A quantum particle constrained between two high potential barriers provides a paradigmatic example of a system sustaining quasi bound (or resonance) states. When the system is prepared in one of such quasi bound states, the wave function approximately maintains its shape but decays in time in a nearly exponential manner radiating into the surrounding space, the lifetime being of the order of the reciprocal of the width of the resonance peak in the transmission spectrum. Naively, one could think that adding more lateral barriers would preferentially slow down or prevent the quantum decay since tunneling is expected to become less probable and because of quantum backflow induced by multiple scattering processes. However, this is not always the case and in the early stage of the dynamics quantum decay can be accelerated (rather than decelerated) by additional lateral barriers, even when the barrier heights are arbitrarily large. The decay acceleration originates from resonant tunneling effects and is associated to large deviations from an exponential decay law. We discuss such a counterintuitive phenomenon by considering the hopping dynamics of a quantum particle on a tight-binding lattice with on-site potential barriers.

It is since long known, that SAW devices, resonators as well as delay lines, can be used as passive wireless sensors for physical quantities like temperature and pressure as well as gas sensors or ID-Tags. The sensors are robust, work passively without battery, can be applied at high temperatures and provide a high resolution. Nevertheless, if the devices should be readout wirelessly in an industrial environment, several constraints have to be taken into account, especially when more than one quantity or device needs to be measured at the same time. The paper addresses the challenges that have to be tackled when establishing multi-sensor-wireless-readout for industrial applications. Major issues here are the legal ISM-band regulations, as well as sampling time and costs, which impose severe restrictions to any system design. We describe several design approaches and their constraints. We have successfully designed sensors based on reflective delay lines that allow the parallel readout of four independent temperature sensors in the 2.45 GHz ISM-band. These devices have been fabricated, positively tested and demonstrate the applicability of SAW sensors for industrial applications.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Background Systemic sclerosis (SSc) is a rare, multisystemic disorder of connective tissue, characterized by widespread inflammation, vascular abnormalities, and both skin and visceral organ fibrosis. Tissue fibrosis is the final phase of a complex biological process of immune activation and vascular damage. Objectives The aim of study was to assess hepatic fibrosis and steatosis in SSc patients by transient elastography (TE). Methods Fifty-nine SSc patients, satisfying the 2013 ACR/EULAR classification criteria, were recruited. Clinical and laboratory findings, modified Rodnan skin score (mRSS), ac-tivity index, video-capillaroscopy, echocardiography, and lung function data were ana-lyzed. Liver stiffness (LS) was measured by transient elastography (TE), with 7 kPa used as the cut-off value for significant liver fibrosis and steatosis. Specifically, values ≥ 238 CAP ≤ 259 dB/m were considered consistent with mild steatosis (S1), 260 ≥ CAP ≤ 290 dB/m with moderate steatosis (S2) and ≥291 dB/m with severe steatosis (S3) Results The median age of patients was 51 years, with a median disease duration of 6 years. Median LS was 4.5 (2.9–8.3) kPa; 41 patients (69.5%) had no evidence of fibrosis (F=0), 16 (27.1%) displayed LS values between 5.2 and 7 kPa; only 2 patients (3.4%) had LS values >7 kPa (F3). The median CAP value for liver steatosis was 223 dB/m (IQR: 164–343). Overall, 39 patients (66.1%) did not show evidence of steatosis (CAP values <238 dB/m); 9 patients (15.2%) showed values consistent with mild (S1) steatosis (CAP value ≥238 ≤259 dB/m); 8 patients (13.5%) had moderate (S2) steatosis (CAP value ≥260 ≤290 dB/m); 3 patients (5.1%) were deemed to have severe steatosis (S3) due to CAP values ≥291 dB/m. Conclusions Only 3.4% of our patient population showed evidence of marked liver fibrosis, which is the same prevalence as that expected in the general population. Likewise, the prevalence of significant steatosis was low (5.1%) and depending on the same variables associated with fatty liver in the general population. TE was shown to be an easy and valuable method for detection and screening of liver fibrosis in SSc patients with no additional risk factors for liver disease.

Amyotrophic lateral sclerosis (ALS) is also called "motor neuron disease”. In this review, we propose that ALS is not just a neuromotor disorder, but begins as a disorder of P53-modulated skeletal muscle metabolism, leading to failures at the energy state of the cells, incorrect redox states, motor denervation, and a loss of muscle fibers. Motoneurons die as a consequence of the lack of muscular feedback, and the oligomeric TDP43 aggregates progressively and relentlessly lead to mistakes in peripheral immune self-tolerance sustained over time. An effective treatment has not been found for this devastating pathology, as for 152 years the target has not been accurately defined. Scientists and doctors should consider new knowledge regarding ALS and consider immunomodulatory therapies that, based on genetic analysis and symptoms, can be combined with compounds that regulate metabolism and promote the elimination of useless organelles and cells. What if ALS could be cured as a result of seeing motor neuron disease differently? This review aims to develop that goal and change the paradigm of our understanding of ALS.

Balo’s concentric sclerosis is a rare disease and a subtype of multiple sclerosis. A 38-year-old male patient presented to the hospital with the complaint of numbness in the left-sided upper and lower limb, slurring of speech and left-sided headache for 15 days. Further investigation was done and in ECG ‘Delta wave’ was identified along with tachycardia. Diagnosis of Wolff Parkinson White syndrome was made. The patient’s MRI Brain has shown a non-enhancing intra-axial altered signal intensity lesion at the callose-septal interface adjacent to both lateral ventricles, which was identified as Balo’s concentric sclerosis.

Introduction: In Traditional Chinese Medicine (TCM), tongue diagnosis plays an important role. Besides shape, colour and textural attributes of tongue regions have significance due to their association with different organs (viz. heart, lung, kidney-bladder, liver-gallbladder and stomach-spleen) in health and disease. Although numerous quantitative methods have been proposed to reduce inter and intra observer variability in tongue diagnosis, almost all of them considered only global colour/ textural features i.e. from entire body of tongue. In this work, regional colour and texture information of tongue have been analysed for healthy subjects (NOM) and patients suffering from chronic acidity-indigestion (ACD). Methods: Tongue boundaries are marked manually in each image and then tongue bodies are automatically partitioned into five regions linked with said internal organs. Rough assessments of regions’ boundaries are obtained from literature and then they are fine-tuned according to experts’ advice. As boundaries are not well defined, regions near the common boundary of two or more organs, are not assigned to any organ. Several first and second order statistical features based on grey scale intensities and a* values of LAB colour space (indicative of redness) have been extracted from five different regions of tongue images. Intragroup analysis using Wilcoxon signed rank test compared different regions within individual study group. Additionally, intergroup analysis using Wilcoxon rank sum test compared tongues of NOM with ACD for each region separately. Results: Intragroup analysis reveals a* values are statistically different (p&lt;0.01) between stomach-spleen and liver-gallbladder regions for ACD while no significant change of a* are noted between these regions of normal tongue. It was found from intergroup analysis that correlation (one of the second order texture features extracted from grey scale images) of heart region has significantly decreased while correlation of kidney, liver-gallbladder and stomach-spleen regions significantly increased from NOM to ACD. Conclusion: This study sheds light on importance of inclusion of regional textural analysis of tongue in quantitative studies and can be applied to automated tongue diagnosis for other diseases.

Introductions- Liveable housing environments face the menace of global climate change. In-frastructure (including buildings and houses) continuously experiences significant impacts ex-acerbated by natural variability in climate. The study addressed how climate change impacts the resilience of residential buildings, increased maintenance frequency, and the wellbeing and comfort of residents in UK residential buildings. Design/Methodology/Approach: This study used deductive reasoning and an empirical epis-temological methodology as a data-collecting basis to evaluate primary information obtained via a questionnaire. Regression analysis was ultimately employed to analyse the collected da-ta. Result/Discussions: The findings show a significant relationship between climate change and the wellbeing of the occupants of UK residential buildings. Also, the results show that social wellbeing is more important to the occupants than mental and physical wellbeing. It reveals that residential buildings in the UK suffer the cost of maintenance due to continuous reduc-tion in the building fabric's resilience to the impacts of climate change; for instance, a recent increase in rainfall/storms results in unprecedented flooding, which continues to damage the UK residential building fabrics.

This paper explores the integration of multiple intelligences and artificial intelligence (AI) in language learning, focusing on its potential to enhance personalization and engagement. Drawing from existing research and studies conducted in various contexts, including the Philippines, this study aims to contribute to the understanding of the benefits, challenges, and effectiveness of this integration. The paper begins with an introduction that highlights the background and significance of integrating multiple intelligences and AI in language learning, identifying research gaps, objectives, research questions, and the theoretical framework. A literature review provides an overview of multiple intelligences theory by Howard Gardner, the role of AI in language learning, and identifies gaps in the existing literature. The methodology section outlines the research design and approach, participant selection, data collection methods, validity and reliability measures, and ethical considerations. Findings and results are presented through the analysis of qualitative data, exploring emergent themes and patterns. The discussion section critically examines the identified research gaps, discusses the validity and reliability of the study, addresses the scope and limitations, and explores the implications of the findings for theory, practice, and future research. The conclusion summarizes the key findings and contributions of the study, reflects on the achievement of research objectives, offers recommendations for further research, and provides final remarks tying together the main points of the study. This paper contributes to the existing body of knowledge by providing insights into the integration of multiple intelligences and AI in language learning and its impact on personalization, engagement, and language learning outcomes.

Leucokinins (LKs) constitute a family of neuropeptides identified in numerous insects and many other invertebrates. The LKs act on G-protein coupled receptors that display only distant relations to other known receptors. In adult Drosophila, 26 neurons/neurosecretory cells of three main types express LK. The four brain interneurons are of two types, and these are implicated in several important functions in the fly’s behavior and physiology, including feeding, sleep-metabolism interactions, state-dependent memory formation, as well as modulation of gustatory sensitivity and nociception. The 22 neurosecretory cells (ABLKs) of the abdominal neuromeres coexpress LK and a diuretic hormone (DH44), and together these regulate water and ion homeostasis and associated stress, as well as food intake. In Drosophila larvae, LK neurons modulate locomotion, escape responses, and aspects of ecdysis behavior. A set of lateral neurosecretory cells, ALKs, in the brain express LK in larvae, but inconsistently so in adults. These ALKs coexpress three other neuropeptides and regulate water and ion homeostasis, feeding and drinking, but the specific role of LK is not yet known. This review summarizes Drosophila data on embryonic lineages of LK neurons, functional roles of individual LK neuron types, interactions with other peptidergic systems, and orchestrating functions of LK.

In the present study. At first, some properties of r-fuzzy soft β-closed sets are introduced on fuzzy soft topological spaces based on the paper Aygunoglu et al. (Hacet. J. Math. Stat. 2014, 43, 193-208). Also, we define the closure and interior operators with respect to the classes of r-fuzzy soft β-closed and r-fuzzy soft β-open sets, and investigate some of their properties. In addition, the concept of r-fuzzy soft β-connected sets is introduced and characterized with help of fuzzy soft β-closure operators. Thereafter, some properties of a fuzzy soft β-continuity are studied. Furthermore, we introduce and study the concepts of fuzzy soft almost (weakly) β-continuous functions, which are weaker forms of a fuzzy soft β-continuity. Also, the relationships between these classes of functions are specified with the help of some illustrative examples. Finally, we explore new types of fuzzy soft functions called, fuzzy soft β-irresolute (strongly β-irresolute, β-irresolute open, β-irresolute closed and β-irresolute homeomorphism) functions, and discuss some properties of them. Also, we show that fuzzy soft strongly β-irresolute → fuzzy soft β-irresolute → fuzzy soft β-continuity, but the converse may not be true.

