Cognitive reserve is the adaptability of cognitive processes in the face of brain aging and pathology. This study aimed to validate the Arabic version of the Cognitive Reserve Index Questionnaire (CRIq) in a healthy Lebanese sample. CRIq assesses cognitive reserve through three domains: education, working activity, and leisure time. Statistical measures, including descriptive and regression analysis along with structural equation modeling, were utilized to investigate the convergent and discriminant validity of CRIq, incorporating fluid intelligence (Gf) and measures of cognitive function, long-term memory encoding and retrieval (Glr), and processing speed (Gs). Results from 174 participants revealed that the activities assessed by CRIq-Arabic were comparable to the original CRIq study, with slight cultural differences. The internal consistency of CRIq-Arabic was good (Cronbach's α = 0.88), indicating reliability. Convergent validity was confirmed, with moderate to high loadings on the cognitive reserve latent construct. Discriminant validity was supported as correlations between cognitive reserve variables and non-target constructs (Gf, Glr, Gs) were less than 1. The findings provide an initial psychometric validation of the CRIq-Arabic. Further research in clinical samples is needed to enhance its utility in neuropsychological practice.

Type 2 diabetes mellitus (T2DM) is a common metabolic disease characterised by insulin resistance and elevated blood glucose levels, affecting millions of people worldwide. T2DM patients with dyslipidaemia have an increased risk of cardiovascular disease (CVD). A complex interplay of risk factors such as hyperglycaemia, dyslipidaemia, hypertension, obesity, inflammation and oxidative stress favour the development of atherosclerosis, a central mechanism in the pathogenesis of cardiovascular disease. Dyslipidaemia, a hallmark of T2DM, is characterised by elevated triglycerides, decreased high-density lipoprotein (HDL) cholesterol and the presence of small, dense low-density lipoprotein (LDL) particles, all of which promote atherosclerosis. In this article, we have attempted to present various treatment strategies that include pharmacological interventions such as statins, ezetimibe, PCSK9 inhibitors, fibrates and omega-3 fatty acids. We have also tried to highlight the pivotal role of lifestyle modifications, including physical activity and dietary changes, in improving lipid profiles and overall cardiovascular health in T2DM patients. We have also tried to present the latest clinical guidelines for the management of dyslipidaemia in T2DM patients. In conclusion, the treatment of dyslipidaemia in T2DM patients is of great importance as it lowers lipid particle levels, slows the progression of atherosclerosis and ultimately reduces susceptibility to cardiovascular disease.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

D-Glucaric acid is an important bio-based building block of polymers and is a high value-added chemical that can be used in a variety of applications. In the present study, the Udh target genes from Pseudomonas putida and Pseudomonas syringae were used together to construct the expression vector pETDuet-2×Udh. The transformants of BL21(DE3) with vector pETDuet-2×Udh was applied to produce glucaric acid from glucuronic acid. After optimization of induction conditions, the highest Udh expression were achieved when 0.4 mmol L-1 isopropyl-β-d–thiogalactoside (IPTG) was added to cell cultures at an OD600 value of 0.6 followed by culture at 26℃ for 6 hours. The production of glucaric acid substantially reached 5.24 ± 0.015 g L-1 in fed-batch cultures in a 30 L tank. In the present study, a new system for glucaric acid production was established, which was more economic and friendly to environment.

One of the hallmarks of microgravity-induced effects in several cellular models is represented by the alteration of oxidative balance with the consequent accumulation of Reactive Oxygen Species (ROS). It is well known that male germ cells are sensitive to oxidative stress and to changes of gravitational force even if published data on germ cell models are scarce. To gain more insights into the mechanisms of male germ cell response to altered gravity, a 3D cell culture model has been established from TCam-2 cells, a seminoma-derived cell line considered the only human cell line available to study in vitro mitotically active human male germ cells. TCam-2 cell spheroids were cultured for 24 hours under unitary gravity (Ctr) or simulated microgravity (s-microgravity) conditions, these last ones were obtained using the Random Positioning Machine (RPM). A significant increase in intracellular ROS and mitochondria superoxide anion levels has been observed after RPM exposure. In line with these results a trend of protein and lipid oxidation increase, and increased pCAMKII expression levels were observed after RPM exposure. The ultrastructural analysis by Transmission Electron Microscopy revealed that RPM-exposed mitochondria appeared enlarged and, even if seldom, disrupted. Notably, even the expression of the main enzymes involved in the redox homeostasis appears modulated by RPM exposure in a compensatory way, being GPX1, NCF1, and CYBB downregulated, whereas NOX4 and HMOX1 upregulated. Interestingly, HMOX1 is involved in the heme catabolism of mitochondria cytochromes, and therefore the positive modulation of this marker can be associated to the observed mitochondria alteration. All together, these data demonstrate TCam-2 spheroid sensitivity to acute SM exposure and indicate the capability of these cells to trigger compensatory mechanisms that allow to overcome the exposure to altered gravitational force.

Systemic sclerosis (SSc) is a multisystem connective tissue disease characterized by pathological processes involving autoimmunity, vasculopathy, and resultant extensive skin and organ fibrosis. Recent studies have demonstrated activation and aberrant wound healing responses in the epithelial layer of the skin in this disease, implicating the epithelial keratinocytes as a source of pro-fibrotic and inflammatory mediators. In this paper we investigated the role of Immunoglobulin G (IgG) autoantibodies directed against epithelial cells, as potential initiators and propagators of pathological keratocyte activation and the ensuing SSc fibrotic cascade. A keratinocyte cell-based ELISA is used to evaluation binding of SSc IgG. SSc skin biopsies were stained by immunofluorescence for the presence of IgG in the keratinocyte layer. Moreover, IgG purified from SSc sera is evaluated for the potential to activate keratinocytes in tissue culture and to induce signaling in TLR2 & 3 reporter cell lines. We demonstrate enhanced binding of SSc IgG to keratinocytes, and activation of these cells leading to release of IL-1α, representing a potential initiating pathway in this disease.

N'-(5-bromofuran-2-carbonyl)isonicotinohydrazide (1) was obtained as a white solid in 83% yield by 2-methyl-6-nitrobenzoic anhydride (MNBA)/4-dimethylaminopyridine (DMAP)-catalyzed reaction of 5-bromofuran-2-carboxylic acid and isoniazid in dichloromethane at room temperature. The structure of N'-(5-bromofuran-2-carbonyl)isonicotinohydrazide (1) was elucidated by 1H NMR, 13C NMR, FTIR, and the high resolution mass spectrometers. Molecular docking screening of the title compound (1) on the cyclooxygenase-2 (COX-2) protein (PDB ID: 5IKR) exhibited that compound (1) has a good binding affinity, suggesting that it is very interesting for further structure optimization and in-depth research as a potential COX-2 inhibitor.

Adipose tissue is a crucial organ in energy metabolism and thermoregulation. Adipose tissue phenotype is controlled by various signaling mechanisms under pathophysiological conditions. Type II transmembrane serine proteases (TTSPs) are a group of trypsin-like enzymes anchoring on the cell surface. These proteases act in diverse tissues to regulate physiological processes, such as food digestion, salt-water balance, iron metabolism, epithelial integrity, and auditory nerve development. More recently, several members of the TTSP family, namely, hepsin, matriptase-2, and corin, have been shown to play a role in regulating lipid metabolism, adipose tissue phenotype, and thermogenesis, via direct growth factor activation or indirect hormonal mechanisms. In mice, hepsin deficiency increases adipose browning and protects from high-fat diet-induced hyperglycemia, hyperlipidemia, and obesity. Similarly, matriptase-2 deficiency increases fat lipolysis and reduces obesity and hepatic steatosis in high-fat diet-fed mice. In contrast, corin deficiency increases white adipose weights and cell sizes, suppresses adipocyte browning and thermogenic responses, and causes cold intolerance in mice. These findings highlight an important role of TTSPs in modifying cellular phenotype and function in adipose tissue. In this review, we provide a brief description about TTSPs and discuss recent findings regarding the role of hepsin, matriptase-2, and corin in regulating adipose tissue phenotype, energy metabolism, and thermogenic responses.

Preterm delivery can be precipitated by infection, and preterm infants are at heightened risk of postnatal infection. Little is known about the ontogeny of inflammatory biomarkers in extremely preterm infants. We hypothesized that suspected prenatal infection (chorioamnionitis or spontaneous preterm labor) and clinically diagnosed postnatal infection would be associated with unique biomarker signatures, and those patterns would be influenced by the degree of prematurity. Venous blood was collected daily for the first week and weekly for up to 14 additional weeks from 142 neonates born at 22-32 weeks gestation. A custom array was utilized to measure monocyte chemoattractant protein-1 (MCP-1) and interleukin-6 (IL-6). C-reactive protein (CRP) levels were obtained from the electronic medical record. 90 infants had suspected prenatal infection and 63 were diagnosed with postnatal infection. Independent of gestational age at delivery, MCP-1 was significantly increased (P < 0.001) in association with maternal preeclampsia, but MCP-1 was decreased (P<0.01) and CRP was increased (P<0.05) in the presence of chorioamnionitis. IL-6 and CRP were both increased in infants diagnosed with postnatal infection with peak levels observed on days 2 and 3, respectively. In conclusion, suspected prenatal and postnatal infections and non-infectious complications of pregnancy are associated with unique biomarker profiles, independent of gestational age. In those clinically diagnosed with a postnatal infection in the absence of antenatal infection concerns, IL-6 increases before CRP, emphasizing a potential role for expanded biomarker screening if antibiotics are initially avoided in infants born exclusively for maternal indications.

Erectile dysfunction (ED) is a common and feared complication of radical prostatectomy (RP) for prostate cancer. Recently, tissue engineering is being attempted for post-prostatectomy ED, with controlled interactions between cells, growth factors, and extracellular matrix (ECM) being important for nerve regeneration's structural integrity. In this study, we evaluated the effects of biomechanical ECM patch on human bone marrow-derived mesenchymal stem cells (hBMSCs) morphology and behavior in bilateral cavernous nerve injury (BCNI) rat model. The ECM patch, made of decellularized human fibroblast-derived ECM (hFDM) and a biocompatible polyvinyl alcohol (PVA) hydrogel, was tested with human bone marrow-derived mesenchymal stem cells (hBMSCs) on a bilateral cavernous nerve injury (BCNI) rat model. In vitro analysis showed that the hFDM/PVA + hBMSCs patches significantly increased neural development markers. In vivo experiments demonstrated that the rats treated with the hFDM/PVA patch had higher ICP/MAP ratio, a higher ratio of smooth muscle to collagen, increased content of nNOS, higher levels of eNOS protein expression, and a higher cGMP level compared to the BCNI group. These results indicate that the hFDM/PVA patch is effective in promoting angiogenesis, smooth muscle regeneration, and nitrergic nerve regeneration, which could contribute to improved erectile function in post-prostatectomy ED.

Beyond plasma glucose-lowering in patients with type 2 diabetes, sodium- glucose cotransporter 2 inhibitors (SGLT2i) significantly reduced the hospitalization for heart failure (HF) and retarded the progression of chronic kidney disease (CKD). Endothelial dysfunction is not only involved in the development and progression of cardiovascular disease (CVD), and is also associated with the progression of CKD. In patients with type 2 diabetes, hyperglycemia, insulin resistance, hyperinsulinemia and dyslipidemia induce the development of endothelial dysfunction. SGLT2i have shown an improvement in endothelial dysfunction, as assessed by flow-mediated vasodila-tion, in individuals at high risk for CVD. Along with an improvement of endothelial dysfunction, SGLT2i showed improvements in oxidative stress, inflammation, mitochondrial dysfunction, glucotoxicity such as advanced glycation end products signaling and nitric oxide bioavailability. The improvements in endothelial dysfunc-tion and such endothelium-derived factors may play an important role in preventing the development of coronary artery disease, coronary microvascular dysfunction and diabetic cardiomyopathy which cause HF and in retarding CKD. The suppression of the development of HF and the progression of CKD achieved by SGLT2i might have been largely induced by the improvement of vascular endothelial function by SGLT2i.

This research intended to report amine-functionalized multiwall carbon nanotubes (MWCNTs) prepared by a simple method for efficient and rapid removal of Reactive Yellow 2 (RY2) from water. EDS analysis showed that the N content increased from 0 to 2.42% and from 2.42 to 8.66% after modification by APTES and PEI, respectively. BET analysis displayed that the specific surface area, average pore size, and total pore volume were reduced from 405.22 to 176.16 m2/g, 39.67 to 6.30 nm, and 4.02 to 0.28 cm3/g, respectively. These results proved that the PEI/APTES-MWCNTs were successfully prepared. pH edge experiment indicated that pH 2 was optimal for RY2 removal. At pH 2 and 25 °C, the time required for adsorption equilibrium was 10, 15, and 180 min at initial concentrations of 50, 100, and 200 mg/L, respectively; and the maximum RY2 uptake calculated by the Langmuir model was 714.29 mg/g. Thermodynamic studies revealed that the adsorption process was spontaneous and endothermic. 0-0.1 mol/L of NaCl showed negligible effect on RY2 removal by PEI/APTES-MWCNTs. Five adsorption/desorption cycles confirmed the good reusability of PEI/APTES-MWCNTs in RY2 removal. Overall, the PEI/APTES-MWCNTs are a potential and efficient adsorbent for reactive dye wastewater treatment.

In an historic perspective on the development of the Standard Model of particle physics it is shown how mathematically driven axioms have masked the merits of a physically comprehensible structural view. It is concluded that the difference between the two approaches can be traced back to two major issues. Whereas in the Standard Model the quark is a Dirac particle with a single real dipole moment, the quark in the structural model, in confinement with other quarks, is a Dirac particle with two real dipole moments. The second issue is the view that empty space does not exist, but that space is filled with a polarisable energetic fluid. It is shown how recognition of these two issues pave a road to reconcile particle physics with gravity, in which the quark can be seen as a magnetic electron and in which the gluon, as the strong force carrier, can be seen as a massive photon.

