Traditional asexual propagation of hops limits its phytosanitary quality and the concomitant plant availability. This scenario worsens with the global climate change. In this study we develop protocols for in vitro propagation of Humulus lupulus var. mapuche. Two explant types were evaluated: shoot tips, from field material collected in Río Negro province (Argentina), and nodal segments, from vitroplants. Different growth regulator, such as 6-Benzylaminopurine, gibberellic acid, indole-3-butyric acid and indole-3-acetic acid, was used to induce desired morphogenic responses. Additionally, the impact of abscisic acid application on acclimatization was assessed, and resulted in robust growth and reduced plant stress symptoms during ex vitro adaptation. Also, the study develops a protocol for synthetic seeds production, with storage at 4°C to enhance conservation and plant material transport, ensuring a constant supply of female plants. This comprehensive approach addresses current producer demands and emerging climate challenges. The findings highlight the fundamental role of in vitro multiplication of hops in improving plant material availability and quality, with significant implications for the brewing industry and related sectors.

Spatial and temporal variation of the free electron concentration in the ionosphere affects SAR interferograms, in particular at low radar frequencies. In this work the identification, estimation and compensation of ionospheric path delay phases in PALSAR-3 and NISAR-L interferograms is discussed. Both these L-band sensors acquire simultaneously SAR data in a main spectral band and in an additional, spectrally separated, narrower second band to support the mitigation of ionospheric path delays. The methods presented permit separating the dispersive and the non-dispersive phase terms based on the double-difference interferogram between the two available spectral bands and the differential interferogram of the main band. The applicability of the proposed methods is demonstrated using PALSAR-3-like data that was simulated based on PALSAR-2 SM1 mode data.

The integration of artificial intelligence (AI) into academic settings in Sabah, Malaysia, is transforming education and research landscapes. While AI technologies promise to enhance teaching, learning, and scholarly activities, they also pose challenges such as ethical concerns and skill gaps among academic staff. This study addresses the multifaceted impacts of AI adoption on academicians in Sabah, focusing on two key research questions: the impact of AI-based intelligent tutoring systems on student engagement, learning outcomes, and educational equity, and the challenges and opportunities in building academicians' capacity to integrate AI technologies effectively. Through a multidisciplinary approach, incorporating insights from education, computer science, social sciences, and ethics, this research aims to evaluate the effectiveness of AI tools in educational settings and identify strategies for skill development and infrastructure support. The study recommends empirical assessments within Sabah's educational institutions, considering contextual factors and fostering collaborative partnerships with local communities. Professional development programs, collaboration with industry partners, and improved access to AI infrastructure are proposed strategies. Longitudinal studies and interdisciplinary research initiatives are suggested for future research, along with qualitative methods to capture diverse perspectives. Ultimately, by embracing a collaborative and multidisciplinary approach, Sabah's academic community can harness the transformative potential of AI to advance education, research, and scholarship while promoting ethical and inclusive practices.

The undoped and tungsten (W)-doped vanadium dioxide (VO₂) thin films were prepared by electron beam evaporation associated with ion-beam assisted deposition (IAD). The influence of different W-doped contents (3%-5%) on the optical, electrical, structural, and thermos-mechanical properties of VO₂ thin films was investigated experimentally. Spectral transmittance results showed that with the increase of W-doped contents, the transmittance in the visible light range (400-750 nm) decreases from 60.2% to 53.9%, and the transmittance in the infrared wavelength range (2.5 μm to 5.5 μm) drops from 55.8% to 15.4%. As the W-doped content increases, the residual stress in the VO₂ thin film decreases from -0.276 GPa to -0.238 GPa, but the surface roughness increases. For temperature-dependent spectroscopic measurements, heating the VO2 thin films from 30°C to 100°C showed the most significant change in transmittance for the 5% W-doped VO₂ thin film. When the heating temperature exceeds 55°C, the optical transmittance drops significantly, and the visible light transmittance drops by about 11%. Finally, X-ray Diffraction (XRD) and scanning electron microscope (SEM) were used to evaluate the microstructure characteristics of VO₂ thin films.

Study of alterations in Osteoarthritis (OA) of Glypicans 1 to 6 (GPCs) and Notum in plasma, bone marrow mesenchymal stromal cells (BM-MSCs) and osteoblasts. Plasma levels of GPCs and Notum were measured of 25 patients and 24 healthy subjects. In addition, BM-MSCs from eight OA patients and eight healthy donors were cultured during 21 days with culture me-dium and osteogenic medium. Protein and gene expression levels of GPCs and Notum were de-termined by ELISA and qPCR at 0, 7 ,14 and 21 days. GPC5 and Notum have been found de-creased in OA patients’ plasma. OA BM-MSCs showed downexpression of GPC6 and upregula-tion of Notum. A decrease in GPC5 and Notum proteins and an increase in GPC3 were found. During osteogenic differentiation, elevated GPC2, 4, 5, 6 and Notum mRNA levels and decreased GPC3 were observed in OA. Furthermore, the protein levels of GPC2, GPC5 and Notum de-creased and GPC3 increased. Glypicans and Notum are altered in BM-MSCs and during osteo-genic differentiation from patients with OA. Furthermore, GPC5 and Notum can be proposed as new biomarkers of the pathology. The alterations found indicate that Notum could be a prom-ising therapeutic strategy for Osteoarthritis.

With the increasing of China's international status and the acceleration of the process of global economic integration, the internationalization strategy of Chinese enterprises is getting deeper and deeper. This paper analyzes the problems and challenges faced by the international supply chain management of Chinese bamboo weaving and creative products, and puts forward a set of supply chain management model that ADAPTS to the international development. Firstly, the concept, connotation and types of supply chain management are sorted out through literature review. Secondly, this paper analyzes the current situation of international supply chain management of bamboo editing and creative products, and points out the existing problems. Thirdly, based on the theory and practice of international supply chain management, this paper puts forward a set of supply chain management model suitable for the international development of bamboo editing and creative products. Finally, taking a bamboo weaving and creative products enterprise as an example, the application effect of the supply chain management model is empirically analyzed. The results show that the supply chain management model can effectively reduce the cost and improve the efficiency, and is conducive to the international development of bamboo editing and creative products.

A comprehensive investigation was undertaken at Vytautas Magnus University Experimental Station, located at 54°52’50” N latitude and 23°49’41” E longitude on soil (Epieutric Endocalcaric Planosol – PLe-gln-w) since 1999, to understand the impacts of different agrotechnical measures on soil health and crop yield. Two primary factors were assessed. Factor A incorporated practices of straw removal versus straw chopping and spreading, while Factor B evaluated a spectrum of tillage techniques: conventional deep ploughing, shallow ploughing, ploughless tillage, single seedbed discing, and two no-tillage practices, one of which involved cover crops. Findings from this long-term study highlight the significant potential of specific farming systems in enhancing soil organic carbon. It has a positive effect on the release of CO2 emissions from the soil, thus promoting soil resilience and increasing plant productivity. These insights are paramount in devising sustainable agricultural strategies to counter the challenges of climate change on agroecosystems. This research showcases the profound effects of combining residue management and tillage practices, setting a novel standard for sustainable soil management of climatic uncertainties.

Certain Trichoderma isolates provide biofertilizer, biocontrol, and other plant-beneficial activities while inhabiting the soil or internal plant issues; and their use in agricultural systems could contribute to sustainable food production. It is thought that this colonization of soil and internal plant tissues is fundamental for biocontrol and biofertilizer applications. Our collective analyses of prior surveys, where the tef1 sequence was almost exclusively used to identify Trichoderma species, showed that isolates from the Harzianum Complex Clade, the T. asperellum/T. asperelloides group, T. virens, T. hamatum, and T. atroviride were prevalent in soil and/or as endophytes. Population structure and genetic diversity of these species were investigated, and new lineages with geo-graphic significance within T. atroviride, T. asperellum, T. hamatum, and T. virens populations were found. The nearest relatives of some species were also revealed. Choosing isolates from among more than 500 known Trichoderma species for use in non-targeted evaluation screens for biocontrol or biofertilizer applications is time-consuming and expensive. Preferentially selecting species from T. atroviride, T. asperellum/T. asperelloides, T. hamatum, species from the T. harzianum Complex Clade, T. virens, and possibly nearest relatives, may speed the identification of candidates for commercialization due to the demonstrated ability of these species to successfully inhabit the soil and endorhizosphere. To our knowledge, this is the first report where dominant soil- and en-dophyte-inhabiting Trichoderma species were identified from past survey data and population structure and genetic diversity analyses conducted.

Rare ginsenoside compound K (CK), is an intestinal microbial metabolite with a low natural abundance that is primarily produced by physicochemical processing, side chain modification, or metabolic transformation in the gut. Moreover, CK exhibits potent biological activity compared to primary ginsenosides, which has raised concerns in the field of ginseng research and development as well as ginsenosides-related dietary supplements and natural products. Ginsenosides Rb1, Rb2, and Rc are generally used as a substrate to generate CK via several bio-conversion processes. Current research shows that CK has a wide range of pharmacological actions including boosting osteogenesis, lipid and glucose metabolism, lipid oxidation, insulin resistance, anti-inflammatory, and anti-apoptosis properties. Further research on the bioavailability and toxicology of CK can advance its medicinal application. The purpose of this review is to lay the groundwork for future clinical studies and the development of CK as a therapy for metabolic disorders. Furthermore, the toxicology and pharmacology of CK are investigated as well in this review. The findings indicate that CK primarily modulates signal-ing pathways associated with AMPK, SIRT1, PPARs, WNTs, and NF-kB. It also demonstrates a positive therapeutic effect of CK on nonalcoholic fatty liver disease, obesity, hyperlipidemia, diabetes, and its complications, as well as osteoporosis. Additionally, the analogues of CK showed more bioavailability, less toxicity, and more efficacy against disease states. Enhancing bioavailability and regulating hazardous variables are crucial for its use in clinical trials.

Epidemiological and clinical evidence have extensively documented the role of obesity in the develop-ment of endometrial cancer. However, the effect of fatty acids on cell growth in endometrial cancer has not been widely studied. Here we reported that palmitic acid significantly inhibited cell proliferation of endometrial cancer cells and primary cultures of endometrial cancer, and reduced tumor growth in a transgenic mouse model of endometrial cancer, in parallel with increased cellular stress and apoptosis and decreased cellular adhesion and invasion. Inhibition of cellular stress by N-acetyl-L-cysteine effec-tively reversed the effects of palmitic acid on cell proliferation, apoptosis and invasive capacity in the endometrial cancer cells. Palmitic acid increased the intracellular formation of lipid droplets in a time- and dose-dependent manner. Depletion of lipid droplets by blocking DGAT1 and DGAT2 effectively increased the ability of palmitic acid to inhibit cell proliferation and induce cleaved caspase 3 activity. Collectively, this study provides new insight into the effect of palmitic acid on cell proliferation, inva-sion and the formation of lipid droplets that may have potential clinical relevance in the treatment of obesity-driven endometrial cancer

This study sought to improve the nutritional, functional and biochemical properties of pearl millet through malting and fermentation. Moringa oleifera leaf powder (MLP) was used as a fortificant. Mixture design was used to find optimal proportions for each of the components that yield a high protein and or low saturated fat content. Twelve mixtures with varying ratios of fermented, and malted pearl millet flour ranging between 30–65%, and MLP between 5–15% were generated through I-Optimal mixture design. The mixtures were wet-cooked, freeze-dried and analyzed for protein and fat content. The data obtained were fitted to a linear mixture model and the search for the optimum was done using Numerical Optimization for maximising protein and minimising saturated fat. The linear model was suitable for explaining variation for total protein and saturated fat with r2 of 0.50 and 0.51, respectively. Increasing MLP increased protein content. Two final formulations were generated through the optimization process. Pearl millet’s protein content increased by up to 22% while saturated fat decreased by up to 13%. Ash content increased by 75%. Polyphenol content and oxygen radical absorbance capacity increased by 80% and 25%, respectively. Final and peak viscosity were reduced by 90% and 95%, respectively.

The terrain of Changbai Mountain has great influence on the distribution of atmospheric flows and the occurrence and development of precipitation. This study quantitatively analyzes the regional characteristic of topographic perturbations and the relationship between terrain, wind and precipitation in Changbai Mountain region, by using a spectral analysis of the two-dimensional discrete cosine transform. Three domains with relatively heavy summer precipitation are selected as the study region. The results indicate that the overall terrain of Changbai Mountain region exhibits anisotropic characteristics. The terrain spectra of domain B are less than those of domain A and C across the whole wavelength (λ) bands, indicating that the large-scale topographic perturbations of domain B are relatively weak. The largest topographic spectral peak of domain C shows the most pronounced undulation of terrain among the three domains. The dominant wavelengths of terrain height variance for domain A and C, both close to the respective maximum wavelengths, indicate more prominent large-scale topographic perturbations. For domain A, the variation of the precipitation spectra is consistent with that of the wind spectra at the wavelength bands of λ < 390 km, showing a high correlation between wind field and the occurrence of rainfall. The inverse relationship at larger wavelengths indicates that multiple factors contribute to the occurrence of rainfall. For domain B, there is consistency in the fluctuations of terrain spectra, precipitation spectra, and wind spectra at the wavelength bands of λ < 278.3 km, implying that the smaller-scale terrain has an important effect on the occurrence of summer precipitation. For domain C, the variations of terrain spectra, precipitation spectra, and wind spectra are almost consistent across the whole wavelength bands, indicating that the large-scale terrain and minor terrain both play a crucial role in atmospheric uplift and the occurrence and development of summer rainfall.

Newly designed pentacyclic benzimidazole derivatives, featuring amino or amido side chains, were synthesized to assess their in vitro antiproliferative activity. Additionally, we conducted investigations into their direct interaction with nucleic acids, aiming to uncover potential mechanisms of biological action. These compounds were synthesized using conventional organic synthesis methodologies, alongside photochemical and microwave-assisted reactions. Upon synthesis, the newly derived compounds underwent in vitro testing for their antiproliferative effects on various human cancer cell lines. Notably, derivatives 6 and 9 exhibited significant antiproliferative activity within the submicromolar concentration range. Our biological assessment highlighted that the biological activity was strongly influenced by both the position of the N atom on the quinoline moiety and the position and nature of the side chain on the pentacyclic skeleton. Findings from fluorescence, circular dichroism spectroscopy, and thermal melting assays indicated a mixed binding mode—comprising intercalation and the binding of aggregated compounds along the polynucleotide backbone—of these pentacyclic benzimidazoles with DNA and RNA.