The study investigated roles of institutional types and ethnic/racial background on academic credit among the traditionally underrepresented population of the U.S. study abroad program. Using archival data, the study sampled the student’s enrollment and academic credit information spanning a period of 20 years (2003 - 2022). Data analysis Using One-Way Analysis of Variance (ANOVA) indicates significant main influence of institutional type (p<.001) and significant main influence of ethnic/racial identity (p<.001) on students’ academic credit. The result was discussed in terms of its relevance in educational policy re-evaluations, improvement of the study conditions of the underrepresented students, and enhancement of the enrollment opportunities of these minority population across all U.S. institutions of learning.

(1) Background: Mixed Reality is a technology that has gained attention due to its unique capabilities for accessing and visualizing information, becoming a valuable tool for medicine, particularly for the operating room and surgical learning; (2) Methods: A systematic review was conducted following the PRISMA guidelines to answer the research questions established using the PICO framework; (3) Results: Although implementation of Mixed Reality applications in the operations room presents some challenges, when used appropriately, it can yield remarkable results. It can make learning easier, flatten the learning curve for several procedures, and facilitate various aspects of the surgical processes; (4) Conclusion: Technical complexity, equipment costs, and steep learning curves present significant obstacles to the widespread adoption of Mixed Reality and computer-assisted evaluation. The possibility of integration of distinct medical imaging modalities and innovative functionalities holds promise for clinical applications. However, it is important to consider issues related to usability, bias, and statistical analyses need consideration. Mixed Reality offers significant benefits, but there are still open challenges such as ergonomic issues, limited field of view, and battery autonomy that must be addressed to ensure widespread acceptance.

Individuals with BPD grapple with unstable relationships, marked by extreme emotional swings and interpersonal conflicts. Emotional instability, a distorted self-image, and impulsivity further complicate matters, often leading to self-harm and suicide attempts as desperate coping mechanisms. Genetics and adverse childhood experiences contribute to BPD's development, shaping brain function and emotional regulation. Diagnosis involves meticulous assessments, paving the way for personalized treatments like dialectical behavior therapy and, in severe cases, hospitalization. Early intervention, professional support, and societal understanding are pivotal for positive outcomes, and challenging mental health stigma.

In order to the effect of hydrated phase change materials on suppressing coal spontaneous combustion, the thermogravimetric experiment and reaction activation energy analysis experiment were used to explore the changes of combustion characteristic, parameters characteristic temperature and activating energy of gas coal, long flame coal, meagre coal, and lean coal before and after adding hydrated phase change materials. The research results showed that hydrated phase change materials increased the coal samples’characteristic temperature point and have effective inhibitory effects on different stages of oxidation process.However, the effect was best at low temperatures, as hydrated phase change materials undergo phase change and absorb heat when heated at low temperatures, isolating coal from contact with oxygen. The activating energy increased by 1.138 KJmol-1～23.048 KJmol-1 and the mass loss reduced by 1.6%～9.3% after the inhibition of the coal sample,indicating that the oxidation rate of various coal samples can be slowed down and the spontaneous combustion can be suppressed by using hydrated phase change materials.At the same time, this material can also reduce the combustibility index of meagre coal and lean coal, as well as the comprehensive combustion index and maximum loss rate of long flame coal and gas coal.

This review explores the transformative impact of sensor technologies in early disease detection. It highlights recent advancements in nanotechnology-based sensors, particularly focusing on their applications in identifying disease biomarkers at early stages. The integration of these sensors with artificial intelligence for predictive analytics in healthcare is also discussed. Applications in cancer, infectious diseases, and chronic disease management underscore their diverse utility. Challenges in sensor technology adoption and future directions, including multiplexed sensors and wearable devices, are examined. This review underscores sensors' potential in enhancing disease management and patient outcomes.

Legumes develop root nodules that harbour endosymbiotic bacteria, rhizobia. These rhizobia convert nitrogen to ammonia by biological nitrogen fixation. A thorough understanding of the biological nitrogen fixation in legumes and its regulation is key to develop sustainable agriculture. It is well known that plant hormones affect nodule formation; however, most studies are limited to model legumes due to their suitability for in vitro, plate-based assays. Specifically, it is almost impossible to measure the effects of exogenous hormones or other additives during nodule development in crop legumes such as soybean as they have huge root system in soil. To circumvent this issue, the present research develops suitable media and growth conditions for efficient nodule development under in vitro, soil free conditions in an important legume crop, soybean. Moreover, we also evaluate the effects of all major phytohormones during soybean nodulation under identical conditions. This versatile, inexpensive, scalable and simple protocol provides several advantages over previously established methods. It is extremely time-and resource-efficient, does not require special training or equipment, and produces highly reproducible results. The approach is expandable to other large legumes as well as for other exogenous additives.

Objective: The goal of this review is to provide a succinct, yet comprehensive, guide to the an-tepartum management of multiple gestations. Methods: This narrative review on twins and multiple gestation provides a concise guide for providers with this ever-growing patient population. PubMED was utilized for literature search. Each reference was evaluated and graded for quality of evidence by US Preventative Services Task Force and Cochrane Review guidelines. Screening, surveillance, and management strategies are delineated succinctly and organized by type of multiple gestation being managed from the lowest risk dichorionic twin pair to the increasingly escalating risks of twins and higher order multiples sharing a placenta and/or amniotic sac. Results: The incidence of twin pregnancies has grown over the past several years, due in large part to delayed reproductive timing and surge in assisted reproductive technologies. Twin pregnancies are associated with higher morbidity for both gravidas and offspring, warranting evidence-based approach in counseling and management. Conclusions: We note the important differences among multiples in chorionicity and amnionicity, in the importance of close surveillance and early delivery. Graded clinical pearls and evi-dence-based recommendations are presented to guide obstetric providers.

Background: Temporal lobe epilepsy (TLE) is the most common focal epilepsy subtype in adults and is frequently accompanied by depression, anxiety and psychosis. Aberrations in total paraoxonase (PON)1 status may occur in TLE and those psychiatric conditions. Methods: We examined paraoxonase (PON)1 status, namely Q192R PON1 genotypes and PON1 enzymatic activities, in 40 normal controls and 104 TLE patients, 27 without comorbidities, and 77 with comorbidities including mood disorders (n=25), anxiety disorders (n=27) and psychosis (n=25). Outcomes: CMPAase and arylesterase activities were significantly lower in TLE and mesial temporal sclerosis (MTS) with and without psychiatric comorbidities than in normal controls. The areas under the ROC curve of CMPAase were 0.893 (0.037) for TLE and 0.895 (±0.037) for MTS. Partial Least Squares (PLS) path analysis showed that there were specific indirect effects of PON1 genotype on TLE severity (p<0.0001) and psychopathology (p<0.0001), which were both mediated by lowered CMPAase activity, while arylesterase activity was not significant. The severity of TLE was significantly associated with psychopathology scores. Furthermore, PON1 CMPAase activity was inversely associated with Mini Mental State Examination scores. Interpretation: The severity of TLE and comorbidities are to a large extent explained by lowered PON1 enzyme activities and by effects of the Q192R genotype which are mediated by lowered CMPAase activity. Total PON1 status plays a key role in the pathophysiology of TLE, MTS and psychiatric comorbidities by increasing the risk of oxidative toxicity. PON1 enzyme activities are new drug targets in TLE to treat seizure frequency and psychiatric comorbidities.

This study introduces a hardware accelerator to support various Post-Quantum Cryptosystem (PQC) schemes, addressing the quantum computing threat to cryptographic security. PQCs, while more secure, also bring significant computational demands, especially problematic for lightweight devices. Previous hardware accelerators are typically scheme-specific, which is inefficient given the National Institute of Standards and Technology (NIST)'s multiple finalists. Our approach focuses on the shared operations among these schemes, allowing a single design to accelerate multiple candidate PQCs at the same time. This is further enhanced by allocating resources according to performance profiling results. Our compact, scalable hardware accelerator supports four of NIST PQC finalists, achieving an area efficiency of up to 81.85\% compared to the current state-of-the-art multi-scheme accelerator while supporting twice as many schemes. The design demonstrates average throughput improvements ranging from 0.97$\times$ to 35.97$\times$ across the four schemes and their main operations, offering an efficient solution for implementing multiple PQC schemes within constrained hardware environments.

Measuring bias is important as it helps identify flaws in quantitative forecasting methods or judgmental forecasts. It can, therefore, potentially help improve forecasts. Despite this, bias tends to be under-represented in the literature: many studies focus solely on measuring accuracy. Methods for assessing bias in single series are relatively well-known and well-researched, but for datasets containing thousands of observations for multiple series, the methodology for measuring and reporting bias is less obvious. We compare alternative approaches against a number of criteria when rolling-origin point forecasts are available for different forecasting methods and for multiple horizons over multiple series. We focus on relatively simple, yet interpretable and easy-to-implement metrics and visualization tools that are likely to be applicable in practice. To study the statistical properties of alternative measures we use theoretical concepts and simulation experiments based on artificial data with predetermined features. We describe the difference between mean and median bias, describe the connection between metrics for accuracy and bias, provide suitable bias measures depending on the loss function used to optimise forecasts, and suggest which measures for accuracy should be used to accompany bias indicators. We propose several new measures and provide our recommendations on how to evaluate forecast bias across multiple series.

A well known result for the interference of two single-mode fields is that the degree of coherence and the degree of indistinguishablity are same when we consider the detection of a single photon. In this article we present the relation between degree of coherence, path indistinguishability and the fringe visibility considering interference of multiple number of single-mode fields while being interested in the detection of a single photon only . We will also mention how Born’s rule of interference for multiple sources is reflected in these results.

If genetic gains in wheat yield are to be achieved in today’s breeding, increasing genetic variability of cultivated genotypes is an essential requisite to meet. To this aim, alien gene transfer through chromosome engineering (CE) is a validated and sound strategy. Attempts to incorporate more than one alien segment into cultivated wheat have been rare, particularly for tetraploid durum wheat. Here we present the agronomic and quality performance of the first successful CE-mediated multiple introgression into the latter species. By assembling into 7AL, 3BS and 1AS arms of a single genotype homoeologous segments of Thinopyrum ponticum 7el1L, Aegilops longissima 3SlS, and Triticum aestivum 1DS arms, respectively, we have stacked several valuable alien genes, comprising Lr19+Sr25+Yp (leaf and stem rust resistance and a gene increasing semolina yellowness), Pm13 (powdery mildew resistance) and Gli-D1/Glu-D3 (genes affecting gluten properties), respectively. Advanced progenies of single, double and triple recombinants were field-tested across three years in a typical durum wheat growing area of Central Italy. The results showed that not only all recombinants had normal phenotype and fertility, but also that one of the triple recombinants had the highest yield through all seasons compared with all other recombinants and control cultivars. Moreover, the multiple introgressions enhanced quality traits, including gluten characteristics and semolina yellow index. Presence of effective disease resistance genes confers additional breeding value to the novel and functional CE products, which can greatly contribute to crop security and safety.