Low back pain is a clinically highly relevant musculoskeletal burden and is associated with inflammatory as well as degenerative processes of the intervertebral disc. However, the pathophysiology and cellular pathways contributing to this devastating condition are still poorly understood. Based on previous evidence, we hypothesize that tissue renin-angiotensin system (tRAS) components, including the SARS-CoV-2 entry receptor angiotensin-converting enzyme 2 (ACE2), are present in human nucleus pulposus (NP) cells and associated with inflammatory and degenerative processes. Experiments were performed with NP cells from 4 human donors. The existence of angiotensin II, angiotensin II type 1 receptor (AGTR1), AGTR2, MAS-receptor (MasR), and ACE2 in human NP cells was validated with immunofluorescent staining and gene expression analysis. Hereafter the cell viability was assessed after adding agonists and antagonists of the target receptors as well as angiotensin II in different concentrations for up to 48 hours of exposure. A TNF-α-induced inflammatory in vitro model was employed to assess the impact of angiotensin II addition and the stimulation or inhibition of the tRAS receptors on inflammation, tissue remodeling, expression of tRAS markers, and the release of nitric oxide (NO) into the medium. Further, protein levels of IL-6, IL-8, IL-10, and intracellular as well as secreted angiotensin II were assessed after exposing the cells to the substances, and inducible nitric oxide synthase (iNOS) levels were evaluated utilizing Western Blot. The existence of tRAS receptors and angiotensin II were validated in human NP cells. Cell viability analysis revealed no cytotoxic effects of angiotensin II. The AGTR1 inhibitor Candesartan and the MAS receptors AVE0991 showed cytotoxic effects at high concentrations (100 µM). The addition of angiotensin II only showed a mild impact on gene expression markers. However, there was a significant increase in NO secreted by the cells. The gene expression ratios of pro-inflammatory/anti-inflammatory cytokines IL-6/IL--10, IL-8/IL-10, and TNF-α /IL-10 were positively correlated with the AGTR1/AGTR2 and AGTR1/MAS1 ratios, respectively. The stimulation of the AGTR2 MAS-receptor and the inhibition of the AGTR1 receptor revealed beneficial effects on the gene expression of inflammatory and tissue remodeling markers. This finding was also present at the protein level. We did not find alterations in iNOS protein concentrations after adding the drugs. The current data showed that tRAS components are expressed in human NP cells and are associated with inflammatory and degenerative processes. Further characterization of the associated pathways is warranted. The findings indicate that tRAS modulation might be a novel therapeutic approach to intervertebral disc disease.

Fusarium culmorum is a major pathogen of grain crops. Infected plants accumulate deoxynivalenol (DON), 3-acetyl-deoxynivalenol (3-ADON), or nivalenol (NIV), which are mycotoxins of the trichothecene B group. These toxins are also produced by F. graminearum species complex. New trichothecenes structurally similar to trichothecenes B but lacking the carbonyl group on C-8, designated NX toxins, were recently discovered in atypical isolates of F. graminearum from North America. Only these isolates and a few strains of a yet to be characterized Fusarium species from South Africa are known to produce NX-2 and other NX toxins. Here we report that among 20 F. culmorum strains isolated from maize, wheat, and oat in Europe and Asia over a period of 70 years, 18 strains produced NX-2 simultaneously with 3-ADON and DON or NIV. Rice cultures of strains producing 3-ADON accumulated NX-2 in amounts corresponding to 2-8% of 3-ADON (1.2 - 36 mg/kg). A strain producing NIV accumulated NX-2 and NIV at comparable amounts (13.6 and 10.3 mg/kg, respectively). In F. graminearum, producers of NX-2 possess a special variant of cytochrome P450 monooxygenase encoded by TRI1 that is unable to oxidize C-8. In F. culmorum, producers and nonproducers of NX-2 possess identical TRI1; the reason for the production of NX-2 is unknown. Our results indicate that production of NX-2 simultaneously with trichothecenes B is a common feature of F. culmorum.

Conventional methods of crop mapping need ground truth information to train the classifier. Thanks to the frequent acquisition allowed by recent satellite missions (Sentinel 2), we can identify temporal patterns that depend on both phenology and crop management. Some of these patterns are specific to a given crop and thus can be used to map it. Thus, we can substitute ground truth information used in conventional methods with agronomic knowledge. This approach was applied to identify irrigated permanent grasslands (IPG) in the Crau area (Southern France) which play a crucial role in groundwater recharge. The grassland is managed by making three mows during the May-October period which leads to a specific temporal pattern of leaf area index (LAI). The mowing detection algorithm was designed using the temporal LAI signal derived from Sentinel 2 observations. The algorithm includes some filtering to remove noise in the signal that might lead to false mowing detection. A pixel is considered a grassland if the number of detected mows is greater than 1. A data set covering five years (2016-2020) was used. The detection mowing number was done at the pixel level and then results are aggregated at the plot level. A validation data set including 780 plots was used to assess the performances of the classification. We obtained a Kappa index ranging between 0.94-0.99 according to the year. These results were better than other supervised classification methods that include training data sets. The analysis of land-use changes shows that misclassified plots concern grasslands managed less intensively with strong intra-parcel heterogeneity due to irrigation defects or year-round grazing. Time series analysis, therefore, allows us to understand different management practices. Real land-use change in use can be observed, but long time series are needed to confirm the change and remove ambiguities with heterogeneous grasslands.

In this paper, the phases in the Mg-Ti-O system using the 1:1 formulation of MgO:TiO2 mixing synthetic brucite of Mexican origin with TiO2 microparticles of high purity and with a heat treatment at 1100°C for 1 h were studied. The raw materials and formulation by XPS and DRX techniques were characterized. The results demonstrate the presence of different oxidation states in titania and the formation of different oxides in the Mg-Ti-O system when mixed and calcined at 1100°C; additionally, the formation of vacancies in the crystal lattice during the transformation from hexagonal brucite to magnesia with a cubic structure centered on the faces is estimated. With the results, its thermal behavior is warned based on the MgO-TiO2 phase diagram.

The purpose of the current study was directed to investigate the effectiveness of docosahexaenoic acid (DHA) as a chemopreventive agent on experimentally induced hamster buccal pouch (HBP) carcinogenesis; Material and methods: 40 Syrian male hamsters, five weeks old, were divided into 4 groups of 10 animals in each as follows, GI: Topical application of liquid paraffin alone (thrice a week for 14 weeks), GII: Topical application of 7, 12 dimethyl benz[a]anthracene (DMBA) alone (0.5 % in liquid paraffin, thrice a week for 14 weeks), GIII: Topical application of DMBA (0.5 % in liquid paraffin, thrice a week for 14 weeks) + Oral administration of DHA (125 mg/kg b.w. in 1 ml distilled water by oral gavage, thrice a week for 14 weeks on alternative days of DMBA application), GIV : Oral administration of DHA alone (125 mg/kg b.w. in 1 ml distilled water by oral gavage, thrice a week for 14 weeks); Results: Gross observations and histopathological findings revealed a-GI: normal stratified squamous epithelium b- GII: well and moderately differentiated squamous cell carcinoma (SCC) c-: GIII: showed variable results ranges from hyperkeratosis, hyperkeratosis and focal hyperplasia, mild dysplasia, and well differentiated SCC with superficial invasion of tumor cells not extended to deeper areas d: GIV: normal similar to GI. Immunohistochemical results revealed that oral DHA treatment to DMBA treated hamsters restored the normal expression of bcl-2; Conclusion: DHA has the potential to be a dietary chemopreventive agent due to its capacity to improve carcinogen detoxification and to block/suppress the initiation and promotion stages of experimentally produced HBP carcinogenesis.

Calcium dihydrogen phosphate monohydrate [Ca(H2PO4)2·H2O] (a fertilizer) was successfully synthesized by the recrystallization process by using a prepared triple superphosphate (TSP) that derived from oyster shell waste as starting material. This bio-green, eco-friendly process to produce an important fertilizer can promote a sustainable society. The shell-waste-derived TSP was dissolved in distilled water and kept at 30, 50, and 80 °C. Non-soluble powder and TSP solution were obtained. The TSP solution fraction were then dried and the recrystallized products (RCP30, RCP50, and RCP80) were obtained and confirmed as Ca(H2PO4)2·H2O. Whereas the non-soluble products (NSP30, NSP50, and NSP80) were observed as calcium hydrogen phosphate dihydrate (CaHPO4·2H2O). The recrystallized yields of RCP30, RCP50, and RCP80 were found to be 51.0%, 49.6%, and 46.3%, whereas the soluble percentages were 98.72%, 99.16%, and 96.63%, respectively. RCP30 shows different morphological plate sizes, while RCP50 and RCP80 present the coagulate crystal plates. X-ray diffractograms confirm the formation of both the NSP and RCP. The infrared adsorption spectra confirmed the vibrational characteristics of HPO42‒, H2PO4‒ and H2O existed in CaHPO4·2H2O and Ca(H2PO4)2·H2O. Three thermal dehydration steps of Ca(H2PO4)2·H2O (physisorbed water, polycondensation, and re-polycondensation) were observed. Ca(H2PO4)2 and CaH2P2O7 are the thermodecomposed products from the first and second steps, whereas the final product is CaP2O6.

Type 2 diabetes (T2D) is associated with increased cardiovascular morbidity, mortality, and hospital admissions. There is variability in clinical practice. The objectives are to analyze the variability in the control of Blood Pressure (BP), HbA1c, and LDL-C in T2D patients and its influence on admissions due to cardiovascular events (CVE) Methods: We analyzed the electronic records in Primary Care Health centers in Navarra (Spain) and hospital admission for CVE. We follow 480637 people from 2012 to 2016. We calculated indicators of control of patients with T2D for each year, percentage with: HbA1c < 7%; HbA1c >= 9%; BP <140/90 mmHg; LDL-C <100 mg/dl. We used logistic and Cox regression. Results: Patients in the best control GP practices cluster are 2.5 times more likely to have HbA1c <7% [OR: 2.46 (95% CI: 2.29-3.64)]. Poor HbA1c control ≥ 9% is more likely in the worst control cluster [OR: 1.73 (95% CI:1.63-1.83)]. The probability of admission for CVE increases with age, being male, low income, obesity, history of CVE, having HbA1c ≥ 9%, and belonging to a GP practice in the cluster of HbA1C ≥ 9% worst control. In contrast, it decreases in patients with HbA1c <7%, BP<140/90 mmHg and LDL <100 mg/dl.

Water reuse for irrigation is increasingly recognized as an essential and economical strategy in areas with water scarcity. A simple, low-cost, low-maintenance, and highly efficient Pond-In-Pond (PIP) treatment system can be used for wastewater reuse. PIP is a treatment technology in which two types of ponds -- anaerobic and aerobic -- are combined into a single pond and consist of a deeper inner section entirely submerged within the outer pond. Previous studies on PIPs and PIP-like systems have reinforced the potential for reuse through promising performance results with BOD removal over 80% and a reduction in land area requirements by approximately 40%. Yet, no prior efforts have been made to understand the performance mechanism of such systems. This study makes use of two, 2-D modeling tools in developing a fundamental understanding of PIP flow dynamics and the expected performance. The modeling results showed that the PIP configuration offers improved flow diversion along with reduced flow velocity. Additionally, the PIP retained approximately 17% more (p<0.05) particles than the traditional pond with most of the particles concentrated within the inner pond. Lower velocity and the higher solids retention in the PIP thus allowed for better treatment performance compared to traditional ponds. The findings from this study can be used as preliminary data for future in-depth investigations of the PIP system leading toward effective and optimal designs. This will help address the major societal concern of water scarcity with low-cost and effective wastewater treatment.

In this article, the geometry of pseudoparallel, Ricci-generalized pseudoparallel and 2-Ricci-generalized pseudoparallel invariant submanifolds of an almost $\alpha$-cosymplectic $(\kappa,\mu,\nu)$ space has been searched under the some conditions. We also give some characterizations for such submanifolds. I think that obtained new results contribute to differential geometry.

Abstract. The purpose of this review is to investigate the nature of privacy concerns in the context of Smart Local Energy Systems (SLES) to understand how SLES providers can minimize both users’ concern, and cause for concern, around privacy. We conducted a rapid realist review and thematic framework analysis against Bronfrenbrenner’s socio-ecological model to understand privacy concerns in different contexts. A common privacy concern was that sharing detailed energy use data had the potential to reveal information about home life, and to intrude upon people’s sense of autonomy, choice and control. Evidence suggests that people are willing to accept newdata sharing technologies if the benefits of doing so are clear, anticipated, and mutually beneficial. Building trust, through increasing knowledge and understanding was a mechanism for overcoming privacy concerns, but this was mediated by the organization providing the information. Non-profit organizations were more trusted to ensure appropriate safeguards to privacy were in place. One key barrier to participation with good supporting evidence was that people can resist perceived intrusions on their privacy. This could be actively resisted by refusing to install data collection technologies or passively by non-participation in adapting energy use behaviors: both of which are necessary for SLES to achieve their goals of managing energy demand and building resilience in smart grids.

The urgent need to improve performance in the construction industry has led to the adoption of many innovative technologies. 3D laser scanners are amongst the leading technologies being used to capture and process assets or construction project data for use in various applications. Due to its nascent nature, many questions are still unanswered about 3D laser scanning, which in turn contribute to the slow adaptation of the technology. Some of these include the role of 3D laser scanners in capturing and processing raw construction project data. How accurate is the 3D laser scanner or point cloud data? How does laser scanning fit with other wider emerging technologies such as Building Information Modelling (BIM)? This study adopts a proof-of-concept approach, which in addition to answering the afore-mentioned questions, illustrates the application of the technology in practice. The study finds that the quality of the data, commonly referred to as point cloud data is still a major issue as it depends on the distance between the target object and 3D laser scanner’s station. Additionally, the quality of the data is still very dependent on data file sizes and the computational power of the processing machine. Lastly, the connection between laser scanning and BIM approaches is still weak as what can be done with a point cloud data model in a BIM environment is still very limited. The aforementioned findings reinforce existing views on the use of 3D laser scanners in capturing and processing construction project data.