Sleep is of vital necessity for health, it has a restorative and protective function for children and adolescents with chronic conditions and their families. The purpose was to identify the scientific production on sleep patterns in children and adolescents with chronic conditions and their families. This integrative review was developed in March and June 2022, of the MEDLINE, Web of Science, CINAHL and PSYCInfo. The articles included were original papers published be-tween January 2007 and mid-2022. Excluded were review studies that did not evaluate sleep and whose participants did not have chronic conditions or were not children, adolescents and/or their families. The searches returned 814 abstracts. After exclusions, 47 studies were selected to be read in full; of these, 29 were selected and were grouped empirically into four categories: major alterations in sleep patterns of children and adolescents with chronic conditions; the relationship between sleep disorders and symptoms in children and adolescents with chronic conditions; impaired sleep patterns of families of children and adolescents with chronic conditions; sleep alterations and their relationship with other problems in families of children and adolescents with chronic conditions. All studies showed sleep pattern impairment in children and adolescents with chronic conditions and their families.

Fingerhuthia africana Lehm belongs to family Poaceae, is an erect perennial grass used traditionally to cure different diseases. The current study was carried out to find the bioactive compounds by GC-MS, elemental analysis through atomic absorption spectrophotometry, proximate analysis by AOAC, genotoxic activity through comet assay, antioxidant activity through DPPH and antidiarrheal activity through castor oil induce diarrhea followed by charcoal meal on mice model. GC-MS chromatogram represents different compounds detected in the crude extract. Major pharmacological bioactive compounds are 4H-Pyran-4-one, 2,3-dihydro-3,5-dihydroxy-6-methyl-; 4-Methyl itaconate; .alpha.-Terpineol; 1,2,3-Propanetriol, 1-acetate; Benzofuran, 2,3-dihydro-; Caryophyllene oxide; Hinesol; n-Hexadecanoic acid; 9,12-Octadecadienoic acid (Z,Z)-, methyl ester; Hexadecanoic acid and methyl ester. Elemental analysis of stem, leaves and roots of the plant show the presence of (macro and micro) nutrients such as Ca, Mg, K, Na, Cu, Pb, Zn, Mn, Fe, Cd and Co were absent in all parts. Proximate analysis of different parts revealed the presence of moisture contents (8.57%), ash (9.77%), fats contents (5.96%), fibers contents (45.03%), protein (3.62%), carbohydrates (39.71%) and Gross energy (Kcal/100g) (220.10). The ethanolic extract show dose-dependent genoprotective potential (127.38 ± 1.16), (83.28 ± 0.65), and (44.08 ± 1.40) at 50, 75, and 100 mg/100 ml, respectively, as compared to the methanolic extract which show genotoxic activity (85.13 ± 1.23) at high dose. After 90 minutes at a concentration of 300 (g/ml), methanolic extract demonstrated the greatest antioxidant potential (79.5%), followed by aqueous extract (76.5%). The methanolic extract of F. africana demonstrated antidiarrheal efficacy, with the maximum inhibition of charcoal movement (83.78%) occurring at a dosage of 300 mg/kg, followed by doses of 200 and 100 mg/kg, 73.26% and 59.56%, respectively. The current research highlights that the plant contains a substantial quantity of micro and macro nutrients, possesses high nutritional value, and exhibits pharmacological activities. These properties render the plant suitable for developing remedies to treat various therapeutic diseases.

This study was to designed to develop sorafenib-loaded polymeric nanoparticles, surface-modified with pluronic F-127 for the effective treatment of hepatocellular (HCC) and renal cell carcinomas (RCC). Poly lactic coglycolic acid (PLGA) was used to encapsulate different concentrations of sorafenib by a simple modified solvent evaporation method applying pluronic F-127 as a surfactant and coating agent. The preformulation and characterization studies were conducted to evaluate the incompatibilities among sorafenib, PLGA and pluronic F-127, and physicochemical properties of the formulations, respectively. The sizes of the coated and plain PLGA nanoparticles were ~140 ± 14.7 nm and ~ 120 ± 10.1 nm, respectively. It has been confirmed from the in vitro release studies that PLGA sustained the release of sorafenib, avoiding the initial burst release, while the in vivo studies demonstared that surface-modified nanoparticles have greater affinity in the target aorgans than plain PLGA nanoparticles and free drug keeping the dose constant (20 mg/kg body weight). The delivery of sorafenib-loaded polymeric PLGA nanoparticles into the target tissues and their pharmacokinetic parameters have been improved significantly compared to the reported formulations.

Cannabis, renowned for its historical medicinal use, harbours various bioactive compounds—cannabinoids, terpenes, and flavonoids. While major cannabinoids like THC and CBD have received extensive scrutiny for their pharmacological properties, emerging evidence underscores the collaborative interactions among these constituents, suggesting a collective therapeutic potential. This comprehensive review explores the intricate relationships and synergies between cannabinoids, terpenes, and flavonoids in cannabis. Cannabinoids, pivotal in cannabis's bioactivity, exhibit well-documented analgesic, anti-inflammatory, and neuroprotective effects. Terpenes, aromatic compounds imbuing distinct flavours, not only contribute to cannabis's sensory profile but also modulate cannabinoid effects through diverse molecular mechanisms. Flavonoids, another cannabis component, demonstrate anti-inflammatory, antioxidant, and neuroprotective properties, particularly relevant to neuroinflammation. The entourage hypothesis posits that combined cannabinoid, terpene, and flavonoid action yields synergistic or additive effects, surpassing individual compound efficacy. Recognizing the nuanced interactions is crucial for unravelling cannabis's complete therapeutic potential. Tailoring treatments based on the holistic composition of cannabis strains allows optimization of therapeutic outcomes while minimizing potential side effects. This review underscores the imperative to delve into the intricate roles of cannabinoids, terpenes, and flavonoids, offering promising prospects for innovative therapeutic interventions and advocating continued research to unlock cannabis's full therapeutic potential within the realm of natural plant-based medicine.

Alternaria alternata is a saprophyte and is also known to cause many opportunistic infections in humans. Alternaria infections are important factors of morbidity and mortality in im-mune-compromised and solid organ transplant (SOT). Sensitivity to the airborne fungus Alter-naria alternata is also believed to be a common cause of allergic asthma. Therapies are limited by the lack of knowledge about the role of individual fungal gene products and symptoms in im-mune-compromised and transplant patients. This review summarizes the published case studies on Alternaria alternata infections in transplant patients.

(1) Background: Emotion regulation is a critical determinant of adaptive functioning during adolescence, exerting profound influence on psychological well-being. This study seeks to deepen our understanding of the intricate interplay between emotion regulation and maladaptive psychological symptoms, examining these dynamics through a cross-countries comparison; (2) Methods: A total of 224 adolescents, aged 13 to 21 years, from both Iran and Belgium, participated in a cross-sectional comparative study. The study aimed to elucidate the relationship between emotion regulation and mental health functioning, assessing internalizing symptoms, externalizing symptoms, and self-injury. A demographic questionnaire, the Emotion Regulation Inventory, Strengths and Difficulties Questionnaire, and Self-Harm Inventory, were administered. Data analysis incorporated correlation assessments, Multivariate Analysis of Variance, and Structured Equation Modeling; (3) Results: The findings revealed a positive association between emotional dysregulation and psychological symptoms across the entire sample. Conversely, emotional suppression, more prevalent in Iran, showed no significant link with maladaptive symptoms but was associated with self-harm in the Belgian sample. Cultural disparities were evident, with internalizing problems more prevalent in Iran and externalizing issues more common in Belgium; (4) Conclusion: Emotional dysregulation emerged as a common factor compromising mental health. It emphasizes the necessity of considering cultural nuances when developing intervention and prevention programs and calls for further research in this field.

Emerging research has revealed a complex bidirectional interaction between the gut microbiome and cannabis. Preclinical studies have demonstrated that the gut microbiota can significantly influence the pharmacological effects of cannabinoids. One notable finding is the ability of the gut microbiota to metabolise cannabinoids, including Δ^9-tetrahydrocannabinol (THC). This metabolic transformation can alter the potency and duration of cannabinoid effects, potentially impacting their efficacy in cancer treatment. Additionally, the capacity of gut microbiota to activate cannabinoid receptors through the production of secondary bile acids underscores its role in directly influencing the pharmacological activity of cannabinoids. While the literature reveals promising avenues for leveraging the gut microbiome-cannabis axis in cancer therapy, several critical considerations must be accounted for. Firstly, the variability in gut microbiota composition among individuals presents a challenge in developing universal treatment strategies. The diversity in gut microbiota may lead to variations in cannabinoid metabolism and treatment responses, emphasising the need for personalised medicine approaches. The growing interest in understanding how the gut microbiome and cannabis may impact cancer has created a demand for up-to-date, comprehensive reviews to inform researchers and healthcare practitioners. This review provides a timely and invaluable resource by synthesizing the most recent research findings and spotlighting emerging trends. A thorough examination of the literature on the interplay between the gut microbiome and cannabis, specifically focusing on their potential implications for cancer, is presented in this review to devise innovative and effective therapeutic strategies for managing cancer.

Green synthesis using plant extracts has emerged as an eco-friendly, clean, and viable strategy alternative to chemical and physical approaches. The leaf, stem, and root extracts of Lannea discolor was utilized as a reducing and stabilizing agent in the synthesis of gold (AuNPs) and copper (CuNPs) nanoparticles. The formation of AuNPs and CuNPs confirmed by their color change, was characterised by UV–Vis Spectroscopy (UV- Vis), Scanning electron microscopy analysis and energy dispersive x-ray (SEM-EDX), Transmission Electron Microscopy (TEM), and Fourier Transform Infrared Spectroscopy (FTIR), coupled with minimum concentration inhibitory (MIC) antibacterial assays. AuNFs, NPs and CuNPs peaked at wavelengths in the ranges of 316, 544 and 564 nm respectively. TEM showed unexpected nanoflowers (30 – 97 nm) in the leaf extracts and spherical NPs (10 -33 nm; 9.3 – 37.5) from stem and root extracts, while spherical CuNPs (20 – 104 nm), were observed from all the extracts. EDX was able to confirm the presence of metal salts and FTIR revealed stable capping agents. AuNPs and NFs from L. discolor extracts showed appreciable antibacterial activity against Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae and Bacillus subtilis, when compared to the plant extracts, while none was observed from the CuNPs. These AuNPs and CuNPs are particularly appealing in a variety of applications in the biomedical as well as conductivity manufacturing, due to their shapes and sizes and economical and environmentally friendly production.

Global degradation of coral reefs is reflected in the destruction of shelters in various environments and threatens the stability of marine ecosystems. Artificial shelters offer an alternative, but their design is challenging due to limited knowledge regarding the shelter characteristics preferences of desired inhabitants. Investigating these preferences is resource-intensive, particularly regarding small shelters that mimic natural reef condition. Further, fish abundance may be too low for statistical analysis in small shelters. We propose a method to characterize the species-specific shelter preferences using low-volume data. During a study conducted from January 2021 to April 2022, round clay artificial shelters (RAS) were deployed on an abandoned oil pier to examine a coral reef fish community. We recorded 92 species from 30 families; grouped them to systematically (families) and functionally (dietary group) classes. Grouping enabled examining each group’s preference while crossing these group preferences revealed species- specific preferences, that matched field observations. This approach proved effective in profiling the shelter preferences of 17 species while having limited resources. These profiles may latter allow the establishment of ecological-oriented artificial reefs.

Radiotheranostics refers to pairing of radioactive imaging biomarkers with radioactive therapeutic compounds that deliver ionizing radiation. Given the introduction of very promising radio-pharmaceuticals, the radiotheranostics approach is creating a novel paradigm in personalized, targeted radionuclide therapies (TRTs), also known as radiopharmaceuticals (RPTs). Radiother-apeutic pairs targeting somatostatin receptors (SSTR) and prostate-specific membrane antigens (PSMA) are increasingly used to diagnose and treat patients with metastatic neuroendocrine tumors (NETs) and prostate cancer. In parallel, radiomics and artificial intelligence (AI) as important areas in quantitative image analysis are paving the way for significantly enhanced workflows in diagnostic and theranostic fields, from data and image processing to clinical decision support, improving patient selection, personalized treatment strategies, response prediction, and prognostication. Furthermore, AI has the potential for tremendous effectiveness in patient dosimetry which copes with complex and time-consuming tasks in the RPT workflow. The present work provides a comprehensive overview of radiomics and AI application in radio-theranostics, focusing on pairs of SSTR- or PSMA‑targeting radioligands, describing the funda-mental concepts and specific imaging/treatment features. Our review includes ligands radio-labeled by 68Ga, 18F, 177Lu, 64Cu, 90Y, and 225Ac. Specifically, contributions by radiomics and AI towards improved image acquisition, reconstruction, treatment response, segmentation, restag-ing, lesion classification, dose prediction, and estimation as well as ongoing developments and future directions are discussed.

Background: Chronic post-surgical pain is a condition persisting at least three months after surgery. It is estimated that 25-60% of patients who underwent breast cancer removal surgery suffer from post-mastectomy pain syndrome and occurred anxiety, depression, sleep disturbance and catastrophizing. Physical activity can reduce the risk of chronic diseases and has a good impact on mood and cognitive function. Aim of this study was to evaluate the effects of physical activity on the intensity of pain, depression and anxiety in women underwent mastectomy for breast cancer removal. Methods: A prospective observational unicentric cohort study was performed. Patients were female underwent unilateral or bilateral mastectomy. Numerical Rating Scale (NRS), was used to assess pain intensity, Beck’s Depression Inventory (BDI) for depression and Generalized Anxiety Disorders-7 (GAD-7), for anxiety evaluation. Physical activity was assessed by International Physical activity questionnaire (IPAQ). Interleukin (IL)-17, IL-1β, cortisol, adrenocorticotropic hormone (ACTH) and brain-derived neurotrophic factor (BDNF) were also evaluated in the blood of patients. All the evaluation was assessed 3 and 6 months after the surgery. Results: Adequate physical activity reduced intensity of pain, depression and anxiety symptoms in women affected by post-mastectomy pain syndrome. Moreover, adequate active women, showed a reduction of biomarkers of inflammation, cortisol, ACTH and an increase of BDNF. Conclusions: Our results suggest that physical activity can improve quality of life, reducing intensity of pain, inflammatory markers and it can be useful in the reduction of associated anxiety and depression.