We present 4 cases of patients diagnosed with multiple myeloma initially treated without monoclonal antibodies. It was decided to provide the benefit of the drug after maintenance with lenalidomide was initiated to consolidate the post-maintenance response followed by monitoring without any kind of treatment. In this series of 4 cases 100% of the patients achieved a strict complete response with undetectable Minimal Residual Disease (MRD) for flow cytometry after post-maintenance consolidation with daratumumab regardless of the scheme used as induction/consolidation, as well as whether they had received HSCT. Until the last follow-up the patients are under surveillance with no evidence of progression. It should be noted that 3 of 4 of these patients debuted with high-risk disease.

This study presents the complexity and sensitivity of chaotic system dynamics in the case of the double pendulum. It applied detailed numerical analyses of the double pendulum in multiple computing platforms in order to demonstrate the complexity in behavior of the system of double pendulums. The equations of motion were derived from the Euler-Lagrange formalism, in order to capture the system's dynamics, which is coupled nonlinearly. These were solved numerically using the efficient Runge-Kutta-Fehlberg method, implemented in Python, R, GNU Octave, and Julia, while runtimes and memory usage were extensively benchmarked across these environments. Time series analyses, including the calculation of Shannon entropy and the Kolmogorov-Smirnov test, quantified the system's unpredictability and sensitivity to infinitesimal perturbations of the initial conditions. Phase space diagrams illustrated the intricate trajectories and strange attractors, as further confirmation of the chaotic nature of the double pendulum. All the findings have a clear indication of the importance of accurate measurements of the initial condition in a chaotic system, contributing to an increased understanding of nonlinear dynamics. Future research directions are faster simulations using Numba and GPU computing, stochastic effects, chaotic synchronization, and applications in climate modeling. This work will be useful for understanding chaos theory and efficient computational approaches in complex systems of dynamical nature.

This comprehensive review delves into the multifaceted aspects of ERK signaling and the intricate mechanisms underlying distinct cellular fates. ERK1 and ERK2 (ERK) govern proliferation, transformation, epithelial-mesenchymal transition, differentiation, senescence, or cell death, con-tingent upon activation strength, duration, and context. The biochemical mechanisms underlying these outcomes are inadequately understood, shaped by signaling feedback and the spatial localization of ERK activation. Generally, ERK activation aligns with the Goldilocks principle in cell fate determination. Excessive or insufficient ERK activity inhibits growth, whereas moderated activation supports proliferation and survival. Unraveling the intricacies of how the degree of ERK activation dictates cell fate requires deciphering mechanisms encompassing protein stability, transcription factors downstream of ERK, and the chromatin landscape.

Multiple myeloma (MM) is an incurable, diverse cancer in which abnormal plasma cells produce and release monoclonal immunoglobulin (Ig), also known as monoclonal protein or M protein. MM is always preceded by monoclonal gammaglobulinemia of unknown significance (MGUS) and smoldering multiple myeloma (SMM). Diagnosis of MM is made from a bone marrow sample, which involves analysis of the appearance of plasma cells. Quantification of CD138+ plasma cells in core biopsies is performed using techniques such as immunohistochemistry, flow cytometry, fluorescence in situ hybridization (FISH) and conventional cytogenetics. Urinalysis includes total protein by immunofixation and 24-hour urine by serum protein electrophoresis. FISH probes should detect the presence of at least del 13, del 17p, t(4;14), t(11;14), t(14;16), and 1q21 amplifications. Indeed, next-generation sequencing (NGS) has become an increasingly important tool in the diagnosis and treatment of MM. It can be used to identify genetic mutations, copy number changes, and clonal structures to help determine disease prognosis and treatment strategies. NGS can identify subclonal populations of cancer cells that are resistant to therapy and may lead to disease relapse, and can be used to identify potential targets for personalized therapy. For example, NGS can identify mutations in genes involved in drug resistance, enabling the selection of drugs that may be more effective in treating a patient's cancer. This systematic review analyzes 182 papers to determine the position and role of NGS in the diagnosis of MM. We first analyze the platforms and sample types used in the selected studies, and then start discussing the results.

Foliar fungal diseases in tomatoes include early blight (Alternaria linariae), Septoria leaf spot (Septoria lycopersici), and late blight (Phytophthora infestans) which is oomycetes. These are one of the significant production constraints in tomatoes. We describe the etiology, host range, distribution, symptoms, and disease cycle to understand the biology followed by management practices emphasizing the resistance breeding approach for these diseases. In crop improvement efforts, we provide an analytical review, including conventional and molecular methods for improving this disease resistance. Modern breeding tools, including genomics, genetic transformation, and genome editing, can be used to improve these traits. There is a good possibility of using these tools in the future to improve these traits.

The system identification problem with multiple nonlinearities is relevant. Its decision depends on many factors. These include: feedbacks, the method of connecting nonlinear links, signal properties. They affect the identifiability of the system parameters. We introduced a condition for the excitation constancy for state variables, which considers the S-identifiability of the system. We propose system decomposition by measuring input to identify parameters. Each subsystem has an implicit identification representation. It guarantees obtaining estimates of subsystem parameters based on experimental data. The trajectories boundedness of adaptive system proved in parametric and coordinate spaces. Conditions guaranteeing exponential stability of the system obtained. Systems of self-oscillation generation and nonlinear correction of a nonlinear system consider. Conditions for the trajectories boundedness of the adaptive system obtained for these cases. The influence of nonlinearity and feedback on the system performance estimated.

Polypropylene (PP) is commonly used in the polymer processing industry. Its feature is a good chemical resistance, it is non-toxic and not harmful to people. Polypropylene is widely used in the manufacturing of food packages, laboratory and medical equipment, electric cables insulators, automotive parts, toys and furniture. The application of this material enables us to obtain complicated shapes of big surfaces. It is also highly recyclable. Polylactide (PLA) is a product of the so called “green chemistry” because it is obtained from the renewable raw materials (biomass). As its price is higher compared to the traditional polymers, its repeated use (recycling) is of high interest. Due to the same reason (cost) the mixtures of PLA with other polymers are applied. In this paper the results of testing the PP/PLA mixtures of various mass ratio of the components are presented. Technical terms of preparing and processing such mixtures have been practically tested. Also the mechanical strength was determined based on the static tensile tests. The results showed that those mixtures can be repeatedly processed. Even five-times reprocessing does not cause essential drop of mechanical properties

Freeway travelling time is affected by many factors including traffic volume, adverse weather, accident, traffic control and so on. We employ the multiple source data-mining method to analyze freeway travelling time. We collected toll data, weather data, traffic accident disposal logs and other historical data of freeway G5513 in Hunan province, China. Using Support Vector Machine (SVM), we proposed the travelling time model based on these databases. The new SVM model can simulate the nonlinear relationship between travelling time and those factors. In order to improve the precision of the SVM model, we applied Artificial Fish Swarm algorithm to optimize the SVM model parameters, which include the kernel parameter σ, non-sensitive loss function parameter ε, and penalty parameter C. We compared the new optimized SVM model with Back Propagation (BP) neural network and common SVM model, using the historical data collected from freeway G5513. The results show that the accuracy of the optimized SVM model is 17.27% and 16.44% higher than those of the BP neural network model and the common SVM model respectively.

Remote sensing image registration plays an important role in military and civilian fields, such as natural disaster damage assessment, military damage assessment and ground targets identification, etc. However, due to the ground relief variations and imaging viewpoint changes, non-rigid geometric distortion occurs between remote sensing images with different viewpoint, which further increases the difficulty of remote sensing image registration. To address the problem, we propose a multi-viewpoint remote sensing image registration method which contains the following contributions. (i) A multiple features based finite mixture model is constructed for dealing with different types of image features. (ii) Three features are combined and substituted into the mixture model to form a feature complementation, i.e., the Euclidean distance and shape context are used to measure the similarity of geometric structure, and the SIFT (scale-invariant feature transform) distance which is endowed with the intensity information is used to measure the scale space extrema. (iii) To prevent the ill-posed problem, a geometric constraint term is introduced into the L2E-based energy function for better behaving the non-rigid transformation. We evaluated the performances of the proposed method by three series of remote sensing images obtained from the unmanned aerial vehicle (UAV) and Google Earth, and compared with five state-of-the-art methods where our method shows the best alignments in most cases.

Abstract: In the Western of Mekong Delta belong to Vietnam a amount of alluvium sediments flows from upstream China to Vietnam, they are going from the river branches to in the Mekong Delta, then get out the Western Sea of Vietnam. This sediments accumulated gradually elevation the new land. The increase elevation of the land creates a fertile coastal plain where mangrove forests with a rich ecosystem of plants and animals. Over time, these forests change, with different plant species succeeding each other. This aims of this study to finding plant species in the forest, classification of forest types based on ecological regions, assessement the biodiversity of tree species, and compare the abundance communities, measuring the growth of the forest in these regions. In 2023, a comprehensive survey was conducted by using a systematic approach. The number of survey plots have done depend on the density of the forest, Base on the width of the forest range, the number of survey plots from 500m to 1,000m set up 1-2 plots, sub region set up from 10 to 15 plots. In total, 68 plots have done established in the erea, the area of plot is 100 square meters (10m x 10m). Using the statistical software in forestry to survey and analysis data. The result provided a complete picture of the tree species composition, distribution, and community structure characteristics in each ecological sub-region. The result of survey showed in the sub-region 1 have seven species as Sonneracia ovate, Rhzophora apiculata, Excoecaria agallochha, Avicennia officinalis, Avicennia alba, Agricerasvcoculatum, Bruguiera gymnorhiza. In the sub region 2 have eleven species as Sonneracia caseolaris, Annona reticulata, Lumnitzera littorea, Lumnizera racemosa, Rhizophora apiculata, Excoecaria agallocha, Avicennia officinalis, Avicennia alba, Hibiscus tillacerus, Bruguiera gymorhiza, Aericeras comiculatum. In the sub region 3 have eight as Sonratia caseolaris, Rhizophora mucronata, Rhizophora apiculata, Excoecaria agallocha, Avicennia marine, Avicennia alba, Bruguiera gymorhiza. In the region 4 have ten species as Sonneracia caseolaris, Sonneracia ovate, Lumnizera racemosa, Rhizophoa apiculata, Excoecaria agallocha, Avicennia marina, Avicennia officinalis, Aviecnnia alba, Bruguiera gymorhiza, Bruguiera cylindrica The total species of the mangrove forest in the Western Mekong Delta have 16 species from 11 plant families have been identified. Among these species have 6 dominant species include Avicennia oficinali),Avicennia alba, Rhizophora apiculata, Excoecaria agallocha, Someratia caseolaris, and Bruguiera yipamoriza. Two species easy grow on the new land are Avicennia officinalis Avicennia alba this findings show they can develope on the original new land for the shore of the Western Mekong Delta. The surveyed results also calculated the average of the height, diameter (D1.3), canopy, health of the nature mangrove tree for each sub region and total region. From these results showed the division of foresty structure, the structure of height, diameter (D1.3), canopy, vitality of the sub region and total region in the Western Mekong Delta.