Aims: Angiotensin-converting enzyme 2 (ACE2) plays an important role in the entry of coronaviruses into host cells. This paper described how carnosine, a naturally occurring supplement, can be an effective drug candidate for coronavirus disease (COVID-19) on the basis of molecular docking and modeling to host ACE2 co-crystallized with COVID-19 spike protein. Methods: First, the starting point was ACE2 inhibitors and their structure-activity relationship (SAR). Next, chemical similarity (or diversity) and PubMed searches made it possible to repurpose and assess approved or experimental drugs for COVID-19. In parallel, at all stages, authors performed bioactivity scoring to assess potential repurposed inhibitors at ACE2. Finally, investigators performed molecular docking and modeling of the identified drug candidate to host ACE2 co-crystallized with COVID-19 spike protein. Results: Carnosine emerged as the best known drug candidate to match ACE2 inhibitor structure. Preliminary docking was more optimal to ACE2 than the known typical angiotensin-converting enzyme 1 (ACE1) inhibitor (enalapril) and quite comparable to known or presumed ACE2 inhibitors. Viral spike protein elements binding to ACE2 were retained in the best carnosine pose in SwissDock at 1.75 Angstroms. Out of the three main areas of attachment expected to the co-crystallized protein structure, carnosine bind with higher affinity to two compared to the known ACE2 active site. LibDock score was 92.40 for site 3, 90.88 for site 1, and inside the active site 85.49. Conclusion: Carnosine has promising inhibitory interactions with host ACE2 co-crystallized with COVID-19 spike protein and hence could offer potential mitigating effect against current COVID-19 pandemic.

The regioselectivity in non-polar [3+2] cycloaddition (32CA) reactions has been studied within the Molecular Electron Density Theory (MEDT) at the B3LYP/6-311G(d,p) level. To this end, the 32CA reactions of nine simplest three-atom-components (TACs) with 2-methylpropane were selected. The electronic structure of the reagents has been characterised through the Electron Localisation Function (ELF) and the Conceptual DFT. The energy profiles of the two regioisomeric reaction paths and ELF of the transition state structures are studied to understand the origin of the regioselectivity in these 32CA reactions. This MEDT study permits to conclude that the least electronegative ends X1 atom of these TACs controls the asynchronicity in the C-X (X = C,N,O) single bond formation, and consequently, the regioselectivity. This behaviour is a consequence of the fact that the creation of the non-bonding electron density required for the formation of the new CX single bonds has a lesser energetic cost at the least electronegative X1 atom than that at the Z3 one.

Sun-Induced chlorophyll Fluorescence (SIF) relates directly to photosynthesis yield and stress but there are still uncertainties in its interpretation. Most of these uncertainties concern the influences of the emitting vegetation’s structure (e.g., leaf angles, leaf clumping) and biochemistry (e.g., chlorophyll content, other pigments) on the radiative transfer of fluorescent photons. The Caatinga is a large region at northeast Brazil of semiarid climate and heterogeneous vegetation, where such biochemical and structural characteristics can vary greatly even within a single hectare. With this study we aimed to characterize eleven years of SIF seasonal variation from Caatinga vegetation (2007 to 2017) and to study its responses to a major drought in 2012. Orbital SIF data from the instrument GOME-2 was used along with MODIS MAIAC EVI and NDVI. Environmental data included precipitation rate (TRMM), surface temperature (MODIS) and soil moisture (ESA CCI). To support the interpretation of SIF responses we have used red and far-red SIF adjusted by the Sun’s zenith angle (SIF-SZA) and by daily Photosynthetically Active Radiation (dSIF). Furthermore, we have also adjusted SIF through two contrasting formulations using NDVI data as proxy for structure and biochemistry, based on previous leaf-level and landscape level studies: SIF-Yield and SIF-Prod. Data was tested with time-series decomposition, rank correlation, spatial correlation and Linear Mixed Models (LMM). Results show that GOME-2 SIF and adjusted SIF formulations responded consistently to the observed environmental variation and showed a marked decrease in SIF emissions in response to a 2012 drought, that was generally larger than the corresponding NDVI and EVI decreases. Drought sensitivity of SIF, as inferred from LMM slopes, was correlated to land cover at different regions of the Caatinga. This is the first study to show correlation between landscape-level SIF and an emergent property of ecosystems (i.e., resilience), showcasing the value of remotely sensed fluorescence for ecological studies.

Anti-diabetic effects of Glycine soja seed extract (GS) on Type 2 diabetes mellitus mouse model and human hepatocytes induced insulin resistance were investigated. 3 weeks old db/db mice were divided into 5 groups (n = 6) including two control groups and 3 GS treated groups with different doses. Oral administration of GS for 6 weeks to diabetic db/db mice reduced blood glucose level significantly in a dose dependent manner by 44.7% (300 mg/kg/day), 30.9% (150 mg/kg/day) and 21.1% (75 mg/kg/day). GS treatment also lowered significantly plasma level of HbA1c, insulin, IGF-1 and leptin, and increased that of adiponectin. GS treatment activated AMPK, and down-regulated GLUT2 in liver tissues of mice while up-regulated GLUT4 in muscle tissues of mice. In in vitro study with insulin resistance induced human hepatocyte, GS treatment increased glucose uptake and increased the activities of Akt and PPAR-γ in response to insulin. Treatment of GS appears to reduce blood glucose level by regulating energy metabolism positively through various metabolic pathways and reducing insulin resistance in Type 2 diabetes mellitus.

Anti-diabetic effects of Glycine soja seed extract (GS) on Type 2 diabetes mellitus mouse model and human hepatocytes induced insulin resistance were investigated. 3 weeks old db/db mice were divided into 5 groups (n = 6) including two control groups and 3 GS treated groups with different doses. Oral administration of GS for 6 weeks to diabetic db/db mice reduced blood glucose level significantly in a dose dependent manner by 44.7% (300 mg/kg/day), 30.9% (150 mg/kg/day) and 21.1% (75 mg/kg/day). GS treatment also lowered significantly plasma level of HbA1c, insulin, IGF-1 and leptin, and increased that of adiponectin. GS treatment activated AMPK, and down-regulated GLUT2 in liver tissues of mice while up-regulated GLUT4 in muscle tissues of mice. In in vitro study with insulin resistance induced human hepatocyte, GS treatment increased glucose uptake and increased the activities of Akt and PPAR-γ in response to insulin. Treatment of GS appears to reduce blood glucose level by regulating energy metabolism positively through various metabolic pathways and reducing insulin resistance in Type 2 diabetes mellitus.

Western Anatolia comprises a vast amount of various volcanic successions spanning from Eocene to Upper Miocene periods. These units mainly display southward younging in broad sense and display large amounts of chemical variation that spanned from basalt to rhyolite. The southward younging of magmatism and chemical variations have been largely attributed to the retreat and roll-back of the Hellenic slab and the western escape of the Anatolian microplate. However, there is still a lack of high precision data to pinpoint the exact nature of the magmatism and lithospheric tectonics. In this contribution we investigated a poorly known region along the Western Anatolia along Manisa district called Karakılıçlı volcanic field. We investigated two different volcanic sections (Kalpakkaya and Çamlık hill) that display the best volcano-sedimentary features in terms of geochronology and geochemistry. Samples acquired from the bottom, middle and upper portions of these sections display Early-Middle Miocene ages of 17.64±0.20, 17.22±0.15, 16.16±0.17 and 16.36±0.13, 15.79±0.71 and 13.61±0.20 Ma respectively. The results indicate that the volcanism in the region generated by the melting of the mantle and/or lithospheric mantle by slab retreat and roll-back of the Hellenic slab and evolved in the shallow magma chambers/mushes by fractional crystallization, magma mixing and crustal assimilation.

In this paper, a solenoid based linearly movable armature system is designed using robust control theory in order to improve the performance of the system. Reference track method is the best performance analysis for position control systems. Among the robust controllers, H infinity mixed-sensitivity and Mixed H 2 /H∞ with Regional Pole Placement Controllers are used to improve the performance of the system. Comparison of the proposed controllers for tracking a reference displacement signals (step and sine wave) and a promising simulation result have been obtained.

Water quality retrieval for small urban waterbodies by remote sensing get used to be difficult due to coarse spatial resolution of the remote sensing imagery. The recently launched Sentinel-2 produces imagery with a spatial resolution of 10 m. It provides an opportunity to solve the problem of retrieving water quality for small waterbodies. Additionally, many water management issues also require fine resolution of imagery, e.g. illegal discharge to an urban waterbody. Since illegal discharges are an important issue for urban water management, chemical oxygen demand (COD), total phosphorous (TP), and total nitrogen (TN) were chosen as the target parameters for water quality retrieval in this study. COD, TP and TN, however, are non-optically active parameters. There were limited studies in the past to retrieve these parameters in comparison with optically active parameters, e.g. Chlorophyll-A etc. This study compared three machine learning models, namely Random Forest (RF), Support Vector Regression (SVR), and Neural Networks (NN), to investigate the opportunity to retrieve the above non-optically active parameters. Results showed that R² of TP, TN, and COD by NN, RF and SVR were 0.94, 0.88, and 0.86, respectively. The performances of water quality retrieval for these non-optically active parameters were significantly improved by the optimized machine learning models. These models hence solved the problem to use remote sensing data to retrieve these non-optically active water quality parameters and provided a new monitoring strategy for small waterbodies. Water quality mapping obtained by Sentinel-2 imagery provided a full spatial coverage of the water quality characterization for the entire water surface. Compared with water samples collecting and testing, it greatly reduced labor cost, reagents cost, and waste treatment cost. It also may help identify illegal discharges to urban waterbodies. The method developed in this research provides a new practical and efficient water quality monitoring strategy in managing water with consideration of environmental sustainability.

The transnational spread of coronavirus (2019-nCoV) first detected in Wuhan is causing global panic; thus, accelerated research into clinical intervention is of high necessity. The spike glycoprotein structure has been resolved, and its affinity to human angiotensin-converting enzyme 2 (ACE-2) has been experimentally validated. Here, using computational methods, a metastable conformation of 2019-nCoV-RBD/ACE-2 complex has been revealed and FDA-database of approved drugs have been docked into the interface. Darunavir has been discovered as high ligand affinity candidate capable of disrupting communication between 2019-nCoV-RBD and ACE-2. Darunavir, in addition to its previously known anti-HIV protease inhibitor is now repurposeable for the treatment 2019-nCoV disease acting via disruption of cellular recognition, binding and invasion.

A new compound containing a triene, a tetrahydropyran ring and glycine ester functionalities, restricticin B (1), together with four known compounds (2-5) were obtained from the EtOAc extract of the marine fungus Penicillium janthinellum. The planar structure of 1 was determined by detailed analyses of MS, 1D and 2D NMR data. The relative and absolute configurations of 1 were established via analyses of NOESY spectroscopy data, comparison of optical rotation values with those of restricticin derivatives reported and electronic circular dichroism (ECD). All the compounds were screened for their anti-neuroinflammatory effects in lipopolysaccharide (LPS)-induced BV-2 microglia cells. Restricticin B (1) and N-acetyl restricticin (2) exhibited anti-neuroinflammatory effects by suppressing the production of pro-inflammatory mediators in activated microglial cells.

Iron and zinc are essential micronutrients required for growth and health. Deficiencies of these nutrients are highly prevalent among populations, but can be alleviated by supplementation. Cross-sectional studies in humans showed positive association of serum zinc levels with hemoglobin and markers of iron status. Dietary restriction of zinc or intestinal specific conditional knock out of ZIP4 (SLC39A4), an intestinal zinc transporter, in experimental animals demonstrated iron deficiency anemia and tissue iron accumulation. Similarly increased iron accumulation has been observed in cultured cells exposed to zinc deficient media. These results together suggest a potential role of zinc in modulating whole body iron metabolism. Studies in intestinal cell culture models demonstrate that zinc induces iron uptake and transcellular transport via induction of divalent metal iron transporter-1 (DMT1) and ferroportin (FPN) expression, respectively. It is interesting to note that intestinal cells are exposed to very high levels of zinc through pancreatic secretions, which is a major route of zinc excretion from the body. Therefore, zinc appears to be modulating the iron metabolism possibly via regulating the DMT1 and FPN1 levels. Herein we critically reviewed the available evidence to hypothesize novel mechanism of Zinc-DMT1/FPN axis in regulating intestinal iron absorption and tissue iron accumulation to facilitate future research aimed at understanding the yet elusive mechanisms of iron and zinc interactions.

The NA61/SHINE experiment studies hadron production in hadron-hadron, hadron-nucleus and nucleus-nucleus collisions. The physics programme includes the study of the onset of deconfinement and search for the critical point as well as reference measurements for neutrino and cosmic ray experiments. For strong interactions, future plans are to extend the programme of study of the onset of deconfinement by measurements of open-charm and possibly other short-lived, exotic particle production in nucleus-nucleus collisions. This new programme is planned to start after 2020 and requires upgrades to the present NA61/SHINE detector setup. Besides the construction of a large acceptance silicon detector, a 10-fold increase of the event recording rate is foreseen, which will necessitate a general upgrade of most detectors.

The Biginelli reaction is a highly versatile reaction, which leads to dihydropyrimidinones/thiones. This scaffold is reported as being a privileged structure due to its ability to interact with biological targets. Synthesis of ethyl 4-(2-fluorophenyl)-6-methyl-2-thioxo-1-(p-tolyl)-1,2,3,4-tetrahydropyrimidine-5-carboxylate was achieved through the Biginelli reaction using a functionalized thiourea. In silico studies demonstrated that the compound title showed good potential for interacting with ecto-5’-nucleotidase, which has been considered as a target in designs for anti-cancer drugs.