Circadian rhythm disruptions are a hallmark feature of mood disorders. Patients experiencing acute depressive episodes report noticeable changes in their sleep-wake cycles. This research explains the association between depression and various circadian rhythm metrics, explicitly focusing on adolescents diagnosed with depressive disorders. Adolescence is a critical period marked by significant physiological and psychological changes, making it imperative to understand how mood disorders manifest during this phase. However, there have been minimal specific studies in pediatric populations to determine whether circadian rhythm changes differ between adolescents with first- and multiple-recurrent depressive episodes. Our study involved a group of 61 adolescents aged between 13 and 18. We performed a cross-sectional study of a clinical popu-lation of patients presenting to a child and adolescent psychiatry clinic diagnosed with depression. Participants were asked to complete self-report evaluations using several tools: The Korean ver-sion of the Biological Rhythms Interview of Assessment in Neuropsychiatry (K-BRIAN), the Korean Translation of Composite Scale to Measure Morningness-Eveningness (KtCS), and the Seasonal Pattern Assessment Questionnaire (SPAQ). Tools such as the Children's Depression In-ventory (CDI), State-Trait Anxiety Inventory (STAI), and K-Mood Disorder Questionnaire (K-MDQ) were employed for the assessment of clinical characteristics of depression. Based on the frequency of their depressive episodes, participants were bifurcated into two distinct groups: those experi-encing their first episode (n=22, mean age: 15.09±1.44 years) and those with recurrent episodes (n=39, mean age: 15.95±1.26 years). At first, the two groups' data revealed no significant differences regarding mood or circadian rhythm metrics (CDI: first-episode 26.18±10.54 and recurrent episode 25.90±10.59, STAI-S: first-episode 56.91±12.12 and recurrent episode 57.49±11.93, STAI-T: first-episode 60.36±11.63 and recurrent episode 59.09±12.10, SPAQ-total: first-episode 6.59±4.86 and recurrent episode 6.77±5.23, KtCS: first-episode 30.32±5.83 and recurrent episode 28.13±7.36). However, we observed significant correlations between circadian rhythm disruptions and depression scales (CDI with SPAQ-weight (r=0.26), KtCS (r=-0.48), K-BRIAN-sleep (r=0.58), K-BRIAN-activity (r=0.64), K-BRIAN-social (r=0.71) and K-BRIAN-eating (r=0.40)). These correlations were especially pronounced in the recurrent episode group, suggesting that with the progression and chronicity of depression, the relationship between circadian rhythms and depression becomes more intertwined and evident. In conclusion, especially in adolescents, as the severity and chronicity of depression increase, the interplay between circadian rhythms and mood disorders becomes more pronounced, warranting further research and clinical attention.

This study assessed the impact of mineral fertilization on tuber yield and food quality of yam genotypes, specifically Dioscorea alata and Dioscorea rotundata. Four genotypes, each from D. alata and D. rotundata, were used in field experiments conducted in Ibadan, Nigeria, in the 2017 and 2018 cropping seasons. Experiments were conducted under low soil NPK fertility conditions with and without fertiliser treatments. A recommended NPK rate for the area (90, 50, and 75 Kg N, P, K ha-1) was applied to plots with fertiliser treatment. Tuber yield, functional and pasting properties of yam flour, and sensory attributes of pounded yams were collected. The results showed differential responses of the genotypes to tuber yield and food quality with fertiliser application. Fertiliser application has generally increased fresh tuber yield, but it has affected some genotypes' flour quality and textural attributes of the pounded yams. As regards genotypes Danacha and TDa0200012, fertiliser application has increased tuber yield without causing a decrease in tuber quality hence, suggesting Danacha and TDa0200012 as suitable genotypes for maximizing fertiliser productivity. However, in another genotype Ojuiyawo, fertiliser application effectively increased tuber yield but deteriorated tuber quality. Our results suggested that it is crucial to determine the impact of fertilisation on tuber yield and quality for each genotype and select the appropriate genotype to improve productivity through mineral fertilisation. The results of this study can be widely applied to enhance yam productivity in sub-Saharan Africa and useful for sustainable agriculture in yam-growing areas.

Adding zinc (II) and formate anions improves the thermal phase-stability of alpha-FAPbI3 materials and the spin-coated thin films of such doped FAPbI¬3 show an increased emission lifetime of up to 3.7 microsecond on quartz. This work investigates the effects of zinc and formate on the stability and time resolved photoluminescence of FAPbI3 perovskites for solar cell applications. Perovskite samples with varying concentrations of zinc and formate were made by incorporating different amounts of zinc formate and zinc iodide and characterized with XRD. Doping levels of 1.7% Zn(II) and 1.0% formate (relative to Pb) seem optimal. The thermal stability of the perovskite powders and thin films were assessed. XRD was virtually unchanged after 6 months. The time-resolved photo-luminescence spectroscopy of the doped spin-coated perovskite samples is reported. The results show that synergy between an anionic and a cationic dopant can take place, making the perovskite thermally more stable with a longer charge carrier lifetime.

Rail, as the cleanest and greenest high-volume transport, has a central role in the decarbonizing, and it is expected to become the backbone of future mobility in the world. It is worthy to highlight that rail generates the lowest CO2 emissions and energy consumption in operation with respect to the other transportation modes but during construction and maintenance phases CO2 emission, energy consumption and other environmental impacts are significant and need to be carefully assessed and properly mitigated. This paper, based on an extensive literature review, provides a comprehensive framework of trends and challenge in railway sustainability. Attention is focused on track and related materials, maintenance strategies, and methods of assessment of the sustainability. Results show that improvement of materials and practices used in construction and appropriate strategies in maintenance, supported by effective monitoring of the state of the track, can reduce the negative effects on the environment and society and contributes to make this transportation mode greener. Proper methods for the assessment of the sustainability, (LCA, Circularity Index) help to quantify the potential of environmental enhancement of different solutions and constitute effective and indispensable tools in the decision-making process.

Introduction. This retrospective study aimed to compare the risk factors for vascular calcification (VC) between pre-hemodialysis (HD) and prevalent HD adult patients while investigating associations with calcification biomarkers. Methods. Baseline data from 30 pre-HD and 85 HD patients were analyzed, including iPTH, vitamin D, FGF23, fetuinA, sclerostin, and VC scores (Adragao method). Multivariable linear regression identified VC predictors. Results: The prevalence of VC was similar in both groups, but HD patients had more pronounced VC scores ≥6. Pre-HD patients were older, with higher prevalence of Balkan endemic nephropathy, hypertension, and less frequent use of calcium phosphate binders. Both groups exhibited similar patterns of hyperphosphatemia, low vitamin D, and iPTH levels. In HD group normal phosphate was significantly common in patients with VC, whereas hyperphosphatemia was significantly common in patients without VC. Fetuin-A levels were higher in pre-HD patients, while FGF23 was elevated in HD patients. In pre-HD patients, male gender was associated with reduced VC risk, while in HD patients, malignancies and serum phosphate levels were negative VC predictors. Conclusion: Effective monitoring and tailored treatment of VC in CKD are still focused on phosphate regulation. Besides, mineral disturbances, hormones and biomarkers regulation, and patient-specific variables need to be considered.

In this work we present a versatile, rapid, and low-cost manufacturing technique to develop bioceramic scaffolds that could enhance bone tissue regeneration via microwave preparation using a commercial microwave oven. The scaffolds were prepared combining hydroxyapatite and water glass (sodium trisilicate solution), foamed by using a microwaves oven and then characterized by means of SEM-EDS, mechanical properties, infrared spectroscopy (ATR-FTIR), density and stability test in water. Furthermore, in vitro tests were performed to verify the affinity of osteoclast cells versus the so prepared scaffold. The morphology of the samples showed interconnected pores suitable for promoting tissue regeneration and vascularization while specific mechanical properties were preserved. The physicochemical characterization and the in vitro tests presented promising results for bone regenerative applications.

The increased cultivation of Cannabis sativa L. in North America, represented by high Δ9-tetrahydrocannabinol-containing (high-THC) cannabis genotypes and low THC-containing hemp genotypes, has been impacted by an increasing number of plant pathogens. These include fungi which destroy roots, stems and leaves, in some cases causing a build-up of populations and mycotoxins in the inflorescences that can negatively impact quality. Viroids and viruses have also increased in prevalence and severity and can reduce plant growth and product quality. Rapid diagnosis of the occurrence and spread of these pathogens is critical. Techniques in the area of molecular diagnostics have been applied to study these pathogens in both cannabis and hemp. These include polymerase chain reaction (PCR)-based technologies, including RT-PCR, multiplex RT-PCR, RT-qPCR, and ddPCR, as well as whole genome sequencing (NGS) and bioinformatics. In this study, examples of how these technologies have enhanced the rapidity and sensitivity of pathogen diagnosis on cannabis and hemp will be illustrated. These molecular tools have also enabled studies on the diversity and origins of specific pathogens, specifically viruses and viroids, and these will be illustrated. Comparative studies on the genomics and metabolomics of healthy and diseased plants are urgently needed to provide insight into their impact on quality and composition of cannabis and hemp-derived products. Management of these pathogens will require monitoring of their spread and survival using the appropriate technologies to allow accurate detection, followed by appropriate implementation of disease control measures.

Abstract: This article explores the intricate relationship between environmental degradation, specifically air pollution, and economic growth in the Sultanate of Oman spanning the period from 1990 to 2022. We employ cointegration and vector error correction models to uncover both short- and long-term dynamics in the association between air pollution and economic growth. Fur-thermore, Granger causality analysis is utilized to investigate the causal links between these crucial variables. This data encompasses factors related to environmental quality and various control variables. The empirical results unveil a sustained long-term cointegration connection between the variables. Additionally, our findings highlight a statistically significant positive impact of economic growth and energy consumption on CO2 emissions. Furthermore, the short-term analysis reveals an annual adjustment of approximately 14.1% in N2O emissions dis-equilibrium. The Granger causality study indicates unidirectional causal relationships involving N2O emissions, economic growth, and CO2 emissions. The implications of these findings for Oman's policy landscape are substantial. To effectively reduce greenhouse gas emissions, it is imperative for Oman to establish robust climate change policies. Additionally, the government can play a pivotal role in encouraging and endorsing the use of renewable energy sources, such as green hydrogen, as a promising alternative to traditional oil and gas resources.

(Background) Phytotoxicity refers to the capacity of chemical substances or environmental factors to have a negative impact on plants. This is a crucial issue in both the context of crop cultivation and environmental protection. (Material and Methods) The research results were based on a 3-year field experiment conducted at the experimental station in Jadwisin (52°28′ N, 21°02′ E) on loamy soil. The experiment was set up using a randomized sub-block design in a split-split-plot arrangement, with three replications. The first-order factor consisted of potato cultivars, while the second-order factors were weed control methods: 1) Control – without protection; 2) mechanical weed control, extensive mechanical treatments to close rows; 3) Sencor 70 WG – pre-emergence (PRE) of potatoes; 4) Sencor 70 WG + Titus 25 WG + Trend 90 EC – PRE of potatoes; 5) Sencor 70 WG – post-emergence (POST) of potatoes; 6) Sencor 70 WG + Titus 25 WG + Trend 90 EC – POST of potatoes; 7) Sencor 70 WG + Fusilade Forte 150 EC – POST of potatoes; 8) Sencor 70 WG + Apyros 75 WG + Atpolan 80 SC – POST of potatoes. The phytotoxic effects of herbicides on potato plants and weeds were assessed every 7 days, starting from the date when the first signs of damage appeared, until they stabilized or disappeared. (Results:) Phytotoxic damage to potato and weed plants were caused by the chemical weed control methods used. The response of potato plants to herbicides was significantly related to the genetic traits of the cultivars and meteorological conditions in the years of research. (Conclusion:) Phytotoxicity is an important aspect in both agriculture and environmental protection. Research on its mechanisms and impact will enable the development of effective plant protection strategies and the preservation of ecosystem balance.

The ribosome is a macromolecular complex composed of RNA and proteins that interact through an integrated and interconnected network to preserve its ancient core activities. In this review, we emphasize the pivotal role played by RNA-binding proteins as a driving force in the evolution of the current form of the ribosome, underscoring their importance in ensuring accurate protein synthesis. This category of proteins includes both ribosomal proteins and ribosome biogenesis factors. Impairment of their RNA-binding activity can also lead to ribosomopathies, a group of disorders characterized by defects in ribosome biogenesis that are detrimental to protein synthesis and cellular homeostasis. A comprehensive understanding of these intricate processes is essential for elucidating the mechanisms underlying the resulting diseases and advancing potential therapeutic interventions.

Ornamental kale (Brassica oleracea var. acephala) is an attractive ornamental plant with a range of leaf colors and shapes. Breeding new varieties of ornamental kale has proven challenging due to its lengthy breeding cycle and the limited availability of genetic markers. Microspore culture is an effective approach to generate new materials and genetic maps are a prerequisite for quantitative trait loci analysis, MAS, fine gene mapping, and genome sequence assembly. In this study, a F1DH ornamental kale population comprising 300 DH lines was constructed using microspore culture. A high-density genetic map was developed by conducting whole-genome sequencing on 150 individuals from the F1DH population. The genetic map contained 1,696 bin-markers with 982,642 single-nucleotide polymorphisms (SNPs) spanning a total distance of 775.81 cM on all nine chromosomes with an average distance between markers of 0.46 cM. The ornamental kale genetic map contained substantially more SNP markers compared with published genetic maps for other B. oleracea crops. The F1DH progenies provide an excellent resource for germplasm innovation and breeding new varieties of ornamental kale. The high-density genetic map provides crucial insights for gene mapping and unraveling the molecular mechanisms behind important agronomic traits in ornamental kale.

The large quantity of information retrieved from communities, public data repositories, web pages, or data mining can be sparsed and poorly classified. This work shows how to employ unsupervised classification algorithms such as K-means proper to classify user reviews into their closest category, forming a balanced data set. Moreover, we found that the text vectorization technique significantly impacts the clustering formation, comparing TF-IDF and Word2Vec. The value for mapping a cluster with movie genre was 81.34% ± 20.48 of the cases when the TF-IDF was applied, whereas Word2Vec only yielded a 53.51% ± 24.1. In addition, we highlight the impact of the removal of stop-words. Thus, we detected that pre-compiled lists are not the best method to remove stop-words before clustering because there is much ambiguity, centroids are poorly separated, and only 57% of clusters could match a movie genre. Thus, our proposed approach achieved a 94% of accuracy. After analyzing the classifiers’ results, we appreciated a similar effect when divided by the stop-words method removal. Statistically significant changes were observed, especially in precision metric and Jaccard scores in both classifiers, using custom-generated stop lists rather than pre-compiled ones. Reclassifying sparse data is strongly recommended as using custom-generated stop lists.