: Controlling the distribution of water and wastewater between industrial processes is very vital in rationalizing water and preserving the environment. In this paper, a mathematical technique is proposed to optimize water-wastewater networks; a nonlinear program is introduced to minimize the consumption of freshwater, and consequently, the flowrate of the wastewater dis-charge will be also minimized. A general mathematical model, able to handle industrial plants containing up to eight sources and eight sinks, is developed using LINGO optimization software to facilitate dealing with complex case studies. The introduced model can handle single contam-inant networks as well as multiple contaminants cases. The optimal water network is synthe-sized through two steps; the first step is to introduce the case study data to the developed mathematical model. The second step considers using the optimal solution produced after run-ning the developed LINGO model as feed data for a pre-designed Excel sheet able to deal with these results and simultaneously draw the optimal water-wastewater network. The proposed mathematical model is applied to two case studies; The first case study includes actual data from four fertilizer plants located in Egypt; the water resources and requirements are simultaneously integrated to obtain a sensible cutting in both freshwater consumption (lowered by 52.2%) and wastewater discharge (zero wastewater discharge). The second case study is for a Brazilian pet-rochemical plant; the obtained results showed noticeable reductions in freshwater consumption for the second case study by 12.3 % while the reduction percentage of wastewater discharge is 4.5%.

Multiple myeloma (MM) accounts for about 10 to 15% of all diagnosed hematologic malignancies and about 1-2% of all cancer cases. Approximately 80-90% of MM patients develop bone disease and the changes rarely regress. It is only possible to stop or slow their progression. A major role in bone destruction in MM is attributed to the Wnt signaling pathway, and its action can be modified by various types of interventions including training and diet. Therefore, the aim of this project was to evaluate the effects of a Nordic Walking (NW) training cycle and intermittent fasting (IF) on the levels of selected bone turnover markers associated with the Wnt pathway in patients with MM. Results from 35 patients divided into training (NW and IF NW) and non-training (IF and control) groups were included in the analysis. A 6-week training cycle involving 60-minute workouts 3 times a week was conducted. Body mass and composition and the levels of: vitamin D, calcium and phosphorus, beta2-microglobulin and albumin were examined before and after completion of training cycle. Markers of bone turnover were also determined: sclerostin (SOST), Dickkopf-related protein 1 (DKK-1), osteoprotegrin (OPG), osteopontin (OPN) and Tartrate-resistant acid phos-phatase 5b (TRACP 5b). There was no negative effect of IF or combined training and fasting on the nutritional status of the patients (the level of albumines was unchanged). Both training groups showed an increase in serum concentrations of the active metabolite of vitamin D (IF NW and NW: p=0.001 and p=0.022, re-spectively). The change in the concentration of this vitamin negatively correlated with the con-centration of TRACP 5b (r=-0.413, p=0.014). Evaluating the concentrations of markers related to bone turnover, a reduction in the concentrations of SOST (time: p=0.026, time vs. group: p=0.033) and TRACP 5b (time: p

Respiratory therapist(RT)internet-supervised At-Home Telespirometry(AHT)was validated in pilot 22/95=23% ALS Clinic population. Erect, supine Vital Capacity(eFVC, sFVC)were measured longitudinally using ZephyRx smartphone interface and database recording in-clinic-conventional(Viaire-Vyasis-)and at-home-portable(MIR-Spirobank-Smart-)spirometers. Bland-Altman(BA)analysis supported content validity-precision and 7-day-test-re-test-validity [mean difference=0.15L(conventional–portable;95%CI -0.40L, 0.70L); = 2.7% predicted (conventional-portable;95%CI -12.1%, 17.5%) ]meeting ATS-ERS performance standards. RT Internet-supervised AHT measured sFVC was more frequently obtained[35/52=67.3 %]in-home-vs-in-clinic sFVC[9/21=42.9 %](Chi-Square;P=0.0533). Monthly mean eFVC slope decline for the eFVC > 60 % predicted baseline cohort was – 1.24% predicted per month[95% CI -2.15 ,-0.33% predicted]statistically significantly(P=0.015)less compared with the – 5.86% predicted per month[95% CI -9.44, -2.29 % predicted]decline for the eFVC < 60 % predicted baseline cohort and in this cohort was associated with statistically significant decreased survival(P=0.0219). RT Internet-supervised AHT facilitated initiation of non-invasive ventilation(NIV)in 5/22[23%]patients including 3/4[75%] homebound subjects. RT Internet-supervised AHT can be deployed for ALS patients stratified according to baseline eFVC for earlier detection of eFVC and sFVC decreases between clinic visits. A prospective research study[NCT05106569]is ongoing to further define the capability of online deployment of Respiratory therapist(RT)internet-supervised AHT in the timely initiation of NIV use to improve ALS respiratory care in larger numbers of ALS subjects.

Dendrobium Sw have multiple photosynthetic pathways but due to the lack of identification, the influence of CAM pathway on the plastid genomic evolution of Dendrobium and the origin of CAM pathway are still poorly understood. In this study, based on the results of δ13C, net photosynthetic rates (Pn) and titratable acid value, we identified Dendrobium species into three photosynthetic pathways. Then the chloroplast whole genome characteristics of 10 Dendrobium species were analyzed with next-generation sequencing technology. The quadripartite-structure plastomes ranged from 151,673 bp to 160,375 bp and included 127 to 132 genes. Five noncoding mutational hotspots (rbcL-accD, atpB-rbcL, rbcL, trnLUAA, accD, Pi &gt; 0.10) were identified. A total of 41–60 SSRs were recognized, the average trinucleotide content was only about 4%, which is probably due to a more conserved SSR. Among multiple photosynthetic pathways, the apparent differences in IR junctions of SSC/IRB junctions (JSBs) were measured within chloroplast genomes, and the chloroplast genome size of constitutive CAM plants is shorter because of their ndh gene loss or pseudogenization, and this phenomenon accounts for a decreasing proportion of constitutive CAM, facultative CAM, and obligate C3 plants, so that the loss of the ndh gene may be speculated to be closely related to the CAM pathway. Phylogenetic analyses showed that there are multiple independent CAM origins in selected Dendrobium species, and the ancestral Dendrobium plastome possessed full ORFs for all ndh genes. The study aims to clarify the chloroplast genomic features of different photosynthetic pathways, enrich the genomic data of CAM plants, and provide genetic information from different perspectives for further systematic study of Dendrobium.

Abstract: This comprehensive review seeks to deepen our comprehension of the African plant Momordica balsamina L. by elucidating its therapeutically important molecules and micronutrient composition. Commonly referred to as the balsam apple, this plant species is extensively harnessed for its diverse therapeutic potentials across its various organs including leaves, fruits, roots, and stems. Numerous bioactive molecules have been isolated or identified within this plant, notably encompassing polyphenols, flavonoids, terpenes, and carotenoids. These compounds exhibit a wide array of biological activities, ranging from antioxidative, anti-inflammatory, anti-diabetic, anti-carcinogenic, to anti-malarial properties, among others. Furthermore, the leaves of Momordica balsamina L. stand out for their abundant micronutrients, proteins, and amino acids. This investigation aims to shed light not only on the botanical characteristics of the Momordica balsamina plant and its potential applications in traditional medicine, but also on its chemical composition, biological functionalities, and physicochemical attributes, thus accentuating its nutritional advantages. Nonetheless, an intriguing avenue presents itself for the exploration of strategies to conserve this species, delve deeper into its potential within the cosmetics industry, and innovate methodologies for the synthesis or biosynthesis of these bioactive molecules.

This paper is concerned with the optimal linear quadratic Gaussian (LQG) control problem for discrete time-varying system with multiple input delays and multiplicative noises. The main contributions are two-fold. Firstly, when the state variables can be observed exactly, we obtain a necessary and suffcient condition for the multiple-delays system in terms of the non-homogeneous relationship between the state and costate, which is the solution to the coupled forward and backward stochastic difference equations. Secondly, when the state variables are partially observed, we derive a suboptimal linear output feedback controller for the discrete-time system based on the obtained results of the optimal LQG control. Numerical examples are shown to illustrate the proposed algorithm.

The surface defects of shield subway tunnel can significantly affect the serviceability of the tunnel structure and may compromise the operation safety. To effectively detect the multiple surface defects, this research employs a tunnel inspection trolley (TIT) based on the mobile laser scanning technique. By conducting the inspection of the shield tunnel on a metro line section, various surface defects are identified by the TIT, including water leakage defect, dislocation, spalling, cross-section deformation, etc. To explore the root causes of the surface defects, the association rules between different defects are calculated via an improved Apriori algorithm. Results show that: i) there are significant differences in different association rules of various surface defects of the shield tunnel; ii) the average confidence of the association rule “dislocation &amp; spalling → water leakage” is as high as 57.78%, indicating that most of the water leakage defects are caused by dislocation and spalling of the shield tunnel in the sections being inspected; iii) the weakest rule appears at “water leakage → spalling”, with the average confidence of 13%. The association analysis can be used in predicting the critical defects influencing the structural reliability and operation safety, such as water leakage, and optimizing the construction and maintenance work for the shield subway tunnel.

We propose a computer-generated hologram method for near-eye virtual reality and augmented reality 3D display. A 3D object located near the holographic plane is projected onto a projection plane to obtain a plurality of projected images with different angles. The hologram is calculated by superposition of projected image convolution with a specific PSF through the interference of reference wave with object wave. Holographic 3D display systems with LED as illumination, 4f optical filtering system and lens as eyepiece for near-eye VR display and HOE as combiner for near-eye AR display are designed. The results show that the proposed method is about 38 times faster than the conventional point cloud method. The proposed method is flexible to produce speckle noise free high-quality VR and AR images with efficient focus and defocus capabilities.

In the context of video background-foreground separation, we propose a compressive online Robust Principal Component Analysis (RPCA) with optical flow that separates recursively a sequence of video frames into foreground (sparse) and background (low-rank) components. This separation method can process per video frame from a small set of measurements, in contrast to conventional batch-based RPCA, which processes the full data. The proposed method also leverages multiple prior information by incorporating previously separated background and foreground frames in an n-l₁ minimization problem. Moreover, optical flow is utilized to estimate motions between the previous foreground frames and then compensate the motions to achieve higher quality prior foregrounds for improving the separation. Our method is tested on several video sequences in different scenarios for online background-foreground separation given compressive measurements. The visual and quantitative results show that the proposed method outperforms other existing methods.

The era of Internet of Things (IoT) has begun to evolve and with this the devices around us are getting more and more connected. Vehicular Ad-hoc NETworks (VANETs) is one of the applications of IoT. VANET allow vehicles within these networks to communicate effectively with each another. VANETs can provide an extensive range of applications that support and enhance passenger safety and comfort. It is important that VANETs are applied within a safe and reliable network topology; however, the challenging nature of reaching reliable and trustworthy agreement in such distributed systems is one of the most important issues in designing a fault-tolerant system. Therefore, protocols are required so that systems can still be correctly executed, reaching agreement on the same values in a distributed system, even if certain components in the system fail. In this study, the agreement problem is revisited in a VANET with multiple damages. The proposed protocol allows all fault-free nodes (vehicles) to reach agreement with minimal rounds of message exchanges, and tolerates the maximal number of allowable faulty components in the VANET.