(RADA)4 nanoscaffolds are excellent candidates for use as peptide delivery vehicles: they are relatively easy to synthesize with custom bio-functionality, and assemble in situ to allow a focal point of release. This enables (RADA)4 to be utilized in multiple release strategies by embedding a variety of bioactive molecules in an all-in-one ‘construct’. One novel strategy focuses on the local, on-demand release of peptides triggered via proteolysis of tethered peptide sequences. However, the spatial-temporal morphology of self-assembling nanoscaffolds may greatly influence the ability for enzymes to both diffuse into as well as actively cleave substrates. Fine structure and its impact on overall affect on peptide release is poorly understood. In addition, fractal networks observed in nanoscaffolds are linked to the fractal nature of diffusion in these systems. Therefore, matrix morphology and fractal dimension of virgin (RADA)4 and mixtures of (RADA)4 and matrix metalloproteinase 2 (MMP-2) cleavable substrate modified (RADA)4 were characterized over time. Sites of high (GPQG+IASQ, CP1) and low (GPQG+PAGQ, CP2) cleavage activity were chosen. Fine structure was visualized using established according to established methods. After 2 hrs of incubation, nanofiber networks showed an established fractal nature, however nanofibers continued to bundle in all cases as incubation times increased. It was observed that despite extensive nanofiber bundling after 24 hrs of incubation time, the CP1 and CP2 nanoscaffolds were susceptible to MMP-2 cleavage. The properties of these engineered nanoscaffolds characterized herein illustrate that they are an excellent candidate as an enzymatically initiated peptide delivery platform.

In the recent past about 40 botulinum neurotoxin (BoNT) subtypes belonging to serotypes A, B, E, and F pathogenic to humans were identified among hundreds of independent isolates. BoNTs are the etiological factors of botulism and represent potential bioweapons, but are also recognized pharmaceuticals for efficient counteraction of hyperactive nerve terminals in a variety of human diseases. The detailed biochemical characterization of subtypes as the basis for development of suitable countermeasures and possible novel therapeutic applications is lagging behind the increase in new subtypes. Here we report the primary structure of a ninth subtype of BoNT/F. Its amino acid sequence diverges by at least 8.4% at the holotoxin and 13.4% on the enzymatic domain level from all other known BoNT/F subtypes. We found that BoNT/F9 shares the scissile Q⁵⁸/K⁵⁹ bond in its substrate vesicle associated membrane protein 2 with the prototype BoNT/F1. Comparative biochemical analyses of four BoNT/F enzymatic domains showed that the catalytic efficiencies decrease in the order F1 > F7 > F9 > F6 and vary by up to factor eight. K_M values increase in the order F1 > F9 > F6 ≈ F7, whereas k_cat decreases in the order F7 > F1 > F9 > F6. Comparative substrate scanning mutagenesis studies revealed a unique pattern of crucial substrate residues for each subtype. Based upon structural coordinates of F1 bound to an inhibitor polypeptide the mutational analyses suggest different substrate interactions in the substrate binding channel of each subtype.

The considerable biological and medicinal activities of pyridazines has stimulated considerable research on efficient syntheses of these derivatives. In the last decade, microwave irradiation has generally been used for the energy source. As demonstrated in recent studies, pressure reactor “Q-tubes” may be used to accelerate several of these reactions in a more optimal and safer manner (compared to microwaves). In these studies there has been postulated a pathway for the formation of pyridazino[5,4,3-de][1,6]naphthyridine derivatives . In this paper we consider this pathway, and an alternate pathway, for several reactions. Contrary to the suggestion in these studies the pathway in which initial dimerization of malononitrile was postulated could be excluded based on chemical evidence. The reactions performed were the reaction of arylhydrazonals 1a,b with benzylidinemalononitrile which afforded in Q-tube the 3-acyl-4-aryl-1-phenyl-6-amino-1,4-dihydropyridazines, and the reaction of arylhydrazonals 1a,b, malononitrile 9 and aromatic aldehydes 10a-g in Q-tubes which afforded the tricyclic systems 12a-n whose structure could be established by X-ray crystal structure determination. In conclusion, we have added to the work of the recent studies by excluding a reaction pathway for one of their reaction products.

Abstract Background: Diabetes mellitus is dramatically increasing in the wide world. The managing of diabetes care emphasized the self-management education and support into patients’ care and family care. Objective: to review and synthesizes the effectiveness of DSME strategies involving family as a key person to provide social support for diabetes mellitus self-management of glycemic uncontrolled patients Method: Three databases through PubMed, CINAHL, and Scopus were reviewed to assess the relevant articles. The following search terms: “type 2 diabetes,” “self-management,” “family support,” and “glycemic uncontrolled.” We summarized details of family support on self-management among glycemic uncontrolled patients for 14 existing studies. Results: A total of 22 intervention studies were identified. Those studies have a heterogeneous of the education strategies, support perceived, follow-ups strategies and outcomes among type 2 DM. Family integration on diabetes self-management education (DSME) has a positive impact on several outcomes including, self-care behaviors, psychological outcomes, self-efficacy and clinical outcomes Conclusions: This systematic review found robust data related to the integration of family support on diabetes self-management among glycemic uncontrolled patients. Consequently, the improvement in outcomes was identified. Implications: The findings suggest model of family engagement is better and needed for sustaining the diabetes care in the long-term care

Glacier dynamics play an important role in the mass balance of many glaciers, ice caps and ice sheets. In this study we exploit Radarsat-2 (RS-2) Wide Fine (WF) data to determine the surface speed of Svalbard glaciers in the winters of 2012/2013 and 2013/2014 using Synthetic Aperture RADAR (SAR) offset and speckle tracking. The RS-2 WF mode combines the advantages of the large spatial coverage of the Wide mode (150 x 150 km) and the high pixel resolution (9m) of the Fine mode and thus has a major potential for glacier velocity monitoring from space through offset and speckle tracking. Faster flowing glaciers (1.95 m d^-1 - 2.55 m d^-1) which are studied in detail are Nathorstbreen, Kronebreen, Kongsbreen and Monacobreen. Using our Radarsat-2 WF dataset, we compare the performance of two SAR tracking algorithms, namely the GAMMA Remote Sensing Software and a custom written MATLAB script (GRAY method) that has primarily been used in the Canadian Arctic. Both algorithms provide comparable results, especially for the faster flowing glaciers and the termini of slower tidewater glaciers. A comparison of the WF data to RS-2 Ultrafine and Wide mode data reveals the superiority of RS-2 WF data over the Wide mode data.

Mitochondrial pyruvate dehydrogenase complex (PDHC) is essential for the brain glucose and neurotransmitter metabolism, dysregulated in many pathologies. Using specific inhibitors of PDHC in vivo, we determine biochemical and physiological responses to PDHC dysfunction. Dose dependence of the responses to membrane-permeable dimethyl acetylphosphonate (Ac-PMe2) is non-monotonous. Primary decreases in glutathione and its redox potential, methionine and ethanolamine are alleviated with increasing PDHC inhibition, the alleviation accompanied by physiological changes. Comparison of 39 brain biochemical parameters after administration of four phosphinate and phosphonate analogs of pyruvate at a fixed dose of 0.1 mmol/kg reveals no primary, but the secondary changes, such as activation of 2-oxoglutarate dehydrogenase complex (OGDHC) and decreased levels of glutamate, isoleucine and leucine. The accompanying decreases in RMSSD of ECG and freezing time are most pronounced after administration of me-thyl acetylphosphinate and dimethyl acetylphosphonate. The levels of PDHA1 expression and phosphorylation, sirtuin 3 and total protein acetylation are not significantly changed by the PDHC inhibitors that affect the brain protein succinylation and glutarylation. Thus, decreased production of the tricarboxylic acid cycle substrate acetyl-CoA by inhibited PDHC is compen-sated by increased degradation of amino acids through the cycle with activated OGDHC, increas-ing total protein succinylation and decreasing anxiety indicators.

In the present work, we investigate the possibility that long-range airborne transport of infectious aerosols could initiate an epidemic outbreak at distances downwind beyond one hundred kilometers. For this, we have developed a simple atmospheric transport box-model which, for a hypothetical case of a COVID-19 outbreak, was compared to a more sophisticated 3-dimensional transport-dispersion model (HYSPLIT) calculation. Coupled with an extended Wells-Riley description of infection airborne spread, it shows that, the very low probability of outdoor transmission can be compensated by high numbers and densities, such as occurs in large cities, of infected and susceptible people in the source upwind and in the target downwind respectively. This may result in the creation of a few primary cases. It is worth pointing out that the probability of being infected remains very small at the individual level. Therefore, this process alone, which depends on population sizes, geography, seasonality and meteorology, can only “trigger” an epidemic which could then spread by the standard infection routes

Epithelial characteristics underlying the differential susceptibility of chronic asthma to SARS-CoV-2 (COVID-19) and other viral infections are currently unclear. By revisiting transcriptomic data from patients with Th2 low versus Th2 high asthma, as well as mild, moderate and severe asthmatics, we characterized the changes in expression of human coronavirus and influenza viral entry genes relative to sex, airway location and disease endotype. We found sexual dimorphism in expression of COVID-19 genes ACE2, TMPRSS2, TMPRSS4, and SLC6A19. ACE2 receptor downregulation occurred specifically in females in Th2 high asthma, while proteases broadly assisting coronavirus and influenza viral entry, TMPRSS2 and TMPRSS4, were highly upregulated in both sexes. Overall, changes in COVID-19 gene expression were specific to Th2 high molecular endotype of asthma, and different by asthma severity and airway location. The downregulation of ACE2 (COVID-19, SARS) and ANPEP (HCoV-229E) viral receptors correlated with loss of club and ciliated cells in Th2 high asthma, while the increase in DPP4 (MERS-CoV), ST3GAL4, and ST6GAL1 (influenza) associated with an increase in goblet and basal activated cells. Overall, this study elucidates sex, airway location, disease endotype and changes in epithelial heterogeneity as factors underlying asthmatic susceptibility, or lack thereof, to COVID-19.

late in December 2019 2019-nCoV was identified as the pathogen responsible for an outbreak of severe respiratory distress in Wuhan, China. The virus was detected in multiple countries during January, but it is believed widespread community transmission began late in February or early March. Since March the virus has caused over 100k confirmed deaths in the US, with some states more severely impacted, notably NY and NJ. Here I examine excess mortality at the national and state level from January through July 2020. I find that the increase in excess mortality began in late February, suggesting the pathogen was circulating undetected earlier than assumed. The timing and intensity of the increase in excess mortality varied across states, with two patterns emerging: an early, sharp increase reaching a peak during April-May, best exemplified by NY and NJ, and a shallower, sustained increase, reaching a peak in late July, observed mostly in the southern regions of the US.

Neuroinflammation, defined as inflammatory reactions mediated by cytokines, chemokines, reactive oxygen species, and secondary messengers in the central nervous system (CNS) including the brain and spinal cord is the basis of many neurological disorders. Recently, erythropoietin (EPO) has been considered and studied as a modulator of neuroinflammation. On this article minireview of pathophysiology of neuroinflammation and the neuroprotective effects of EPO is discussed and a case of subacute huge subdural hematoma with double mydriasis operated urgently, treated with low daily dose (vs high dose once or twice a month in the literature) of EPO and recovered fully and discharged home with good consciousness is reported. In addition, the probable unfavorable outcome of erythropoietin administration in patients with neuroinflammation in COVID-19 is considered.

Diabetes mellitus – type 2 (DM2) is a hypercoaguable state with enhanced platelets (PLTs) activation and increased clotting factor production. Simultaneously, the fibrinolytic cell system is inhibited due to formation of clots with high resistance to fibrinolysis. The stages of PLTs "activation" have been well-characterized microscopically, morphometrically and nanomechanically (by light microscope, transmisiion electron microscope - TEM, scanning electron microscope - SEM and atomic force microscope - AFM). Thrombocytes in "acivated" (pro-coagulant) state play central role in two main biological processes: hemostasis and repair of vascular vessels. Pro-coagulant PLTs participate in generation of thrombin and in development of fibrin fibers in the clot matrix. Enhanced PLTs reactivity in dibetic- (diabetes mellitus - DM2) patients is considered as a "pro-thrombotic" state. In the retrospective- and prospective- studies on the topic, the higher are the PLTs' hematometrical indices: PLTs (count), MPV (mean platelet volume), PDW (platelet distribution width), PCR (plateletcrit), as well as PLTs/Ly ratio. The PLТs parameters/indices are usefull biomarkers in early diagnosis and prognosis of DM2. The precise studies of PLTs' state of activation during DM2 might be useful for creation of new diabetes (DM2) treatment strategies and effective medicines. Using the amount of blood glucose, attached to hemoglobin (HbA1c values) as markers of glycemic control in diabetic patients, researchers have observed association between MPV and medications as Insulin, Metformin, sulphonyl ureas. Computational modellng of PLTs' activation in DM2 is also a controlling factor for thrombocyte distribution and margination in bood vessels, associated with micro- and macrovascular disease in DM2. PLTs-derived miRNAs are novel molecular biomarkers for diagnosis and prognosis of DM2, insulin resistance and diabetes complications. We have proposed (2010) oleic acid (OA) as a substance suppressing "PLT hyperactivation" and inhibiting “thrombocyte aggregation”. Antiplatelet agents, natural plant products including, could be effective in the prevention and the secondary treatment of micro- and macrovascular complications in the type 2 Diabetes mellitus. Our proposal on following up of a combination of hematological-, hemorheological- and hemostatic parameters (indices) as a new way in diagnosis, treatment, predicting and management of DM2 and its related vascular complications, probably could be more explored in future studies.

