase, and the recombination expression plasmid pET28-bta was constructed and transformed into E. coli BL21(DE3) to obtain recombinant engineered bacteria. The expressed keratinase was purified using a Ni2+ affinity chromatography column to obtain recombinant bta keratinase bta with a molecular weight of 37.953 kD. The identification and characterization of this keratinase gene provides some theoretical basis for the further enhancement of keratinase activity by means of genetic engineering.

Effective detection of isopropyl methylfluorophosphonate (GB, sarin), a type of organophosphine poisoning agent, is an urgent issue to be addressed in maintaining public safety. In this research, a gas-sensitive film material defined as poly (4-hydroxy-4,4-bis trifluoromethyl) - butyl-1-enyl) - si-loxane (SXFA) with the structure of hexafluoroisopropyl (HFIP) functional group was synthesized by using methyl vinylpropyl dichlorosilane and hexafluoroacetone trihydrate as initial materials. Synthesis process products were characterized by FTIR. SXFA was prepared on a 200 MHz shear surface wave delay line with spin coating method for GB detected. Detection limit of ＜ 0.1 mg/m3 was obtained through conditional experiments. Meanwhile, we also obtained the maximum re-sponse of 2.168 mV at 0.1 mg/m3 concentration, which indicting a much lower detection limit of SAW-SXFA sensor. Additionally, the maximum response standard deviation of 0.11 mV with a co-efficient of variation of 0.01, as well as the maximum recovery standard deviation of 0.22 mV with a coefficient of variation of 0.02 were also obtained through 5 repeated experiments. Results showed that the SAW-SXFA sensor has strong selectivity and reproducibility, good selectivity, positive detection ability, high sensitivity, and fast alarm performance for sarin detection.

Cell junction that is usually associated with dynamic cytoskeletons is essential for a wide range of cellular activities such as cell migration, cell communication, barrier function and signal transduction. Real-time observation of cell junction facilitates understanding of the mechanisms by which cell junction regulate relevant cellular activities. In this study, we examined the binding capacity of a modified tridecapeptide from Cx43 to cell junction protein ZO-1 and sought to create a fluorescent peptide that could be used to label cell junction. To introduce the fluorescent peptide into the cells, a cell-penetrating peptide was linked to the modified tridecapeptide and synthesized. The binding of the modified tridecapeptide was tested using pull down and immunoprecipitation assay. The ability of the peptide to label cell junction was assessed by adding it to fixed or cultured Caco-2 cells. Testing assay revealed that the Cx43-derived peptide can bind to ZO-1. Besides, the peptide was able to label cell junction of fixed cell, although no obvious cell junction labeling was observed clearly in living cells, probably due to the inadequate affinity. These results indicate that a peptide-based strategy for labeling cell junction may be feasible, and efforts to improve its affinity are warranted in the future.

The influence of polysialic acid (PSA) and sialic acid (SA) on the gut microbial community composition and metabolites in healthy human was investigated using a bionic gastrointestinal reactor. The results indicated that PSA and SA significantly changed the gut microbiota and metabolites in different degrees. PSA can increase the relative abundances of Faecalibacterium and Allisonella, whereas SA can increase those of Bifidobacterium and Megamonas. Both can significantly increase the content of short-chain fatty acids. The results of metabolome analysis showed that PSA can upregulate ergosterol peroxide and gallic acid and downregulate the harmful metabolite N-acetylputrescine. SA can upregulate 4-pyridoxic acid and lipoic acid. PSA and SA affect gut microbiota and metabolites in different ways and have positive effects on human health. These results will provide reference for the further development of PSA- and SA-related functional foods and health products.

In order to master the structure state of subway shield tunnel, reduce the diseases and avoid the potential safety hazards, the lateral convergence deformation of subway shield tunnels should be predicted. For the non-stationarity small sample size of subway shield tunnel lateral convergence deformation value, the existing prediction models have poor performance in terms of accuracy and stability. In this paper, a lateral convergence model of subway shield tunnel based on Kalman algorithm is constructed based on Kalman filtering theory. The model is efficient, adaptive and robust, and can accurately predict the lateral convergence deformation of subway shield tunnel. Taking the horizontal diameter of 200 rings shield segment in the interval section of a subway tunnel as an example, it is proved that the residuals of the Kalman prediction model are small, the residual distribution conforms to the normal distribution, and the prediction effect is great. The model is suitable for the prediction of more than 5 periods of data, and the prediction accuracy of the model is improved with the increase of the number of data periods. In addition, the Kalman model is compared with GM(1,1) model and GM-Markov model, and RMSE and MAPE are introduced as evaluation indexes. The results show that the Kalman model has higher prediction accuracy and is more suitable for predicting the lateral convergence deformation of subway shield tunnel.

The transition region is a very thin but most peculiar layer in the solar atmosphere, located between the solar chromosphere and the corona. It is a key region for understanding the coronal heating, the solar eruptions triggering, and the origin of solar winds. Here, the gradients of all physical parameters are very high, including plasma density, ionization degree, temperature, and magnetic fields, etc. Therefore, the transition region should be highly dynamic, such as fast energy releasing and transporting, plasma heating, and even particle accelerating. They include two physical aspects: thermal and non-thermal processes. The thermal processes can be observed from the ultraviolet (UV) and extreme ultraviolet (EUV) emission by multi-wavelength images. The non-thermal processes, however, should be related to radio emissions especially at millimeter wavelengths, and the frequency range should span from several GHz to beyond 300 GHz, and the emission mechanism should be highly related to the magnetic fields and variations. The ultra-wide broadband spectral observations at millimeter wavelengths with high spectral resolutions may provide rich dynamic information about the transition region, such as non-thermal energy release and transmission, the flows of plasma and energetic particles, the magnetic fields and their variations, the generation and transportation of various waves, and the formation and evolution of the source regions of solar eruptions. Here, we discussed the spectral characteristics of millimeter-wave emission from the transition region and proposed a new conception of ultra-wide broadband millimeter-wave spectrometers to observe them.

The Hippo pathway plays crucial roles in governing various biological processes during tumorigenesis and metastasis. Within this pathway, upstream signaling stimuli activate a core kinase cascade, involving MST1/2 and LATS1/2, which subsequently phosphorylates and inhibits the transcriptional co-activators YAP and its paralog TAZ. This inhibition modulates the transcriptional regulation of downstream target genes, impacting cell proliferation, migration, and death. Despite the acknowledged significance of protein kinases in the Hippo pathway, the regulatory influence of protein phosphatases remains largely unexplored. In this study, we conducted the first gain-of-functional screen for protein tyrosine phosphatases (PTPs) regulating the Hippo pathway. Utilizing a LATS kinase biosensor (LATS-BS), a YAP/TAZ activity reporter (STBS-Luc), and a comprehensive PTP library, we identified numerous novel PTPs that play regulatory roles in the Hippo pathway. Subsequent experiments validated PTPN12, a master regulator of oncogenic receptor tyrosine kinases (RTKs), as a previously unrecognized negative regulator of the Hippo pathway effectors, oncogenic YAP/TAZ, influencing breast cancer cell proliferation and migration. In summary, our findings offer valuable insights into the roles of PTPs in the Hippo signaling pathway, significantly contributing to our understanding of breast cancer bi-ology and potential therapeutic strategies.

Hyperspectral anomaly detection is to recognize anomalies from complex scene in an unsupervised way. Currently, many spectral-spatial detection methods have been proposed with a cascaded manner. However, they often neglect complementary characteristics between spectral and spatial dimensions, which easily leads to yield high false alarm rate. To alleviate this issue, a spectral-spatial information fusion (SSIF) method is designed for hyperspectral anomaly detection. First, an isolation forest is exploited to obtain spectral anomaly map, in which the object-level feature is constructed with entropy rate segmentation algorithm. Then, a local spatial saliency detection scheme is proposed to produce spatial anomaly result. Finally, the spectral and spatial anomaly scores are integrated together followed by a domain transform recursive filtering to generate the final detection result. Experiments on five hyperspectral datasets prove that the proposed SSIF produces superior detection result over other state-of-the-art detection techniques.

Hypsizygus marmoreus has become one of the most popular edible mushrooms due to its high nu-tritional and economic value. Previous researchers found that Serratia odorifera could promote the growth of H. marmoreus by producing and secreting some of its inducers. However, the specific mechanism of action was still unclear. In this study, we found that exogenous addition of sterile fermentation filtrate (HZSO-1), quorum sensing (QS signaling molecules, 3-oxo-C6-HSL, cy-clo(Pro-Leu), and cyclo(Tyr-Leu) could significantly promote the growth of H. marmoreus, increase the number of clamp junctions, and the diameter of mycelium (P < 0.05). In addition, non-targeted metabolomic analysis has revealed that 706 metabolites were detected in the treated group. Of these, 307 metabolites were significantly different (P < 0.05). Compared with the control, 54 and 86 metabolites were significantly increased and decreased in the HZSO-1 group, respec-tively (P < 0.05). We speculated that the sterile fermentation filtrate of S. odorifera could mediate the carbohydrate and amino acid metabolism of H. marmoreus by influencing the pentose phosphate pathway (PPP) to increase the energy supply for the growth and development of the mycelium. The above results will further reveal the growth-promoting mechanism of S. odorifera on H. mar-moreus.

Background Acute kidney injury (AKI) is a common comorbidity in the intensive care unit (ICU), with higher mortality rate among those who receive continuous renal replacement therapy (CRRT). This study aimed to investigate the association of white blood cell (WBC) levels with all-cause mortality in AKI patients undergoing CRRT. Method We conducted a post hoc analysis of ICU patient data from multiple centers in Korea. First, the levels of WBCs were classified into four groups based on quartiles. Second, the relationship between different WBC levels and mortality was investigated with the Kaplan-Meier (K-M) survival curves, Cox proportional hazards model, and generalized additivity model (GAM). Finally, we used multiple imputation to avoid bias caused by non-randomized missing data. The endpoints were short-term (28 days) and long-term (90 days) mortality. Result In our analysis, a total of 1,100 ICU patients were included. Among them, 670 (60.90%) and 781 (71.00%) died within 28 and 90 days, respectively. K-M survival curves showed that patients with the lowest WBC levels had the highest risk of mortality for both outcomes. Adjusted multivariate Cox regression analysis confirmed that compared with the reference level (quartile 2), low WBC levels increased the risk of both 28-day mortality (quartile 1, HR = 1.43, 95% CI: 1.13–1.83, P = 0.004) and 90-day mortality (quartile 1: HR = 1.32; 95% CI: 1.05-1.66, P = 0.016). GAM analysis showed a non-linear, U-shaped relationship between pre-CRRT WBC levels and all-cause mortality (non-linear P < 0.05). Conclusion The baseline WBC level is an independent predictor of prognosis for ICU patients receiving CRRT. Patients in the lowest WBC quartile had the highest risk of all-cause mortality. These results provide further evidence that early observation and intervention may have a prognostic value for these high-risk patients.

The limitations of conventional sensors have made phased array antennas increasingly crucial for gathering information and communication applications in intelligent transportation systems. Compact cylindrical arrays, in particular, are favored for their ability to achieve azimuth angle scan. However, the substantial mutual coupling effect between elements on curved surfaces and its implication in these arrays remains unclear, which is a crucial factor to consider when such arrays are used for multibeam applications. This study investigated the effect of mutual coupling in a dual-slant-polarized cylindrical array. The results showed that mutual coupling is essential for achieving an ultra-wide bandwidth. Mutual coupling is predominantly observed among elements that are closely positioned. The study also analyzes the impact of mutual coupling on scan impedance and radiation characteristics for multibeam applications and reveals that these arrays exhibit robust multibeam capability, hence having great potential for use in intelligent transportation systems.

In this study, the effects of combined addition of CeLa and GdY on microstructure and mechanical properties of as-cast Al-4Cu-1Mn alloys were investigated by X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopies (TEM) and tensile testing. The results show that the minor addition of CeLa and GdY leads to the refinement of grain size. The addition of CeLa results in the formation of supersaturated vacancies in the Al matrix, whereas the addition of GdY leads to a decrease in the precipitation temperature of the Al2Cu phase. The combined CeLa and GdY addition can significantly increase ultimate tensile strength (UTS) while losing only a small amount of elongation (EL). Compared with the unmodified alloy, the grain size and SDAS of the alloy (0.2 wt% CeLa + 0.1 wt% GdY) were diminished by 67.2% and 58.7%, respectively, while maximum hardness and UTS rose by 31.2% and 36.9%, correspondingly.