Enteric viruses are the major cause of gastroenteritis and enteric hepatitis worldwide, but in some areas like Saudi Arabia little data is known about their presence in water sources. The available information from clinical samples is not enough to figure their actual prevalence. The aim of this study was to gather information for the first time in Saudi Arabia on the presence of Norovirus (NoV) genogroup GI and GII, hepatitis A virus (HAV) and hepatitis E virus (HEV) in water. For this purpose, thirteen monthly samples were collected in lake Wadi Hanifa and surrounding wells from December 2014 to November 2015. Viruses were detected and quantified by Real-time RT-qPCR. Despite HEV findings were anecdotic, our results highlight interesting behaviors of the other viruses. There was a higher prevalence of noroviruses in Wadi Hanifa samples than in well water samples (46.43% vs12.5% of NoV GI; 66.67% vs8.33% of NoV GII). On the contrary, similar levels of HAV positivity were observed (40.48% in surface water vs 43.06% in well water). Also, a strong influence of flooding events on HAV and NoV GI occurrence was observed in both surface and well water samples, being NoV GII apparently not affected.

Background: Influenza vaccine is a tool for preventing infection and reducing exacerbations in patients with asthma and chronic obstructive pulmonary disease (COPD). Purpose of this study is to investigate dynamics of CRP and serum cytokines (IL-2, IL-6, IL-10, IL-17) in patients with asthma and COPD, as well as to perform a correlation analysis with the clinical parameters of the disease manifestation. Methods: The study included 34 patients with asthma, 20 patients with COPD vaccinated against influenza during a period of remission from 2 to 4 weeks, both groups being under a basic maintenance therapy, and 26 healthy individuals vaccinated with the trivalent polymer-subunit vaccine Grippol® Plus, containing 5 µg of influenza virus strains and 500 µg of azoximer bromide. Results: Observing patients with asthma and COPD, during a year after the vaccination, has revealed a significant reduction in exacerbations frequency (p < 0.05) and duration (p < 0.05) of the bronchial obstructive syndrome (BF). Before the vaccination the IL-6 level in patients with asthma had a direct moderate correlation with duration of exacerbations of the underlying disease (p < 0.05), along with the number of systemic corticosteroids courses during exacerbations (p < 0.05). In 12 months after the vaccination, while assessing cytokine profile of all study groups, a significant reduction in the level of IL-6 was observed, compared to the baseline values (p< 0.05). Conclusion: Conducted analysis of immunological, clinical, and functional parameters of patients with asthma and COPD has proven for influenza vaccine to be effective in BF patients.

Although the effect of thermal modification (TM) on teak wood color is well documented, a few studies were carried out in closed system processes, as well as it remains unclear the effect of different processes on the same material. This work aimed to verify the effect of closed and open system processes of TM on the color of fast-growing teak wood. Thermally modified wood was evaluated in a closed system at 160 °C (CS160) and in an open system at 185 °C and 210 °C (OS185 and OS210). We measured the moisture content (initial and final) of wood, and the corrected mass loss (CML). The chemical analyses encompassed the contents of alpha-cellulose, hemicelluloses, lignin, and extractives (total, in acetone and dichloromethane). Wood color was measured before and after TM according to the CIEL*a*b* color space. It was possible to achieve the same color using different processes of thermal modification (CS160 and OS210). TM reduced wood lightness (L*), red-green chromaticity coordinate (a*), and yellow-blue chromaticity coordinate (b*). L* and a* had the bigger and lower variations, respectively. The color of thermally modified wood was significantly changed, even at the mildest condition tested (OS185, 0.33% CML).

In this study, we considered the structural stability, electronic properties, and phonon dispersion of the cubic (c-ZrO₂), tetragonal (t-ZrO₂), and monoclinic (m-ZrO₂) phases of ZrO₂. We found that the monoclinic phase of zirconium dioxide is the most stable among the three phases in terms of total energy, lowest enthalpy, highest entropy, and other thermodynamic properties. The smallest negative modes were found for m-ZrO₂. Our analysis of the electronic properties showed that during the m–t phase transformation of ZrO₂, the Fermi level first shifts by 0.125 eV toward higher energies and then decreases by 0.08 eV in the t–c cross-section. The band gaps for c-ZrO₂, t-ZrO₂, and m-ZrO₂ are 5.140 eV, 5.898 eV, and 5.288 eV, respectively. Calculations based on the analysis of the influence of doping 3.23, 6.67, 10.35, and 16.15 mol. %Y₂O₃ onto the m-ZrO₂ structure showed that the enthalpy of m-YSZ decreases linearly, which accompanies further stabilization of monoclinic ZrO₂ and an increase in its defectiveness. A doping-induced and concentration-dependent phase transition in ZrO₂ under the influence of Y₂O₃ was discovered, due to which the position of the Fermi level changes and the energy gap decreases. It has been established that, not only for pure systems but including those doped with Y₂O₃, the main contribution to the formation of the conduction band is made by the p-states of electrons. The t-ZrO₂ (101) and t-YSZ (101) surface models were selected as optimal surfaces for water adsorption based on a comparison of their surface energies. An analysis of the mechanism of water adsorption on the surface of t-ZrO₂ (101) and t-YSZ (101) showed that H₂O on unstabilized t-ZrO₂ (101) is adsorbed dissociatively with an energy of -1.22 eV, as well as by the method of molecular chemisorption with an energy of - 0.69 eV and the formation of a hydrogen bond with a bond length of 1.01 Å. In the case of t-YSZ (101), water is molecularly adsorbed onto the surface with an energy of -1.84 eV. Dissociative adsorption of water occurs at an energy of -1.23 eV, near the yttrium atom. The results show that ab initio approaches are able to describe the mechanism of doping-induced phase transitions in (ZrO₂+Y₂O₃)-like systems, based on which it can be assumed that DFT calculations can also flawlessly evaluate other physical and chemical properties of YSZ, which have not yet been studied quantum chemical research. The obtained results complement the database of research works carried out in the field of the application of biocompatible zirconium dioxide crystals and ceramics in green energy generation and can be used in designing humidity-to-electricity converters and creating solid oxide fuel cells based on ZrO₂.

PDMS samples may be used in various microfluidic applications by hydrophilizing their surfaces. This study examines the effects of air plasma jet (APJ) and dielectric barrier discharge (DBD) plasma on the surface hydrophilicity of polydimethylsiloxane. In order to increase the hydrophilicity of PDMS sample surfaces, two plasma sources including APJ and DBD were compared. Both DBD and APJ setups were measured for voltage and current, and their respective power was calculated and compared based on their characteristics. It is important to note that the electrical specifications of APJ and DBD were identical, and the source power rates for APJ and DBD plasma were 306W and 300W respectively. UV-vis spectroscopy was used to characterize the plasma, and an electrical characterization of the plasma's power supply was carried out. The effects of parameters such as the distance from the nozzle tip, the duration of the process, and the source voltage on the hydrophilicity of the surfaces during the treatment by APJ were also examined, and samples were then examined for a period of time to determine whether surface hydrophilicity was preserved. On the PDMS surface, a contact angle of about 5.1° was observed using short-term plasma treatments of 10 seconds. In the same conditions, the effect of DBD treatment was superior to that of APJ treatment.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The availability of multiple sequenced genomes from a single species made it possible to explore intra- and inter-specific genomic comparisons at higher resolution and build clade-specific pangenomes of several crops. The pan-genomes of crops constructed from various cultivars/accessions, landraces, and wild ancestral species represent a compendium of genes and structural variations and allow researchers to search for the novel genes and alleles that were inadvertently lost in domesticated crops during the historical process of crop domestication or in the process of extensive plant breeding. Fortunately, many valuable genes and alleles associated with desirable traits like disease resistance, abiotic stress tolerance, plant architecture, and nutrition qualities exist in landraces, ancestral species, and crop wild relatives. The novels genes from the wild ancestors and landraces can be introduced back to high-yielding varieties of modern crops by implementing classical plant breeding, genomic selection, and transgenic/gene editing approaches. Thus, pan-genomic represents a great leap in plant research and offers new avenues for targeted breeding for mitigating the impact of global climate change. Here we summarize the tools used for pangenome assembly and annotations, web-portals hosting plant pangenomes. Furthermore, we highlight a few discoveries made in crops using the pan-genomic approach and its future potential.

The outbreak of the COVID-19 pandemic has raised concerns about potential environmental factors that could influence the spread and severity of the SARS-CoV-2 virus. Atmospheric pollution, particularly particulate matter (PM), has been suggested as a contributing factor to viral infections and respiratory complications. This two-year observational study aimed to investigate the relation between air pollution and the spread of COVID-19, focusing on PM2.5. Unlike previous studies limited to specific cities or countries, inevitable to use temporal data. Our research analyzed data from various states across the United States, considering both spatial and temporal correlation. The analysis considered the number and geographic distribution of COVID-19 cases along with daily PM2.5 exposure levels, accounting for monthly average PM2.5 exposure, from March 2020 to December 2021. The observed conflicting results of the temporal and spatial correlation present challenges for researchers in understanding the true nature of the relationship between PM2.5 air pollution and COVID-19 cases. The correlation between various factors, such as population density, PM2.5, temperature, and wind speed, and COVID-19 refers to an association or statistical relationship, not causation. Moreover, the intricate interplay of these variables makes it difficult to establish a clear cause-and-effect relationship.

Building on the carbon reduction targets agreed in the Paris Agreements, many nations have renewed their efforts toward achieving carbon neutrality by the year 2050. In line with this ambitious goal, nations are seeking to understand the appropriate combination of technologies which will enable the required reductions in such a way that they are appealing to investors. Around the globe, solar and wind power lead in terms of renewable energy deployment, while carbon capture and storage (CCS) is scaling up toward making a significant contribution to deep carbon cuts. Using Japan as a case study nation, this research proposes a linear optimization modeling approach to identify the potential contributions of renewables and CCS toward maximizing carbon reduction and identifying their economic merits over time. Results identify that the combination of these three technologies could enable a carbon dioxide emission reduction of between 55 and 67 percent in the energy sector by 2050 depending on resilience levels and CCS deployment regimes. Further reductions are likely to emerge with increased carbon pricing over time. The findings provide insights for energy system design, energy policy making and investment in carbon reducing technologies which underpin significant carbon reductions, while identifying potential regional social co-benefits.

Intra-abdominal pressure (IAP) elevation during capnoperitoneum can cause adverse cardiovascular and respiratory effects. This study aimed to determine if a sequentially increased IAP affects cardiovascular and respiratory variables in anesthetized dogs and evaluate the effects of constant rate infusion of dexmedetomidine (Dex) on cardiovascular and respiratory variables with increased IAP. Five dogs were anesthetized, instrumented, and the Veress needle was equipped to adjust the IAP using a carbonic anhydrase insufflator. Stabilization was conducted for 1 h, and physiological variables were measured in IAPs of 0, 5, 10, 15, and 20 mmHg and after desufflation. After the washout period, the dogs underwent similar procedures along with constant rate infusion of dexmedetomidine. Cardiovascular effects of increased IAP up to 20 mmHg were not significant in healthy beagle dogs and those administered with dexmedetomidine. In the control group, the arterial pressure slightly increased, but not statistically significant, at an IAP of 20 mmHg compared with that at baseline (mean arterial blood pressure, p = 0.399; systolic arterial blood pressure, p = 0.293; diastolic arterial blood pressure, p = 0.141). When comparing the control and dexmedetomidine groups, overall significant effects of dexmedetomidine were noted on heart rate, cardiac output, and systemic vascular resistance during the experiment. Respiratory effects were not affected by abdominal insufflation when compared between different IAPs and between the two groups. Overall, an increased IAP of until 20 mmHg did not significantly affect cardiovascular and respiratory variables in both control and dexmedetomidine groups. This study suggests that dexmedetomidine infusion administration is applicable in laparoscopic procedures in healthy dogs.

The perceived poor performance of publicly traded companies on their sustainability commitments and the quality of sustainability reporting has prompted stakeholders to consider the economic, environmental, and social impacts of corporate activities. Economic activities have led to various threats in the form of climate change, pollution, greenhouse gas emissions, natural disasters, and other issues that have negatively impacted the environment and stakeholders. Companies are expected to report to stakeholders on their sustainability performance, but reality proves that present reporting falls below stakeholders’ expectations mainly due to its still voluntary nature. The present study aims to provide a literature review of the relationship between sustainability reporting and the role of companies governance, especially observing if climate change requirements and energy-needed changes are being accounted. Results highlight mixed evidence for the influence of board governance attributes, providing interesting insights for research advancement. The study has practical implications for businesses, regulators, governments, and other stakeholders in their policy deliberations and investment decisions. Further empirical studies are recommended to re-examine sustainability reporting using the variables identified as important factors and gaps in this study and other board characteristics to improve the generalizability of the results.

We have developed additive logistic models for the occurrence of lightning, large (≥ 2 cm), and very large (≥ 5 cm) hail to investigate the evolution of these hazards in the past, in the future, and for forecasting applications. The models, trained with lightning observations, hail reports, and predictors from atmospheric reanalysis, assign an hourly probability to any location and time on a 0.25° × 0.25° × 1-hourly grid as a function of reanalysis-derived predictor parameters, selected following an ingredients- based approach. The resulting hail models outperform the Significant Hail Parameter and the simulated climatological spatial distributions and annual cycles of lightning and hail are consistent with observations from storm report databases, radar, and lightning detection data. As a corollary result, CAPE released above the -10°C isotherm was found to be a more universally skilful predictor for large hail than CAPE. In the period 1950–2021, the models applied to the ERA5 reanalysis indicate significant increases of lightning and hail across most of Europe, primarily due to rising low-level moisture. The strongest modelled hail increases occur in northern Italy with increasing rapidity after 2010. Here, very large hail has become 3 times more likely than it was in the 1950s. Across North America trends are comparatively small, apart from isolated significant increases in the direct lee of the Rocky Mountains and across the Canadian Plains. In the southern Plains, a period of enhanced storm activity occurred in the 1980s and 1990s.