This systematic review critically examines the adoption and integration of Human Resource Information Systems (HRIS) and Artificial Intelligence (AI) in small and medium-sized enterprises (SMEs), with a focus on enhancing workforce productivity and strategic decision-making. Using the PRISMA framework, 100 research articles from reputable sources such as Google Scholar, Scopus, and Web of Science were analyzed. The analysis reveals that HRIS adoption can improve employee productivity by 29%, decision-making by 20%, and operational efficiency by 26%, highlighting its transformative impact on SMEs. The review identifies major challenges, including high implementation costs, limited IT resources, and integration difficulties with AI and machine learning technologies. Despite these barriers, integrating AI into HRIS presents significant opportunities for SMEs, fostering innovation in talent management, compliance automation, and data-driven decision-making, thus creating a competitive edge in rapidly evolving markets. Actionable insights for practitioners emphasize the need for cost-effective, scalable HRIS solutions tailored to the unique operational needs of SMEs, while researchers are urged to further explore AI-driven HRIS advancements to address current gaps in workforce engagement and performance management. This review offers a comprehensive roadmap for future HRIS innovations and underscores the strategic importance of digital transformation in human resources for sustained SME competitiveness.

The rapid development of specific-purpose Large Language Models (LLMs), such as Med-PaLM, MEDITRON-70B, and Med-Gemini, has significantly impacted healthcare, offering unprecedented capabilities in clinical decision support, diagnostics, and personalized health monitoring. This paper reviews the advancements in medicine-specific LLMs, the integration of Retrieval-Augmented Generation (RAG) and prompt engineering, and their applications in improving diagnostic accuracy and educational utility. Despite the potential, these technologies present challenges, including bias, hallucinations, and the need for robust safety protocols. The paper also discusses the regulatory and ethical considerations necessary for integrating these models into mainstream healthcare. By examining current studies and developments, this paper aims to provide a comprehensive overview of the state of LLMs in medicine and highlight the future directions for research and application. The study concludes that while LLMs hold immense potential, their safe and effective integration into clinical practice requires rigorous testing, ongoing evaluation, and continuous collaboration among stakeholders.

It is often said in human society that it all starts from the mind, and this is true. The answer to the question “Why is it that pets require much fewer years to fully develop than humans?” could be headed to the Theory of Relativity and the perceived time according to the levels of instinct and rationality. It is perhaps no wonder that the French language translates the word “mind” as “l’esprit”, which also means “spirit” in the English language. Given that the Theory of Relativity applies to all physical matter, the theory applies to chemistry, biology and psychology as well. The level of instinct is proportional with the perceived speed of time and implicitly, to the speed of time itself for the whole organism, given that the nervous system coordinates all bodily functions. A pet may experience a few years as humans experience over a decade, making their perceived lifetime to be approximately equal to the human’s. The same applies to the perception of space and its components. This aspect would emphasise upon the fact that all life on Earth shows the same degree of value with regards to uniqueness. Nevertheless, the values represented by the hierarchy of competences among living organisms at the same time differs based on species. Honour of uniqueness and hierarchy of competences represent two scientific concepts that never overcross. As a result, there is no evidence to suggest that scientific facts as such constitute a form of contradiction to philosophical and religious ideas, given that religion refers to animals as companions of humans. With regards to the clock of the living organism; there are three kinds of clocks in a living organism: the emotional clock, the cognitive clock and the molecular clock. These three categories actually constitute the temporal layers of our dimension, so they are in a relationship of interdependence. When one has a feeling that time is slower or quicker, they are not fully experiencing that change in the time speed, but only partially. And one can profoundly experience the change of perceived time speed when they experience profound feelings, which sweep them away from reality. Complete, deep mental focus can bring about this profound change in perception, which will make the individual feel as if they are in a different form of reality. When one is more instinctive, the person in cause perceives time as slower and sees more opportunities within the same frame of time and space. When one experiences the “Fight or flight” mode, the person in the cause finds themselves to be in danger and has two options; to try to prevail over the danger or to flee it. Whilst experiencing such a mode, people are much more alert and therefore, time passes more slowly and the physical space dilates. When people are relaxed, however, time and space become smaller, and when they are in a deep state of resting, they become very small. And where there is a smaller dimension, there is a greater speed, just as the circulating air gains speed when it crosses narrow passages.

Humans have a unique cognitive ability known as relational abstraction, which allows us to identify logical rules and patterns beyond basic perceptual characteristics. This ability represents a key difference between how humans and other animals learn and interact with the world. With current large language models rivaling human intelligence in many regards, we investigated whether relational abstraction was an emergent chat completion capacity in various models. We find that despite their impressive language processing skills, all tested language models failed the relational match-to-sample (RMTS) test, a benchmark for assessing relational abstraction. These results challenge the assumption that advanced language skills inherently confer the capacity for complex relational reasoning. The paper highlights the need for a broader evaluation of AI cognitive abilities, emphasizing that language proficiency alone may not be indicative of certain higher-order cognitive processes thought to be supported by language.

Cervical cancer, primarily caused by high-risk human papillomavirus (HR-HPV) types 16 and 18, is a major global health concern. Persistent HR-HPV infection can progress from reversible pre-cancerous lesions to invasive cervical cancer, which is driven by the oncogenic activity of human papillomavirus (HPV) genes, particularly E6 and E7. Traditional screening methods, including cytology and HPV testing, have limited sensitivity and specificity. This review explores the ap-plication of p16/Ki-67 dual-staining cytology for cervical cancer screening. This advanced im-munocytochemical method allows for simultaneously detecting p16 and Ki-67 proteins within cervical epithelial cells, offering a more specific approach for triaging HPV-positive women. Dual staining and traditional methods are compared, demonstrating their high sensitivity and negative predictive value but low specificity. The increased sensitivity of dual staining results in higher detection rates of CIN2+ lesions, which is crucial for preventing cervical cancer progression. However, its low specificity may lead to increased false-positive results and unnecessary biopsies. The implications of integrating dual staining into contemporary screening strategies, particularly considering the evolving landscape of HPV vaccination and changes in HPV genotype prevalence are also discussed. New guidelines and further research are necessary to elucidate the long-term effects of integrating dual staining into screening protocols.

Diving decompression theory hypothesizes inflammatory processes as a source of micronuclei which could increase related risks. Therefore, we tested 10 healthy, male divers. They performed 6-8 dives with a maximum of two dives per day at depths ranging from 21 to 122 msw with CCR mixed gas diving. Post-dive VGE were counted by echocardiography. Saliva and urine samples were taken before and after each dive to evaluate to evaluate inflammation: ROS production, lipid peroxidation (8-iso-PGF2), DNA damage (8-OH-dG), cytokines (TNF-, IL-6, and neopterin). VGE exhibits a progressive reduction followed by an increase (p<0.0001) which parallels in-flammation responses. Indeed, ROS, 8-iso-PGF2, IL-6 and neopterin increases from 0.19 ± 0.02 to 1.13 ± 0.09 μmol.min−1 (p<0.001); 199.8 ± 55.9 to 632.7 ± 73.3 ng.mg-1 creatinine (p<0.0001); 2.35 ± 0.54 to 19.5 ± 2.96 pg.ml-1 (p<0.001); and 93.7 ± 11.2 to 299 ± 25.9 μmol·mol−1 creatinine (p=0.005), respectively. The variation after each dive was held constant around 158.3 ± 6.9% (p = 0.021); 151.4 ± 5.7% (p <0.0001); 176.3 ± 11.9% (p<0.0001); and 160.1 ± 5.6% (p<0.001), respectively. When oxy-inflammation reaches a certain level, it exceeds hormetic coping mechanisms allowing second-generation micronuclei substantiated by an increase of VGE after an initial continuous decrease consistent with a depletion of “first generation” pre-existing micronuclei.

Human violence recognition is an area of great interest in the scientific community, given its broad spectrum of applications, especially in video surveillance systems, since detecting violence in real-time could prevent criminal acts and save lives. Despite the number of existing proposals and research, most focus on the precision of results, leaving aside efficiency and its practical implementation. Thus, this work proposes a model that is effective and efficient in recognizing human violence in real-time. The proposed model consists of three modules: a first module called Spatial Motion Extractor (SME), in charge of extracting regions of interest from a frame; a second module called Short Temporal Extractor (STC), whose function is to extract temporal characteristics of rapid movements, finally the Global Temporal Extractor (GET) module, responsible for identifying long-lasting temporal features and fine-tuning the model. The proposal was evaluated regarding efficiency, effectiveness, and ability to operate in real-time. The results obtained on Hockey, Movies, and RWF-2000 datasets demonstrated that this approach is highly efficient compared to other alternatives. A VioPeru dataset was created to validate real-time applicability with violent and non-violent videos captured by real video surveillance cameras in Peru. The effectiveness results in this dataset outperformed the best existing proposal. Therefore, our proposal has contributions in efficiency, effectiveness, and real-time.

Background: allergic diseases and, in particular food allergy (FA), have been identified as one of the major diseases in the world. The first 1000 days of life can be a “window of opportunity” or a “window of susceptibility” during which several factors can predispose children to FA development. Changes in gut microbiota composition, from pregnancy to infancy, could have a pivotal role in this regard: some bacterial genus such as Lactobacillus or Bifidobacterium seem to be protective from FA development, on the contrary Clostridium and Staphylococcus appear to be unprotective. Methods: we conducted a research through the most recent literature (2013-2023), using Pubmed and Scopus as databases. We included English original papers, clinical trials, metanalysis and reviews. Case reports, series and letters have been excluded. Results: during pregnancy, maternal diet can play a fundamental role in influencing gut microbiota composition of newborns. After birth, human milk can promote the development of protective microbial species by human milk oligosaccharides (HMOs), that play a prebiotic role. Also complementary feeding can modify gut microbiota composition. Conclusions: the first two years of life are a critical period where several factors, in genetic predisposed children, can increase the risk of FA development.

In modern security situations, tracking multiple human objects in real-time within challenging urban environments is a critical capability for enhancing situational awareness, minimizing response time, and increasing overall operational effectiveness. Tracking multiple entities enables informed decision-making, risk mitigation, and the safeguarding of civil-military operations to ensure safety and mission success. This paper presents a multi-modal electro-optical/infrared (EO/IR) and radio frequency (RF) fused sensing (MEIRFS) platform for real-time human object detection, recognition, classification, and tracking in challenging environments. By utilizing different sensors in a complementary manner, the robustness of the sensing system is enhanced, enabling reliable detection and recognition results across various situations. Specifically designed Radar tag and thermal tag can be used to discriminate friendly and non-friendly objects. The system incorporates deep learning-based image fusion and human object recognition and tracking (HORT) algorithms to ensure accurate situation assessment. After integrating into an all-terrain robot, multiple ground tests were conducted to verify the consistent HORT in various environments. The MEIRFS sensor system has been designed to meet the Size, Weight, Power, and Cost (SWaP-C) requirements for installation on autonomous ground and aerial vehicles.

The adipose-derived mesenchymal stem cells are becoming the tool of choice for many clinical applications and nowadays, nearly 200 clinical trials are running worldwide to prove the efficacy of this cell type for many diseases and pathological conditions. To reach the goal of cell therapies and produce ATMPs as drugs for regenerative medicine, it is necessary to properly standardize the GMP processes and thus collection methods, transportation strategies, extraction protocols and characterization procedures without forgetting that all the tissues of the human body are characterized by a wide inter-individual variability genetically determined and acquired during life. Here we compare 302 samples processed under GMP rules to exclude the influence of the operator and of the anatomical site of collection. Variability in the age of patients, gender and laboratory parameters like total cell number, cell viability, stem cell number and other stromal vascular fraction cell sub-populations have been compared to each other. Results show that, when the laboratory protocol is standardized, the variability in quantifiable cell parameters is widely statistically non-significant, meaning that we can make a further step toward standardized advanced cell therapy products.

Monocarboxylate transporter 8 (MCT8) and organic anion-transporting polypeptide 1C1 (OATP1C1) are thyroid hormones (TH) transmembrane transporters relevant for the availability of TH in neural cells, crucial for their proper development and function. Mutations in MCT8 or OATP1C1 result in severe disorders with dramatic movement disability related to alterations in basal ganglia motor circuits. Mapping the expression of MCT8/OATP1C1 in those circuits is necessary to explain their involvement in motor control. We studied the distribution of both transporters in the neuronal subpopulations that configure the direct and indirect basal ganglia motor circuits using immunohistochemistry and double/multiple labeling immunofluorescence for TH transporters and neuronal biomarkers. We found their expression in the medium-sized spiny neurons of the striatum (the receptor neurons of the corticostriatal pathway), and in various types of its local microcircuitry interneurons, including the cholinergic. We also demonstrate the presence of both transporters in projection neurons of intrinsic and output nuclei of the basal ganglia, motor thalamus and nucleus basalis of Meynert, suggesting an important role of MCT8/OATP1C1 for modulating the motor system. Our findings suggest that a lack of function of these transporters in the basal ganglia circuits would significantly impact motor system modulation, leading to clinically severe movement impairment.

Postural deficits such as hyperlordosis (hollow back) or hyperkyphosis (hunchback) are relevant health issues. Diagnoses depend on the experience of the examiner and are therefore often subjective and prone to errors. Machine learning (ML) methods in combination with explainable ar-tificial intelligence (XAI) tools have proven useful for providing an objective, data-based orien-tation. However, only a few works have considered posture parameters, leaving the potential of more human-friendly XAI interpretations still untouched. Therefore, the present work proposes an objective, data-driven ML system for medical decision support that enables especially human-friendly interpretations using counterfactual explanations (CFs). Posture data for 1151 subjects were recorded by means of stereophotogrammetry. An expert-based classification of the subjects regarding the presence of hyperlordosis or hyperkyphosis was initially performed. Using a Gaussian progress classifier, the models were trained and interpreted using CFs. Label errors were flagged and re-evaluated using confident learning. Very good classification performances for both hyperlordosis and hyperkyphosis were found, whereby the re-evaluation and correction of the test labels led to a significant improvement (MPRAUC = 0.97). A statistical evaluation showed that the CFs seemed to be plausible in general. In the context of personalized medicine, the present study’s approach could be of importance for reducing diagnostic errors and thereby improving the individual adaptation of therapeutic measures. Likewise, it could be a basis for the development of apps for preventive posture assessment.