Chromium poisoning strongly influences the performance of solid oxide fuel cell (SOFC) stacks. A three-dimensional, time-dependent, computational fluid dynamics model of a single channel of a F10 SOFC stack in Forschungszentrum Jülich GmbH is developed to investigate chromium poisoning for different stack designs, temperatures and absolute air humidities. The model takes into account both chemical and electrochemical mechanisms of chromium poisoning and is able to predict the spatial distribution of SrCrO4 and Cr2O3. The voltage degradation over 100 kh can be simulated quantitatively. According to the simulation results, chromium poisoning is almost eliminated by the application of the protective coating fabricated by the atmospheric plasma-spraying (APS) technology. Besides, with the help of the APS protective coating, operating a SOFC stack with less dehumidified air at 650 oC is possible according to the simulation.

The optical reflection characteristics of asphalt pavement are an important influencing factor in road lighting design, and the macro and micro textures of asphalt pavement significantly affect its reflection characteristics. To investigate the impact of texture parameters on the retroreflection coefficient of asphalt pavement, this study obtained the macroscopic and microscopic texture properties of rutting board specimens and on-site asphalt pavement using a pavement texture tester. The macro- and microtexture parameters, such as macroscopic texture distribution density (D1), microscopic texture distribution density (D2), profile height root-mean-square (Rq), profile slope root-mean-square (Δq), skewness Rsk and kurtosis Rku, were measured, and the corresponding retroreflection coefficient RL was measured using a retro-reflectometer. In the laboratory ex-periments, rutting specimens of AC-13, SMA-13, and OGFC-13 asphalt mixtures were formed. The changes in texture parameters and retroreflection coefficient of different rutting specimens before and after crushing were studied, and a factor influence model between macro- and microtexture parameters and RL was established. And the correlation models of texture index and RL of asphalt pavement are further established. The results showed that in the single factor model, the param-eters can be used to characterize RL with high prediction accuracy, whereas for the on-site meas-urements, the three parameters of Δq, Rsk, and Rku can characterize the RL well. The nonlinear model established on the basis of the B-P neural network algorithm improves its prediction ac-curacy. This research can provide ideas for optimizing the reflection characteristics of asphalt pavement and further provide a decision-making basis for road lighting design.

It’s been reported that Mori Folium (MF) and Eucommiae Cortex (EC) exhibit pharmacological effects on the treatment of immunosuppression. However, the mechanism of MF and EC against immunosuppression remains unclear. This study aims to explore the mechanism of action of MF and EC for the treatment of immunosuppression through network pharmacology, molecular docking, molecular dynamics simulations and animal experiments. As a result, 11 critical components, 9 hub targets, and related-signaling pathways of treatment of immunosuppression were obtained based on network pharmacology. The molecular docking suggested that 11 critical components exhibited great binding affinity to 9 hub targets of immunosuppression. The molecular dynamics simulations results showed that (-)-Tabernemontanine-AR, beta-sitosterol-AR and Dehydrodieugenol-HSP90AA1 complexes are stably bound. Additionally, in the animal experiments, the treated group results compared to the control group suggest that MF and EC have a significant effect on the treatment of immunosuppression. Therefore, the MF and EC treatment for immunosuppression may take effects in a multi-component, multi-target, and multi-pathway manner. The results would provide novel insights into the treatment of immunosuppression in humans.

The guided ultrasonic wave (GUW) is extensively employed in non-destructive testing (NDT) for the purpose of detecting defects in aerospace vehicles, oil pipelines and mechanical equipment. The filtration of GUW signals, which often contain substantial environmental noise, is a crucial procedure in signal processing. This paper presents a novel denoising approach that combines Variational Mode Decomposition (VMD) with an enhanced Singular Value Decomposition (SVD). The VMD method is employed to preprocess the initial signal, thereby segregating the signal component from the noise component. Subsequently, the SampEn-SVD (Sample Entropy-SVD) method is utilized to extract the effective component from the VMD-preprocessed noise component. Finally, the VMD-preprocessed signal component and the SampEn-SVD-processed effective component are combined to yield the resultant signal, which effectively filters out the noise. The efficacy of this integrated denoising approach is substantiated through the examination of experimental signals. Furthermore, a comparative analysis is conducted to evaluate the efficacy of this method in relation to other denoising techniques. The results indicate that the SampEn-SVD method yields a superior signal-to-noise ratio (SNR) when processing the GUW signal transmitted through the steel strand. Moreover, the denoising procedure significantly reduces the discretization of characteristic parameters in the signal waveform, thereby addressing the issue of inadequate reproducibility in testing outcomes. Consequently, the denoised signal exhibits high fidelity and demonstrates a strong correlation between its combined eigenvector and strand stress.

In order to balance the conflicts among mass flow rate, total pressure ratio, adiabatic efficiency and stall margin in a low-bypass transonic fan, the optimization of the rotor blade is implemented in this study. An advanced 3D optimization design system is adopted, and flow diagnostic methods based on vorticity dynamics are employed to discuss the flow field. Results indicate that by controlling the blade camber line curvature, significant improvements in the aerodynamic performance for the fan stage are achieved, the total pressure ratio is increased by 1.90%, while the adiabatic efficiency and mass flow rate are increased by 4.45% and 5.82%, respectively. Vorticity diagnosis suggest that there exists a close link between performance parameters and vorticity parameters in the axial fan/compressor, both azimuthal vorticity and boundary vortex flux have significant influences on the stage performance. Moreover, the boundary layer separation is accompanied by the spike of entropy and static pressure, while the derivation/gradient of these flow parameters would also suffer drastic changes under the effect of shock wave. The vorticity parameters could provide detailed flow information about the on-wall flow with high accuracy, which provides the researchers with a novel method for the turbomachinery aerodynamic design and analysis.

Conical emission is a typical nonlinear phenomenon that occurs when the femtosecond laser pulses interact with transparent media. In this work, the conical emission induced by two kinds of typical vortex beams (i.e., Laguerre-Gaussian (LG) and Bessel-Gaussian (BG) beams) in water is experimentally studied. By recording the light spots of different wavelengths on the screen, the characteristics of the conical emission induced by femtosecond vortex beams are studied. It is found that the spots of the supercontinuum induced by the two kinds of vortex beams differ greatly from each other: The spots of the supercontinuum induced by the BG beam are a set of concentric rings like a rainbow with a white center, while the whit light spot in the case of the LG beam are a circular white disk, which is different from the commonly observed white light spots. By measuring the maximum divergence angle, it is observed that the divergence angle increases with the decrease of the wavelength, while the TC merely affects the divergence angle, which is explained from the formation mechanism of conical emission in terms of self-phase modulation. We hope this work can be helpful to the understanding of interaction between the intense laser pulses and matters.

Hu7691 represents a novel Pan-Akt kinase inhibitor, demonstrating excellent selectivity towards non-AGC kinase families and pronounced inhibitory effects on the proliferation of multiple tumor cell lines. However, there is currently a notable absence of in vivo toxicological research evidence concerning Hu7691. This study represents the first investigation into the 14-day repeated dose toxicity of Hu7691 in male and female Sprague-Dawley (SD) rats. Male rats were administered daily doses of 12.5, 50, 100, and 150 mg/kg, while female rats received doses of 12.5, 25, 50, and 75 mg/kg for 14 consecutive days. Hematological assessments, organ weights, and histopathological examinations revealed corresponding alterations, suggesting potential target organs for toxicity including the spleen, thymus, and gastrointestinal tract. It is worth noting that the test substance may also impact the liver, kidneys, heart, and ovaries. The No Observed Effect Level (NOAEL) was determined to be no greater than 12.5 mg/kg. Based on the observed gender-related toxicity differences in preliminary trials, it is recommended that the high dose reference dose for male animals in formal experiments should not be less than 100 mg/kg, while for female animals, it should be less than 50 mg/kg.

As the largest accretionary orogen in the world, the Central Asian Orogenic Belt (CAOB) has continuous juvenile crustal growth in the Phanerozoic. The northern margin of the North China Craton(NCC) and its adjacent area is the eastern segment of the CAOB, and is a key area to study the geological evolution of Paleo-Asian Ocean (PAO). In the Permian, the west of the northern margin of NCC belongs to a post-collision extensional environment, and the east belongs to a subduction stage. But, As a connecting area, the Permian evolution of PAO in the middle of northern margin of NCC has not been systematically studied. In order to fill the blank and understand the temporal and spatial continuous evolution process of PAO, this paper focused on the Permian granitic rocks in the Chifeng area, zircon U-Pb dating and the geochemical analysis of the whole rock main and trace elements were conducted in order to build a granite chronological framework, discuss the genesis and tectonic background of the granite rocks as well as the magma-tectonic evolution history in the Chifeng area. Zircon U-Pb dating results of 8 samples are 269±1 Ma, 268±3 Ma, 260±4 Ma, 260±1 Ma, 260±1 Ma, 255±2 Ma, 254±2 Ma, 256±1Ma, which showed that the Permian granitic rocks had undergone three stages of emplacement: (1) The monzogranite and syenite (294-284 Ma); (2) The monzogranite (269-260Ma) and (3) The monzogranite and syenite (256-254Ma). The Middle Permian magmatism (269-260Ma) was represented by the monzogranite assemblages with different grain sizes. The geochemical characteristics showed that they were high-potassium calc-alkaline-potassium dossonite series of granites formed in compressional environment, indicating there was a collision between the Xing’an-Mongolian Orogenic Belt (XMOB) and the North China Craton (NCC). During the Late Permian-Early Triassic (256-248Ma), the granites in the Chifeng area are dominated by the A-type and I-type granites of high-potassium calc-alkaline series formed under an extensional environments, which constituted typical "bimodal" rock assemblage combined with the coeval basic rocks, suggesting the study area was in an extensional environment where the subducting slab is fragmented during the collision between the XMOB and the NCC. According to emplacement time and occurrence location, the plutons are interpreted to have been generated by the subduction-collision of the Paleo-Asian oceanic crust beneath the NCC. This study provides strong evidence for Permian tectonic evolution and the characterization of the eventual closure of the Paleo-Asian Ocean in the Chifeng City at the northern margin of the NCC.

Lucky bamboo (Dracaena sanderiana hort. ex Mast. = Dracaena braunii) is a domestic species widely cultivated for ornamental purposes in China. In March 2022, a severe occurrence of anthracnose disease was observed on the stems of lucky bamboo plants in a greenery retail store located in Nanjing, Jiangsu Province, China. The morphological characteristics of isolates obtained from diseased stem tissues were identical with those described for Colletotrichum species. Based on multilocus phylogenetic analysis with the internal transcribed spacer (ITS), actin (ACT) gene, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene, the pathogen was identified as Colleto-trichum gloeosporioides (Penz.) Penz. & Sacc. Pathogenicity was verified by mycelial plug-inoculating stem cuttings of one-year-old lucky bamboo plants and spray-inoculating whole one-year-old lucky bamboo plants, respectively. Koch’s postulates were fulfilled by the re-isolation of C. gloeosporioides from symptomatic tissues. To the best of our knowledge, this report describes the first time that C. gloeosporioides was observed to cause anthracnose on lucky bamboo in China.

The relative position of the orchard robot to the rows of fruit trees is an important parameter for achieving autonomous navigations. The current methods for estimating the position parameters between rows of orchard robots obtain low parameter accuracy, and to address this problem, this paper proposes a machine vision-based method for detecting the relative position of orchard robots and fruit tree rows. Firstly, the fruit tree trunk is identified based on the improved YOLOv4 model; secondly, the camera coordinates of the tree trunk are calculated from the principle of binocular camera triangulation, and the ground projection coordinates of the tree trunk are obtained through coordinate conversion; finally, the midpoints of the projection coordinates of different sides are combined and the navigation path is obtained by linear fitting with the least squares method, and the position parameters of the orchard robot are obtained through calculation. The experimental results show that the average accuracy and average recall of the improved YOLOv4 model for fruit tree trunk detection are 97.05% and 95.42%, respectively, which are 5.92 and 7.91 percentage points higher than those of the original YOLOv4 model. The average errors of heading angle and lateral deviation estimates obtained based on the method in this paper are 0.57° and 0.02 m. The method can accurately calculate heading angle and lateral deviation values at different positions between rows, and can provide a reference for autonomous visual navigation of orchard robots.