Object detection is important in many applications, such as autonomous driving. While 2D images are lack of depth information and are sensitive to environmental conditions, 3D point cloud can provide accurate depth information and a more descriptive environment. However, sparsity is always a challenge in single-frame point cloud object detection. This paper introduces a two-stage proposal-based feature fusion method for object detection using multiple frames. The proposed method, called proposal features fusion (PFF), utilizes a cosine-similarity approach to associate proposals from multiple frames and employs an attention weighted fusion module to merge features from these proposals. It allows for feature fusion specific to individual objects and offers lower computational complexity while achieving higher precision. The experimental results on the nuScenes dataset demonstrate the effectiveness of our approach, achieving a mAP of 46.7%, which is 1.3% higher than the state-of-the-art 3D object detection method.

Antibiotic resistance among bacterial pathogens is recognized as a major threat to human health worldwide. The emergence of multidrug-resistant bacteria can also be found in the community settings, apart from hospital environment, which indicates that reservoirs of antibiotic resistance genes do exist outside the hospital. The growth of antibiotic resistance is a consequence of bacterial adaptations in response to selective pressures. To survive in this hostile environment, bacteria develop defence mechanisms such as chemical modification of antibiotics, enzyme-catalysed antibiotic degradation, altered permeability, antibiotic efflux, mutation of target sites and biofilm formation, resulting in resistance to nearly all currently available antibiotics used in the clinical practice. The present review summarizes insights into the molecular mechanisms underlying the antibiotic resistance which is useful for planning strategies to combat antibiotic resistance and devise innovative therapeutic tools to fight against multidrug-resistant bacterial species.

Feral cats are both difficult to manage and harder to monitor. We analysed the cost-efficacy of monitoring the pre- and post-bait abundance of feral cats via camera-traps or track counts using four years of data from the Matuwa Indigenous protected Area. Additionally, we report on the recovery of the feral cat population and the efficacy of subsequent Eradicat® aerial baiting programs following 12 months of intensive feral cat control in 2019 that consisted of aerial baiting and leg-hold trapping. Significantly fewer cats were captured in 2020 (n = 8) compared to 2019 (n = 126). Pre-baiting surveys for 2020 and 2021 suggested that the population of feral cats on Matuwa was very low, at 5.5 and 4.4 cats/100 km respectively, which is well below our target threshold of 10 cats/100 km. Post-baiting surveys then recorded 3.6 and 3.0 cats/100 km respectively, which still equates to a 35% and 32% reduction in cat activity. Track counts recorded significantly more feral cats than camera traps and were cheaper to implement. We recommend that at least two methods of monitoring cats be implemented to prevent erroneous conclusions.

We present a new Multiple-Observations (MO) helper data scheme for secret-key binding to an SRAM PUF. This MO scheme binds a single key to multiple enrollment observations of the SRAM PUF. Performance is improved in comparison to classic schemes which generate helper data based on a single enrollment observation. The performance increase can be explained by the fact that the reliabilities of the different SRAM cells are modeled (implicitly) in the helper data. We prove that the scheme achieves secret-key capacity for any number of enrollment observations, and, therefore it is optimal. We evaluate performance of the scheme using Monte Carlo simulations, where an off-the-shelf LDPC code is used to implement the linear error-correcting code. Another scheme that models the reliabilities of the SRAM cells is the so-called Soft-Decision (SD) helper data scheme. The SD scheme considers the one-probabilities of the SRAM cells as an input, which in practice are not observable. We present a new strategy for the SD scheme that considers the binary SRAM-PUF observations as an input instead and show that the new strategy is optimal and achieves the same reconstruction performance as the MO scheme. Finally, we present a variation on the MO helper data scheme that updates the helper data sequentially after each successful reconstruction of the key. As a result, the error-correcting performance of the scheme is improved over time.

While there are many models of epidemic evolution perhaps the basis for such models finds itself in the lumped behavior expressed through the so-called SIR model (Susceptible, Infectious, Recovered) from which spring many related models. This paper discusses multiple analytic solutions to that equation including those that are available in closed analytic form and those for which at least one final integral has to be done numerically, so-called quasi-analytic solutions. The solutions are intrinsically time-dependent of course. The hope is that such an investigation will lead to a better understanding of when and how models can be of use in studying the dynamical evolution of diseases including, perhaps, the great influenza pandemic of 1918 together with later pandemics and epidemics not excluding the Covid-19 pandemic of the present day.

Novel coronavirus (COVID-19) can lead to multiple organ injuries such as acute respiratory distress syndrome (ARDS), acute renal injury (AKI) and so on. ACE2 is an important part of the renin-angiotensin system (RAS) and a key protein needed for COVID-19 to invade cells. First of all, we searched the HPA, GTEx and FANTOM5 Databases and found that the expression of ACE2 in kidney tissue was significantly higher than that in lung tissue. Then, by searching the Nephroseq Database, it is further verified that ACE2 is highly expressed in renal tissue and plays a protective role in renal tissue. However, current studies have found that the incidence of AKI caused by COVID-19 is much lower than that of ARDS. Because of this, we further searched the proteins interacting with ACE2 protein through the STING Database and analyzed the expression of tissue protein mRNA in the HPA Database. It was noted that AGTR2 mRNA was highly expressed in lung tissue, but low in kidney tissue, and hard tissue specificity in lung tissue. Through further research, it is found that AGTR2 plays a major role in the development of pulmonary fibrosis. Therefore, AGTR2 may be a key protein in COVID-19 pneumonia, and AGTR2 may be a potential new therapeutic target for the treatment of COVID-19 patients.

In this paper, a technique of image watermarking using multiple images as watermarks is presented. The technique is based on transform domain functions including discrete wavelet transform (DWT), discrete cosine transform (DCT) and singular value decomposition (SVD) with an image as the host signal i.e. the watermarks will be used as proofs of the authenticity of the host image. The technique is executed by performing multilevel DWT followed by applying DCT and SVD to both the host and watermark. Multiple watermarks are used for the insurance of better security level. The scheme is immune to common image processing operations & some attacks and exhibits PSNR of 108.3781dB, normalized cross correlation (NCC) over 0.99 and normalized correlation (NC) over 0.99.

Conservation of natural habitats in human-dominated landscapes is critical for halting biodiversity loss. Maintaining habitat quantity and connectivity requires landscape-level collective action, which results from environmental decisions made by individual land owners. We investigate how individual decision making in a rural collective translates into quantitative differences in landscape-level environmental outcomes. Behavioral science has become a critical domain of knowledge in conservation, but little attention has been paid to how multiple behavioral drivers determine the success of collective environmental action. We developed a social-ecological model for landscape-level conservation using a detailed data set of 600 land owners in New Zealand. With the model, we tested whether the effect of social influence networks on collective conservation action was altered by their interplay with land owners’ personal characteristics, connections to cross-scale actors and local environmental contexts. Interactions between multiple behavioral drivers determined the environmental outcomes of collective action in unexpected ways by modifying, muting or amplifying the effects of single drivers. Importantly, we detected a social-ecological mechanism for rapid change in the extent of protected habitats, which can explain highly successful or failed environmental outcomes of collective conservation. Further, when environmentally desirable and undesirable behaviors spread simultaneously through the social network, homophily and network cohesion hinder desirable environmental outcomes. This effect can be modified by other drivers such as social responses to local environmental change. Thus, understanding how the antagonistic and synergistic effects of behavioral drivers can be best utilized in conservation will benefit biodiversity and ensure benefits that humans obtain from biodiversity.

Six Half-ring with varying linewidth from 120nm to 370nm were connected in series on five corners. The magnetization reversal processes were investigated by the measurement of anisotropic magnetoresistances (AMR). The number of switching jumps in the AMR loops, from zero to five, varied with the longitudinal applied field. These discrete jumps result from domain wall nucleating and depinning on the corners. The larger external field applied the fewer number of jumps in the MR curve. This reproducible and particular-respondence of domain wall device in pattern of half-ring wire might be the new promising magnetoelectronic devices.

Brain-stimulation reward, also known as intracranial self-stimulation (ICSS), is a commonly used procedure for studying brain reward function and drug reward. In electrical ICSS, an electrode is surgically implanted into the medial forebrain bundle in the lateral hypothalamus or the ventral tegmental area in the midbrain. Operant lever responding leads to the delivery of electrical pulse stimulation. The alteration in the stimulation frequency-lever response curve is used to evaluate the impact of pharmacological agents on brain reward function. If a test drug induces a leftward or upward shift in the ICSS response curve, it implies a reward-enhancing or abuse-like effect. Conversely, if a drug causes a rightward or downward shift in the functional response curve, it suggests a reward-attenuating or aversive effect. A significant drawback of electrical ICSS is the lack of cellular selectivity in understanding the neural substrates underlying drug reward versus aversion. Excitingly, recent advancements in optical ICSS (oICSS) have facilitated the development of at least three cell type-specific oICSS models – dopamine-, glutamate-, and GABA-dependent oICSS. In these new models, a comparable frequency-rate response curve has been established and employed to study the substrate-specific mechanisms underlying brain reward function and a drug's rewarding versus aversive effects. In this review article, we summarize recent progress in this exciting research area. The findings in these new behavioral models have not only increased our understanding of the neural mechanisms underlying drug reward and addiction but have also introduced a novel experimental approach in preclinical medication development for treating substance use disorders.

We introduce the Transformation Flower Approach (TFA), a Theory of Change that attends to multiple value creation and institutional change as a dual design challenge. We highlight how the TFA integrates social scientific theories and models relevant for transformative change (in particular focusing on pathways, leverage points, governance, power, and values) and demonstrate its practical value by an application to the ongoing transformation of the Dutch food system. By providing a holistic, transdisciplinary and practically relevant approach that aims to support new social contract formation, the TFA goes beyond other transformative change approaches. Based on the notion of pathways, it offers a toolbox that aids in working towards desired futures, involving both incumbents and challengers in an effort to harness untapped yet proximal potentials in a forward-looking way. By embracing an innovation approach, it not only promises to circumvent resistance to change, but also serves as a step-by-step approach to identify options for multiple value creation and effective cooperation. We demonstrate the analytical and practical value of the TFA by discussing action perspectives at various levels and scales in the context of the Dutch food system transition, including (1) area-oriented approaches, (2) acceleration agendas for specific transformation pathways, and (3) actor-specific transformation flowers. In developing these, we emphasize the importance of interdependencies between leverage points. Our approach helps to identify opportunities to link transformative options (the what), actors (the who) and levers (the how) in dynamic interaction to embark on transformative pathways.

Hepatocellular carcinoma (HCC) is one of the most frequent cancers in humans, characterised by high resistance to conventional chemotherapy, late diagnosis, and high mortality rate. It is necessary to elucidate the molecular mechanisms involved in hepatocarcinogenesis to improve diagnosis and treatment outcomes. The Runt-related (RUNX) family of transcription factors (RUNX1, RUNX2, and RUNX3) participates in cardinal biological processes and play paramount roles in the pathogenesis of numerous human malignancies. Their role is often controversial as they can act as oncogenes or tumour suppressors, dependent on cellular context. Evidence shows that deregulated RUNX genes may be involved in hepatocarcinogenesis from the earliest to the latest stages. In this review, we summarise the topical evidence on the roles of RUNX gene family members in HCC. We discuss their possible application as non-invasive molecular markers for early diagnosis, prognosis, and development of novel treatment strategies in HCC patients.