We live in the world that is completely entangled on energy and thus, Humankind can no longer do without it, power. With electricity being the main form of energy today, this has increased the complexity of our life today. In Uganda, electricity generation is mainly through hydropower which put the country in the bottleneck of over dependence on one source of energy. Yet, there are many energy systems out there that country can diversify its electricity generation. Therefore, the need to understand, the level of development and utilization of various energy systems has been the underlying question for this present study. Comprehensive literature survey was conducted from the electronic databases including ScienceDirect, Wiley, Sage, Scopus, Taylor & Francis, and Google Scholar. The publications in form of reports, conference papers, working papers, discussion papers, journal articles, book sections and textbooks were considered in this study. In total, 11 energy systems including human and animal energy, solid biomass (firewood), hydropower, wind, geothermal, solar, nuclear, peat, coal, petroleum, and non-solid biomass (methanol, hydrogen, ethanol, biodiesel, and biogas) are described. The current and the future development and utilization of these energy systems has been described. The challenges with their development and utilization were elaborated and the solution the challenges were presented. The hydropower with River Nile being the main river for large hydropower plant construction is the dominance energy system in Uganda. Nuclear energy will be the salvation for the country’s electric energy supply in the near future. Therefore, Uganda needs to bet big on nuclear energy.

Holographic subsurface radar (HSR) is currently not in widespread usage. This is due to an historical perspective in the ground penetrating radar (GPR) community that the high attenuation of electromagnetic waves in most media of interest, and the inability to apply time-varying gain to the continuous wave (CW) HSR signal precludes sufficient effective penetration depth. While it is true that the fundamental physics of HSR, with its use of a CW signal, does not allow amplification of later (i.e. deeper) arrivals in lossy media (as is possible with impulse subsurface radar — ISR), HSR has distinct some distinctive advantages. The most important of these is the ability to do shallow subsurface imaging with a resolution that is not possible with ISR. In addition, the design of an HSR system is simpler than for ISR due to the relatively low-tech transmitting and receiving antennae. This paper provides a review of the main principles of HSR through an optical analogy and describes possible algorithms for radar hologram reconstruction. We also present a review of the history of development of systems and applications for HSR of the “RASCAN” type which is possibly the only holographic subsurface radar that is produced in lots. Among the subsurface imaging and remote sensing applications considered are humanitarian demining, construction inspection, surveys of historic architecture and artworks, nondestructive testing of dielectric aerospace materials, security applications, paleontology, detection of wood-boring insect damage, and others. Each application is illustrated with relevant data acquired in laboratory and/or field experiments.

Since the 1970s, the application of microprocessor in industrial machinery and the development of computer systems have transformed the manufacturing landscape. The rapid integration and automation of production systems have outpaced the development of suitable human design criteria, creating a deepening gap where human factor was seen as an important source of errors and disruptions. Today the situation seems different: the scientific and public debate about the concept of Industry 4.0 has raised the awareness about the central role humans have to play in manufacturing systems, to the design of which they must be considered from the very beginning. The future of industrial systems, as represented by Industry 4.0, will rely on the convergence of several research fields such as Intelligent Manufacturing Systems (IMS), Cyber-Physical Systems (CPS), Internet of things (IoT), but also socio-technical fields such as social approaches within technical systems. This article deals with different Human dimensions associated with CPS and IoT and focuses on their conceptual evolution of automatization to improve the sociability of such automated production systems and consequently puts again the human in the loop. Hereby, our aim is to take stock of current research trends, and to show the importance of integrating human operators as a part of a socio-technical system based autonomous and intelligent products or resources. As results, different models of sociability as way to integrate human into the broad sense and/or the development of future automated production systems, were identified from the literature and analysed.

Holographic subsurface radar (HSR) is currently not in widespread usage. This is due to an historical perspective in the ground penetrating radar (GPR) community that the high attenuation of electromagnetic waves in most media of interest, and the inability to apply time-varying gain to the continuous wave (CW) HSR signal precludes sufficient effective penetration depth. While it is true that the fundamental physics of HSR, with its use of a CW signal, does not allow amplification of later (i.e. deeper) arrivals in lossy media (as is possible with impulse subsurface radar — ISR), HSR has distinct some distinctive advantages. The most important of these is the ability to do shallow subsurface imaging with a resolution that is not possible with ISR. In addition, the design of an HSR system is simpler than for ISR due to the relatively low-tech transmitting and receiving antennae. This paper provides a review of the main principles of HSR through an optical analogy and describes possible algorithms for radar hologram reconstruction. We also present a review of the history of development of systems and applications for HSR of the “RASCAN” type which is possibly the only holographic subsurface radar that is produced in lots. Among the subsurface imaging and remote sensing applications considered are humanitarian demining, construction inspection, surveys of historic architecture and artworks, nondestructive testing of dielectric aerospace materials, security applications, paleontology, detection of wood-boring insect damage, and others. Each application is illustrated with relevant data acquired in laboratory and/or field experiments.

The cyclic regeneration of human endometrium is guaranteed by the proliferative capacity of Endometrial Mesenchymal Stromal Cells (E-MSCs). Due to this, the autologous infusion of E-MSCs has been proposed to support endometrial growth in a wide range of gynecological diseases. We aimed to compare two different endometrial sampling methods, the surgical curettage and the Vacuum Aspiration Biopsy Random Assay, and to validate a novel xeno-free method to culture human E-MSCs. Six E-MSCs cell lines were isolated after a mechanical tissue homogenization and cultured using human platelet lysate. E-MSCs were characterized for the colony formation capacity, proliferative potential and multilineage differentiation. The expression of mesenchymal and stemness markers was tested by FACS analysis and Real-Time PCR, respectively. Chromosomal alterations were evaluated by karyotype analysis, whereas tumorigenic capacity and invasiveness were tested by soft agar assay. Both endometrial sampling techniques allowed to efficiently isolate and expand E-MSCs using a xeno-free method preserving their mesenchymal and stemness phenotype, proliferative potential and multi-lineage differentiation ability during the culture. No chromosomal alterations and invasive/tumorigenic capacity were observed. Herein we report the first evidence of efficient E-MSCs isolation and culture in Good Manufacturing Practice compliance conditions, suggesting Vabra endometrial sampling as alternative to surgical curettage.

A two-link model of exoskeleton with variable-length links for supporting the lower limbs of the human musculoskeletal system is proposed in the article. The researched model differs from the existing ones by the variable-length links, and by the angle calculation method. While in the existing models, the angles are calculated from the regular direction – from vertical, or from horizontal, - in the proposed research they are calculated between the links. As for practical exoskeleton implementation, the proposed method of angle calculation is appropriate to the actual working conditions of the electrical motors with the reduction gears installed in the hinges, which change the angles between the links. The mathematical model in the form of the system of Lagrange differential equations of the second kind is obtained. The obtained mathematical model is examined for existence and uniqueness of the Cauchy solution. The kinematic trajectory of the link motion has been synthesized. The controlling actions required for its implementation have been found.

Social distancing is a recommended solution by the World Health Organisation (WHO) to minimise the spread of COVID-19 in public places. The majority of governments and national health authorities have set the 2-meter physical distancing as a mandatory safety measure in shopping centres, schools and other covered areas. In this research, we develop a Deep Neural Network-based Model for automated people detection, tracking, and inter-people distances estimation in the crowd, using common CCTV security cameras. The proposed DNN model along with an inverse perspective mapping technique leads to a very accurate people detection and social distancing monitoring in challenging conditions, including people occlusion, partial visibility, and lighting variations. We also provide an online infection risk assessment scheme by statistical analysis of the Spatio-temporal data from the moving trajectories and the rate of social distancing violations. We identify high-risk zones with the highest possibility of virus spread and infection. This may help authorities to redesign the layout of a public place or to take precaution actions to mitigate high-risk zones. The efficiency of the proposed methodology is evaluated on the Oxford Town Centre dataset, with superior performance in terms of accuracy and speed compared to three state-of-the-art methods.

Victor Vasarely’s (1906-1997) important legacy to the study of human perception is brought to the forefront and discussed. A large part of his impressive work conveys the appearance of striking three-dimensional shapes and structures in a large-scale pictorial plane. Current perception science explains such effects by invoking brain mechanisms for the processing of monocular (2D) depth cues. Here in this study, we illustrate and explain the local effects of 2D color and contrast cues on the perceptual organization in terms of figure-ground assignments, i.e. which local surfaces are likely to be seen as “nearer” or “bigger” in the image plane. Paired configurations are embedded in a larger, structurally ambivalent pictorial context inspired by some of Vasarely’s creations. The figure-ground effects these configurations produce reveal a significant correlation between perceptual solutions for “nearer” and “bigger” when no other monocular depth cues are given in the image. In consistency with previous findings on similar, albeit simpler visual displays, a specific color may compete with luminance contrast in resolving the planar ambiguity of a complex pattern context. Vasarely intuitively understood, and successfully exploited, this kind of subtle context effect in his art, well before empirical investigations had set out to study and explain their genesis in terms of information processing by the visual brain.

Programmed cell death protein 1 (PD-1) is a biomarker on the surface of cells that has a role in promoting self-tolerance by suppressing the inflammatory activity of T cells. In this work, one peptide of PD-1 was used as the template in molecular imprinting. The magnetic peptide-imprinted poly(ethylene-co-vinyl alcohol) composite nanoparticles (MPIP NPs) were characterized by dynamic light scattering (DLS), high-performance liquid chromatography (HPLC), Brunauer-Emmett-Teller (BET) analysis and superconducting quantum interference device (SQUID) analysis. Natural killer-92 (NK-92) cells were added to these composite nanoparticles and then incubated with human hepatoma (HepG2) cells. The viability and apoptosis pathway of HepG2 were then studied using cell counting kit-8 (CCK8) and the quantitative real-time polymerase chain reaction (qRT-PCR), respectively. These nanoparticles were found significantly enhance the activity of natural killer cells toward HepG2 cells by increasing expression of NK-kB, caspase 8 and especially caspase 3.

When using computer-aided translation systems in a typical, professional translation workflow, there are several stages at which there is room for improvement. The SCATE (Smart Computer-Aided Translation Environment) project investigated several of these aspects, both from a human-computer interaction point of view, as well as from a purely technological side. This paper describes the SCATE research with respect to improved fuzzy matching, parallel treebanks, the integration of translation memories with machine translation, quality estimation, terminology extraction from comparable texts, the use of speech recognition in the translation process, and human computer interaction and interface design for the professional translation environment. For each of these topics, we describe the experiments we performed and the conclusions drawn, providing an overview of the highlights of the entire SCATE project.

Abstract Introduction: Visual perceptual skills are essential for independent participation in self-care tasks, educational, work and leisure time activities. The effect of HIV on the visual perceptual skills is not well understood among children in low resource settings like Zimbabwe. Methods: A cross sectional comparative study was done with 30 children living with HIV and 30 children living without HIV residing in Harare urban area. The TVPS-3 was used to assess their visual perceptual skills. SPSS version 22, STATISTICA 13 and Microsoft 2016 were used for data analysis. Results: Both groups of children had mean percentile ranks below 50 on their TVPS-3 scores. Children without HIV generally performed better than those with HIV but the difference was not statistically significant in most cases. Through univariate analysis, only performance on Spatial Relations significantly differed between the two groups. Both groups had lowest scores in Basic visual perceptual skills. Age and school grade were the independent predictors of the children’s performances in the study. Conclusion: There is need for Occupational therapy services in public primary schools and in the pediatric Opportunistic Infections clinics in hospitals to be part of the health team which caters for children with visual perceptual challenges.

To cope with a projected global population increase from 7.2 bn to 9.6 bn by 2050, many more cities must be built. Although there are great benefits to modern urban living, there also great costs, such as the seemingly unstoppable rise in Type 2 diabetes, obesity, coronary issues and various cancers. The new towns should be designed to contain or constrain the epidemic of those ‘Western Lifestyle Diseases’ that currently plagues today’s cities. But how might this be achieved? It is suggested here that a greater understanding of human evolution combined with the potency of the ‘Palaeolithic genome’ holds the key to our future urban wellbeing. Consequently, a new paradigm is suggested that underpins positive forward thinking on townplanning and city lifestyles to create healthier urban environments. This builds directly on the ‘Evolutionary Determinants of Health’ programme initiated at University College London (UCL). A four-stage model is proposed that integrates and develops both evolutionary-concordant personal and institutional health behaviours with appropriately reconfigured town-planning and building regulations. When integrated, these strands could deliver a healthier urban culture within greened, active townscapes by proactively constraining or eliminating some of the key underlying causes of the so-called ‘Western Lifestyle Diseases’.

Here we report the preparation and characterization of a novel biomimetic toothpaste containing morphogenetically active amorphous polyphosphate (polyP) microparticles enriched with retinyl acetate (“a-polyP/RA-MP”). The spherical microparticles (average size, 550±120 nm), prepared by co-precipitating sodium-polyP with calcium chloride and supplemented with retinyl acetate, were incorporated into a basis toothpaste at a final concentration of 1% or 10%. The paste containing “a-polyP/RA-MP” significantly increased the growth of human mesenchymal stem cells (MSC), compared to a commercial toothpaste which acts rather inhibitory and the paste without polyP and retinyl acetate. qRT-PCR experiments revealed that the retinoid causes an induction of the expression of the MSC marker genes for osteoblast differentiation encoding collagen type I and alkaline phosphatase. On the other hand, the polyP ingredient, supplied as Zn-polyP microparticles (“Zn-a-polyP-MP”) strongly inhibited the growth of the cariogenic bacterium Streptococcus mutans. We demonstrate that the amorphous polyP-containing toothpaste, enriched with retinyl acetate, efficiently repairs both cracks/fissures and carious lesions in the tooth enamel, and reseals dentinal tubules, already after a 5 d treatment (brushing) of teeth twice daily for 5 min as examined by SEM and quantitative EDX analysis. The stability of the occlusion of dentin cracks even turned out to resist against short high power sonication treatment. Our results demonstrate that the novel toothpaste prepared here, containing amorphous polyP and retinyl acetate, is particularly suitable for prevention/repair of (cariogenic) damages of tooth enamel/dentin and for treatment of dental hypersensitivity.