The assessment and prediction of drought risk under future climate change and land use land cover (LULC) scenarios is critically important for drought prevention and mitigation, as it enables a clearer understanding of potential shifts in drought patterns. The primary aim of this study is to evaluate sub-seasonal and seasonal meteorological and hydrological drought hazards across the Yellow River Basin (YRB) under projected future climate conditions and LULC patterns. The BCC-CSM1-1 climate model projections from the NASA Earth Exchange Global Daily Downscaled Projections (NEX-GDDP) dataset are utilized to represent future climate for 2025-2060 under RCP 4.5 and 8.5 scenarios. The CA-Markov model is employed to predict future LULC distributions. Meteorological and hydrological drought risks across different YRB zones are evaluated through a copula-based risk assessment approach, based on the joint probability distribution of drought duration and severity. The results indicate that sub-seasonal meteorological and hydrological droughts will likely be the primary concern moving forward. Specifically, the upper YRB (zones A, B, C) exhibits greater vulnerability to sub-seasonal meteorological drought, while the Loess Plateau (zones C, E) shows higher susceptibility to sub-seasonal hydrological drought. Moreover, zone F in the downstream region may experience increased seasonal hydrological drought risk due to projected urban expansion in the middle and lower portions of the YRB.

Titanium alloys are difficult to machine and have poor tribological properties. This paper investigates the lubricating performance of γ-Al2O3/ZnO hybrid nanofluids for Ti-6Al-4V. The pure and hybrid nanofluid are compared, and the effects of γ-Al2O3/ZnO ratios are studied. The results show that γ-Al2O3/ZnO hybrid nanofluids outperform pure nanofluid in terms of lower friction coefficients and better surface quality. Moreover, the hybrid nanofluid with a mass ratio of Al2O3 to ZnO of 2:1 demonstrates the best lubrication performance with a reduced friction coefficient of up to 22.1% compared to the base solution, resulting in improved surface quality. Al2O3 nanoparticles can adhere to the surface of ZnO nanoparticles and work as a coating, which further enhances the lubrication performance of the water-based nanofluid.

The emergence of non-canonical amino acids (ncAAs) has enriched the functional pool inherent in canonical amino acids (cAAs). ncAAs are important building blocks in the production of various pharmaceuticals. The biosynthesis of ncAAs has emerged as an alternative to traditional chemical synthesis because of its environmental friendliness and high efficiency. The breakthrough genetic code expansion (GCE) technique developed in recent years has allowed for the incorporation of ncAAs into target proteins, giving them special functions and biological activities. Biosynthesis of ncAAs and their incorporation into target proteins within a single microbe has become an enticing application of such molecules. Based on that, in this study we first review the biosynthesis methods for ncAAs and analyze the difficulties in biosynthesis. We then summarize the GCE methods and analyze their advantages and disadvantages. Further, we review the application progress of ncAAs and anticipate the challenges and future development directions of ncAAs.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Background: Plasma levels of von Willebrand factor (VWF) are significantly elevated in patients with COVID-19. However, the dynamic changes and prognostic value of this biomarker in hospitalized patients with COVID-19 are not determined. Methods: 124 patients infected with SARS-CoV2 were prospectively recruited for the study. Serial blood samples were obtained at the time of admission (D1), 3-4 days following standard of care treatments (D2), and 1-2 days prior to discharge or death (D3). Plasma VWF antigen, ADAMTS13 antigen and activity, as well as the ratio of VWF/ADAMTS13 were determined, followed by statistical analyses. Results:While admission plasma levels of VWF in COVID-19 patients were significantly elevated, no statistical significance was detected among patients of different disease severity. Plasma ADAMTS13 activity, but not its antigen levels, were significantly lower in patients with severe or critical COVID-19 compared with other groups. Interestingly, the ratios of plasma VWF antigen to ADAMTS13 antigen were significantly higher in patients with severe or critical COVID-19 than in those with mild to moderate disease. More importantly, plasma levels of VWF and VWF/ADAMTS13 ratios were persistently elevated in patients with COVID-19 during hospitalization. Kaplan-Meier and Cox proportional hazard regression analysis revealed that an increased plasma VWF or ratio of VWF/ADAMTS13 at D2 and D3 associated with an increased mortality rate. Conclusions: Persistent endotheliopathy, marked by an elevated level of plasma VWF or an increased VWF/ADAMTS13 ratio, is present in all hospitalized patients following SARS-CoV2 infection and strongly associated with mortality.

Cellobiose phosphorylase (CBP) catalyzes the reversible phosphorolysis of cellobiose into α-glucose 1-phosphate and glucose. When it was used in transforming cellulose to amylose (PNAS, 110: 7182-7187, 2013) as well as in constructing a yeast with the ability to phosphorolytically use cellodextrin to produce ethanol, a CBP with a broadened substrate specificity would be more desirable. Based on the structure differences in the catalytic loops of CBP and cellodextrin phosphorylase from Clostridium thermocellum (named CtCBP and CtCDP, respectively), CtCBP was mutated. A single-site mutant S497G was identified to have a 5.7-fold higher catalytic efficiency with cellotriose as a substrate in phosphorolytic reaction direction compared to wild type, without any loss of catalytic efficiency on its natural substrate cellobiose. When S497G variant was used in the transformation of mixed cellodextrin (cellobiose + cellotriose) to amylose, a significant increase in amylose yield was achieved compared to that of wild type CtCBP. Structure change in the substrate binding pocket of S497G variant accounted for its capacity to accept longer cellodextrins than cellobiose. Taken together, S497G variant of CtCBP was confirmed to acquire a promising feature favorable to those application scenarios involving cellodextrin’s phosphorolysis.

Energy transition is a major structural change in the whole social system, and the energy system must be changed globally to replace fossil fuels. Hydropower is one of the largest renewable energy in the world. However the involuntary resettlees due to the construction of hydropower projects are suffering from being far away from their native land, losing the land cultivated for generations and the houses they live in, and losing the social relationship network based on geography and blood ties. Based on the system evaluation theory of reservoir resettlement and referring to relevant research findings, this paper constructs a comprehensive evaluation index framework for assessing the implementation effect of the PostRelocation Support (PReS) policy. The research region is located in Zhijin County, Bijie City, Guizhou Province, China. Accordingly, a combined method of a structural equation model and a fuzzy comprehensive evaluationary model is used in this paper to analyze the implementation of the PReS policy. The results show that the total score of implementing effects of the PReS policy is 4.4, with dramatic significance. The subindex scores of the resettlers’ family income, living conditions, and production conditions; the local economy; and social stability are 4.3, 4.6, 4.4, 4.6, and 4.3, respectively, with dramatic significance. This paper has analyzed and summarized the successful practices of implementing the PReS policy for reservoir resettlers in three dimensions: poverty alleviation, beautiful home construction and accelerating rural revitalization. Research shows that China's rural reservoir resettlers' PReS policy has been more effective in restoring the livelihoods of reservoir resettlers.

Pastes containing reduced graphene oxide (rGO) and LiCl-Mn(NO3)2·4H2O are screen-printed on a carbon cloth substrate and then calcined using a nitrogen atmospheric-pressure-plasma jet (APPJ) for conversion into rGO-LiMnOx nanocomposites. The APPJ processing time is within 300 s. RGO-LiMnOx on carbon cloth is used to sandwich H2SO4, LiCl, or Li2SO4 gel electrolytes to form hybrid supercapacitors (HSCs). The areal capacitance, energy density, and cycling stability of the HSCs are evaluated using electrochemical measurement. The Li2SO4 gel electrolyte HSC exhibits the highest areal capacitance and energy density but lower cycling stability. By contrast, the H2SO4 gel electrolyte HSC exhibits better cycling stability but lower areal capacitance and energy density.

In this paper, we present a new stress calculation method for flexible structures, particularly, the tensile armors, and apply it to flexible riser fatigue analysis. The method is based on a 3-dimensional curved bar theory. First, the tensile armor center line was described as a cylindrical helix curve, its bended curve length and bending migration length were derived and studied under different friction scenarios. Second, the tensile and bending stiffness was given with consideration of frictional hysteretic effect, and verified through FEA analysis results. Third, we presented the stress calculation formula for tensile armor under tension and bending load. All stress components are considered, including tensile, bending and shear stresses. Fourth, the method was benchmarked with published experimental results on a flexible prototype tension and bending tests, and comparisons showed general agreements. Fifth, the method is further applied to a 8” flexible riser for fatigue assessment and lifetime extension evaluation, and showed the flexible riser has sufficient remaining fatigue life, and is suitable to continue its service under the current operating conditions. Last, conclusions are drawn. It concluded that the presented tensile armor stress calculation method and modelling techniques are valid for flexible riser fatigue analysis. This method is time efficient, and can be implemented into other multi-scale models for riser dynamic analysis. It is also applicable to other similar helix structure stress analysis, such as wire ropes, submarine hoses, and subsea umbilicals.

Polarimetric Synthetic Aperture Radar (PolSAR) images with dual polarization modes have great potential to map FSV by excellent penetration capabilities and distinct microwave scattering processes. However, the response of these SAR data to FSV is still uncertain at non-growing season. To further interpret the response of forest FSV to these dual-polarization SAR images, three types of dual polarization SAR images (GF-3, Sentinel-1, and ALOS-2) were initially acquired in coniferous planted forest at non-growing season. Then, sensitivity between FSV and all alternative features extracted from each type of SAR images were analyzed to express the difference of bands and polarization modes in deciduous (Larch) and evergreen (Chinese pine) forests. Finally, mapped FSVs using single and combined dual polarization images were derived by optimal feature sets and four machine learning models, respectively. The combined effects were also analyzed to clarify the response of FSV to dual polarization SAR images with bands and polarization modes at non-growing season. The results demonstrated that the difference of backscattering energy from different sensors is significant in Chinese pine forests, and the difference is gradually reduced in Larch forests. it is also implied that polarization mode is more important than penetration capability in mapping forest FSV in deciduous forest at non-growing season. By comparing the accuracy of mapped FSV using single and combined images, combined images have more capability to improve the accuracy and reliability of mapped FSV. Meanwhile, it is also confirmed that compensation effect with bands and polarization modes not only have great potential to delay the saturation phenomenon, but also have capability to reduce errors caused by over-estimation.

In modern security situations, tracking multiple human objects in real-time within challenging urban environments is a critical capability for enhancing situational awareness, minimizing response time, and increasing overall operational effectiveness. Tracking multiple entities enables informed decision-making, risk mitigation, and the safeguarding of civil-military operations to ensure safety and mission success. This paper presents a multi-modal electro-optical/infrared (EO/IR) and radio frequency (RF) fused sensing (MEIRFS) platform for real-time human object detection, recognition, classification, and tracking in challenging environments. By utilizing different sensors in a complementary manner, the robustness of the sensing system is enhanced, enabling reliable detection and recognition results across various situations. Specifically designed Radar tag and thermal tag can be used to discriminate friendly and non-friendly objects. The system incorporates deep learning-based image fusion and human object recognition and tracking (HORT) algorithms to ensure accurate situation assessment. After integrating into an all-terrain robot, multiple ground tests were conducted to verify the consistent HORT in various environments. The MEIRFS sensor system has been designed to meet the Size, Weight, Power, and Cost (SWaP-C) requirements for installation on autonomous ground and aerial vehicles.

High-performance electromagnetic interference (EMI) shielding materials with ultralow density and environment friendly properties are greatly demanded to address electromagnetic radiation pollution. Herein, carbon nanotubes/polylactic acid (CNTs/PLA) materials with different CNTs contents, which exhibit characteristics of light weight, environmental protection and good chemical stability, are fabricated by 3D printing technology, where CNTs are evenly distributed and bind well with PLA. The performances of 3D printed CNTs/PLA composite are improved compared to pure 3D printed PLA composite, which include mechanical properties, conductive behaviors and electromagnetic interference (EMI) shielding. The EMI shielding effectiveness (SE) of CNTs/PLA composite could be improved when the contents of CNTs increase. When it reaches 15 wt%, the EMI SE of 3D printed CNTs/PLA composite could get up to 47.1 dB, which shields 99.998% of electromagnetic energy. Meanwhile, the EMI shielding mechanism of 3D printed CNTs/PLA composite is mainly of absorption loss, and it generally accounted for more than 80% of the total shielding loss. These excellent comprehensive performances endow the 3D printed CNTs/PLA composite with great potential for use in industrial and aerospace area.