Nanoporous films of Eu-doped organosilicate glass (OSG) have been synthesized using sol-gel technology and spin-coating, employing evaporation-induced self-assembly (EISA), on silicon wafers. The Eu doping is achieved by dissolution of Eu(NO3)3·6H2O in the precursor solution. The deposited films are characterized by using Fourier transform infrared (FTIR) spectroscopy, ellipsometric porosimetry (EP), X-ray photoelectron spectroscopy (XPS) and photoluminescence spectroscopy. It is observed that Eu doping makes the films more hydrophilic and reduces the pore size and open porosity. The reduction Eu3+ → Eu2+ occurs in the pores of OSG films, which is confirmed by depth profiling XPS. However, Eu3+ still presents on the film’s top surface. Presence of Eu3+ and Eu2+ gives characteristic luminescence emission in the range of 600‒630 nm (Eu3+) and 290‒400 nm (Eu2+). The Eu2+/Eu3+ concentrations ratio depends on CH3 groups concentration in the films. Moreover, concentration of Eu2+ ions in the pores can be reduced by exposure in inductively coupled (ICP) oxygen plasma. The observed shift of the luminescence spectra towards the UV region, in comparison to previously reported Eu-doped organosilicate films, can be attributed to the energy transfer occurring between the host material and Eu2+ ions.

In the light of current justified international concerns about pollution caused by both greenhouse gases and by current agricultural practices, as well as the management of livestock manure, zeolite rocks with a prevalent zeolite content (a mineral endowed with peculiar chemical-physical properties), are widely used worldwide. They have a high extraction potential and represent an effective and scientifically proven means of pollution control. Moreover, based on the results of countless laboratory and field experiments, zeolitites (in particular Italian chabazite) rich in potassium (K) but low in sodium (Na) and with high drainage and water retention properties, have an effective potential for environmental protection, reduction of fertilizers and irrigation water, and increase of agronomic production. In agriculture and horticulture, in particular, the permanent correction of agricultural soils and growing media with appropriate amounts of zeolitites makes it possible to reduce the input of synthetic fertilizers and water as well, in order to substantially increase yields in quantity and quality. However, there are few scientific articles describing the use of zeolite in agriculture and its benefits for farmers. This review is aimed at gaining a better insight into the application of zeolitites in agriculture, particularly in difficult climatic situations, and to provide more information on how these minerals can ensure both the reduction of the use of fertilizers and the increase of plant protection. In addition, details and explanations are provided on the term 'zeolitite' used in order to ensure higher quality agricultural products.

Persistent Organic Pollutants (POP) such as dichlorodimethyltrichloroethane (DDT) are present and ubiquitous in the environment due to their resilient nature. DDT is a prevalent endocrine disruptor still found in detectable amounts in organisms and the environment even after its use was banned in the 1970s. Studies show that exposure to DDT can cause adverse health effects in humans and animals, impairing fertility and increasing the risk of developing cancer. The aim of this work is to provide a comprehensive overview of the available literature on the effect of DDT and its metabolites on female reproductive tract, leading to infertility and cancer. Medline and Google Scholar were systematically searched to detect all relevant animal and human studies published in the last 20 years (January 2003 to February 2023) in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-analyses (PRISMA) statement. In total, 38 studies were included for qualitative synthesis. This systematic search and review indicated that exposure to DDT is associated with female reproductive health decline and that DDT acts as a sufficient carcinogen instigating reproductive cancers.

Papain-like lysosomal cysteine proteases include 11 human cysteine cathepsins which act as endopeptidases and/or exopeptidases. They are involved in numerous physiological and pathological processes. Among them, only cathepsins B, H, C, and X/Z exhibit exopeptidase activity. Their activities are tightly regulated in various ways to prevent potentially hazardous effects on the cell. In this review, we focus on the structural and functional aspects of these four cysteine cathepsins and their role in neurodegeneration and cancer. Neurodegenerative disorders of aging share an endolysosomal dysfunction and accumulation and spread of oligomeric forms of neurotoxic proteins. The accumulation of various protein aggregates activates the microglia, thus inducing the activation and release of cysteine cathepsins and proinflammatory cytokines, leading to neurodegeneration. In cancer, cysteine cathepsins participate in tumor progression and metastasis. Tumor–stromal crosstalk leads to activation of the stroma and overexpression and secretion of proteolytic enzymes, triggering extracellular matrix degradation and the release of soluble factors. Activated stromal cells (i.e., macrophages, fibroblasts, mast cells) secrete additional growth factors, cytokines, and chemokines that are responsible for the regulation of processes leading to tumor progression and metastasis. Therefore, a better understanding of the role of cysteine cathepsins in neurodegeneration and cancer could lead to novel targeted therapeutic approaches.

Among all Brazilian economic sectors, the livestock sector stands out due to its large production and high export volume. However, beef production is associated to significant environmental impacts, such as deforestation and greenhouse gas (GHG) emission. The Paris Agreement was settled to avoid that global mean temperature rise up to 1.5 – 2º C by 2100. In 2020, Brazil committed in its nationally determined contribution (NDC) to reduce its GHG emission by 43% until 2030. This study aims to identify the association of beef production and beef cattle emissions, as well as assess predictive GHG emission scenarios for 2030 and value these emissions. To translate the environmental impacts of beef production into economic impacts, and thus amplify the discussion, we valued GHG emissions using the social cost of carbon (SCC). The results showed that the business as usual (BAU) GHG emission derived from beef production would range between 0.423 and 0.634 GtCO₂e in 2030, whereas the maximum emission estimated to meet the NDC should be 0.257 GtCO₂e. The SCC revealed the opportunity to reduce between US $18.8 and $42.6 billion in the cost of BAU emissions from beef production in 2030 if the NDC is met. Lastly, assessing a scenario where climate targets and beef exports are prioritized, between 2-10 kg of beef per capita would be available in the domestic market in 2030. Our results reveal the need and urgency of changes in livestock production to emit less GHG per kg of beef produced, and the avoided monetary cost of reducing emissions.

Development of agriculture in Russia and Belarus is based on the practical implementation of "smart" systems in agriculture based on the use of modern wireless, intelligent technologies and Internet of Things. This review presents research articles (mainly, in Russian) published in the period of 2013 – 2022 on the use of cloud technologies and Internet of Things for the development of agriculture in Russia and Belarus. An analysis of the use of cloud technologies and Internet of Things in the modern world is given on the basis of research articles and reviews published in English in the period of 2017 – 2022. The main directions of digitalization of modern agriculture are listed. The uses of cloud technologies and Internet of Things in agriculture are described along with promising directions for further research and applications.

The quality and safety of fermented milk products, which make up a sizeable portion of human nutrition, are greatly influenced by both the milk itself and the starting cultures employed to ferment it. Lactic acid bacteria (LAB) create a variety of metabolites throughout the fermentation process, altering the organoleptic properties of the substrates. The final product’s nutritional value and digestibility are enhanced by fermentation of the raw materials, which also adds vitamins, vital amino acids, and fatty acids. The quality and safety of fermented milk products, which make up a sizeable portion of human nutrition, are greatly influenced by both the milk itself and the starting cultures employed to ferment it. The inhibition of the growth of pathogenic microbes, which lowers the likelihood of the emergence of foodborne diseases, is another crucial function of LAB. A variety of pathogenic bacteria are frequently present in raw (unpasteurized) milk, and other raw materials; these pathogenic bacteria should be removed during the fermentation process. As a result, a variety of LAB metabolites, such as hydrogen peroxide, organic acids, and bacteriocins, function as bio preservative agents, enhancing food safety and lengthening the shelf life of the finished products.

Diverse development models, including waterfall development, iterative development, and agile development, have been put forth and implemented across real-world contexts. When engaging in discussions on project management, the examination and exploration of development models assume paramount importance and are integral. This paper embarks upon an investigation and scrutiny of these development models, culminating in the proposition of "Quasi" Development Models: Quasi-Waterfall and Quasi-Agile.

Angiotensin II (Ang II) plays a role in several inflammatory diseases and is capable of inducing the release of inflammatory mediators in several cell types. The objective was to investigate the potential of Ang II to induce mRNA expression of inflammatory mediators by cultured primary human periodontal cells. A synergistic effect of a co-treatment with Ang II and IL1β on mRNA expression of inflammatory mediators was also explored. Primary cultures of human fibroblast-like cells isolated from gingival and periodontal ligament tissues from 3 subjects were established using explant techniques. Immunophenotyping of STRO-1, Ang II type 1 receptor (AT1R) and Ang II type 2 receptor (AT2R) was performed by flow cytometry analysis. Cell cultures were challenged with Ang II (1M) for 3, 6 and 24h with or without a co-treatment with IL1β (0.1ng/mL) for 24h. mRNA expression of inflammatory mediators was performed by real time quantitative polymerase chain reaction (RT-qPCR). We present, for the first time, a precise quantification for AT1R and AT2R on human gingival and periodontal fibroblast-like cell types; the percentage of positive immunostaining compared to the total population of cells varied from 3.35% through 5.29% for AT1R and 2.97% through 4.57% for AT2R. Ang II slightly upregulated mRNA expression of IL6 and CCL2/MCP1 in gingival cells and IL8 and PTGS2/COX2 in periodontal ligament cells. IL1β induced upregulation of IL8, IL6 CCL2/MCP1, PTGS2/COX2 and IL1β mRNA in both cell types. Co-treatment with Ang II and IL1β did not show a synergistic effect under these experimental conditions. Ang II shows a low potential to induce mRNA upregulation of inflammatory mediators in cultured primary human gingival and periodontal ligament cells, most likely due to the low percentage of Ang II receptors in such cells, and no synergistic effect with the co-treatment with IL1β.

Inhibition of quorum sensing (QS)-dependent biofilm formation and virulence is extensively investigated as a novel approach to combat bacterial pathogens by impeding their ability to cause antibiotic-tolerant diseases. Such strategies are considered a promising alternative to conventional antibacterial therapy since interrupting the central cell-to-cell communication system imposes less selective pressure on the target pathogen. In this study, novel hybrid compounds composed of anthranilic acids substituted with halogens at different positions of the phenyl ring, and 4-(2-aminoethyl/4-aminobuthyl)amino-7-chloroquinoline linked via 1,3,4-oxadiazole were synthesized using standard procedures. Their anti-QS activities were evaluated using Chromobacterium violaceum ATCC31532 (anti-biofilm and bactericidal activities) and Pseudomonas aeruginosa PAO1 (anti-biofilm/-virulence activities). The results showed that compounds 15–19 and 23 inhibited the production of violacein, the QS-inducible pigment, in C. violaceum to a similar extent as the model QS inhibitor - quercetin (83.5–90%). Compound 15 exhibited the strongest effect on P. aeruginosa in the anti-biofilm screening, reducing its ability to form biofilm by almost 50%, while compounds 16 and 19 were able to reduce the biofilm formation by approximately 30%. However, compound 23 did not demonstrate significant anti-biofilm activity and only inhibited pyocyanin production in P. aeruginosa. In conclusion, this study suggests that 1,3,4-oxadiazoles 15, 16, and 19 are the most promising compounds for future research as novel QS inhibitors against Gram-negative bacteria equipped with different QS signaling pathways.

This study investigated the mechanical properties and fatigue behavior of FH36 steel plate rolled in different directions. By adopting a sequential rolling process in the rolling direction (RD) and transverse direction (TD), the differences in properties between RD and TD were eliminated, resulting in nearly identical tensile properties. The steel plate exhibited a yield strength of approximately 420 MPa, a tensile strength of approximately 506 MPa, and an elongation of approximately 25%. Fatigue tests conducted at room temperature and -60℃ showed a fatigue limit of the maximum stress of 488 MPa at room temperature and 500 MPa at -60℃, indicating improved low-temperature fatigue performance. The fracture surfaces displayed distinct characteristics, such as oblique shearing fractures for high-cycle fatigue and cup-cone shape fractures for low-cycle fatigue. The fatigue source zone were both on the surface of the specimens. As the maximum stress increased, the area of the crack propagation zone for high-cycle fatigue decreased, while the area of the final fracture zone, the number of dimples and the proportion of the LAGBs increased.

The present work was performed to evaluate the levels of phytochemical constituents and the antioxidant and antibacterial properties of marine red seaweed (Kappaphycus alvarezii) and seagrass (Cymodocea serrulata). Quantitative phytochemical analysis, antioxidant activity and antimicrobial activity against 5 potential pathogenic bacteria was investigated. In both cases were found presence of flavonoids, tannins, phenolic compounds, glycosides, steroids, carbohydrates and ashes. Alkaloids were only found in K. alvarezii, buy not in C. serrulata. The antimicrobial properties of both K. alvarezii and C. serrulata chloroform extracts were found to be antagonis-tically effective against the gram-positive bacterium Bacillus subtilis and the gram-negative bacterium Vibrio parahaemolyticus, Vibrio alginolyticus, Vibrio harveyi and Klebsiella pneu-moniae. GC‒MS analysis revealed the presence of 94 bioactive compounds in K. alvarezii and 104 C. serrulata, including phenol, decane, dodecane, hexadecane, vanillin, heptadecane, diphenyla-mine, benzophenone, octadecanoic acid, dotriaconate, benzene, phytol, butanoic acid, and 2-hydroxyl-ethyl ether, which played a vital role in antioxidant and antibacterial activities. Thus, in view of the results, both K. alvarezii and C. serrulata could be considered as sources of ingre-dients with appreciable nutritional and medicinal value.

The biological synthesis of nanoparticles has been emerging as an environmentally benign and eco-friendly method owing to its cost-effectiveness and high efficiency. Recently, the biological synthesis of semiconductor and metal-doped semiconductor nanoparticles with enhanced photocatalytic degradation efficiency and anticancer and antibacterial properties have gained tremendous attention. In pursuit of this purpose, for the first time, we biosynthesized zinc oxide (ZnO) and silver/ZnO nanocomposites (NCs) as semiconductor and metal-doped semiconductor nanoparticles, respectively, using the cell-free filtrate (CFF) of Lysinibacillus sphaericus bacterium. The biosynthesized ZnO and Ag/ZnO were characterized by various techniques such as ultraviolet-visible spectroscopy, X-ray diffraction, Fourier-transform Infrared spectroscopy, Field-emission scanning electron microscopy, transmission electron microscopy, and photoluminescence spectroscopy. The photocatalytic degradation potential of these semiconductor/metal-semiconductor nanoparticles was evaluated against the degradation of azo dye methylene blue (MB) under simulated solar irradiation. Ag/ZnO showed 90.7 ± 0.91% photocatalytic degradation of MB, compared to 50.7 ± 0.53% by ZnO in 120 min. The cytotoxicity of ZnO and Ag/ZnO on human cervical HeLa cancer cells was determined using an MTT assay. Both nanomaterials exhibited cytotoxicity in a concentration-dependent and time-dependent manner on HeLa cells. The antibacterial activity was also determined against Gram-negative (Escherichia coli) and Gram-positive (Staphylococcus aureus). Compared to ZnO, Ag/ZnO NPs showed higher antibacterial activity. Hence, the biosynthesis of semiconductor nanoparticles could be a promising strategy for developing hybrid metal/semiconductor nanomaterials for different biomedical and environmental applications.