Access to medical care is a global issue. Technology-aided approaches have been applied in addressing this. Interventions have however not focused on medical diagnosis as a fully automated procedure and available applications employ mainly text-based inputs rather than conversation in natural language. We explored the utility of ontology-based chatbot technology for the design of intelligent agents for medical diagnosis through a systematic review of the most recent related literature. English articles published in 2011-2016 returned 233 hits which yielded 11 relevant articles after a 3-stage screening. Findings showed that the creation of expert systems had been the focus of many the studies which utilize the physician-system-patient framework with system training based mostly on expert knowledge for designing web- or mobile phone-based applications that serve assistive purposes. Findings further indicated gaps in the design and evaluation of more effective systems deployable as standalone applications, for example, on an embodied robotic system. The need for technology supporting the physical examination part of diagnosis, connection to data sources on patients’ vitals and medical history are also indicated in addition to the need for more qualitative work on natural language-based interaction. The system should be one that is continuously learning. Future works should also be directed towards the building of more robust knowledge base as well as evaluation of theory-based diagnostic methodological options

Quantifying forest carbon storage to better manage climate change and its effects requires accurate estimation of forest structural parameters such as canopy height. Variables from remote sensing data and machine-learning models are tools that are being increasingly used for this purpose. This study modelled canopy height of forest-savannah mosaics in the Sudano-Guinean zone of Togo. Relative heights were extracted from GEDI and ICESat-2 products, which were combined with optical, radar and topographic variables for canopy height modelling. We tested four methods: Random Forest (RF); Support Vector Machine (SVM); Extreme Gradient Boosting (XGBoost); and Deep Neural Network (DNN). The RF algorithm obtained the best predictions using 98% relative height (RH98). The best performing result was obtained from variables extracted from GEDI data (r = 0.84; RMSE = 4.15 m; MAE = 2.36 m), compared to ICESat-2 (r = 0.65; RMSE = 5.10 m; MAE = 3.80 m). Models that were developed during the study, from the combination of multisource and multisensor data, can be applied over large areas in forest-savannah mosaics, thereby contributing to better monitoring of forest dynamics according to the objectives and requirements of REDD+.

Background: Obesity and Type 2 diabetes (T2D) promote inflammation, increasing the risk of colorectal cancer (CRC). High-fat diet (HFD)-induced obesity plays a key role in these diseases through biological mechanisms. This study examined the effect of genetic background on the multimorbidity of intestinal cancer, T2D, and inflammation due to HFD-induced obesity. Methods: A cohort of 357 Collaborative Cross (CC) mice from 15 lines was fed either a control chow diet (CHD) or HFD for 12 weeks. Body weight was tracked biweekly, and blood glucose was assessed at weeks 6 and 12 via intraperitoneal glucose tolerance tests (IPGTT). At the study's endpoint, intestinal polyps were counted, and cytokine profiles were analyzed to evaluate the inflammatory response. Results: HFD significantly increased blood glucose levels and body weight, with males showing higher susceptibility to T2D and obesity. Genetic variation across CC lines influenced glucose metabolism, body weight, and polyp development. Mice on HFD developed more intestinal polyps, with males showing higher counts than females. Cytokine analysis revealed diet-induced variations in pro-inflammatory markers like IL-6, IL-17A, and TNF-α, differing by genetic background and sex. Conclusions: Host genetics plays a crucial role in susceptibility to HFD-induced obesity, T2D, CRC, and inflammation. Genetic differences across CC lines contributed to variability in disease outcomes, providing insight into the genetic underpinnings of multimorbidity. This study supports gene-mapping efforts to develop personalized prevention and treatment strategies for these diseases.

Damage to peripheral arteries by the atherosclerotic process accounts for about 3% of the world's population, which puts this problem in the category of major social problems. Modified lipoproteins and cholesterol crystals are known to accumulate in the arterial intima and cause the formation of proatherogenic macrophages, foam cells, and inflammation. Defective efferocytosis of apoptotic foam cells leads to the formation of a necrotic core, a sign of failure to resolve inflammation. Resolution of inflammation is mediated by specialized pro-resorption lipid mediators, proteins and signaling gases. Improving the balance between pro-inflammatory and anti-inflammatory factors contributes to the reverse development of local atherogenesis. Active direct intervention in the reconstruction of the adventitial layer of the arterial wall using cholesterol-affinity polysaccharide hydrogels containing a cocktail of growth factors creates conditions for the formation of additional extracellular matrix and reversal of cholesterol mass from the subintimal zone. Creating concentration and electrostatic gradients in the adventitia zone using a hydrogel may be one of the effective ways to degrade early soft atherogenic plaques and locally restore the damaged structure of the vessel wall. Growing scientific interest in the previously insufficiently studied adventitia indicates its important role in angionesis and atherogenesis.

Cementitious materials exhibit excellent binding properties and micropore structures that support the stabilization of TiO2 nanoparticles within the matrix. Therefore, these materials are ideal for the development of functional construction products with TiO2 nanoparticles. This study investigated the degree of hydration, microstructure, and mechanical properties of cement-containing TiO2 nanoparticles. The experimental results demonstrated that TiO2 nanoparticles accelerated the hydration rate of cement, reducing the setting times. Moreover, TiO2 nanoparticles changed matrix microstructure, decreasing the porosity and improving early-age strength. Although TiO2 nanoparticles function as nucleation sites in the cement hydration reaction, the tendency of the particles to clump implies that proper dispersion should be ensured when mixing in large quantities. When developing new building materials incorporating TiO2 nanoparticles, considering the effect of TiO2 nanoparticles on the hydration reaction of cementitious materials is crucial.

With the aim to produce new heterocycle molecules, the previously reported 2-(aminomethyl)-2-(4-chlorophenyl)-2,3-dihydroquinazolin-4(1H)-one was converted efficiently by reacting with N,N’-dithiocarbonyldiimidazole (DTCI), to produce the substituted imidazolidine-2-thione moiety inserted in a three fused ring scaffold of the title compound. The molecular composition was confirmed by a high-resolution MS experiment, and its structure was elucidated by 1H, 13CNMR, and IR analyses. The thioacetamide form of the product was supported by density functional theory (DFT)-NMR analysis where 13C chemical shifts of thioacetamide form and of its iminothiol tautomer were calculated in chloroform at the BP86 /Jgauss-TZP2 level of theory. The very good linear correlation between 13C chemical shifts by experiment and by calculation for the NHC=S form confirmed the structure.

Recent advancements in communication technology have catalyzed the widespread adoption of realistic content, with augmented reality (AR) emerging as a pivotal tool for seamlessly inte-grating virtual elements into real-world environments. In construction, architecture, and urban design, the integration of mixed reality (MR) technology enables rapid interior spatial mapping, providing clients with immersive experiences to envision their desires. The rapid advancement of MR devices, or devices that integrate MR capabilities, offers users numerous opportunities for enhanced entertainment experiences. However, to support designers at a high level of expertise, it is crucial to ensure the accuracy and reliability of the data provided by these devices. This study explores the potential of utilizing spatial mapping within various methodologies for surveying architectural interiors. The objective is to identify optimized spatial mapping procedures and determine the most effective applications for their use. Experiments were conducted to evaluate the interior survey performance, using HoloLens 2, iPhone 13 Pro for spatial mapping, and photogrammetry. The findings indicate that HoloLens 2 is most well-suited for the tasks exam-ined in the scope of experiments. Nonetheless, based on the acquired parameters, the author also proposes approaches to apply the other technologies in specific real-world scenarios.

Predicting type 2 diabetes mellitus (T2DM) using phenotypic data with machine learning (ML) techniques has received significant attention in recent years. PyCaret, an ML tool that enables the simultaneous application of 16 different algorithms, was used to predict T2DM using phenotypic variables from the “Nurses’ Health Study” and “Health Professionals’ Follow-up Study” datasets. Ridge classifier, Linear Discriminant Analysis, and Logistic Regression (LR) were the best-performing models for the male-only data subset. For the female-only data subset, LR, Gra-dient Boosting Classifier, and CatBoost Classifier were the strongest models. The AUC, accuracy, and precision were 0.77, 0.70, and 0.70 for males and 0.79, 0.70, and 0.71 for females, respective-ly. The feature importance plot showed that familial history of diabetes (famdb), never having smoked, and high blood pressure (hbp) were the most influential features in females, while famdb, hbp, and current smoking were the major variables in males. In conclusion, PyCaret was used successfully for speed analysis for the prediction of T2DM by simplifying complex ML tasks. Gen-der differences are an important consideration for T2DM prediction. Despite this comprehensive ML tool, phenotypic variables alone may not be sufficient for early T2DM prediction; genotypic variables could also be used in combination for future studies.

Epigallocatechin gallate (EGCG), the principal catechin in green tea, exhibits diverse therapeutic properties. However, its clinical efficacy is hindered by poor stability and low bioavailability. This study investigated solid particle-in-oil-in-water (S/O/W) emulsions stabilized by whey protein isolate (WPI) and sodium caseinate (NaCas) as carriers to enhance the bioavailability and intestinal absorption of EGCG. Molecular docking revealed binding interactions between EGCG and these macromolecules. The emulsions exhibited high encapsulation efficiencies and augmented EGCG bioaccessibility by 64% compared to free EGCG in a simulated gastrointestinal digestion model. EGCG-loaded emulsions demonstrated minimal cytotoxicity towards Caco-2 cells and facilitated EGCG transport across the intestinal epithelial layer without compromising tight junction integrity. Notably, EGCG-loaded emulsions protected Caco-2 cells against oxidative stress by suppressing intracellular reactive oxygen species generation. The results demonstrate the potential of WPI- and NaCas-stabilized S/O/W emulsions to enhance the bioavailability, intestinal absorption, and bioactivity of EGCG, expanding its applications in functional foods and nutraceuticals.

Flexible polymer-based dye-sensitized solar cells (DSSCs) offer promising potential for lightweight, cost-effective and versatile photovoltaic applications. However, the critical challenge in their widespread applications is the weak thermal stability of the majority of polymeric substrates, which can only withstand a maximum temperature processing of 150°C. In this study, we propose a facile and low-cost strategy to develop at low temperature DSSC flexible photoanode based on a polymeric matrix. Highly porous nanocomposites fibrous mats composed of polyethylene terephthalate (PET) and titanium dioxide (TiO2) nanobars were prepared through electrospinning process using different configurations (uniaxial electrospinning, coaxial electrospinning, and electrospray-assisted electrospinning). These techniques enabled precise control of the microstructure and the positioning of TiO2 within the composite nanofibers. Therefore, the as-produced photoanodes were loaded with N719 dye and tested in DSSC prototype using iodide-triiodide electrolyte and platinum (Pt) coated counter electrode. The results show that incorporating TiO2 on the fiber surface through the electrospray-assisted electrospinning enhanced the performance of the nanofiber composite, leading to improved dye loading capacity, electron transfer efficiency and photovoltaic performance.

The study conducts a comparative analysis of solar radiation estimation methods, assessing the efficacy of the Heliosat-2 algorithm against ground measurements across seven distinct countries: Netherlands, Spain, Japan, Namibia, South Africa, Saudi Arabia, and India. To achieve this, it utilizes two distinct satellite data sources—Himawari-8 for Japan and Metosat Second Generation-MSG for the rest of the countries—spanning the years Jan 2022 to April 2024. A robust methodology for determining albedo parameters specific to Heliosat-2 was developed. During cloudy days, the estimates provided by Heliosat-2 generally exceeded the ground measurements in all the countries. Conversely, on clear days, there was a tendency for underestimation, as indicated by the median value of the mean bias (MB) across most of the countries. The Heliosat-2 model slightly underestimates daily radiation values, with a median MB ranging from −27.5 to +10.2 W.m⁻². Notably, the median root mean squared error (RMSE) on clear days is significantly lower, with values ranging from 24.8 to 108.7 W.m⁻², compared to cloudy days where RMSE values lie between 75.3 and 180.2 W.m⁻². In terms of R² values, both satellites show a strong correlation between the estimated and actual values, with a median value consistently above 0.86 on a monthly scale and over 92% of daily data points falling within ±2 standard deviation.

A two-qubit Hamiltonian model exhibiting an SU(2) symmetry is considered. The related dynamical problem results to be then exactly solvable both in the time-independent and in the time-dependent case. Basing on the formal, general form of the related time evolution operator, the time-dependence of the level of entanglement of some initial conditions is studied within both the Rabi and the Landau-Majorana-Stückelber-Zener scenarios.

Metabolic syndrome (MS), a complex pathology with features like abnormal body fat distribution, insulin resistance, and dyslipidaemia, contributes to higher cardiovascular (CV) risk. A cross-sectional study including 87 individuals, assessed CV risk in elderly patients with type 2 diabetes and MS in Algarve, Portugal. The 10-year CV risk was estimated using the ADVANCE risk score calculator. The reductions in CV risk were estimated by adjusting the data inputted on the online tool to achieve systolic blood pressure (SBP) <130 or <120 mmHg, and LDL-cholesterol <70 mg/dL. Beyond waist circumference, the mean number of clinical features of MS was 3.14±0.84, without significant sex differences. The mean CV risk was 22.5% (CI: 20.3-24.7). Sex-specific analysis showed higher risk in males (24.2%, CI: 21.3-27.0) vs. females (19.7%, CI: 16.2-23.3; p=0.028). Hypothetical risk reductions show that lowering SBP to <130 mmHg could significantly lower the risk by an average of 9.2% (CI: 7.7-10.7), whereas 34.5% of the participants would be out of the diagnostic criteria for MS. When comparing each potential intervention with current risk, all interventions significantly reduce the 10-years CV risk. The study highlights the potential of blood pressure control in reducing CV risk and the importance of multifaceted risk reduction strategies.