Previous research via cell experiments has shown that ultrafine particles (UFPs, particles less than 100 nm) emitted from Three-Dimensional desktop printers (3D printers) had cytotoxicity. However, a few particles from different filaments and their cytotoxicity combinations have been tested. Here we quantify emissions of UFPs and use Air-Liquid Interface (ALI) from one commercially available filament extrusion desktop 3D printer utilizing three different filaments by controlled experiments. A549 cells were exposed at the ALI to UFPs generated by a working 3D printer for an average of 45 minutes and 90 minutes. Twenty-four hours after exposure, cells were analyzed for percent cytotoxicity grown on the 24-well ALI insert (LDH assay). UFP exposure resulted in decreased cell viability (significantly increased LDH levels). The result shows that Acrylonitrile butadiene styrene (ABS) has the most significant particle emission. ALI exposures enable in vitro testing of mixtures of particles such as UFP from a 3D printer. ABS is the only filament with a significant difference compared with the HEPA control in 90 minutes of exposure (p-value &lt;0.05). ABS and PETG we used during the experiment presented a significant difference compared with the HEPA control in 45 minutes of exposure.A screening analysis of potential exposure to these products in a typical environment suggests caution should be used when operating many printer and filament combinations in poorly ventilated spaces or without the aid of combined gas and particle filtration systems.

Multiple myeloma (MM) is a genetically complex disease that results from a multistep transformation of normal to malignant plasma cells in the bone marrow. However, the molecular mechanisms responsible for the initiation and heterogeneous evolution of MM remain largely unknown. A fundamental step needed to understand the oncogenesis of MM and its response to therapy is the identification of driver mutations. The introduction of gene expression profiling (GEP) in MM was an important step in elucidating the molecular heterogeneity of MM and its clinical relevance. Since some mutations in myeloma occur in non-coding regions, studies based on the analysis of mRNA provide more comprehensive information on the oncogenic pathways and mechanisms relevant to MM biology. In this review, we discuss the role of gene expression profiling in understanding the biology of multiple myeloma together with the clinical manifestation of the disease, as well as its impact on treatment decisions and future directions.

This study evaluates spatial analyses of groundwater quality and environmental changes to obtain information on the groundwater contamination in the Permian Basin, Texas. Coupled with the U.S. government’s open data, these analyses can identify regions where environmental change could have potentially effected groundwater quality. A total of thirty-six wells were selected within the six counties: Andrews, Martin, Ector, Midland, Crane, and Upton. Spatial distribution maps were created for six different parameters: pH, total dissolved solids (TDS), chloride, fluoride, nitrate, and arsenic. Total groundwater quality maps incorporate all the contaminants and denote regions of poor, medium, and optimum conditions. To identify spatial changes in groundwater quality, maps were separated into two different time intervals, 1992-2005 and 2006-2019. We found that groundwater contamination resulted primarily from the mobilization of the contaminant from natural sources or anthropogenic activities such as chemical fertilizers. Overall, groundwater quality decreased during the study period from 1992 to 2019 as population and urban growth began to develop in the Permian Basin. This study contributes on understanding of the response of groundwater quality associated with environmental change in the Permian Basin. Therefore, this research provides important information for groundwater managements in developing plans for the use of water resource in the future for Texas.

To understand great disparities in disease outcomes between CIVID-19 patients, we explore infection and host responses in kinetics. From existing data, we deduced a model that the lungs are damaged by rapidly rising flow resistance as a result of retaining white blood cells in lung tissues. The retention of white blood cells is initially triggered by viral infection but aggravated by injuries caused by low temperature. Lungs are initially damaged by fluid leakage, rapidly followed by extruding blood into alveolar spaces. The step of blood extruding is predicted to take place in a very short time. Our simulations show that as little as 0.1% retention of white blood cells in the lungs can lead to their failure in 5 to 10 days. The small degrees of imbalance implies that this imbalance could be corrected by a large number of factors that are known to reduce flow resistance. The model implies that the top priority is maintaining blood micro-circulation and preserving organ functions in the entire disease course, especially after the virus has spread the whole lungs. From exploring a large number of hypothetical infection modes, we propose preventive, mitigating and treatment strategies for ultimately ending the pandemic. The first strategy is avoiding exposures that could result in widespread damages to lungs and taking post exposure mitigating measures that would reduce disease severity. The second strategy is reducing death rate and disability rate from the current levels to one tenth for infected patients by using multiple factors health optimization method. The double reduction strategies are expected to generate a series of chain reactions that favor mitigating or ending the pandemic. Some reactions include a big reduction of the amount of viral discharges from infected patients into the air, the avoidance of panic, chronic stress and emotional distress, and cross-infections which are expected in quarantines. The double reductions would have a final effect of ending the pandemic.

This work is a natural extension of the author’s previous work: “Multiple scattering theory for heterogeneous elastic continua with strong property fluctuation: theoretical fundamentals and applications” (arXiv:1706.09137 [physics.geo-ph]), which established the foundation for developing multiple scattering model for heterogeneous elastic continua with either weak or strong fluctuations in mass density and elastic stiffness. Polycrystalline material is another type of heterogeneous materials that widely exists in nature and extensively used in industry. In this work, the corresponding multiple scattering theory for polycrystalline materials with randomly oriented anisotropic crystallites is developed. To validate the theory, the theoretical results for a series of materials such as OFHC copper, 304 stainless steel, and Inconel 600 are compared to experimental measurements and the numerical results obtained using finite element simulations. Detailed analysis shows that the new theory is capable of predicting the dispersion and attenuation of polycrystals with satisfactory accuracy. The results also show the new model can give an estimate on the average grain size with a relative error equal to or less than ten percent. As applications in ultrasonic nondestructive evaluation, we calculated the dispersion and attenuation coefficient of one of the most important polycrystalline materials in aeronautics engineering: high-temperature titanium alloys. The effects of grain symmetry, grain size, and alloying elements on the dispersion and attenuation behaviors are examined. Key information is obtained which has significant implications for quantitatively evaluating the average grain size, monitoring the phase transition, and even estimating gradual change in chemical composition of titanium components in gas turbine engines. For applications in seismology, the velocities and Q-factors for both hexagonal and cubic polycrystalline iron models for the Earth’s uppermost inner core are obtained in the whole frequency range. Using the realistic material parameters of iron under the high temperature and high-pressure conditions calculated from ab initio simulations, the numerical results show that the Q-factors range from 0.001 to 0.05, which shows good agreement with that inferred from real seismic data. The new model predicts the velocity of longitudinal waves varies between ± 1% to ± 5 % relative to the Voight average velocity, while the velocity of transverse waves varies from ± 10% to ± 20%, which gives promising explanation to the abnormally slow transverse velocity observed in practical measurements. The numerical results support the conjecture that the Earth’s uppermost inner core is a solid polycrystalline medium. The comprehensive numerical examples show the new model is capable of capturing the most important scattering features of both ultrasonic and seismic waves with satisfactory accuracy. This work provides a universal, quantitative model for characterization of a large variety of polycrystalline materials. It also can be extended to incorporate more complicated microstructures, including ellipsoidal grains with or without textures, and even multi-phase polycrystalline materials. The new model demonstrates great potential of applications in ultrasonic nondestructive evaluation and inspection of aerospace and aeronautic structures. It also provides a theoretical framework for quantitative seismic data explanation and inversion for the material composition and structural formations of the Earth’s inner core.

This work presents some characteristics of MoNet, a computerized platform for the modeling and visualization of complex systems. Emphasis is on the ideas that allowed the successful progressive development of this modeling platform, which goes along with the implementation of applications to the modeling of several studied systems. The platform has the capacity to represent different aspects of systems modeled at different observation scales. This tool offers advantages in the sense of favoring the perception of the phenomenon of the emergence of information, associated with changes of scale. Some criteria used for the construction of this modeling platform are included. The power of current computers has made practical representing graphic resources such as shapes, line thickness, overlaying-text tags, colors and transparencies, in the graphical modeling of systems made up of many elements. By visualizing diagrams conveniently designed to highlight contrasts, these modeling platforms allow the recognition of patterns that drive our understanding of systems and their structure. Graphs that reflect the benefits of the tool regarding the visualization of systems at different scales of observation are presented to illustrate the application of the platform.

Conyza canadensis is a species invading large agricultural areas throughout the world, mainly to its ability to evolve herbicide resistance. Specifically, in Hungary, extensive areas have been infested by this species due to the difficulty in controlling it with glyphosate. To corroborate this fact as resistance and not as an incorrect herbicide application, eight suspicious glyphosate-resistant C. canadensis populations from different Hungarian regions were studied. In dose-response assays with glyphosate, the LD50 and GR50 values indicated that populations 1 to 5 were resistant to this herbicide (H-5 population the most resistant). Besides, the shikimic acid accumulation tests corroborated the results observed in the dose-response assays. 11 alternative herbicides from 6 different mode of action (MOA) were applied at field doses as control alternatives on populations H-5 and H-6 (both in the same regions). The H-5 population showed an unexpected resistance to flazasulfuron (ALS-inhibitor). The ALS enzyme activity studies indicated that the I50 for H-5 was 63.3 fold higher compared to its correspondent susceptible population (H-6). Therefore, the H-5 population exhibited multiple-resistance to flazasulfuron and glyphosate, being the first case reported in Europe for this two MOA. For that reason, the other herbicides with different MOA have to be tested here.

Following our previous success in identifying new steroid-based anticancer agents, we herein disclosed the structural requirements for retaining high potency against cancer cells and associated modes of action. The structurally novel steroidal dimer by001 inhibited growth of different esophageal cancer cells and colony formation at low micromolar levels, elevated cellular ROS levels and caused mitochondrial dysfunction. Mechanistic studies showed that by001 induced cell death through the mitochondria and death receptor-mediated apoptotic pathways and autophagy induction, as well as inhibited migration.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

This article explores the lack of unanimity regarding the nomenclature used to refer to the field of research that explores the intersection between art and science. A series of examples of nomenclatures and the context in which they are applied are listed and referenced. The diverse terminology reflects the heterogeneity, transdisciplinarity, and complexity of a research field in full expansion.

Resistance to therapy and disease progression are the main causes of mortality in most cancers. In particular, the development of resistance is an important limitation affecting the efficacy of therapeutic alternatives for cancer, including chemotherapy, radiotherapy, and immunotherapy. Signaling pathways are largely responsible for the mechanisms of resistance to cancer treatment and progression, and multiple myeloma is no exception. p38 mitogen-activated protein kinase (p38) is downstream of several signaling pathways specific to treatment resistance and progression. Therefore, in recent years, developing therapeutic alternatives directed at p38 MAPK has been of great interest, in order to reverse chemotherapy resistance and prevent progression. In this review, we discuss recent findings on the role of p38, including recent advances in our understanding of its expression and activity as well as its isoforms, and its possible clinical role based on the mechanisms of resistance and progression in multiple myeloma.

The world has been highly impacted by the COVID-19 as the virus has spread to all continents – about 200 countries in total. The latest update claims about 4,000,000 confirmed cases and about 300,000 confirmed deaths owing to the COVID-19 pandemic. This probably makes the COVID-19 as the most dangerous contagious disease in the era 2000s. Apart from massive publications on this topic, there is no available qualitative analysis that describes the dynamic spreads of the COVID-19 and its impacts on healthcare and the economy. Through the system archetypes analysis, this paper explains that the dynamic spread of the COVID-19 consists of the limits to growth and the success to successful structures. The limits to growth elucidates that more symptomatic and asymptomatic patients owing to infected droplets may be bounded by self-healing and isolated treatments. The success to successful structure explains that once the COVID-19 affects the economy through the lockdown, there will be a limited fund to support the government aids and the aggregate demand. In overall, this paper gives readers simplified holistic insights into understanding the dynamic spread of the COVID-19.