Eugenol is a widely used fishery anaesthetic. This study investigated the effects of various concentrations of eugenol on blood physiological and biochemical indexes, and muscle flavor, in crucian carp (Carassius auratus). To determine the appropriate concentration of eugenol anesthetic for use in crucian carp transportation and production operations, we evaluated seven anaesthesia groups of 20, 30, 40, 50, 60, 70 and 80 mg/L and one control group (without eugenol) to determine the effects on blood physiological and biochemical indexes, and muscle flavor. The red blood cells and platelets of crucian carp decreased significantly (P<0.05) with eugenol treatment. With increasing eugenol concentration, the white blood cells and hemoglobin did not change significantly, whereas lactate dehydrogenase, alkaline phosphatase, alanine aminotransferase and aspartate aminotransferase increased significantly (P<0.05). The content of phosphorus, magnesium and sodium increased after anaesthesia, whereas the content of potassium decreased with increasing eugenol concentration. After anaesthesia, the content of albumin and total protein in the serum decreased with increasing eugenol concentration (P<0.05); triglyceride first increased and subsequently decreased (P<0.05); blood glucose content first increased and then decreased (P<0.05); and no significant difference was observed in total cholesterol content (P>0.05). No significant difference was observed in muscle glycogen and liver glycogen content after eugenol anaesthesia (P>0.05). The eugenol-based anaesthesia test did not indicate major liver histomorphological effects, but the very small number of gill sheet edema cases observed requires further study. Analysis of electronic nose data indicated that eugenol treatment affected the flavor of the fish. The anaesthesia concentration of 20–80 mg/L had little effect on the physiology and biochemistry of crucian carp, thus providing a reference for the application of eugenol in crucian carp transportation and experimental research.

Microgrid is one of the important ways to accommodate distributed PV generation. However, the optimal planning scheme of microgrids is closely related to solar resources, load characteristics, and the key components of microgrid systems. This paper uses HOMER software to conduct collaborative planning for grid-connected PV-storage microgrids with electric vehicles in multiple scenarios. Specifically, we construct a multi-scenario capacity optimization model for PV generation, energy storage, and converters, considering both the cleanliness and economic performance of microgrids. The performance is quantified using indices such as net present cost, levelized cost of electricity, and carbon dioxide emission under multiple scenarios. Finally, we conduct extensive case studies on a business park in Wuhan, China, to compare and discuss the planning performance under multiple scenarios, as well as sensitivity analysis with specific cases.

In this paper, MnO2 nanowire (MnO2-NW) modified carbon paper (CP) electrode was developed as a novel electrochemical sensor for sensitive determination of tetrabromobisphenol A (TBBPA). MnO2 nanowire was prepared by a hydrothermal synthesis method, and the morphology and structure of MnO2 were characterized using scanning electron microscopy, X-ray diffraction and X-ray photoelectron spectroscopy. Electrochemical performance of TBBPA on MnO2-NW/CP was investigated by cyclic voltammetry, and the result confirmed that MnO2-NW/CP exhibited excellent sensitive for the determination of TBBPA due to the high specific surface area and good electrical conductivity of the nanowire-like MnO2. Moreover, the important electrochemical factors such as pH value, incubation time and modified material proportion were systematically studied to improve the determination sensitivity. The interferences from similar structure compounds on TBBPA have also been investigated. Under the optimal conditions, MnO2-NW/CP displayed the linear range of 70 500 nM for TBBPA with the detection limit of 3.1 nM, which was superior to some electrochemical methods in references. The work presents a novel and simple method for the determination of TBBPA.

This paper provides an optimization strategy for flexible operation at the system level, so as to guide the real-time flexible ramping of the power grid. Firstly, the concept of regional power grid flexibility was clarified, and the ramping factor is proposed as a flexibility metric. On this basis, taking the output priority of each node as the objective function and considering constraints such as line flow, power balance, and system flexibility, a mathematical model for regional power grid transmitting flexible power externally is proposed. Compare with the traditional models, this model focuses more on flexibility rather than economy. The case analysis based on the improved IEEE 30-Bus System verifies the feasibility and effectiveness of the proposed strategy and its advantages over the traditional models.

This paper proposes an AI-based approach to overcome the limitations of the SHM system in measuring global stress with limited sensors. Feature elements are selected based on correlation analysis among finite elements and used as stress-measured points. An ANN is used to establish the solution relationship between the feature and correlation elements. The proposed method is applied to the connector structure of an offshore platform, and an optimal ANN is established to optimize accuracy by considering factors like the number of sensors, neural network framework, and convergence criteria. The accuracy of the ANN is verified through a real-scale model test, demonstrating 93.6% accuracy. This technology represents a significant advancement, enhancing the practicality of the structural health monitoring (SHM) system from “point monitoring" to “field monitoring".

The process of shock wave focusing can make the strength of shock waves be continuously accumulated and turned into detonation wave in Pulse Detonation Engine (PDE). However, its effective application needs the inlet jets be in high temperature and velocity, which is difficult to be satisfied under certain conditions. Therefore, in this paper, metal magnesium assisted detonation initiation is proposed and the effect of magnesium particle addition on the shock wave focusing process in a kerosene-fueled PDE with cavity configuration is investigated through numerical simulation. The result showed that when the temperature of the premixed fuel/air jets injected in opposite direction was set as 650 K, the collision of leading shock waves on the central axis was the main source of energy deposition and the shock wave focusing could make the detonation be initiated in the cavity. When the temperature of jets is reduced to 550 K, fuel ignition and detonation could not be achieved through shock wave focusing. Then adding metal magnesium particles into the combustor made the energy deposition be enhanced and the detonation be induced. The diffusion of metal particles can significantly change the structure, motion, merging and dissipation of vortices in the flow field. Generally, the shock wave focusing process is basically not affected with metal particles injection. Therefore, this method can be successfully employed for detonation initiation in the cavity when the fuel/air premixed jet temperature is not high for PDE.

Magnesium ions play an important immune-regulatory role during bone repair. For this study, we prepared micro-nano bioactive glass containing magnesium, which can release magnesium, silicon, and calcium ions and has a positive impact on osteogenic differentiation and vascular regeneration. In this study, MgMNBG was compounded and combined with PLGA and PCL for 3D printing. Afterwards, the physicochemical properties and bone repair performance of the scaffolds were evaluated through in vitro and in vivo experiments. We also investigated the effects of MgMNBG on osteogenic differentiation, immune regulation, and vascular regeneration. The results showed that MgMNBG can inhibit inflammation and promote osteogenesis and angiogenesis by regulating macrophages. PLGA/PCL/MgMNBG scaffolds have good osteogenic and angiogenic effects, and the composite scaffolds have excellent bone repair performance and potential application value.

In order to formulate a reasonable water input model for cotton fields in southern Xinjiang, scientific and rational fertilization, reduce soil carbon leaching, and improve soil carbon sequestration capacity, the undisturbed soil column leaching test was used to simulate the current field management method in the study area. Two methods of drip irrigation and flood irrigation were set up, and three irrigation and three nitrogen fertilizer levels were used to carry out the undisturbed soil column leaching test. The results showed that the amount and mode of water and nitrogen input affected the distribution and leaching loss of organic carbon and inorganic carbon in soil. When the nitrogen application rate increased from 270 kg·hm-2 to 450 kg·hm-2, the leaching loss of soluble organic carbon and soluble inorganic carbon increased significantly. When the water input increased from 6000 m3·hm-2 to 9000 m3·hm-2, the leaching loss of DOC and DIC increased significantly. The carbon leaching loss under drip irrigation was higher than that under flood irrigation. The leaching rates of DOC and DIC were the fastest under the conditions of high water ( 9000 m3·hm-2 ) and high fertilizer ( 450 kg·hm-2 ). It shows that water and nitrogen input and irrigation methods are important factors affecting soil carbon leaching. In the case of excessive water input, long-term high-frequency irrigation is the main factor affecting carbon leaching.

Modelling both long and short-term user interests from historical data is crucial for accurate recommendations. However, unifying these metrics across multiple application domains can be challenging, and existing approaches often rely on complex, intertwined models which can be difficult to interpret. To address this issue, we propose a lightweight, plug-and-play interest enhancement module that fuses interest vectors from two independent models. After analyzing the dataset, we identify deviations in the recommendation performance of long and short-term interest models. To compensate for these differences, we use feature enhancement and loss correction during training. In the fusion process, we explicitly split long-term interest features with longer duration into multiple local features. We then use a shared attention mechanism to fuse multiple local features with short-term interest features to obtain interaction features. To correct for bias between models, we introduce a comparison learning task that monitors the similarity between local features, short-term features, and interaction features. This adaptively reduces the distance between similar features. Our proposed module combines and compares multiple independent long-term and short-term interest models on multiple domain datasets. As a result, it not only accelerates the convergence of the models but also achieves outstanding performance in challenging recommendation scenarios.

Starch being renewable and biodegradable is a viable resource for developing sustainable and environmentally friendly materials. This work explores the potential of starch/Ca2+ gels based on waxy corn starch (WCS), normal corn starch (NCS), and two high-amylose corn starches, G50 (55% amylose content) and G70 (68% amylose content) as flame-retardant adhesives. Being stored at 57% relative humidity for up to 30 days, the G50/Ca2+ and G70/Ca2+ gels are stable without water absorption or retrogradation. The starch gels with increasing amylose content displayed increased cohesion, as reflected by significantly higher tensile strength and fracture energy. All the four starch-based gels show good adhesive properties on corrugated paper. For wooden boards, because of the slow diffusion of the gels, the adhesive abilities are weak initially but improve with storage extension. After storage, the adhesive abilities of the starch-based gels are almost the same except for G70/Ca2+, which is peeled off from the wood surface by itself. Moreover, all the starch/Ca2+ gels exhibit excellent flame retardancy with limiting oxygen index (LOI) values all around 60. This work demonstrates a facile method to prepare starch-based flame-retardant adhesives simply by gelating starch with a CaCl2 solution, which can be used in paper or wood products.

Pulmonary fibrosis is a chronic, progressive and fatal disease of the interstitial lung， there still lack of efficient therapy to reverse the prognosis of patients currently. In this study, a fucoidan from Costaria costata was isolated and its anti-idiopathic fibrosis activity was investigated both in vitro and in vivo. The chemical composition analysis results show that Costaria costata polysaccharide (CCP) is consisting of galactose and fucose as the main monosaccharides with a sulfate group content of 18.54%. The results found that CCP could resist TGF-β1-induced epithelial-mesenchymal transition (EMT) in A549 cells by inhibiting the TGF-β/Smad and PI3K/AKT/mTOR signaling pathways. In vivo data found that CCP treatment alleviated bleomycin (BLM)-stimulated fibrosis and inflammation in mice lung tissue. This study suggests that CCP could protect the lung from fibrosis by relieving the EMT process and inflammation in lung cells.

Soil enzyme activity can be affected by both production and degradation, as enzymes can be degraded by proteases. However, the impact of nutrient addition on enzyme activity is often solely attributed to changes in enzyme production without fully considering degradation. Here, we demonstrated that the activities of β-1,4-glucosidase (BG), β-D-cellobiohydrolase (CBH), β-1,4-Xylosidase (BX), and β-1,4-N-acetyl-glucosaminnidase (NAG) were comparable in nitrogen (N) and phosphorus (P) fertilized soils and the unfertilized control under field conditions, but the reduction in activity was substantially greater in the fertilized soils during short-term laboratory incubation. The results show that the interruption of the natural, continuous supply of organic matter or non-soil microbial-derived enzymes, which typically occurs under field conditions, leads to a more significant reduction in apparent enzyme activities in fertilized soils compared to unfertilized control. This may be attributed to the higher abundance of protease in fertilized soils, resulting in faster enzyme degradation. Interestingly, P fertilization alone did not have a similar effect, indicating that N fertilization is likely the main cause of the larger decreases in enzyme activity during incubation in fertilized soils compared to unfertilized control soils, despite our study site being poor in P and rich in N. These findings highlight the importance of considering enzyme degradation when investigating material dynamics in forest ecosystems, including the impact of nutrient addition on enzyme activity, as enzyme production alone may not fully explain changes in apparent enzyme activity.