Membrane gas absorption technology has been considered as a promising approach to mitigate CO2 emissions from power plants. The aim of this study is to evaluate the environmental impacts of CO2 absorption and desorption processes by hollow fiber membrane contactors using life cycle assessment methodology. On the basis of ReCipe 2016 Midpoint and ReCipe 2016 Endpoint methods, the research results show that, membrane gas absorption system exhibits the lowest environmental impacts across the majority assessed categories in comparison with chemical absorption and membrane gas separation systems. The CO2 capture process via membrane gas absorption has the most significant impact on METP category, with heat consumption as the primary contributing factor accounting for 55%, followed by electricity consumption accounting for 43.1%. According to the sensitivity analysis, heating by natural gas shows a better performance than other heat supply sources in improving overall environmental impacts. In addition, the increasing utilization of renewable energy in electricity supply reduces the global warming potential, fossil resource consumption and ozone formation.

Background and Objectives: To investigate the relationship between the SII index and the micro-macro complications and death that develop in the first year and the following 3 years, following the calculation of the index in type 2 diabetic retinopathy patients. Materials and Methods: This study was performed retrospectively with 523 type 2 diabetic retinopathy patients admitted to the endocrinology outpatient clinic of our hospital between January 2019 and December 2019. The demographic, and clinical characteristics of the patients were evaluated using descriptive statistics. Shapiro-Wilk test was used for the normal distribution of quantitative data; Mann-Whitney U, Mc Nemar Chi-square, and Cochran's Q tests were used to analyze SII values between groups and complication rates by years; sensitivity and specificity were determined by ROC analysis and considered statistically significant with a significance level of P

Reservoirs created by damming rivers significantly modify the environment and problems may arise: the storage of nutrients and organic matter in reservoirs often leads to decreased water quality due to eutrophication. Reservoirs built on lowland rivers are exposed to significant nutrient loads, often leading to eutrophication. In this article, the Sulejów Reservoir, in Central Poland, was the subject of the research, which focused on the use of Sentinel-2 remote sensing data to detect phytoplankton blooms, and on understanding the pattern of wind-driven surface currents using the CCHE2D model (a depth-averaged hydrodynamic model). The calculation of the total phosphorus load has shown that the reservoir mainly acts as nutrient storage. Still, during the low flow and intensive phytoplankton bloom, it can be a source of nutrients. The distribution of phytoplankton bloom on the Sulejów Reservoir was documented using eight Sentinel-2 satellite images from the vegetation season of 2020 and the Normalized Difference Chlorophyll Index (NDCl). Coupling remote sensing data and numerical modelling helps to interpret the hydrodynamic model results and understand nutrients and sediment dynamics within the reservoir. Hydrodynamic modelling combined with remote sensing data can be a valuable tool for selecting appropriate locations for water quality measurements at monitoring stations.

(1) Background: Among the chronic complications of type 2 diabetes mellitus, cancer became the leading cause of death in several countries. Our objective was the determination of whether prevalent type 2 diabetes mellitus is associated with a higher incidence of cancer. (2) Methods: This study is a nationwide analysis performed in Hungary. Study population was divided into a group with type 2 diabetes mellitus and into a non-diabetic group. The primary outcome was the risk related to overall cancer incidence. A key secondary outcome was the overall incidence of cancer in distinct study years. Further outcomes were the annual percent changes. (3) Results: The odds ratio related to the overall incidence of cancer was 2.50 (95% confidence interval: 2.46-2.55, P&lt;0.0001) in patients with diabetes as related to controls. The odds ratio was higher in males than in females. The highest risk was found in the 18-39-year-old subgroup. The annual cancer incidence rate declined in controls, but not in patients with diabetes. Several types of cancer showed a decreasing tendency in non-diabetic controls.; (4) Conclusions: type 2 diabetes is associated with a higher risk of cancer. High risk in young patients with type 2 diabetes suggests that these young individuals should be considered as a risk group.

The aim of this study was to determine the microbial stability, challenge to L. monocytogenes, and some physicochemical properties of turkey breast meat by alginate-based coating enriched with postbiotics (8% concentration, CFS) of Bifidobacterium bifidum DSM 20456 and Bifidobacterium bifidum BB12 strains. For this purpose, firstly, some antimicrobial and total phenolic matter, flavonoid, and DPPH activity values of postbiotics were determined. In addition, FTIR analysis was performed to see the intermolecular interactions of the biological coating agent. As a result of the study, alginate solution with postbiotic showed significant differences in pH, a*, b*, yeast-mold values of turkey meat during storage (7 days), while L* value, total aerobic mesophilic bacteria count (TMAP), psychrotrophic bacteria (PAB), lactic acid bacteria (LAB) and Listeria monocytogenes count were not effective (p&gt;0.05).

(1) Background: The aim of study was to investigate the salt consumption by children and adolescents from the Silesian Province (Poland), taking into account the region’s dietary traditions and number of years of school education. (2) Methods : 300 students aged 10–18 from different types of schools, were enrolled in the study and divided into groups in terms of: school, sex, the state of nutrition. The survey questionnaire about dietary habits, including the frequency and serving size with respect to 12 salty products was used. On the basis of the frequency and the amount of consumed products, as well as the data on salt content, the amount of total daily intake of salt was estimated.; (3) Results: The mean daily intake of salt by children and adolescents was 1.083 g ( 0.433 g of sodium); children aged 10–12 consumed the highest amount of salt (1.296 g/day) compared to pupils aged 13–15 (1.131 g of sodium) and adolescents aged 16–18 (0.863 g/day); (4) Conclusions: With age, as a result of various factors, the consumption of salt declines. The parents impact and the familial socio-environmental factors begin to wane, and other factors start to have influence, e.g. school education of healthy lifestyle, health behavior of peers.

Abstract Background: Metabolic syndrome (MetS) is a complex disorder characterized by insulin resistance (IR), central obesity, atherogenic dyslipidemia and higher glucose levels. It increases the risk of cardiovascular disease (CVD) and type 2 diabetes mellitus (T2DM), imposing an economic burden on the healthcare system. However, the historical origins of MetS as well as the development and evolution of its definitions have not been conclusively documented in the literature. Aim: This study seeks to enhance the understanding of the developmental trends of MetS during the preceding two decades, placing particular emphasis on the definition, diagnosis and prevalence. Methods: An extensive search was performed from 1920 to 2023 across prominent scientific research engines, including Scopus, PubMed, MDPI, and others. Results: Despite advancements, many aspects of MetS remain inadequately understood. As the understanding of the nature and pathophysiology of MetS progresses, the development and refinement of its diagnostic criteria, and assessment and treatment guidelines will continue. Additionally, there exists significant variation in the global prevalence of metabolic syndrome, ranging from 14 to 39%. This prevalence is projected to increase due to the adoption of less healthy dietary patterns and sedentary lifestyles. The observed disparities in metabolic syndrome prevalence can be attributed to multiple factors, including demographic characteristics. Furthermore, the lack of a standardized definition across studies also contributes to the variation in reported prevalence rates. Conclusion: Further studies focusing on the standardization of the MetS definition across different research are crucial. The establishment of consistent criteria would enhance the reliability and validity of research findings, enabling more meaningful comparisons and interpretations.

The APIS Breast Cancer Subtyping Kit is an mRNA-based assessment of the three biomarkers routinely assessed in all newly diagnosed breast cancers (BC), estrogen receptor (ER), progesterone receptor (PR), and HER2 as well as an additional four genes that create a novel proliferation signature, MKI67, PCNA, CCNA2, KIF23. Taken together the data is used to produce a molecular sub-type for every sample. The kit was evaluated against the current standard protocol of immunohistochemistry (IHC) and/or in situ hybridization (ISH) in breast cancer patients. The data was presented at the weekly breast Multidisciplinary Team (MDT) meeting. 98 consecutive cases of pre-operative breast cancer core biopsies and two core biopsy of nodal metastases yielding 100 cases were assessed. IHC and APIS Results were available for 100 and 99 cases. ER was concordant in 97% cases, PR in 89% and HER2 results were concordant with IHC/ISH in 100% of the cases. Ki-67 IHC was discordant in 3% cases when compared with MK167 alone but discordant in 24% when compared with the four gene proliferation signature. In conclusion, our study, indicates that the APIS Breast Cancer Subtyping Kit is highly concordant when compared to the results produced for ER/PR/HER2 by IHC and/or ISH. The assay could play a role in the routine assessment of newly diagnoses Breast Cancer (BC) specimens.

Keywords: Spine surgery 1; Metastatic spinal cord compression 2; Spinal metastasis 3; Cancer treatment.

Results showed that mulberry leaves could significantly reduce backfat thickness (P&lt;0.05) and increase intramuscular fat (IMF) content (P&lt;0.05). Lipidomics analysis showed that mulberry leaves improved lipid profile composition and increased the proportion of triglycerides (TG). Interestingly, IMF content was positively correlated with acyl C18:2 and negatively correlated with C18:1 of differential TGs. In addition, cecal microbiological analysis showed that mulberry leaves could increase the abundance of bacteria such as UCG−005, Muribaculaceae_norank, Prevotellaceae_NK3B31_group, Limosilactobacillus, and so on. At the same time improve the L-tyrosine-baton rouge ester, Oleic acid methyl ester, 21-deoxycortisol, N-acetyldihydrosphingosine, Mulberrin relative abundance. In this study, we found that mulberry leaves could extremely significantly increasing the mRNA relative expression of lipoprotein lipase (LPL), fatty acid-binding protein 4 (FABP4) and peroxisome proliferators-activated receptor γ (PPARγ) in muscle (P＜0.01), significantly increasing mRNA relative expression of diacylglycerol acyltransferase 1 (DGAT1) (P＜0.05) and significantly decreasing the mRNA relative expression of acetyl CoA carboxylase (ACC) (P＜0.05), and aignificantly upregulated hormone-sensitive triglyceride lipase (HSL), peroxisome proliferators-activated receptor α (PPARα) mRNA relative expression (P＜0.05) in backfat. In addition mulberry leaves could increased serum leptin and adiponectin (P＜0.01). Ultimately lead to up-regulation of IMF and down-regulation of backfat.

Among the number of hurdles that the vaccines based in modRNA platforms have been facing, there is now another critical one: immune imprinting which decreases even more the effectiveness of the modRNA Covid vaccines.

Tocilizumab against interleukin-6 receptor (IL-6R) has been demonstrated to inhibit the progression of diverse cancers in vitro and in vivo. Nonetheless, evidence regarding the anti-tumor effects of Tocilizumab on human colorectal carcinoma (CRC) corresponding to IL-6R expression levels re-mains scarce. To investigate the influence of IL-6R expression, SW480 and HT-29 cells inoculated subcutaneously into NU/NU mice were used as our human CRC xenograft models with anti-IL-6R antibody (Tocilizumab) therapy. IL-6R expression levels, the histology of CRC growth/ invasiveness and tumor growth-related signaling pathway were estimated by H&E and immunohistochemical staining. SW480 tumor cells with higher IL-6R expression levels exerted better responsiveness in Tocilizumab therapy than the treated HT-29 group. Likewise, therapeutic effects of Tocilizumab on the proliferative ability with mitotic index and Ki-67 expressions, the invasiveness with MMP-9 proteinase expressions, ERK 1/2 and STAT3 signaling transduction in SW480 treatment group were superior to HT-29 treatment group. In light of our results, IL-6R is the key indicator for the efficacy of Tocilizumab treatment in CRC xenografts. From the perspective of precision medicine, tumor response to anti-IL-6R antibody therapy could be predicted on the basis of IL-6R expression levels. In this manner, Tocilizumab may serve as a targeted and promising anti-CRC therapy.

Aronia berries contain antioxidants that may have health promoting properties e.g., demonstrated positive effects on hypertension and dyslipidemia. There is a close link between cardiovascular diseases and hypertension and dyslipidemia, and cardiovascular events are the leading cause of death among subjects with T2D. Thus, we investigated the effect of 8 weeks supplementation with fermented aronia extract (FAE), non-fermented aronia extract (AE) and placebo on cardiovascular risk factors. The extracts were incorporated into snack bars containing 34 g (37%) aronia extract, or 17 g (21%) wheat bran for placebo, as well as raisins and coconut oil. The study was randomized and blinded with a triple-cross-over design. We examined the effects of aronia extracts on blood pressure, adiponectin and high-sensitive C-reactive protein and found no effects. After supplementation with placebo, there were significantly higher total-cholesterol, LDL-cholesterol, and HDL-cholesterol, with the placebo group showing significantly higher increases in total-cholesterol and LDL-cholesterol than the FAE group. Furthermore, we observed an increase in HDL-cholesterol in the AE group and an increase in triglyceride in the FAE group. Thus, we assume that raisins may have increased the participants’ cholesterol levels, however, with both AE and FAE having the potential to prevent this increase.

β3-Adrenoceptors mediate several functions in rodents that could be beneficial for the treatment of obesity and type 2 diabetes. This includes promotion of insulin release from the pancreas, of cellular glucose uptake, of lipolysis, and of thermogenesis in brown adipose tissue. In combination, they lead to a reduction of body weight in several rodent models including ob/ob mice and Zucker diabetic fatty rats. These findings stimulated drug development programs in various pharmaceutical companies, and at least nine β3-adrenoceptor agonists have been tested in clinical trials. However, all of these projects were discontinued due to lack of clinically relevant changes of body weight. Following a concise historical account of discoveries leading to such drug development programs we discuss species differences that explain why β3-adrenoceptors are not a meaningful drug target for the treatment of obesity and type 2 diabetes in humans.