In this paper, a distinction is first made between environmental, sustainable and green chemistry; the last two are then examined in relation to the more general problem of the environmental education. A brief historical digression on the STS (Science, Technology and Society) movement tries to dissect the reasons why chemistry is seen by the general public as a problem, not as a decisive resource for the realization of the ecological transition. Although sustainable and green chemistry can be decisive in overcoming the insularity of chemical disciplines in the high school, it fails to effectively embed itself in educational practices. Specific operational goals, supporting a real scientifical and technological literacy in sustainable and green chemistry, can help chemical educators. They are provided at the end of an examination of the founding axes of sustainable and green chemistry, according to the criteria of scientific and technological literacy.

Grain shape and chalkiness are important appearance quality traits of rice, which also affect the yield and milling quality. In this study, 190 F2 families derived from the cross between Hua 5178S and Hua 611 were sequenced to construct a genetic linkage map. Combined with F2 and F2:3 generations grain shape and chalkiness phenotype, a total of 15 QTL were detected. There are 8 grain shape QTL distributed on chromosomes 2, 5, 6, 8, and 10; 7 chalkiness QTL distributed on chromosomes 2, 3, and 6. A QTL cluster affecting multiple chalkiness traits was found on chromosome 6, qWBR6.1, qWCR6 and qCR6 were selected for genetic effect verification. It was found that qWBR6.1, qWCR6 and qCR6 explained 13% and 24%, and 29% of the phenotypic variations respectively, and qWCR6 and qCR6 were co-mapped. This study laid a foundation for further cloning of rice appearance quality genes.

Bacterial Extracellular Vesicles (BEVs) generated from the bacteria has high feasibility of intracellular interactions with other cells, can be used as a cargo to deliver any therapeutic substances like monoclonal antibodies, proteins, plasmids, siRNA and small molecules for the treatment of neurodegenerative diseases (NDs). BEVs have a high ability for delivering therapeutic molecules across the blood-brain barrier to treat Alzheimer's Disease (AD) via various mechanisms. In this review, we have sum up in-depth research details of the role and advancement of BEVs in NDs, AD and its Therapeutics. Moreover, details about offensive and defensive functions of BEVs in ND pathogenesis and examine the critical BEV networks in the microbiome-gut-brain axis and their role in neurodegenerative disorders. Additionally determining the roles of BEVs in the neuroimmune system and their interaction with neurodegenerative disorders and exploring the risk factors of BEVs in the autophagy-lysosomal pathway and their possible effects on neurodegenerative disorders are summarised in detail. In conclusion, this review seeks to contribute to a better understanding of the potential function of BEVs in NDs and to identify new therapeutic intervention strategies.

In the depths of inquiry, where thoughts unfurl like tendrils of smoke, this qualitative study ventures into the enigmatic realms of diaspora, migration, and the elusive brain drain within the tapestry of the Philippines. It is a journey guided by a sturdy theoretical framework, traversing the multifaceted dimensions of society, culture, and psyche. Here, the lens expands beyond the confines of economics, delving into the essence of these phenomena, seeking profound insights that dance beneath the surface. Through meticulous analysis of empirical data, hidden truths emerge, illuminating the intricate dynamics of diaspora, the intricate patterns of migration, and the intricate threads that shape migration decisions. Moreover, it peers into the intricate tapestry of impacts that diaspora and migration have on both sending and receiving societies, casting a beam of understanding upon their social, economic, and cultural implications. The study, in its wisdom, extends its reach to offer valuable policy recommendations, serving as a compass for stakeholders and decision-makers. It emphasizes the pivotal importance of harnessing the vast potential held within diaspora, fostering social integration, and bridging the gaps in knowledge that lie in wait. In its entirety, this research harmonizes with the existing body of knowledge, blending seamlessly with the symphony of understanding, and ignites the path towards evidence-based strategies that pave the way for sustainable development and the well-being of societies near and far.

With the introduction of more and more monoclonal antibodies selectively targeting various mediators of the immune-system, together with Janus-Kinase (JAK)-inhibitors with variable affinities towards different JAK subtypes, the available therapeutic options for the treatment of inflammatory bowel diseases (IBD) have undergone an acceleration in the last five years. On the other hand, the prevalence of IBD patients over 65-years of age is steadily increasing and, with this, there is a large population of patients that presents more comorbidities, polypharmacy, and, more frequently, frailty compared to younger patients, exposing them to potentially major risks for adverse events deriving from newer therapies, e.g. infections, cardiovascular risks, and malignancies. Unfortunately, pivotal trials for the commercialization of new therapies rarely include older IBD patients and those with serious comorbidities are virtually excluded. In the present review, we focus on existing literature from pivotal trials and real-world studies, analyzing data on efficacy/effectiveness and safety of newer therapies in older IBD patients with special emphasis on comorbidities and frailty, two distinct but intercorrelated aspects of the older population since age by itself seems to be of minor importance.

Abstract: Background: Adolescents frequently self-report pain, according to epidemiological research. The knee is one of the sites where the pain is most common. One of the main factors contributing to the number of years people spend disabled and having substantial personal, societal, and economic burdens globally is musculoskeletal disorders. Insidious, slowly building onset that neither the adolescent nor the parent is aware of [5]. Patellofemoral Pain (PFP) is a clinical knee pain commonly affecting adolescents. In the present study, the authors aimed to estimate the frequency of knee pain in Saudi adolescents. Methods: This cross-sectional survey carried out from June to November 2022 included 676 adolescents, ages 10 to 18. The data are presented as frequencies and percentages for categorical variables. Analysis of variance (ANOVA) was used to compare means between groups, while the chi-square test was used for the comparison of categorical variables. Statistical significance was set at p < 0.05. Results: Adolescents were invited to take part in the study; 57.5% were female and 42.5% were male, and 68.8% were aged between 15 and 18. The prevalence of knee pain was considerably high among females (26%), while it was 19.2% among males. Moreover, age was a significant predictor for knee pain, and BMI was as well. We also found a significant difference between BMI classification and stiffness of the knee (p = 0.008). There is a difference between adolescents who do physical activities in leisure and difficulty bending (p = 0.03). Conclusion: Our study noted a high rate of knee pain among adolescents, so we need to raise awareness about risk factors. Adolescent knee pain can be prevented with conservative methods and some minor lifestyle/activity modifications.

Delve into the ebb and flow of human ingenuity as the researcher traces the evolution of writing from papyrus to pixels. Discover how humble instruments like quill pens and typewriters have propelled human into the digital frontier, forever reshaping the art of expression in the modern age. This article examines the evolution of writing tools from traditional pen and paper to digital writing in the modern age. It explores the development of writing materials such as papyrus, parchment, and paper, as well as the invention of writing tools including quill pens, fountain pens, and typewriters. The rise of digital writing tools, including word processing software and smartphones, is also discussed, along with their benefits such as increased efficiency and productivity, enhanced collaboration and sharing capabilities, and greater accessibility and flexibility. However, the article also highlights the challenges of writing in the digital age, including the impact of digital distractions on writing focus and quality, the issue of online plagiarism and copyright infringement, and the potential loss of traditional writing skills. The article concludes with recommendations for educators, school administrators, students, and researchers to strike a balance between digital and traditional writing practices, to embrace digital writing tools while preserving traditional writing skills, and to understand the importance of the evolution of writing. The theoretical frameworks of Social Construction of Technology (SCOT) Theory, Media Ecology Theory, and Activity Theory are also discussed in relation to the evolution of writing tools. Overall, this article provides valuable insights into the history, benefits, and challenges of writing in the digital age, as well as suggestions for navigating the future of writing and its tools.

The identification and quantitative determination of wool and fine animal fibers are of great interest in the textile field because of significant price differences between them and common adulterations in raw and processed textiles. Since animal fibers have remarkable similarities in their chemical and physical characteristics, specific identification methods have been studied and proposed following advances in analytical technologies. The identification methods of wool and fine animal fibers are reviewed in this paper and the results of relevant studies are listed and summarized, starting from classical microscopy methods which are still used today not only in Small to Medium Enterprises but also in large industries, research studies and quality control laboratories. Particular attention has been paid to image analysis, Nir spectroscopy and proteomics which constitute the most promising technologies of quality control in the manufacturing and trading of luxury textiles and can find application in forensic science and archeology.

In the current socio-economic context, pension systems have become a crucial topic in the agenda of governments and international bodies. In this paper, an empirical study regarding the economic and social sustainability of pension systems in Central and Eastern European Countries was performed. The goal of the research is to establish the sustainability of pension systems with econometric modeling techniques on three dimensions as the research hypotheses are revealed: first, by strengthening the financial soundness of pension systems; second, consolidating the economic environment of pension systems; third, increasing the degree of social security systems with a direct effect of reducing poverty. The results led to relevant insights emphasizing the need for more inclusive economic, financial, and social reforms. From a policy perspective, these findings could be a starting point for the enhancement of the financial adequacy and economic and social sustainability of pension systems in Central and Eastern European Countries. The econometric techniques in this study highlight those modern pensions systems that need to be addressed in a more complex and empirical context that must encompass the main technical aspects. The conclusions suggest that in the future it needs judicial, economic, and social adjustments for the enhancement of the financial soundness of the pension systems.

The positive impact of nature on human health has been explored by researchers. Although studies have indicated that olfaction and odors have an impact on both memory and health, re-search on the odor perception in relation to perceived health is scarce. A recent study found that the naturenatural scent from stem cuttings and potted plants of a specific rose-scented geranium Pelargonium graveolens, ‘Dr. Westerlund,’Westerlund’ had positive effects on stress-related mental disorders. reduction. Essential oils from many Pelargonium species, in particular ‘Dr. Westerlund’, are known to have phytochemical properties and pharmacological activities. No study has, so far, explored and identified the chemical com-pounds and the sensory perception of these compounds in stem cuttings and the potted ´Dr. Westerlund´ plantplants. Such knowledge would be an important contribution forto an increased understanding of the effects of plants’ chemical odor properties on human well-being and link this to the expressed perceived scents. Resulting sensory profiles of P.This study aimed to identify the sensory profile and suggest responsible chemical compounds of Pelargonium graveolens ´Dr. Westerlund´ as a potted plant and as stem cuttings were reported, as well as´. The sensory and chemical analysis results revealed sensory profiles of Pelargonium graveolens ´Dr. Westerlund´s, and suggestions for the chemical compounds that are attributed to the sensory profiles. Further studies are recommended to investigate the odor experience of scented pelargonium species in relation to various levels ofcorrelation between volatile com-pounds and possible stress hormones. reduction in humans.

In the last two decades many detailed full transcriptomic studies on complex biological samples have been published and included in large gene expression repositories. These studies primarily provide bulk expression signal for each sample, including multiple cell-types mixed within the global signal. The cellular heterogeneity in these mixtures does not allow the activity of specific genes in specific cell types to be identified. Therefore, inferring relative cellular composition is a very powerful tool to achieve a more accurate molecular profiling of complex biological samples. In recent decades, computational techniques have been developed to solve this problem by applying cell deconvolution methods, designed to decompose cell mixtures into their cellular components and calculate the relative proportions of these elements. Some of them, only calculate the cell proportions (supervised methods), while other deconvolution algorithms can also identify the gene signatures specific for each cell type (unsupervised methods). In these work, five deconvolution methods (CIBERSORT, FARDEEP, DECONICA, LINSEED and ABIS) were implemented and used to analyze blood and immune cells, and also cancer cells, in complex mixture samples (using three bulk expression datasets). Our study provides three analytical tools (corrplots, cell-signature plots and bar-mixture plots) that allow a thorough comparative analysis of the cell mixture data. The work indicates that CIBERSORT is a robust method optimized for the identification of immune cell-types, but not as efficient in the identification of cancer cells. We also observed that LINSEED is a very powerful unsupervised method that provides precise and specific gene signatures for each of the five main immune cell-types analyzed: neutrophils and monocytes (in the myeloid lineage), B-cells, NK cells and T-cells (in the lymphoid lineage).

Angiotensin II (Ang II) plays a role in several inflammatory diseases and is capable of inducing the release of inflammatory mediators in several cell types. The objective was to investigate the potential of Ang II to induce mRNA expression of inflammatory mediators by cultured primary human periodontal cells. A synergistic effect of a co-treatment with Ang II and IL1β on mRNA expression of inflammatory mediators was also explored. Primary cultures of human fibroblast-like cells isolated from gingival and periodontal ligament tissues from 3 subjects were established using explant techniques. Immunophenotyping of STRO-1, AT1 and AT2 receptors was performed by flow cytometry analysis. Cell cultures were challenged with Ang II (1M) for 3, 6 and 24h with or without a co-treatment with IL1β (0.1ng/mL) for 24h. mRNA expression of inflammatory mediators was performed by real time quantitative polymerase chain reaction (RT-qPCR). We present, for the first time, a precise quantification for AT1 and AT2 receptors on human gingival and periodontal fibroblast-like cell types; the percentage of positive immunostaining compared to the total population of cells varied from 3.35% through 5.29% for AT1 and 2.97% through 4.57% for AT2. Ang II slightly upregulated mRNA expression of IL6 and CCL2/MCP1 in gingival cells and IL8 and PTGS2/COX2 in periodontal ligament cells. IL1β induced upregulation of IL8, IL6 CCL2/MCP1, PTGS2/COX2 and IL1β mRNA in both cell types. Co-treatment with Ang II and IL1β did not show a synergistic effect under these experimental conditions. Ang II shows a low potential to induce mRNA upregulation of inflammatory mediators in cultured primary human gingival and periodontal ligament cells, most likely due to the low percentage of Ang II receptors in such cells, and no synergistic effect with the co-treatment with IL1β.