We propose a novel data hiding method in an audio host with a compressive sampling technique. An over-complete dictionary represents a group of the watermark. Each row of the dictionary is a Hadamard sequence representing multiple bits of the watermark. Then, the singular values of segment-based host audio in a diagonal matrix multiply by the over-complete dictionary producing a lower size matrix. At the same time, we embed the watermark into the compressed audio. In the detector, we detect the watermark and reconstruct the audio. This proposed method offers not only hiding the information but also compressing the audio host. The application of the proposed method is a broadcast monitoring and biomedical signal recording. We can mark and secure the signal content by hiding the watermark inside the signal while we compress the signal for memory efficiency. We evaluate the performance in terms of payload, compression ratio, audio quality, and watermark quality. The proposed method can hide the data imperceptibly, in range 729-5292 bps with compression ratio 1.47-4.84 and perfect detected watermark.

Plants have evolved two opposing strategies in response to competition for light: shade tolerance and shade avoidance. To detect the presence of neighboring vegetation, shade-avoiding plants have evolved the ability to perceive and integrate multiple signals. Among them, changes in light quality and quantity are central to elicit and regulate the shade avoidance response. Here, we describe recent advances in the understanding of photoperception and downstream signaling mechanisms underlying the shade avoidance response, focusing on Arabidopsis because most of our knowledge derives from studies conducted in this model plant. Shade avoidance is an adaptive response, resulting in phenotypes with high relative fitness in natural dense communities. However, it contributes to reduction in crop plant productivity, and the design of new strategies aimed at attenuating shade avoidance in a stage- and/or organ- specific manner in high-density crop plantings is a major challenge for the future. For this reason, in this review, we also report on recent advances in the molecular description of the shade avoidance response in crops, such as maize and tomato, and discuss similarity and differences with Arabidopsis.

The past two decades have seen a revolution in multiple myeloma (MM) therapy with the introduction of several small molecules, mostly orally effective, whose mechanisms are based on proteasome inhibition, histone deacetylase (HDAC) blockade, and immunomodulation. Immunotherapeutic approaches to MM treatment using monoclonal antibodies (mAbs), while long in development, began to reap success with the identification of CD38 and SLAMF7 as suitable targets for development, culminating in the 2015 FDA approval of daratumumab and elotuzumab, respectively. This review highlights additional mAbs now in the developmental pipeline. Isatuximab, another anti-CD38 mAb, currently is under study in four phase III trials and may offer certain advantages over daratumumab. Several antibody-drug conjugates (ADCs) in the early stages of development are described, including JNJ-63723283, which has attained FDA breakthrough status for MM. Other mAbs described in this review include denosumab, recently approved for myeloma-associated bone loss, and checkpoint inhibitors, although the future status of the latter combined with immunomodulators has been clouded by unacceptably high death rates that caused the FDA to issue clinical holds on several of these trials. Also highlighted are therapies based on the B Cell Maturation Antigen (BCMA), another very promising target for anti-myeloma development.

The human casualties from simulated nuclear detonation scenarios in New Delhi, India are analyzed, with a focus on the distribution of casualties in urban environments and the theoretical application of a nuclear-specific triage system. Model estimates of nuclear war casualties employed ESRI's ArcGIS 9.3, blast and prompt radiation were calculated using the Defense Nuclear Agency's WE program, and fallout radiation was calculated using the Defense Threat Reduction Agency's (DTRA's) Hazard Prediction and Assessment Capability (HPAC) V404SP4, as well as custom GIS and database software applications. ESRI ArcGISTM programs were used to calculate affected populations from the Oak Ridge National Laboratory's LandScanTM 2007 Global Population Dataset for areas affected by thermal, blast and radiation data. Trauma, thermal burn, and radiation casualties were thus estimated on a geographic basis for New Delhi, India for single and multiple (six) 25 kiloton (kt) detonations and a single 1 megaton (1000kt) detonation. Major issues related to the emergency management of a nuclear incident are discussed with specific recommendations for improvement. The consequences for health management of thermal burn and radiation patients is the worst, as burn patients require enormous resources to treat, and there will be little to no familiarity with the treatment of radiation victims.

In this paper, we develop the theory of the multiple q-analogue of the Heine’s binomial formula, chain rule and Leibnitz’s rule. We also derive many useful definitions and results involving multiple q-antiderivative and multiple q-Jackson’s integral. Finally, we list here multiple q-analogue of some elementary functions including trigonometric functions and hyperbolic functions. This may be a good consideration in developing the multiple q-calculus in combinatorics, number theory and other fields of mathematics.

This article addresses reinsurance decision making process, which involves the insurance company and the reinsurance company, and is negotiated through reinsurance intermediaries. The article proposes a decision flow to model the reinsurance design and selection process. In contrast to existing literature on pure proportional reinsurance or stop-loss reinsurance, this article focuses on the combination into Proportional-Stop-loss reinsurance design which better addresses interest of both parties. In terms of methodology, the significant contribution of the study is to incorporate Multiple Attribute Decision Making (MADM) into modelling the reinsurance selection. The Multi-Objective Decision Making (MODM) model is applied in designing reinsurance alternatives. Then MADM is applied to aid insurance companies in choosing the most appropriate reinsurance contract. To illustrate the feasibility of incorporating intelligent decision supporting system in reinsurance market, the study includes a numerical case study using simulation software @Risk in modeling insurance claims, and programming in MATLAB to realize MADM. Managerial implications could be drawn from the case study results. More specifically, when choosing the most appropriate reinsurance, insurance companies should base their decision on multiple measurements instead of single-criteria decision making models for their decisions to be more robust.

This paper investigates a distributed, coordinated motion control network based on multiple direct-drive, linear switched reluctance machines (LSRMs). A hierarchical, two-level synchronization control strategy is proposed for the four LSRMs based motion control network. The high-level, reference signals agreement algorithm is first employed to correct the asynchronous behaviors of the position commands. Then, the low-level tracking synchronization method is applied for the collaborative position control of the four LSRMs. The proposed two-level, fault-tolerant control strategy eliminates the asynchrony of the reference signals and it also guarantees the coordinated tracking control performance of the four LSRMs. Experimental results demonstrate that effective coordinated tracking control can be ensured, based on successful agreement of reference signals and an absolute tracking error falling within 2 mm can be achieved.

(Background) Cognitive deficits related to frontotemporal dysfunction are common in Amyotrophic Lateral Sclerosis (ALS). Visuospatial deficits, related to posterior cerebral regions, are often underestimated in ALS, though they play a crucial role in attending daily living activities. Our pilot study aims at assessing visuospatial abilities using a domain-specific tool in ALS patients compared to healthy controls (HC). (Methods) Twenty-three patients with early ALS and 23 age- and education-matched HC underwent the Battery for Visuospatial Abilities (BVA), including visuo-perceptual and visuo-representational subtests. (Results) When compared to HC, ALS scored worse in 2 out of 4 visuo-perceptual subtests (i.e., Line Length Judgment and Line Orientation Judgment) and 1 out of 4 visuo-representational tasks (i.e., Hidden Figure Identification, HFI) (p &lt;0.01). No correlations arose between ALS clinical features and BVA performance. More than 80% of the ALS cohort obtained abnormal scores in HFI subtest. (Conclusions) Our findings revealed that ALS scored worse (compared to HC) on selective tests tapping “perceptual” and “representational” visuospatial abilities, since early stages of disease. In clinical practice, our findings highlight the need of multi-domain neuropsychological assessment, for monitoring disease course and properly organizing care management of patients with ALS.

The origin of neurodegenerative diseases is linked to the abnormal folding of disease-associated proteins. The traditional amyloid hypothesis has been a focal point of research, but recent findings suggest a more complex picture. This review explores the role of physiological conformation of aggregation-prone domain (also known as prion-like low complexity domain) and multiple co-misfolded proteins in neurodegenerative diseases. We highlight the importance of targeting multi-heterotypic misfolded proteins for effective treatments and emphasize the irreversible neurodegeneration stemming from the loss of physiological folding in prion-like disease-causing proteins underscores the criticality of refolding. Additionally, we introduce the concept of ReproFold Therapeutics, a novel approach aimed at restoring the cellular prion-like folding of disease-causing proteins to rebuild normal cross-β interactomes and mitigate neurodegeneration. Baicalein, a potential drug candidate for this approach, shows promise in vitro and in animal models. Moreover, prion-like low complexity domains implicated in neurodegeneration are also associated with other disorders such as diabetes, cancers, and mental illnesses. Understanding the core pathology of neurodegenerative diseases and the broader implications of prion-like LC domains could revolutionize healthcare approaches and policies worldwide.

Process safety plays a vital role in the modern process industry. To prevent undesired accidents caused by malfunctions or other disturbances in complex industrial processes, considerable attention has been paid to data-driven fault detection techniques. To explore the underlying manifold structure, manifold learning methods including Laplacian eigenmaps, locally linear embedding, and Hessian eigenmaps have been utilized in data-driven fault detection. However, only the partial local structure information is extracted from the aforementioned methods. In this paper, these typical manifold learning methods are synthesized to find the underlying manifold structure from different angles. A more comprehensive local structure is discovered under a unified framework by constructing an objection optimization function for dimension reduction of the process data. The proposed method takes advantage of different manifold learning methods. Based on the proposed dimension reduction method, a new data-driven fault detection method is developed. Hotelling’s T2 and Q statistics are established for the purpose of fault detection. Experiments on an industrial benchmark Tennessee Eastman process and a real blast furnace ironmaking process are carried out to demonstrate the superiority and effectiveness of the proposed method.

Multiple myeloma (MM) has witnessed improved patient outcomes through advancements in therapeutic approaches. Notably, allogeneic stem cell transplantation, proteasome inhibitors, immunomodulatory drugs, and monoclonal antibodies have contributed to enhanced quality of life. Recently, a promising avenue has emerged with chimeric antigen receptor (CAR) T cells targeting B-cell maturation antigen (BCMA), expressed widely on MM cells. To mitigate risks associated with allogenic T cells, we investigated the potential of BCMA CAR expression in natural killer cells (NKs), known for potent cytotoxicity and minimal side effects. Using the NK-92 cell line, we co-expressed BCMA CAR and soluble tumor necrosis factor-related apoptosis-inducing ligand (sTRAIL) employing the PiggyBac transposon system. Engineered NK cells (CAR-NK-92-TRAIL) demonstrated robust cytotoxicity against a panel of MM cell lines and primary patient samples, outperforming unmodified NK-92 cells with a mean difference in viability of 45,1% (± 26,1%, depending on the target cell line). Combination therapy was explored with the proteasome inhibitor bortezomib (BZ) and γ-secretase inhibitors (GSI), leading to a significant synergistic effect in combination with CAR-NK-92-TRAIL cells. This synergy was evident in cytotoxicity assays where a notable decrease in MM cell viability was observed in combinatorial therapy compared to single treatment. In summary, our study demonstrate the therapeutic potential of the CAR-NK-92-TRAIL cells for the treatment of MM. The synergistic impact of combining these engineered NK cells with BZ and GSI supports further development of allogeneic CAR-based products for effective MM therapy.