In recent years, with the rapid development of technology, artificial intelligence(AI) security issues represented by adversarial sample attack have aroused widespread concern in society. Adversarial samples are often generated by surrogate models and then transfer to attack the target model, and most AI models in real-world scenarios belong to black boxes, thus transferability becomes a key factor to measure the quality of adversarial samples. The traditional method relies on the decision boundary of the classifier and takes the boundary crossing as the only judgment metric without considering the probability distribution of the sample itself, which results in an irregular way of adding perturbations to the adversarial sample, an unclear path of generation, and a lack of transferability and interpretability. In the probabilistic generative model, after learning the probability distribution of the samples, a random term can be added to the sampling to gradually transform the noise into a new independent and identically distributed sample. Inspired by this idea, we believe that by removing the random term, the adversarial sample generation process can be regarded as static sampling of the probabilistic generative model, which guides the adversarial samples out of the original probability distribution and into the target probability distribution, and helps to improve transferability and interpretability. Therefore, we propose a Score Matching-Based Attack(SMBA) method to perform the adversarial sample attacks by manipulating the probability distribution of the samples, which can show good transferability in the face of different datasets and models, and give reasonable explanations from the perspective of mathematical theory and feature space. In conclusion, our research establishes a bridge between probabilistic generative models and adversarial samples, provides a new entry angle for the study of adversarial samples, and brings new thinking to AI security.

The Internet of Vehicles (IoV) is an emerging field that has attracted significant attention due to its potential to transform transportation and mobility. IoV enables the development of new services and applications that can improve transportation systems' efficiency, safety, and sustainability. However, ensuring secure and trustworthy communication among the different components of an IoV system is a critical challenge that needs to be addressed. This paper proposes a blockchain-enabled communication framework for secure and trustworthy IoV applications. The proposed framework leverages the security and decentralization features of blockchain technology to provide secure communication channels for different components of the IoV system, including vehicles, infrastructure, and service providers. The proposed framework provides an identity management system to authenticate and authorize users and devices, thereby preventing unauthorized access and data breaches. To evaluate the effectiveness of the proposed framework, we conducted experiments using a real-world IoV scenario, and the results demonstrate that the proposed framework can provide secure and trustworthy communication for IoV applications. The proposed blockchain-enabled communication framework offers a promising approach to address the security and trust challenges in IoV communication systems.

A rapid and efficient method using an alkyl functionalized magnetic nanoparticles-based extraction technique combined with Ultra-High Performance Liquid Chromatography was developed for the detection of trace amounts of polycystic aromatic hydrocarbons in tea leaves. As a popular coating for chromatographic column packing materials, C18-alkyl has been demonstrated to be effective in separating polycystic aromatic hydrocarbons. And the magnetism of the nanomaterials accelerates the extraction process while their high surface ratio enables desirable dispersity in the sample matrix. Meanwhile, the adsorbents can be washed and reused 30 times without compromise on recovery, which greatly reduced the budget. The effects of various parameters were investigated and optimized, and the recoveries for five analytes were in the range of 84.8–103.7%. The reproducibility rate of intra-day and inter-day were below 7.1% and 11.3% respectively. The limits of detection and limits of quantification ranged from 1.69–9.97 ng g-1 and 5.12–30.21 ng g-1, indicating satisfactory sensitivity. Thus, the proposed methodology is rapid, highly efficient, and economical, and it expands the application of magnetic cleanup approaches in complex food matrices.

To determine promethazine (PMZ) and its metabolites promethazine sulfoxide (PMZSO) and monodesmethyl-promethazine (Nor1PMZ) in swine muscle, fat, kidney, and liver, a sample preparation and high-performance liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis method were established and validated. The sample was extracted with 0.1% formic acid-acetonitrile, and the extract was purified with acetonitrile-saturated n-hexane. After concentration by rotary evaporation, the extract was re-dissolved in 0.1% formic acid-water and acetonitrile (80:20, v/v). The HPLC-MS/MS column used was a Waters Symmetry C18 (100 mm × 2.1 mm i.d., 3.5 μm), with 0.1% formic acid-water and acetonitrile as the mobile phase, and the target compounds were determined by positive ion scan and multiple reaction monitoring. PMZ and Nor1PMZ were quantified with deuterated promethazine (PMZ-d6) as the internal standard, while PMZSO was quantified by external standard method. The limits of detection (LOD) and limits of quantification (LOQ) of PMZ and PMZSO in muscle, liver, and kidney spiked samples were 0.05 μg/kg and 0.1 μg/kg, respectively, while those of Nor1PMZ were 0.1 μg/kg and 0.5 μg/kg, respectively. The LOD and LOQ of analytes in fat spiked sample were 0.05 μg/kg and 0.1 μg/kg, respectively. The sensitivity of this method reaches or exceeds its presented in previous reports. The analytes PMZ and PMZSO showed good linearity within the range of 0.1 μg/kg to 50 μg/kg, while Nor1PMZ showed good linearity within the range of 0.5 μg/kg to 50 μg/kg, with correlation coefficients (r) greater than 0.99. The recoveries of the target compounds in the sam-ples were between 81.73% and 107.17%, and the precision ranged from 1.78% to 10.47%. This study developed for the first time an HPLC-MS/MS method for the determination of PMZ and its metabolites PMZSO and Nor1PMZ in four swine edible tissues, comprehensively covered target tissues of monitoring object, which is applicable for monitoring veterinary drug residues in ani-mal-derived foods and ensuring food safety.

Underwater wireless optical communication (UWOC) is acknowledged as a useful way to transmit data in ocean for short distance application. Carrying UWOC device on mobile platform is quite practical in ocean engineering, which is helpful to exploit its advantages. In application, such platform needs camera to observe surroundings and guide its action. Since the majority of ocean is always dark, active illumination is necessary to imaging. Once UWOC worked in such environment, its performance is affected by the illumination light noise. In this paper, we study the influence of underwater LED illumination on bidirectional UWOC with Monte Carlo method. We simulate forward noise from the LED illumination to the opposite receiver in the cooperative terminal, and the backscattering noise on the adjacent receiver in the same terminal. The results show that the forward noise is reduced with the increase of absorption coefficient, scattering coefficient, transmitting distance, and separated distance between receiver and the optical axis of LED. But it becomes greater with FOV of receiver. The backscattering noise is reduced with the increase of absorption coefficient and separated distance between receiver and LED. But it becomes greater with FOV and scattering coefficient, while it has little relation with transmitting distance. In order to reduce such two kind noises, besides inserting optical filter in the receivers and narrow their field, the optical axis of LED light should keep away from the receivers. The results in this paper is helpful for UWOC application.

Different inlet structures have a significant impact on the internal flow characteristics of a solid-magnesium powder water ramjet engine. Based on the magnesium-water reaction model, a computational fluid dynamics (CFD) method is applied to establish a numerical simulation method for the internal flow field of the engine, and the internal flow characteristics of the engine under different inlet structure conditions are studied. The simulation results show that high-temperature gas can effectively promote the ignition of magnesium powder at the top of the combustion chamber, while accelerating the evaporation of the first inlet water and increasing the combustion rate of magnesium powder. The secondary inlet has the most significant effect on the temperature inside the combustion chamber. When the secondary inlet flow rate increases towards the top of the combustion chamber, it increases the amount of heat absorbed by the evaporating water at the top of the chamber, thereby reducing the temperature at the top of the combustion chamber. However, when the flow rate is low, it results in insufficient oxidizer at the top of the combustion chamber, which is unfavorable for the combustion of magnesium powder.

Solid oxide cells are capable of efficiently converting various chemical energy carriers to electricity and vice versa. The urgent challenge nowadays is the faster degradation rate compared with other fuel cell/electrolyzer technologies. To understand the degradation mechanisms, simulation of a solid oxide cell is helpful. Since most previous research developed models using commercial software, such as COMSOL and ANSYS Fluent, a gap for knowledge transfer is being gradually formed between academia and industry due to licensing issues. This paper introduces a multiphysics model, developed by a computational code, openFuelCell2. The code is implemented with an open-source library, OpenFOAM. It accounts for momentum transfer, mass transfer, electrochemical reactions and metal interconnect oxidation. The model can precisely predict I-V curves under different temperatures, fuel humidity and operation modes. Comparison between OpenFOAM and COMSOL simulations shows good agreement. The metal interconnect oxidation is modelled, which can predict the thickness of the oxide scale under different protective coatings. Simulations are conducted by assuming an ultra-thin film resistance on the rib surface. It is revealed that coatings fabricated by atmospheric plasma spraying can efficiently prevent metal interconnect oxidation, with a contribution of only 0.53 \% to the total degradation rate.

After long years of development, the technology of analyzing the working condition of power units based on vibration signals has had relatively stable applications, but the accuracy and the degree of automation and intelligence for fault diagnosis are still inadequate due to the limitations of the current development of key technologies. With the development of big data and artificial intelligence technology, the involvement of new technologies will be an important boost to the development of this field. To support the subsequent research, bibliometrics is used as a tool to sort out the development of the technology in this field at the macro level; at the micro level, the classical and key literature is studied to grasp the development status at the technical level and prepare for the selection of entry points to continue in-depth innovation afterwards.

Cigar stacking fermentation is a key step in tobacco aroma enhancement and miscellaneous gas reduction, which both have a great influence on increasing cigar flavor and improving industrial availability. To analyze the effect of cigar tobacco leaf (CTLs) microbial community structure on volatiles during cigar stacking fermentation, this study used multi-omics technology to reveal the changes in microbial community structure and volatiles of different cigar varieties during stacking fermentation, in addition to exploring the interaction mechanism of microbiome and volatiles. The results showed that the dominant microbial compositions of different CTL varieties during stacking fermentation were similar, which included Staphylococcus, Corynebacterium 1, Aerococcus, and Aspergillus. These dominant microbes mainly affected the microbial community structure and characteristic microorganisms of CTLs through microbial interactions, thereby influencing the transformation of volatiles. Characteristic microorganisms of different CTLs varieties such as Trichothecium, Trichosporon, Thioalkalicoccus and Jeotgalicoccus, were found to posively correlate with characteristic volatiles like megastigmatrienone 4, pyrazine, tetramethyl-, geranyl acetone, and 2-undecanone, 6,10-dimethyl-, respectively. This in turn affected the aroma and sensory quality of the CTLs. This study provides theoretical support for the analysis of the mechanism of microorganisms on volatiles and aroma, and development of microbial agents during cigar stacking fermentation.

Lyme disease (LD) is a tick-transmitted infection caused by Borrelia burgdorferi sensu lato species which includes B. burgdorferi, B. afzelii, and B. garinii. The majority of patients with early LD can be cured by standard treatment, yet some still suffer from post-treatment Lyme disease syndrome (PTLDS). The presence of Borrelia persisters has been proposed as a contributing factor, which cannnot be completely killed by the currently used antibiotics for Lyme disease. Finding new pharmaceuticals targeting Borrelia persisters is crucial in developing more effective treatment. Here, we first confirmed the existence of persisters in cultures of B. garinii and B. afzelii and then conducted high-throughput screening of a custom drug library against persister-rich stationary-phase cultures of B. garinii and B. afzelii. Among 2427 compounds screened, hypocrellin A (HA), anthracycline class of drugs, and topical antibiotics along with some other natural compounds were identified to have strong potential in killing persisters of B. garinii and B. afzelii. HA was the most active anti-Borrelia compound, capable of eradicating stationary-phase Borrelia persisters, in particular when combined with doxycycline and/or ceftriaxone. Liposoluble antioxidant vitamin E was found to antagonize the activity of HA, indicating HA’s target is the cell membrane where HA-triggered reactive oxygen species (ROS) generation took place in the presence of light. HA was found to have distinct bactericidal activity against Borrelia species but had poor or no activity against Gram-positive and Gram-negative bacteria. Identification of the above-mentioned drug candidates may help to develop more effective therapies for LD.

Purpose: To construct a hidden Markov model (HMM) for vigilance assessment to improve the real-time performance and accuracy of current vigilance measurement. Methods: ECG signal was collected by sensors, while the noise and baseline drift was eliminated from the original ECG signal. 10 volunteers were randomly selected. Their heart rate variability (HRV) were measured and trained parameters of the modified Hidden Markov model for vigilance assessment. Then, these data were collected to optimize using the Baum-Welch algorithm and obtained the state transition probability matrix A ̂ and the observation probability matrix B ̂. Finally, the data of three volunteers with different transition patterns of mental state were selected randomly and used the Viterbi algorithm to find the optimal state, which compared with the actual state. Results: The constructed vigilance assessment model had a high accuracy rate the accuracy rate of data prediction for these three volunteers exceeded 80%. Conclusion: The Hidden Markov model for vigilance assessment can accurately predict the vigilance level and indicate broad application prospects.