Background: This literature review investigates qualitative and quantitative uses of indocyanine green (ICG) in surgical treatment, as this novel technique has become increasingly popular in ORs (operating rooms) worldwide due to its many advantages. Method: An extensive literature review was performed by searching for relevant terms in 5 international databases (www.pubmed.gov, www.sciencedirect.com, www.scopus.com, www.Oxfordjournals.com, www.reaxys.com). The results of this search were summarized into the main advantages of employing ICG in colorectal surgery as follows: a) intraoperative fluorescence angiography capability; b) fluorescence-guided identification of lymph node involvement in colorectal cancer and the sentinel lymph node method; c) positive fluorescence flagging of a liver tumour as small as "only" 200 tumour cells; d) facilitation of fistula diagnosis; and e) tumour tattooing. Moreover, in addition to qualitative intraoperative ICG use, this technique can be combined with quantitative methods and parameters, such as maximum intensity, relative maximum intensity, and different inflow parameters (time-to-peak, slope, and t1/2max). The conclusion of this article is that fluorescence surgery with ICG aided by near-infrared (NIR) light is a relatively recent technology, an advantage of which is improving the specific anatomic and functional information provided, thus allowing more comprehensive and safer tumour removal as well as preservation of important structures.

The article presents the results of the γ-ray and fast neutrons impact on various rice species, in order to obtain mutant forms resistant to salinity (NaCl) and drought factors (sorbite). They are going to be used as initial forms in synthetic selection when creating varieties, adapted to the stressful conditions of, both, soil and climate in the Kazakhstan Aral Sea. The average lethal doses (LD50) of γ-rays and fast neutrons, as well as, the average NaCl and sorbite lethal concentrations were established. A distinct dependence on the effect of ionizing radiation and stress factors on the number of induced resistant mutant forms has been related to the initial rice variety. The largest number of mutant forms was obtained from the local variety Syr Suluy, followed by Leader and Aikerim varieties. Out of all varieties, only 1% of the initially irradiated by γ-rays seeds survived, while after fast neutron irradiation – 4,3%. M1 mutant plants significantly differ from the initial forms in terms of morphological features – plant height, panicle length, and grain size. They are tolerant to lodging, and have short and highly sterile panicles, indicating that they are mutants.

Background: Hepatic erythrophagocytosis is augmented in NASH and amplifies inflammation and fibrosis. Although various pro-phagocytic signals have been identified on erythrocytes of NASH patients, the role of bound thrombospondin-1 (TSP-1), which acts as an “eat-me” signal, arginase-1, which regulates the levels of nitric oxide in erythrocytes, and phosphatidylethano-lamine (PE) which can amplify erythrophagocytosis and hepatic inflammation have not been explored. Hence, we sought to investigate the levels of arginase-1 and TSP-1 in erythrocyte lysate and PE in erythrocyte membranes of NASH patients. Methods: Twenty-four patients and 14 healthy controls participated in our study. The levels of TSP-1 and arginase were quantified by ELISA in erythrocyte lysates, and the levels of PE in erythrocyte membranes by thin layer chro-matography. Results: Erythrocytes of NAFLD patients exhibit lower levels of arginase-1 and TSP-1 (p<0.01). Erythrocyte-bound TSP-1 levels correlated with the levels of erythrocyte surface CD47. Phosphatidylethanolamine was increased in erythrocytes of NASH patients and was accompanied by increased release, indicating exposure. Conclusion: Our results imply reduced TSP-1 binding by erythrocytes which could allow free TSP-1 molecules to act on macrophages, enhancing erythrophagocytosis. Increased PE which could amplify inflammation after efferocytosis, while downregulation of arginase-1 could lead to defective efferocytosis.

Breast and Cervical cancer are significant causes of morbidity and mortality among women worldwide. Usually, conventional therapies and early detection has shown success in metastasis and relapse rates and improved overall survival of the patients. The elimination of the efficacy of chemotherapies and target therapies because cancer stem cells create resistance against chemotherapy, metastasis, and relapse. Studies reveal that cancer stem cell markers are important for improving efficiencies of targeted therapies. Our study aims to analyze the stem cell markers and target the most significant stem cell marker by phytochemicals and their derivates. Through the analysis, it was observed that CXCR4 and SOX-2, mir-1, mir-125, and mir-429 may have a crucial role in stemness of breast and cervical cancer respectively, while BPMD & MD simulations revealed Di-valinoyl curcumin as a potential compound for CXCR4 targeting.

Solid oxide cells are capable of efficiently converting various chemical energy carriers to electricity and vice versa. The urgent challenge nowadays is the faster degradation rate compared with other fuel cell/electrolyzer technologies. To understand the degradation mechanisms, simulation of a solid oxide cell is helpful. Since most previous research developed models using commercial software, such as COMSOL and ANSYS Fluent, a gap for knowledge transfer is being gradually formed between academia and industry due to licensing issues. This paper introduces a multiphysics model, developed by a computational code, openFuelCell2. The code is implemented with an open-source library, OpenFOAM. It accounts for momentum transfer, mass transfer, electrochemical reactions and metal interconnect oxidation. The model can precisely predict I-V curves under different temperatures, fuel humidity and operation modes. Comparison between OpenFOAM and COMSOL simulations shows good agreement. The metal interconnect oxidation is modelled, which can predict the thickness of the oxide scale under different protective coatings. Simulations are conducted by assuming an ultra-thin film resistance on the rib surface. It is revealed that coatings fabricated by atmospheric plasma spraying can efficiently prevent metal interconnect oxidation, with a contribution of only 0.53 \% to the total degradation rate.

The exceptional Jordan algebra is the algebra of $3 \times 3$ Hermitian matrices with octonionic entries. It is the only one from Jordan’s algebraic formulation of quantum mechanics which is not equivalent to the conventional formulation of quantum theory. It has often been suggested that this exceptional algebra could explain physical phenomena not currently explained by the conventional approach, such as values of the fundamental constants of the standard model of particle physics, and their relation to gravitation. We show that this is indeed the case; and this also unravels the connection between general relativity and the weak force. The exceptional Jordan algebra also predicts a new U(1) gravitational interaction which modifies general relativity, and which provides a theoretical basis for understanding the Modified Newtonian Dynamics (MOND).

The effects of 0.4wt.% Sc addition on a typical Al-Si10-Mg alloy were systematically investigated in the present research. Samples with and without Sc produced refined dendritic arranged microstructures with sensitivity to the aging treatment after solidification, particularly in the case of the alloy without Sc. After being exposed to 300°C for 90 minutes, the dendritic spacing nearly doubled in the Al-10wt.%Si-0.45wt.%Mg samples. The rapidly solidified microstructures were constituted by the -Al dendritic phase surrounded by eutectic phases/intermetallics such as Si, Mg2Si and Al3Sc (in the case of the alloy containing Sc). 255°C and 300°C were deemed most appropriate temperatures for aging treatments, with four exposure times of up to 120 minutes tested for each alloy. The heat treatments allowed the Vickers hardness profiles to be plotted and compared. Moreover, in order to detect both Sc- and Mg- precipitates after aging, specific samples have been prepared for either SEM or TEM analyses. At first, the results pointed to a strong precipitate-related hardening effect formed as a result of the Sc addition to the alloy. All samples containing Sc showed a higher hardness value when compared to their respective treated samples without Sc. Secondly, when comparing the Al-10Si-Mg-Sc alloy samples among themselves after being treated at different conditions, high temperatures and excessive treatment times can become detrimental to the hardness. This was due to the growth of larger Sc-bearing precipitates of approximately 1 µm in size under such conditions, having less pronounced hardening effect. The best condition (255°C for 60 min) for as centrifuged samples in Cu-mold produced very fine dispersion of Mg- and Sc- intermetallics (~200 nm in size) with a peak hardness of 110 HV.

Ultraviolet (UV) radiation has both harmful and beneficial effects on human health. It can cause skin damage and cancer, but also provides the primary source of vitamin D. Additionally, UV radiation affects energy metabolism in mice with metabolic diseases and has protective effects on hypertension and cardiovascular diseases.Metabolic Syndrome is a collection of metabolic dysfunctions such as dyslipidemia, hypertension, hyperglycemia, abdominal/central obesity, and insulin resistance. Chronic UVR exposure suppressed obesity and type 2 diabetes in high-fat diet-fed mice, while vitamin D supplementation did not replicate these effects. On the other hand, topical application of nitric oxide (NO) donors replicated UV effects on mice, and NO scavengers prevented the positive impact of UV. UVR may prevent the development of obesity and metabolic syndrome through mechanisms that depend on UVR-induced NO, not vitamin D. Exposure to sunshine has a protective impact on blood pressure and cardiovascular disease. Although lower vitamin D concentration is linked to increased hypertension and the incidence of CVD, oral vitamin D supplementation does not decrease blood pressure or the risk of CVD, indicating that vitamin D may not mediate the beneficial effects of sun exposure. Instead, NO plays a crucial role as an endogenous vasodilator, produced by the vascular endothelium. Solar UVA may release nitrogen oxides from skin storage into the bloodstream, lowering blood pressure and cardiovascular mortality.In conclusion, UVR exposure could be a promising non-pharmacological intervention for metabolic syndrome, hypertension, and CVD prevention, and NO may play a crucial role in mediating these effects. Further research is needed to explore the precise mechanisms and identify the optimal doses and exposure times of UVR.

The G2 gas cloud motion data and the scarcity of observations on the event horizon-scale distances have challenged the comprehensiveness of the central supermassive black hole model. In addition, the Planck Legacy 2018 release has preferred a positively curved early Universe with a confidence level higher than 99%. This study investigates the impact of the background curvature and its evolution over the conformal time on the formation and morphological evolution of central compact objects and the consequent effect on their host galaxies. The formation of a galaxy from the collapse of a supermassive gas cloud in the early Universe is modeled based on interaction field equations as a 4D relativistic cloud-world that flows and spins through a 4D conformal bulk of a primordial positive curvature considering the preference of the Planck release. Owing to the curved background, this scenario of galaxy formation reveals that the core of the galaxy undergoes a forced vortex formation with a central event horizon leading to opposite vortices (traversable wormholes) that spatially shrink while evolving in the conformal time. It indicates that the galaxy and its core are formed in the same process whereas the surrounding gas clouds form the spiral arms due to the frame-dragging induced by the fast-rotating core. It demonstrates that the accretion flow onto the central supermassive compact object only occurs at the central event horizon of the two opposite vortices while their other ends eject the relativistic jets. This can elucidate the relativistic jet formation and explain the G2 gas cloud motion if its orbit is around one of the vortices but at a distance from the central event horizon. The gravitational potential of the early curved bulk could contribute to galaxy formation while the present spatial flatness deprives the potential of bulk which could lead to galaxy quenching. The formation of a galaxy and its core simultaneously could explain the growth of the supermassive compact galaxy core to a mass of ~10⁹ M_⊙ at just 6% of the current Universe age.

The by-products of the juice and cider industry in forms of pomace and peels are rich sources of pectin which further can be used in the food, cosmetic and non-food industries. The aim of the research was to use by-products from fruits and berries grown in Latvia: Rhubarb (Rheum rhabarbarum); Apples (Malus domestica); Plums (Prunus domestica); Red Currants (Ribes rubrum); Black Currants (Ribes nigrum); Gooseberries (Ribes uva-crispa); Sour Cherries (Prunus cerasus); Pumpkins (Cuccurbita spp.) for pectin extraction. Citric acid (0.1 N) was used for the hot water extraction. The yield of pectin (PY = 4.47 – 17.8 % DM) and physicochemical parameters of obtained pectin were determined: methoxy degree (ME = 4.27 – 8.13 %), esterification degree (DE = 45.16 % – 64.06 %), anhydrouronic acid content (AUA = 38.23.% - 84.74 %); moisture content (5.2 – 7.4 %), ash content (1.42 - 2.88 g 100 g-1), total phenolic content (TPC = 2.076 – 4.668 GAE, mg L-1) and antiradical scavening activity (DPPH Method (0.56 – 37.29 %)). Pectin analysis was performed by FT-IR and the rheological properties of pectin gels were determined.

The addition of prebiotics is one of the most important ways to improve the techno-functional properties of bread. In this study, the effects of resistant starch, polydextrose, and inulin on the wheat flour, dough, and bread properties were investigated. In farinography results, resistant starch significantly increased the development time (2:18) with a boosting effect, but polydextrose (1:48) and inulin (1:36) weakened the dough (P &lt;0.05). Inulin, polydextrose, and resistant starch had the most effect on reducing water absorption (40, 43.2, and 48.9) respectively (P &lt;0.05). According to extensography data, inulin had the best result in baking compared to other polysaccharides. In terms of baked breads, samples containing resistant starch had high moisture that could be due to starch gelatinization and moisture-retaining, which delays the staling process of bread. Inulin, polydextrose, and resistant starch prebiotic ingredients affected dough rheological properties and bread quality, and organoleptic characteristics, however, resistant starch was the best.

Antimicrobial resistance is on the rise, and there aren't enough new treatments to combat it. This might send the modern world back to the pre-antibiotic age. The molecular hybrids of pyrazolo[3,4-b]pyridine and triazole have been designed, synthesized, and analyzed for their drug-like molecule nature and in vitro analyses for their inhibition potentials against S. Aureus and K. Pneumoniae. The compounds CY-R2-25 and CY-R2-28 have been identified as the high potential molecules in this series based on in vitro experiments. CY-R2-25 has zone of inhibition values of 15 0.82 and 14 0.7, whilst CY-R2-28 has the zone of inhibition values of 18 0.95 and 16 0.82 against S. Aureus and K. Pneumoniae, respectively. MIC and MIB values for CY-R2-25 and CY-R2-28 against S. Aureus and K. Pneumoniae are 0.25 and 0.5, respectively.