Heavy metals are toxic, persistent and non-degradable. After sedimentation and adsorption, they accumulate in water sediments. The aim of this study was to understand the heavy metal pollution of Qinjiang River sediments on the ecological environment and apportioning sources. The mean total concentrations of Mn, Zn, Cr, Cu, and Pb are 3.14, 2.33, 1.39, 5.79, and 1.33 times higher than the background values, respectively, except for the Co, Ni, and Cd, which are lower than the background values; Fe, Co, Ni, Cd, Cr, Cu, and Pb are all primarily in the residual state, while Mn and Zn are primarily in the acid-soluble and oxidizable states, respectively. Igeo, RI, SQGs and RAC together indicate that the pollution status and ecological risk of heavy metals in Qinjiang River sediments are generally moderate; among them, Fe, Co, Ni, Cd, Cr, and Pb are not harmful to the ecological environment of the Qinjiang River. Cu is not readily released because of its higher residual composition, depicting that Cu is less harmful to the ecological environment. Mn and Zn, as the primary pollution factors of the Qinjiang River, are harmful to the ecological environment. This heavy metal pollution in surface sediments of the Qinjiang River primarily comes from manganese and zinc ore mining. Manganese carbonate and its weathered secondary manganese oxide are frequently associated with a significant amount of residual copper and Cd, as a higher pH is suitable for the deposition and enrichment of these heavy metals. Lead-zinc ore and its weathering products form organic compounds with residual Fe, Co, Cr, and Ni, and their content is related to salinity. The risk assessment results of heavy metals in sediments provide an important theoretical basis for the prevention and control of heavy metal pollution in Qinjiang River.

We experimentally demonstrate enhanced spectral broadening of femtosecond optical pulses after propagation through silicon-on-insulator (SOI) nanowire waveguides integrated with two-dimensional (2D) graphene oxide (GO) films. Owing to the strong mode overlap between the SOI nanowires and the GO films with a high Kerr nonlinearity, the self-phase modulation (SPM) process in the hybrid waveguides is significantly enhanced, resulting in greatly improved spectral broadening of the femtosecond optical pulses. A solution-based, transfer-free coating method is used to integrate GO films onto the SOI nanowires with precise control of the film thickness. Detailed SPM measurements using femtosecond optical pulses are carried out, achieving a broadening factor of up to ~4.3 for a device with 0.4-mm-long, 2 layers of GO. By fitting the experimental results with theory, we obtain an improvement in the waveguide nonlinear parameter by a factor of ~3.5 and the effective nonlinear figure of merit (FOM) by a factor of ~3.8, relative to the uncoated waveguide. Finally, we discuss the influence of GO film length on the spectral broadening and compare the nonlinear optical performance of different integrated waveguides coated with GO films. These results confirm the improved nonlinear optical performance for silicon devices integrated with 2D GO films.

The three-phase separator was perforated after four years’ service. The perforation position is at the bottom of the vessel under the baffle plate in an oil transfer station. The cause of perforation was investigated by chemical analysis using a direct-reading spectrometer, microstructure examined by optical microscope(OM), and lab simulated corrosion experiments by electrochemical workstation, and the corrosion products examined with scanning electron microscopy(SEM), energy dispersive spectrometer(EDS) in this paper. The analyses indicated that the coating at the base of the pressure vessel failed and this led to the direct exposure of the carbon steel plate to the corrosive medium. The electrical contact between the carbon steel and the stainless steel, sets up a galvanic cell that accelerated the corrosion of the pressure vessel which eventually led leads to the perforation.

MicroRNAs (miRNAs) are a class of small non-coding RNAs, which function as regulators of gene expression and contribute in numerous physiological processes. However, little is known referring to miRNAs function in insect chemosensation. In the current study, nine small RNA libraries were constructed and sequenced from the antennae of nymphs, adult males and females of Apolygus lucorum. In total, 399 miRNAs were identified including 275 known and 124 novel miRNAs. Known miRNAs were classified into 71 families, amongst which, 23 families were insect-specific. Expression profile analysis showed that miR-7-5p_1 was the most abundant miRNAs in the antennae of A. lucorum. Altogether, 69708 target genes related to biogenesis, membrane and binding activities were predicted for 399 miRNAs. Particularly, 15 miRNAs were found to target 16 olfactory genes. These miRNAs could be involved in regulation of olfactory-associated genes ex-pression. Comparing the antennae of nymphs, adult males and females, 94 miRNAs were found to be differentially expressed. The expression levels of some differentially expressed miRNAs measured by qPCR were consistent with sequencing results. This study provides a global miRNAs transcriptome in the antennae of A. lucorum and valuable information for further investigation on miRNA-mRNA interactions, especially the functions of miRNAs in regulating chemosensation.

The purpose of this work is to study quasi-stationary wave structure in the mid-latitude stratosphere and mesosphere (40–50°N) and its role in the formation of the annual ozone cycle. Geopotential height and ozone from Aura MLS data are used and winter climatology for January–February 2011–2020 is considered. More closely examined is the 10-degree longitude segment centered on Longfengshan Brewer station, China, and located in the region of the Aleutian Low influence associated with the quasi-stationary zonal maximum of total ozone. Annual and semi-annual oscillations in ozone were compared using units of ozone volume mixing ratio and concentration, as well as changes in ozone peak altitude and in time series of ozone at individual pressure levels between 316 hPa (9 km) and 0.001 hPa (96 km). The ozone maximum in the vertical profile is higher in volume mixing ratio (VMR) values than in concentration by about 15 km (5 km) in the stratosphere (mesosphere), in consistency with some previous studies. We found that the properties of the annual cycle are better resolved in the altitude range of the main ozone maximum: middle–upper stratosphere in VMR and lower stratosphere in concentration. Both approaches reveal SAO/AO-related changes in the of ozone peak altitudes in a range of 4–6 km during the year. In the lower-stratospheric ozone of the Longfengshan domain, an earlier development of the annual cycle takes place with a maximum in February and a minimum in August compared to spring and autumn, respectively, in zonal means. This is presumably due to the higher rate of dynamical ozone accumulation in the region of the quasi-stationary zonal ozone maximum. The “no-annual-cycle” transition layers are found in the stratosphere and mesosphere. These layers with undisturbed ozone volume mixing ratio throughout the year are of interest for more detailed future study.

A partial aperture onboard calibration method can solve the onboard calibration problems of some large aperture remote sensors, which is of great significance for the development trend of increasingly large apertures in optical remote sensors. In this paper, the solar diffuser reflectance degradation monitor (SDRDM) in the onboard calibration assembly (CA) of the FengYun-4 (FY-4) advanced geostationary radiance imager (AGRI) is used as the reference radiometer for measuring the partial aperture factor (PAF) for the AGRI onboard calibration. First, the linear response count variation relationship between the two is established under the same radiance source input. Then, according to the known bidirectional reflection distribution function (BRDF) of the solar diffuser (SD) in the CA, the relative reflectance ratio coefficient between the AGRI observation direction and the SDRDM observation direction is calculated. On this basis, the response count value of the AGRI and the SDRDM is used to realize the high-precision measurement of the PAF of the AGRI B1 ~ B3 bands by simulating the AGRI onboard calibration measurement under the illumination of a solar simulator in the laboratory. According to the determination process of the relevant parameters of the PAF, the measurement uncertainty of the PAF is analyzed; this uncertainty is better than 2.04% and provides an important reference for the evaluation of the onboard absolute radiometric calibration uncertainty after launch.

Genome-scale metabolic models (GEMs) have been widely used for phenotypic prediction of microorganisms. However, the lack of other constraints in the stoichiometric model often leads to a large metabolic solution space inaccessible. Inspired by previous studies that take allocation of macromolecule resources into account, we developed a simplified Python-based workflow for constructing enzymatic constrained metabolic network model (ECMpy) and constructed an enzyme-constrained model for Escherichia coli (eciML1515) by directly adding a total enzyme amount constraint in the latest version of GEM for E. coli (iML1515), considering the protein subunit composition in the reaction, and automated calibration of enzyme kinetic parameters. Using eciML1515, we predicted the overflow metabolism of E. coli and revealed that redox balance was the key reason for the difference between E. coli and Saccharomyces cerevisiae in overflow metabolism. The growth rate predictions on 24 single-carbon sources were improved significantly when compared with other enzyme-constrained models of E. coli. Finally, we revealed the tradeoff between enzyme usage efficiency and biomass yield by exploring the metabolic behaviors under different substrate consumption rates. Enzyme-constrained models can improve simulation accuracy and thus can predict cellular phenotypes under various genetic perturbations more precisely, providing reliable guidance for metabolic engineering.

Nitric oxide (NO) is a key molecule in cardiovascular homeostasis and its abnormal delivery is highly associated with the occurrence and development of cardiovascular disease (CVD). The assessment and manipulation of NO delivery is crucial to the diagnosis and therapy of CVD, such as endothelial dysfunction, atherosclerotic progression, pulmonary hypertension, and cardiovascular manifestations of Coronavirus (COVID-19). However, due to the low concentration and fast reaction characteristics of NO in cardiovascular system, the clinical applications centered on the NO delivery are challenging. In this tutorial review, we first summarized the methods to estimate the in vivo NO delivery process based on the clinical images and mathematical modeling to assess the endothelial function and vulnerability of atherosclerotic plaque. Then, the emerging bioimaging technologies that have the potential to directly measure the arterial NO concentration were discussed, including the Raman spectroscopy and electrochemical sensor. Aside from the diagnostic methods, therapies aimed at controlling NO delivery to regulate CVD were reviewed, including the inhaled NO therapy to treat the pulmonary hypertension and COVID-19, stem cell therapy and NO-releasing platform to treat endothelial dysfunction and atherosclerosis.

The task of unsupervised anomalous sound detection (ASD) is challenging for detecting anomalous sounds from a large audio database without any annotated anomalous training data. Many unsupervised methods were proposed, but previous works have confirmed that the classification-based models far exceeds the unsupervised models in ASD. In this paper, we adopt two classification-based anomaly detection models: (1) Outlier classifier is to distinguish anomalous sounds or outliers from the normal; (2) ID classifier identifies anomalies using both the confidence of classification and the similarity of hidden embeddings. We conduct experiments in task 2 of DCASE 2020 challenge, and our ensemble method achieves an averaged area under the curve (AUC) of 95.82% and averaged partial AUC (pAUC) of 92.32%, which outperforms the state-of-the-art models.

CO₂ enhanced oil recovery (EOR) has been proven its capability to explore the unconventional tight oil reservoirs and potential for geological carbon storage. Meanwhile, the extremely low permeability pores exaggerate the difficulty CO₂ EOR and geological storage processing in the actual field. This paper initiates the ultrasonic-assisted approach to facilitate the oil-gas miscibility development and finally contribute to unlock more tight oils. First, the physical properties of crude oil with and without ultrasonic treatments were experimentally analysed through gas chromatography (GC), Fourier-transform infrared spectroscopy (FTIR) and viscometer. Second, the oil-gas minimum miscibility pressures (MMPs) were measured from the slim-tube test and the miscibility developments with and without ultrasonic treatments were interpreted from the mixing-cell method. Third, the nuclear-magnetic resonance (NMR) assisted coreflood tests were conducted to physically model the recovery process in porous media and directly obtain the recovery factor. Basically, the ultrasonic treatment (40KHz and 200W for 8 hours) was found to substantially change the oil properties, with viscosity (at 60°C) reduced from 4.1 to 2.8mPa·s, contents of resin and asphaltene decreased from 27.94% and 6.03% to 14.2% and 3.79%, respectively. The FTIR spectrum shows the unsaturated C-H bond, C-O bond and C≡C bond in macromolecules were broken from ultrasonic, which caused the macromolecules (e.g., resin and asphaltenes) to be decomposed into smaller carbon-number molecules. Accordingly, the MMP was determined to be reduced from 15.8 to 14.9MPa from the slim-tube test and the oil recovery factor increased by over 10%. This study reveals the mechanisms of ultrasonic-assisted CO₂ miscible EOR in producing tight oils.

We demonstrate a compact 4x4 wavelength selective switch with 50 % fewer electrical pads as compared with our previous generation. We report loss and crosstalk for different paths of the switch. We measure median loss of 5.32 dB and worst case crosstalk of -35 dB. The microring resonators tune by more than one free spectral range, which is an improvement over our previous generation of switches. This switch can support 8 channels at 400 GHz spacing. We conclude that it is not possible to drive both microring resonators with the same voltage and separate control is required because of fabrication variation of the current technology.

The accuracy of wind field simulation and prediction is one of the most significant parameters in the field of atmospheric science and wind energy. Limited by the observation data, there are few researches on wind energy development. A 3D Doppler wind lidar (DWL) providing the high-vertical-resolution wind data over the urban complex underlying surface in February 2018 was employed to evaluated the accuracy of vertical wind field simulation systematically for the first time. 11 PBL schemes of the Weather Research and Forecasting Model (WRF) were employed in simulation. The model results were evaluated in groups separated by weather (sunny days, haze days and windy days), observation height layers, and various observation wind speeds. The test results presented that the vertical layer altitude of the observation point position was the most important factor. The simulation is fairly well at a height of 1000-2000m, as most of the relative mean bias of wind speed and wind direction are less than 20% and 6% respectively. Below 1000 m, the wind speed and direction biases are about 30%-150% m.s-1 and 6%-30% respectively. Moreover, when the observed wind speed was lower than 5 m.s-1, the bias were usually large, and the wind speed relative mean bias is up to 50-300%. In addition, the accuracy of simulated wind profile is better in 10-15m.s-1 than other speed ranges, and is better up 1000m than below 1000m in the boundary layer. We see that the WRF boundary layer schemes have different applicability to different weather conditions. The WRF boundary layer schemes have significant differences in wind field simulation with larger error under the complex topography. A PBL scheme is not likely to maintain its advantages in the long term under different conditions including altitude and weather conditions.

Recently, ice with the stacking disorder structure, consisting of random sequences of cubic ice (Ic) and hexagonal ice (Ih) layers, is reported to be more stable than pure Ih/Ic. While, due to a much lower free energy barrier of heterogeneous nucleation, in practice, the freezing process of water is usually controlled by heterogeneous nucleation which is triggered by an external medium. Herein, molecular dynamic simulations were carried out to explore the polymorph dependence of ice on the lattice structure of substrates. It turns out that, during the nucleation stage, the polymorph of ice nuclei can be severely altered by the graphene substrate, on which the Ih was found to occupy an absolute majority in new-formed ice. This can be attributed to the structure similarity between graphene and basal face of Ih. Besides the nucleation stage, our results suggest that the substrate can not affect the polymorph of ice which is far from the graphene surface. The polymorph selectivity of graphene to Ih will diminish with the growth of ice layer.

The influence of the Fe2O3 addition amount on the dephosphorization of hot metal at 1623 K with the slag of the low basicity (CaO/SiO2) of about 1.5 was investigated by using high-temperature laboratorial experiments. With increasing the Fe2O3 addition amount, the contents of [C], [Si], [Mn] and [P] in hot metal at the end of dephosphorization decrease, and the corresponding removal ratios increase. The P2O5 content in slag increases, and the CaO and SiO2 contents in slag decrease. The phosphorus mainly exists in the form of the nCa2SiO4-Ca3(PO4)2 solid solution in the phosphorus-rich phase and the value of coefficient n decreases from 20 to 1 with increasing the Fe2O3 addition amount from 5 g to 30 g. With increasing the Fe2O3 addition amount, the oxygen potential and activity at the interface between the slag and hot metal increase. When the oxygen potential and the oxygen activity at the interface are greater than 0.72×10-12 and 7.1×10-3, respectively, the dephosphorization ratio begins to increase rapidly. With increasing the Fe2O3 addition amount to 30 g, the ratio of the Fe2O3 addition amount to theoretical calculation consumption is around 175%, and the dephosphorization ratio reaches the highest value of 83.3%.

Dipeptidyl peptidase (DPP) 9, DPP8, DPP4 and fibroblast activation protein (FAP) are the four enzymatically active members of the S9b protease family. Associations of DPP9 with human liver cancer, exonic single nucleotide polymorphisms (SNPs) in DPP9 and loss of function (LoF) variants have not been explored. Human genomic databases including The Cancer Genome Atlas (TCGA) were interrogated to identify DPP9 LoF variants and associated cancers. Survival and gene signature analyses were performed on hepatocellular carcinoma (HCC) data. We found that DPP9 and DPP8 are intolerant to LoF variants. DPP9 LoF variants were most often associated with uterine carcinoma. Two DPP9 intronic SNPs that have been associated with lung fibrosis and COVID-19 were not associated with liver fibrosis or cancer. All four DPP4-like genes were overexpressed in liver tumours and their joint high expression was associated with poor survival in HCC. Increased DPP9 expression was associated with obesity in HCC patients.. High expression of genes that positively correlated with overexpression of DPP4, DPP8, and DPP9 were associated with very poor survival in HCC. Enriched pathways analysis of these positively correlated genes featured Toll-like receptor and SUMOylation pathways. This comprehensive data mining suggests that DPP9 is essential for human survival and the DPP4 protease family is important in cancer pathogenesis.

Electrical remodelling as a result of the homeodomain transcription factor 2 (Pitx2)‐dependent gene regulation was linked to atrial fibrillation (AF) and AF patients with single nucleotide polymorphisms at chromosome 4q25 responded favorably to Class I antiarrhythmic drugs (AADs). The possible reasons behind this remain elusive. The purpose of this study was to assess the efficacy of AADs disopyramide, quinidine, and propafenone on human atrial arrhythmias mediated by Pitx2-induced remodelling, from a single cell to the tissue level, using drug binding models with multi-channel pharmacology. Experimentally calibrated populations of human atrial action potential (AP) models in both sinus rhythm (SR) and Pitx2-induced AF conditions were constructed by using two distinct models to represent morphological subtypes of AP. Multi-channel pharmacological effects of disopyramide, quinidine, and propafenone on ionic currents were considered. Simulated results showed that Pitx2-induced remodelling increased maximum upstroke velocity (dVdtmax) and conduction velocity (CV), and decreased AP duration (APD) and wavelength (WL). At the concentrations tested in this study, these AADs decreased dVdtmax and CV and prolonged APD in the setting of Pitx2-induced AF. Our findings of alterations in WL indicated that quinidine and disopyramide may be more effective against Pitx2-induced AF than propafenone by prolonging WL.

Alfalfa (Medicago sativa L.) is a perennial, outcrossing legume crop predominantly grown for hay, silage, or pasture. Intensive selection has resulted in dramatic improvement in fitness traits, including winter survival and disease resistance. However, there has been minimal improvement in other economically important traits, such as hay yield, which is still comparable to 30 years ago. Intensive phenotyping costs on this type of trait hinder high selection pressure to identify superior outcross individuals. Severe inbreeding depression inhibits the development of inbred lines with accumulated favorable alleles that exhibit heterosis. This review highlights the outcomes of inbreeding depression as well as the causes, including unmasking deleterious alleles and triggering self-incompatibility. We tracked the research efforts that unveil the genetic bases underlying deleterious alleles and self-incompatibility. The magnitudes of inbreeding depression were compared with the rate of heterozygous halved time in diploid and tetraploid organisms. To fill in the gaps between the controversy and existing hypotheses, we theorized a dosage dominant model of inheritance. The dosage dominant model is similar to the Mendelian dominance model, in which a genotype exhibits a dominant phenotype if there is a dominant allele (alphabet dominant). The difference is that in the dosage dominant model, a genotype will result in a dominant phenotype if the number of dominant alleles is equal to or greater than the number of recessive alleles. This review also includes a discussion on the development of pseudo inbreds and a hypothesis to identify deleterious alleles using bulked segregant analysis and consequently to purge deleterious alleles using marker-assisted selection, to progress toward the successful development of pure inbred lines in alfalfa.

We theoretically investigate and optimize four-wave mixing (FWM) in silicon nitride (SiN) waveguides integrated with two-dimensional (2D) layered graphene oxide (GO) films. Based on extensive previous measurements of the material parameters of the GO films, we perform detailed analysis for the influence of device parameters including waveguide geometry, GO film thickness, length, and coating position on the FWM conversion efficiency (CE) and conversion bandwidth (CB). The influence of dispersion and photo-thermal changes in the GO films is also discussed. Owing to the strong mode overlap between the SiN waveguides and the highly nonlinear GO films, FWM in the hybrid waveguides can be significantly enhanced. We obtain good agreement with previous experimental results and show that by optimizing the device parameters to balance the trade-off between Kerr nonlinearity and loss, the FWM CE can be improved by as much as ~20.7 dB and the FWM CB can be increased by ~4.4 folds, relative to the uncoated waveguides. These results highlight the significantly enhanced FWM performance that can be achieved in SiN waveguides by integrating 2D layered GO films.

Stormwater management is a key urban issue in the world, in line with the global issues of urban sprawl and climate change. It is urgent to investigate the effectiveness in managing stormwater with different strategies for maintain urban resilience. A method based on a storm water management model (SWMM) was developed for assessing the control of stormwater runoff volume and the percentage removal of suspended solids by implementing a Sponge City strategy. An interdisciplinary approach was adopted incorporating Low Impact Development (LID) with urban Green Infrastructure and Gray Infrastructure paradigms in a typical old residential community in Suzhou, China. Four types of sponge facilities for reducing stormwater runoff were bio-retention cells, permeable pavements, grassed pitches, and stormwater gardens. The simulation results indicate that the stormwater pipe system can meet the management standard for storms with a five-year recurrence interval. The volume capture ratio of annual runoff is 91% and the reduction rate of suspended solids is 56%. This study demonstrates that Sponge City strategy is an effective approach for managing stormwater, particularly in old and densely populated urban areas. Implementing spongy facilities with a LID strategy for stormwater management can significantly enhance urban water resilience and increase ecosystem services.

An experiment was conducted to investigate the role of single nucleotide polymorphisms of the gene RNF34 3′UTR-588 G>A and RNF128 I1-2380C>T with carcass and meat quality traits of Chinese Simmental-cross steers. METHOD: We performed sequencing and restriction enzyme digestion to detect genotypes of RNF34 3′UTR-588 G>A and RNF128 I1-2380C>T. Then, we analyzed the association of novel single nucleotide polymorphisms in intron regions of the RNF128 gene and in the 3′UTR region of RNF34 and meat quality traits of Chinese Simmental-cross steers. RESULTS: Statistical analyses revealed that SNP of RNF128 (I1-2380C>T) was significantly associated with dressed weight, forepaw weight, carcass depth, carcass brisket depth, hind legs length (P<0.05), etc. And RNF34 (3′UTR-588 G>A) were significantly associated with testis weight, kidney weight, tare weight (P<0.05), etc. CONCLUSION: Our findings suggest that polymorphisms in RNF34 and RNF128 might be important genetic factors that influence carcass and meat quality in beef cattle. Thus, they might be useful markers for meat quality traits in future marker-assisted selection programs in beef cattle breeding and production.

Background: The current coronavirus disease 2019 (COVID-19) is spreading globally at an accelerated rate. There is some previous evidence that weather may influence the incidence of COVID-19 infection. We assessed the role of meteorological factors including temperature (T) and relative humidity (RH) considering the concentrations of two air pollutants, inhalable coarse particles (PM10) and nitrogen dioxide (NO2) in the incidence of COVID-19 infections in Finland, located in arctic-subarctic climatic zone. Methods: We retrieved daily counts of COVID-19 in Finland from Jan 1 to May 31, 2020, nationwide and separately for all 21 hospital districts across the country. The meteorological and air quality data were from the monitoring stations nearest to the central district hospital. A quasi-Poisson generalized additional model (GAM) was fitted to estimate the associations between district-specific meteorological factors and the daily counts of COVID-19 during the study period. Sensitivity analyses were conducted to test the robustness of the results. Results: The incidence rate of COVID-19 gradually increased until a peak around April 6 and then decreased. There were no associations between daily temperature and incidence rate of COVID-19. Daily average RH was negatively associated with daily incidence rate of COVID-19 in two hospital districts located inland. No such association was found nationwide. The sensitivity analyses indicate the results are robust. Conclusions: Weather conditions, such as air temperature and relative humidity, may not be important factors affecting the COVID-19 incidence in the arctic and subarctic winter and spring. More evidence is needed on the associations between weather and COVID-19 during different seasons.