Contamination with Arsenic, a toxic metalloid, is increasing in the marine environment. Additionally, global warming can alter metalloids toxicity. Polychaetes are key species in marine environments. By mobilizing sediments, they play vital roles in nutrient and element (including contaminants) cycles. Most studies with marine invertebrates focused on the effects of metalloids on either adults or larvae. Here we bring information on the effects of temperature increase and arsenic contamination on the polychaete Hediste diversicolor in different growth stages and water temperatures. Feeding activity and biochemical responses – neurotransmission, indicators of cell damage, antioxidant and biotransformation enzymes and metabolic capacity - were evaluated. Temperature rise combined with As imposed alterations on feeding activity and biochemical endpoints at different growth stages. Small organisms have their antioxidant enzymes increased, avoiding lipid damage. However, larger organisms are the most affected class due to inhibition of superoxide dismutase, which resulted in protein damage. Oxidative damage was observed on smaller and larger organisms exposed to As and 21 °C, demonstrating higher sensibility to the combination of temperature rise and As. The observed alterations may have ecological consequences, affecting the cycle of nutrients, sediment oxygenation and the food chain that depend on the bioturbation of this polychaete.

Hilbert arithmetic in a wide sense, including Hilbert arithmetic in a narrow sense consisting by two dual and anti-isometric Peano arithmetics, on the one hand, and the qubit Hilbert space (originating for the standard separable complex Hilbert space of quantum mechanics), on the other hand, allows for an arithmetic version of Gentzen’s cut elimination and quantum measurement to be described uniformy as two processes occurring accordingly in those two branches. A philosophical reflection also justifying that unity by quantum neo-Pythagoreanism links it to the opposition of propositional logic, to which Gentzen’s cut rule refers immediately, on the one hand, and the linguistic and mathematical theory of metaphor therefore sharing the same structure borrowed from Hilbert arithmetic in a wide sense. An example by hermeneutical circle modeled as a dual pair of a syllogism (accomplishable also by a Turing machine) and a relevant metaphor (being a formal and logical mistake and thus fundamentally inaccessible to any Turing machine) visualizes human understanding corresponding also to Gentzen’s cut elimination and the Gödel dichotomy about the relation of arithmetic to set theory: either incompleteness or contradiction. The metaphor as the complementing “half” of any understanding of hermeneutical circle is what allows for that Gödel-like incompleteness to be overcome in human thought.

Oral immunization with the choleric toxin (CT) elicits a high level of protection against its enterotoxin activities and can control cholera in endemic settings. However, the complete B-cell epitope map of the CT responsible for protection remains to be clarified. Here, we have mapped the B-cell linear epitopes of the three chains of the CT protein (CTP) prepared by Spot synthesis. The immunoreactivity of sera from mice immunized with an oral, inactivated vaccine (Schankol†™) was measured against membrane-bound peptides for mapping. Results: Eighteen IgG epitopes were identified; eight in the CTA, three in the CTB, and seven in the protein P. Three epitopes, TQTGFVRHDDGYVST (aa 66-77, Vc/TxA-3), KNGAIFQVE VPGSQN (aa 64-78, Vc/TxB-11), and LNDEHK (aa 90-95, Vc/TxP-16), were chosen to synthesize a multiple antigen peptide that was used to coat ELISA plates to screen immunized mouse sera as a test for an in vitro diagnostics for cholera. Conclusion: Vaccination with inactive CT-generated antibodies against multiple linear epitopes and the selected epitopes can be used to construct immunological reagents for rapid serological diagnosis of cholera with high sensitivity and specificity.

Various factors, such as uncertainty of component parameters and uncertainty of sensor meas-urement values, contribute to the difficulty of fault detection in the landing gear retrac-tion/extension hydraulic system. In this paper, we introduce linear fractional transformation technology and uncertainty analysis theory for the construction of the diagnostic bond graph of the landing gear retraction/extension hydraulic system. In this way, interval analytical redundancy relations and fault signature matrix can be derived. Using the fault signature matrix, existing faults of the system can be preliminarily detected and isolated. Additionally, interval analytical re-dundancy relations can be used to detect system faults in detail, and cases analysis can be carried out to determine if the actuator is externally or internally leaky, and if the landing gear selector valve is reversing stuck. Compared to the traditional analytical redundancy relations, this method takes into account the negative factors of uncertainty; and compared to the traditional absolute diagnostic threshold, the interval diagnostic threshold is more accurate and sensitive.

Emerging RNA virus infections are a growing concern among domestic bird and poultry industries due to the severe impact it can have on the flock health and economic livelihoods. Avian paramyxoviruses (APMV) are pathogenic, negative sense RNA viruses that cause serious infections in the respiratory and central nervous system. APMV was detected in multiple avian species during the 2017 migration season in Ukraine, and studied using PCR, virus isolation, and sequencing. Of the 4090 wild bird samples, eleven swabs were isolated in chicken embryos and identified for APMV serotype by hemagglutinin inhibition test: APMV-1, APMV-4, APMV-6, APMV-7. At a variety of sites in Ukraine we characterized the virulence of the virus and further analyzed and predicted the potential risks of spillover to immunologically naïve populations. RNA was extracted and amplified using a multiplex-tiling primer approach to encompass full cDNA genomes. Full-length APMV-1 (n=5) and APMV-6 (n=2) genomes were sequenced on an Oxford Nanopore MinION device in Ukraine. All APMV-1 and APMV-6 fusion (F) proteins possessed a monobasic cleavage site, suggesting these APMV were likely low virulence, annually circulating strains. Utilization of this low-cost method will identify gaps in viral evolution and circulation in this understudied but important critical region for Eurasia.

The aims of the study are: a) Describe the reactogenicity of WHO-approved two mRNA (Pfizer-BioNTech, Moderna) and two non-RNA vaccines (Oxford-AstraZeneca, Sinovac) among lactating mother and baby pairs; and b) compare and contrast the reactogenicity between mRNA and non-mRNA vaccines. A cross-sectional, self-reported survey was conducted amongst 1784 lactating women who received COVID-19 vaccinations. The most common maternal adverse reaction was a local reaction at the injection site; the largest minority of respondents, 43.7% (780/1784), reported experiencing worse symptoms when receiving the second dose compared to the first dose. There were no major reported adverse effects or behavioural changes in the breastfed infants. Among the respondents who received non-mRNA COVID-19 vaccinations, a majority reported no change in lactation but those who did more commonly reported an increase in milk supply, decrease in milk supply and pain in the breast. The more commonly reported lactation changes (fluctuations in breastmilk supply and pain in the breast) for the non-mRNA vaccines were similar to that of respondents who received mRNA vaccines. Our study, with a large cohort and wide geographical and racial mix, further augments earlier reported findings that COVID-19 vaccines are safe for breastfeeding mothers and her children.

In the current research work, electrical resistance tomography (ERT) was employed for crystallization process monitoring and visualization. A first-of-its-kind MATLAB-based interactive GUI application “ERT-Vis” is presented. Two case studies involving varied crystallization methods were undertaken. The experiments involving calcium carbonate reactive (precipitative) crystallization for the high conductivity solution-solute media and the cooling crystallization for sucrose crystallization representing the lower conductivity solution-solute combination were designed and performed. The software successfully provided key insights regarding the process progress in both crystallization systems. It could detect and separate the crystal agglomerations in the low as well as high conductivity solutions using visual analytics tools provided. The performance and utility of the software were studied using a software evaluation case study involving domain experts. Participant feedback indicated that ERT-Vis software helps in reconstructing images instantaneously, interactively visualizing, and evaluating the output of the crystallization process monitoring data.

About 70% of children and adolescents with cerebral palsy experience gait impairments which affect their autonomy and well-being. Robotic-assisted gait training using the Lokomat is particu-larly promising for rehabilitation as it provides a standardized environment favoring the massive repetition of the movement, in which physical demands are low on the therapist and high training loads can be achieved. As no guidelines exist regarding training protocols and Lokomat settings, the goal of this study was to review the literature on Lokomat-assisted gait therapy and possibly make training recommendations. The twelve studies reviewed reported both positive and null effects of Lokomat training on gait. Half of the studies combined Lokomat with other types of training and only five used a control intervention to assess its benefit. Overall, training was administered 1-5 times per week for 20-60 minutes, over 1-12 weeks. Although Lokomat settings were not always described, progressively decreasing body-weight support and guidance, while increasing treadmill speed appear to be prioritized. The variety of training protocols and settings used did not allow pooling of the studies to assess effects of interventions on gait parameters in children and adoles-cents with cerebral palsy. This review highlights the need for homogenization of interventions so that clear guidelines can emerge and be applied in rehabilitation centers.

Bacterial vaginosis (BV), the most common cause of vaginal discharge, is characterized by a shift in the vaginal microbiota from lactobacillus dominance to a diverse array of facultative and strict anaerobic bacteria which form a multi-species biofilm on vaginal epithelial cells. The rate of recurrence after therapy is high, often >60%. While the BV biofilm itself likely contributes to recurrent and/or refractory disease after treatment by reducing antimicrobial penetration, antimicrobial resistance in BV-associated bacteria including those, both within the biofilm and the vaginal canal, may be the result of independent, unrelated bacterial properties which are discussed in this paper. Our current recommendations for the treatment of refractory and recurrent BV are also provided.

This paper aims to raise awareness on certain interoperability issues as we intend to shape industry 5.0 in order to enable a human-centric resilient society. We advocate that the need of sharing small and specific data will become more intensive as AI-based solutions will become more pervasive. Consequently, dataspaces should be carefully designed to address this need. We advance the conversation by presenting a case study from HR demonstrating how to predict the possibility of an employee experiencing attrition. Our experimental results show that we need more than 500 samples for developing a machine learning model to be sufficiently capable to generalize the problem. Consequently, our experimental results show the feasibility of the idea. However, in small and medium sized companies this approach cannot be implemented due to the limited number of samples. At the same time, we advocate that this obstacle may be overcome if multiple companies will join a shared dataspace, thus raising interoperability issues

The Environmental interactions contributed to the processes of settlement and development of the first settlers at southern Peru 15,000 BC. The determination of this process is based on paleoclimatic studies at southern Peru and ethnoarchaeological evidence. The determination of this process is based on paleoclimatic studies of southern Peru and ethnoarchaeological evidence; establishing as a result of this analysis the hypothesis of environmental interaction and territorial occupation of the first hunter-gatherer populations until their consolidation, dominating the geographical space from Tacna. The Disruptive disaster events and their effects on climate during the Peruvian Paleolithic resulted in the origin of local societies that shaped the Tiawanaku societies of the early horizon at Southern Peru and Northern Chile.

Amyotrophic Lateral Sclerosis (ALS) is a prototypical neurodegenerative disease characterized by progressive degeneration of motor neurons to severely effect the functionality to control voluntary muscle movement. Most of the non additive genetic aberrations responsible for ALS make its molecular classification very challenging along with limited sample size, curse of dimensionality, class imbalance and noise in the data. Deep learning methods have been successful in many other related areas but have low minority class accuracy and suffer from the lack of explainailbilty when used directly with RNA expression features for ALS molecular classification. In this paper we propose a deep learning based molecular ALS classification and interpretation framework. Our framework is based on training a convolution neural network (CNN) on images obtained from converting RNA expression values into pixels based on DeepInsight similarity technique. Then we employed Shapley Additive Explanations (SHAP) to extract pixels with higher relevance to ALS classifications. These pixels were mapped back to the genes which made them up. This enabled us to classify ALS samples with high accuracy for a minority class along with identifying genes that might be playing an important role in ALS molecular classifications. Taken together with RNA expression images classified with CNN, our preliminary analysis of the genes identified by SHAP interpretation demonstrate the value of utilising Machine Learning to perform molecular classification of ALS and uncover disease-associated genes.

Cancer is a prevalent disease worldwide and treatments such as radiotherapy and chemotherapy sometimes lead to adverse events. Oral mucositis is one of the most disabling and clinical guidelines do not take into account nutritional interventions. The primary endpoint was to gather the evidence about the efficacy of nutritional interventions in the prevention and/or treatment of antineoplastic induced oral mucositis in oncological patients. It was carried out a bibliographic review in PubMed data base by combining MesH terms with boolean operators. Articles were selected based on inclusion and exclusion criteria; 50 final articles were found. Although further evidence is needed, glutamine, honey and vitamins appear to be a good therapeutic option. The rest of the compounds presented controversial or insufficient results to draw conclusions over their utilization as prevention or treatment options. Low evidence is reported about oral mucositis nutritional interventions in spite of being attainable and affordable compounds. Scarce evidence is shown in paediatric patients compared to adults. Developing higher quality studies and combinations with the compounds researched is necessary to create stronger evidence.

We report the development of in vitro propagation protocols through adventitious shoot induction pathway for a rare and medicinal Scutellaria havanensis. In vitro propagation studies using nodal explants showed MS medium supplemented with 10µM 6-Benzylaminopurine induced highest number of adventitious shoots in a time dependent manner. A ten - day incubation was optimum for shoot bud induction as longer exposures resulted in hyperhydricity of the explants and shoots induced. We also report preliminary evidence of Agrobacterium tumefaciens EHA105 - mediated gene transfer transiently expressing of green fluorescent protein in this species. Transformation studies exhibited amenability of various explant tissues, internode being the most receptive. As the plant has medicinal value, research was carried out to evaluate its potential antioxidant capacity and the efficacy of methanolic leaf extracts in curbing the viability of human colorectal cancer cell line HCT116. Comparative total polyphenol, and flavonoid content measurement of fresh and air dried leaf extract revealed that the fresh leaf extracts contain higher total polyphenol and flavonoid content. The HCT 116 cell viability assessed by colorimetric assay using a 3-(4, 5-dimethyl-thiazol-2-yl)-2, 5-diphenyltetrazolium bromide, showed a steady growth inhibition after 24 hours of incubation. Scanning Electron Microscopy of leaf surface revealed high density of glandular and non-glandular trichomes. This research provides basis for the conservation of this rare plant and future phytochemical screening and clinical research.

Potential of co-digestion mixing thickened secondary sludge (TS) from extended aeration wastewater treatment plant and locally available substrates (whey, grease and septage) has been studied using three steps. The first step was a batch test to determine biological methane potential (BMP) of different mixtures of the three co-substrates with TS. The second step has been carried out with lab-scale reactors (20 L) simulating anaerobic continuous stirred tank reactors fed by three mixtures of co-substrates determined according to previous step results. Modelling using ADM1 as a mechanistic model was applied in the third step to help understanding the co-digestion process. According to BMP step, septage used as co-substrate has a negative effect on performance and addition of 10 to 30% grease or 10% whey would lead to a higher production of biogas and with an increase of the methane content. The results from the reactor showed less evi-dence of the positive effects observed with the BMP assay. Protein and lipid fractions of particu-late biodegradable COD are important variables for digester stability and methane production as predicted by modelling. Results of simulations with ADM1 model adapted to co-digestion confirmed that this model is a powerful tool to optimize the process of biogas production.