Objectives: To investigate the value of early lactate dynamic monitoring index in predicting prognosis of patients with sepsis and septic shock. Methods: We performed our test on 50 patients. Out of 50 patients, 28 are male, and 22 are female. Prospectively studied pediatric patients with septic shock were performed. Vital signs, Lactate clearance, were obtained at presentation 6 h, 12 h, 24 h over the first 48 h of hospitalization. The therapy received, outcome parameters of mortality and duration of hospitalization were recorded. Results: The statistical data and comparative analysis showed that an average of 16.88 days after admission, 5 patients have died, 17 patients are poorly prognosis leaves the hospital, and the remaining 28 are recovered and discharged. The primary outcome variable of mean 16 days hospitalization mortality rate was 10%. Poor prognosis 34% and fully recovery 56 % were observed. In this retrospective cohort study, a lactate level of more than 2.5mmol/L was the best threshold to predict 28-day mortality among severe sepsis and septic shock patients. In our research, we found mean LC 6 h 3.08mmol/L, and after 48 h mean it is 1.79mmol/L. Significant LC 6 h found, which is 8.08mmol/L in the death group patient where 48 h mmol/L shows significant high. Poor prognosis also presents a clinical increase of lactate level high in the LC 6 h analysis, which is 3.32mmol/L. Recovered patients showed a significant improvement after administering treatment depending on the patient organ involvement and good decrease of lactate reports achieved, which is 1.20mmol/L, where admission reports show it was 1.91mmol/L in LC 6 h. Mean Heart rate 94/51mmhg, pulse 119, temperature 39℃, respiratory rate 32.26, and urine output 456 ml recorded during our study. Death patient shows a remarkable detonation of those reports but has a significant clinical report with the recovered patients. Conclusion: The early lactate dynamic monitoring index has a high value in predicting sepsis and septic shock patients' prognosis, thus worth popularizing.

We propose a new approach of extending the laser filament plasma channel. By adding a circular aperture quartz plate before the focusing lens, the extension of the plasma channel is doubled. The effects of different diameters, thicknesses of the circular aperture quartz plate and different pulse energies on the length of the plasma channel were investigated. The experimental results show that the thickness of the quartz plate and the depth of the hole have little effects on the plasma channel of the filament, and the diameter of the hole in the center of the quartz plate has a significant effect on the length of the optical filament. The moving-focus model is used to explain the extension of the optical filament.

Layered two-dimensional (2D) GO films are integrated with silicon-on-insulator (SOI) nanowire waveguides to experimentally demonstrate an enhanced Kerr nonlinearity, observed through self-phase modulation (SPM). The GO films are integrated with SOI nanowires using a large-area, transfer-free, layer-by-layer coating method that yields precise control of the film thickness. The film placement and coating length are controlled by opening windows in the silica cladding of the SOI nanowires. Owing to the strong mode overlap between the SOI nanowires and the highly nonlinear GO films, the Kerr nonlinearity of the hybrid waveguides is significantly enhanced. Detailed SPM measurements using picosecond optical pulses show significant spectral broadening enhancement for SOI nanowires coated with 2.2-mm-long films of 1−3 layers of GO, and 0.4-mm-long films with 5−20 layers of GO. By fitting the experimental results with theory, the dependence of GO’s n₂ on layer number and pulse energy is obtained, showing interesting physical insights and trends of the layered GO films from 2D monolayers to quasi bulk-like behavior. Finally, we show that by coating SOI nanowires with GO films the effective nonlinear parameter of SOI nanowires is increased 16 fold, with the effective nonlinear figure of merit (FOM) increasing by about 20 times to FOM > 5. These results reveal the strong potential of using layered GO films to improve the Kerr nonlinear optical performance of silicon photonic devices.

Recent emergence of novel coronavirus (SARS-CoV-2) all over the world has resulted more than 33,106 global deaths. To date well-established therapeutics modules for infected patients are unknown. In this present initiative, molecular interactions between FDA-approved antiviral drugs against the Hepatitis-C virus (HCV) have been investigated theoretically against the RNA-dependent RNA polymerase (RdRp) of SARS-CoV-2. HCV and SARS-CoV-2 are both +ssRNA viruses. At 25^o C beclabuvir, a non-nucleoside inhibitor of the RdRp_HCV can efficiently bind to RdRp _SARS-CoV-2 (ΔG_AutoDock = -9.95 kcal mol^-1) with an inhibition constant of 51.03 nM. Both the ΔG_London and ΔG_{GBVI / WSA} values were - 9.06 and - 6.67 kcal mol^-1, respectively for binding of beclabuvir to RdRp_SARS-CoV-2. In addition, beclabuvir has also shown better binding free energy with RdRp_SARS-CoV-2 (ΔG_vina = -8.0 kcal mol^-1) than that observed with the Thumb 1 domain of RdRp_HCV (ΔG_vina = -7.1 kcal mol^-1). InterProScan has suggested the RNA-directed 5'-3' polymerase activity exists within 549^th to 776^th amino acid residues of RdRp_SARS-CoV, where the major amino acid residues interacting being I591, Y621, C624, D625, A690, N693, L760, D762, D763, and E813-N817. Molecular interaction suggests occupancy of beclabuvir inside the active site environment of the RdRp_SARS-CoV-2, the enzyme essential for viral RNA synthesis. In conclusion, results suggest beclabuvir may serve as an anti-SARS-CoV-2 drug.

Currently, there is no specific treatment for COVID-19 proven by clinical trials. WHO and CDC guidelines therefore endorse supportive care only. However, frontline clinicians have been applying several virus-based and host-based therapeutics in order to combat SARS-CoV-2. Medications from COVID-19 case reports, observational studies and the COVID-19 Treatment Guideline issued by the China's National Health Commission (7^th edition published March 3^rd, 2020. Edited translation attached) are evaluated in this review. Key evidence from relevant in vitro researches, animal models and clinical studies in SARS-CoV-2, SARS-CoV and MERS-CoV are examined. Antiviral therapies remdesivir, lopinavir/ritonavir and umifenovir, if considered, could be initiated before the peak of viral replication for optimal outcomes. Ribavirin may be beneficial as an add-on therapy and is ineffective as a monotherapy. Corticosteroids use should be limited without indicating comorbidities. IVIG is not recommended due to lack of data in COVID-19. Xuebijing may benefit patients with complications of bacterial pneumonia or sepsis. The efficacy of interferon is unclear due to conflicting outcomes in SARS and MERS studies. Chloroquine and hydroxychloroquine have shown in vitro inhibition of SARS-CoV-2 and may be beneficial as both prophylactic and treatment therapy. For patients who developed cytokine release syndrome, interleukin-6 inhibitors may be beneficial. Given the rapid disease spread and increasing mortality, active treatment with readily available medications may be considered timely prior to disease progression.

Safety of source water streams is an urgent environmental issue, while protections in monsoon controlled subtropical regions face difficulties because of the lack of small scaled observation and analysis in small source water catchments. Basing on continuous weekly water quality data (2014-2017) in Pingqiao River Catchment, the annual average values of TN, NO₃, NH₄ and TP are 3.36, 1.64, 0.28 and 0.02 (mg/L) respectively. During dry, normal and wet seasons, the variability of parameters is over 35%, which indicates an obvious seasonality. Multiple methods are combined in order to assess the water quality and find the driving factors during dry, normal and wet seasons. This study suggests precipitation and fertilization are the mainly seasonal factors, which can make water quality better in wet season than dry season due to the dilution effect. The mechanism between seasonality and compound of nutrients can also be traced by log(TN:TP), and log(NO₃:NH₄). Among six main land use types (forest, tea plantation, cropland (paddy), urban, bare soil and water), the former three ones are influential mostly during dry and wet season. Tea plantation has the largest nutrients discharge amount per area, which is similar to cropland in dry season. By contrary, forest has the double power in reducing nitrogen release in wet and normal seasons. When transformed into paddies, croplands can lower the phosphorus concentration. Conclusions of this study can be used in southeastern China and similar regions on source water protection and agricultural plans.

Diesel engines, as power equipment, are widely used in the fields of automobile industry, ship and power equipment. Due to wear or faulty adjustment, the valve train clearance abnormal fault is a typical failure of diesel engines, which may result in the performance degradation, even valve fracture and cylinder hit fault. However, the failure mechanism features mainly in time domain and angular domain, on which the current diagnosis methods based, are easily affected by working conditions or hard to extract accurate enough, as the diesel engine keeps running in transient and non-stationary process. This work arms at diagnosing this fault mainly based on frequency band features which would change when the valve clearance fault occurs. For the purpose of extracting a series of frequency band features adaptively，a decomposition technique based on improved variational mode decomposition is investigated in this work. As the connection between the features and the fault is fuzzy, the random forest algorithm is used to analyze the correspondence between features and faults. In addition, the feature dimension is reduced to improve the operation efficiency according to importance score. The experimental results under variable speed condition show that the method based on variational mode decomposition and random forest is capable to detect valve clearance fault effectively.

The manuscript reported the synthesis of Al2O3 nano-coating onto quartz fiber by plasma electrolysis spray for enhanced thermal conductivity and stability. The nano- and micro-sized clusters were partially observed on the coating, while most coating was relatively smooth. It was suggested that the formation of a ceramic coating was followed as the nucleation-growth raw, that is, the formation of the coating clusters was dependent on the fast grow-up partially, implying the inhomogeneous energy distribution in the electrolysis plasma. The deposition of the Al2O3 coating increased the annealing tensile strength from 19.2 MPa to 58.1 MPa. The thermal conductivity of the coated quartz fiber was measured to be 1.17 W m-1 K-1, increased by ~45% compared to the bare fiber. The formation mechanism of the Al2O3 coating was preliminarily discussed. We believe that the thermally conductive quartz fiber with high thermal stability by plasma electrolysis spray will find a wide range of applications in industries.

The aim of this study is (a) to develop, test, and employ a combined method of unsupervised machine learning to objectively assess the condition of sports facility in primary schools (PSSFC) and (b) examine the examine the geographical and typological association with PSSFC. Based on the Sixth National Sports Facility Census (NSFC), six PSSFC indicators (indoor and outdoor facility included) were selected as the measurements and decomposed by using the t-stochastic neighbor embedding (t-SNE). Thereafter, the Fuzzy C-mean (FCM) algorithm was used to cluster the same type of PSSFC with selecting the optimum numbers of evaluation level. Overall 845 primary schools in Shanghai, China were recruited and tested by this combined approach of unsupervised machine learning. In addition, the two-way analysis of covariance was used to examine the location and types of school associated with PSSFC variables in each level. The combined method was found to have acceptable reliability and good interpretability, differentiating PSSFC into five gradient levels. The characteristics of PSSFC differ by the location and school type of individual school. Our findings are conducive to the regionalized and personalized intervention and promotion on the children’s physical activity (PA) upon the practical situation of particular schools.

Enterovirus 71 (EV71) infection hand-foot-mouth disease (HFMD), meningoencephalitis, neonatal sepsis, and even fatal encephalitis in children, thereby representing a serious public health hazard. It is important to determine the mechanisms underlying the regulation of EV71 infection. In this study, we initially reveal that the interleukin enhancer binding factor 2 (ILF2) down-regulates EV71 50% tissue culture infective dose (TCID50), attenuates EV71 plaque formation unit (PFU), thereby repressing EV71 infection. Moreover, we reveal a distinct mechanism by which EV71 antagonizes ILF2-mediated antiviral effects. Chip data analyses show that ILF2 mRNA is reduced upon EV71 infection. Cellular studies indicate that EV71 infection represses ILF2 mRNA expression and protein production in human leukemic monocytes (THP-1) differentiated macrophages and in human rhabdomyosarcoma (RD) cells. Additionally, EV71 non-structural protein 2B interacts with ILF2 in human embryonic kidney (HEK293T) cells. Interestingly, in the presence of EV71 2B, ILF2 is translocated from the nucleus to the cytoplasm and co-localizes with 2B in the cytoplasm. Therefore, we reveal a distinct mechanism by which EV71 antagonizes ILF2-mediated antiviral effects by inhibiting ILF2 expression and promoting ILF2 translocation from the nucleus to cytoplasm through its 2B protein.

A series of Ni/KIT6 catalystprecusors with 25wt.%Ni loading amount were reduced in H₂ at 400, 450, 500, and 550ºC, respectively. The studied catalysts were investigated by XRD, Quasiin-situ XPS, BET, TEM, and H₂-TPDanalysis methods.It was found that reduction temperature is an important factor affecting the hydrodeoxygenation (HDO) performance of the studied catalysts. The reduction temperature influences mainly the content of active components, crystal size, and the abilityfor adsorbing and activatingH2. The developed pore structure and large specific surface area of the KIT-6 support favored the Ni dispersion.The RT450 catalyst, which was prepared in H₂ atmosphere at 450 ºC, has the best HDO performance. Ethyl acetate can be completely transformed, and maintain 96.8% ethane selectivity and 3.2% methane selectivity at 300 ºC. The calculated apparent activation energies of the prepared catalysts increased in the following order: RT550 > RT400 > RT500 > RT450.