LOXL2, a copper-dependent amine oxidase, has emerged as a promising therapeutic target in hepatocellular carcinoma (HCC). Increased LOXL2 expression in HCC has been linked with aggressive phenotype and represents a poor prognostic factor. Here, we focus on mechanisms by which LOXL2 orchestrates multiple oncogenic functions in HCC development. We are reviewing current knowledge about the roles of LOXL2 in the modulation of the HCC tumor microenvironment, formation of premetastatic niches, and epithelial-mesenchymal transition. Also, we are highlighting the complex interplay between LOXL2 and hypoxia, angiogenesis, and vasculogenic mimicry in HCC. At the end of the review, we summarize current LOXL2 inhibitors and discuss their potential in HCC precision treatment.

Direct imaging systems that create an image of an object directly on the sensor in a single step are prone to many constraints as a perfect image is required to be recorded within this step. In designing high resolution direct imaging systems with a diffractive lens, the outermost zone width either reaches the lithography limit or the diffraction limit itself imposing challenges in fabrication. However, if the imaging mode is switched to an indirect one consisting of multiple steps to complete imaging, then different possibilities open up. One such methods is the widely used indirect imaging method with Golay configuration telescopes. In this study, a Golay-like configuration has been adapted to realize a large area diffractive lens with three sub-aperture diffractive lenses. The sub-aperture diffractive lenses are not required to collect light and focus them to a single point as in a direct imaging system but to focus independently on different points within the sensor area. This approach of Large Area Diffractive lens with Integrated Sub-Apertures (LADISA) relaxes the fabrication constraints and allows the sub-aperture diffractive elements to have a larger outermost zone width and smaller area. The diffractive sub-apertures were manufactured using photolithography. The fabricated diffractive element has been implemented in indirect imaging mode using non-linear reconstruction and Lucy-Richardson-Rosen algorithm with synthesized point spread functions. The computational optical experiments revealed an improved optical and computational imaging resolutions compared to previous studies.

One of matrix equalities composed of multiple products of matrices and their generalized inverses is given by $A_1B_1^{-}A_2B_2^{-} \cdots A_kB_k^{-}A_{k+1}= A$ where $A_1$, $B_1$, $A_2$, $B_2$, $\ldots$, $A_k$, $B_k$, $A_{k+1}$, and $A$ are given matrices of appropriate sizes, and $B_1^{-}$, $B_2^{-}$, $\cdots$, $B_k^{-}$ are generalized inverses of matrices. The cases for $k = 1, 2$ and their special forms were properly approached in the theory of generalized inverses of matrices. In this note, the author presents an algebraic procedure to derive explicit necessary and sufficient conditions for the equality with $k = 3$ to always hold using certain rank equalities for the block matrices constructed by the given matrices, and then mention a key step of extending the previous work to a general situation.

Despite the remarkable success of SARS CoV-2 vaccines, the rise of variants, some of which are more resistant to the effects of vaccination, highlights the potential need for additional COVID-19 vaccines. We used the Multiple Antigen Presenting System (MAPS) technology, in which proteins are presented on a polysaccharide polymer to induce antibody, Th1, Th17 and CD8+ T cell responses, to engineer a novel vaccine targeting SARS CoV-2. This vaccine contains a fragment of the spike (S) protein receptor-binding domain (RBD) sequence of the original D614G strain and was used to immunize nonhuman primates (NHP) for assessment of immunological responses and protection against SARS CoV-2 challenge. The SARS CoV-2 MAPS vaccine generated robust neutralizing antibodies as well as Th1, Th17 and cytotoxic CD8 T-cell responses in NHPs. Furthermore, MAPS-immunized NHPs had significantly lower viral loads in the nasopharynx and lung compared to control animals. Taken together, these findings support the use of the MAPS platform to make a SARS CoV-2 vaccine. The nature of the platform also could enable its use for the inclusion of different variants in a single vaccine.

This paper proposes a model to evaluate business projects to get into an incubator, allowing to rank them in order of selection priority. The model combines the Momentum method to build prospective scenarios and the Multiple Criteria Decision Making (MCDM) method TOPSIS-2N to rank the alternatives. Six business projects were evaluated to be incubated. The Momentum method made it possible for us to create an initial core of criteria for the evaluation of incubation projects. The TOPSIS-2N method supported the decision to choose the company to be incubated by ranking the alternatives in order of relevance. Our evaluation model has improved the existing models used by incubators. This model can be used and / or adapted by any incubator to evaluate the business projects to be incubated. The set of criteria for the evaluation of incubation projects is original and the use of prospective scenarios with a MCDM method to evaluate companies to be incubated does not exist in the literature.

Cardiovascular disease (CVD) is the number one cause of death worldwide. This condition resulted in huge research on CVD increasing the need for animal models suitable for the in vivo research. Daphnia and Zebrafish are good animal models for cardiovascular research due to their relative body transparency and easy culture property. Several methods have been developed to conduct cardiac performance measurement in Daphnia and Zebrafish. However, most of the methods only able to obtain heartbeat rate. The other important cardiac endpoints like stroke volume, ejection fraction, fraction shortening, cardiac output and heartbeat regularity must use other programs for measurement. To overcome this limitation, in this study, we successfully developed a one-stop ImageJ-based method using kymograph macros language that able to obtain multiple cardiac performance endpoints simultaneously for the first time. To validate its utility, we incubate Daphnia magna at different ambient temperatures and exposed zebrafish with astemizole to detect the corresponding cardiac performance alterations. In summary, the kymograph method reported in this study provides a new, easy to use, and inexpensive one-stop method on obtaining multiple cardiac performance endpoints with high accuracy and convenience.

Scattering of elastic waves in heterogeneous media has become one of the most important problems in the field of wave propagation due to its broad applications in seismology, natural resource exploration, ultrasonic nondestructive evaluation and biomedical ultrasound. Nevertheless, it is one of the most challenging problems because of the complicated medium inhomogeneity and the complexity of the elastodynamic equations. A widely accepted model for the propagation and scattering of elastic waves, which properly incorporates the multiple scattering phenomenon and the statistical information of the inhomogeneities is still missing. In this work, the author developed a multiple scattering model for heterogeneous elastic continua with strong property fluctuation and obtained the exact solution to the dispersion equation under the first-order smoothing approximation. The model establishes an accurate quantitative relation between the microstructural properties and the coherent wave propagation parameters and can be used for characterization or inversion of microstructures. Starting from the elastodynamic differential equations, a system of integral equation for the Green functions of the heterogeneous medium was developed by using Green’s functions of a homogeneous reference medium. After properly eliminating the singularity of the Green tensor and introducing a new set of renormalized field variables, the original integral equation is reformulated into a system of renormalized integral equations. Dyson’s equation and its first-order smoothing approximation, describing the ensemble averaged response of the heterogeneous system, are then derived with the aid of Feynman’s diagram technique. The dispersion equations for the longitudinal and transverse coherent waves are then obtained by applying Fourier transform to the Dyson equation. The exact solution to the dispersion equations are obtained numerically. To validate the new model, the results for weak-property-fluctuation materials are compared to the predictions given by an improved weak-fluctuation multiple scattering theory. It is shown that the new model is capable of giving a more robust and accurate prediction of the dispersion behavior of weak-property-fluctuation materials. Numerical results further show that the new model is still able to provide accurate results for strong-property-fluctuation materials while the weak-fluctuation model is completely failed. As applications of the new model, dispersion and attenuation curves for coherent waves in the Earth’s lithosphere, the porous and two-phase alloys, and human cortical bone are calculated. Detailed analysis shows the model can capture the major dispersion and attenuation characteristics, such as the longitudinal and transverse wave Q-factors and their ratios, existence of two propagation modes, anomalous negative dispersion, nonlinear attenuation-frequency relation, and even the disappearance of coherent waves. Additionally, it helps gain new insights into a series of longstanding problems, such as the dominant mechanism of seismic attenuation and the existence of the Mohorovičić discontinuity. This work provides a general and accurate theoretical framework for quantitative characterization of microstructures in a broad spectrum of heterogeneous materials and it is anticipated to have vital applications in seismology, ultrasonic nondestructive evaluation and biomedical ultrasound.

To achieve user retention through multifactor synergy, Internet enterprises must reduce costs and increase efficiency and sustainable development. In response to the dilemma that Internet compa-nies are experiencing increasingly high user acquisition costs and serious user churn, this paper uses a sample of 46,695 user reviews of nine product series from Xiaomi Ecological Chain. Case studies and qualitative comparative analysis are used to explore the influence mechanisms of quality of experience, brand trust, and brand attachment on users' retention intentions. Our find-ings are as follows. (1) Brand attachment alone is not necessary for high user retention intention, but user perception, cognition, and brand trust are necessary. (2) Quality of experience positively impacts brand trust, attachment, and user retention intention. Therefore, improving user perception and cognition is critical in generating high user retention intention. (3) Five configuration paths can achieve high user retention intention, three configuration paths lead to low user retention intention, and there is an asymmetric relationship between these paths. Among them, the role of quality of experience-driven configuration paths in generating user retention intention is the most prominent. (4) In the substitution relationship between configuration paths, user perception, and cognition can substitute with brand trust and attachment. Our findings have important theoretical and practical implications for revealing the realization paths of high user retention intention in Internet companies and provide a new perspective for future research.

Multiple myeloma (MM) is a genetically heterogenous disease that includes a subgroup of 10-15% of patients facing dismal survival despite most intensive treatment. The aim of this review article is to provide an integrated clinical and biological overview on the high-risk MM discussing the novel therapeutic perspectives aimed to target the neoplastic clone and its microenvironment. The dissection of the molecular determinants of the aggressive phenotypes and drug resistance can foster a better tailored clinical management of high-risk profile and refractoriness to therapy. Among the current clinical difficulties in MM, patient’s management manipulating the tumor niche represents a major challenge given the limited knowledge about the MM-milieu interaction. The angiogenesis and bystander infiltrate constitute pivotal mechanisms of mutual collaboration between MM and the non-tumoral counterpart. Immuno-modulatory and anti-angiogenic therapy hold great efficacy but variable and unpredictable responses in high-risk MM. Therefore, it would be worth to better select the population and the MM stage that could profit to a dual immune/vasculogenesis targeting. The comprehensive knowledge of the genetic heterogeneity and MM high-risk ecosystem enforce a systematic bench-to-bedside approach. Despite significant improvements in the biology knowledge, MM is still a chronic and incurable neoplasia and therapeutic options able to overcome the relapsing/refractory behavior represent an unmet clinical need. Here, we corroborate previous biological findings providing a synthetic outlook of novel druggable targets. We also summarize the existing multi-omics-based risk profiling tools, in order to better personalize the patient-oriented clinical management.

Marine sponges, a well documented prolific source of natural products, harbors numerous microbial communities believed to possess N-acyl homoserine lactones (AHLs) mediated Quorum sensing (QS) as one of the mechanisms of interaction. Bacteria and eukaryotic organisms are known to produce molecules that can interfere with QS signaling, thus affecting microbial genetic regulation and function. In the present study, we established the potential for production of both QS signal molecules as well as QS interfering molecules (QSI) in the same sponge species Sarcotragus spinosulus. A total of eighteen saturated acyl chain AHLs were identified along with six putative unsaturated acyl chain AHLs. Bioassay guided purification led to the isolation of two brominated metabolites with QS-interfering activity. The structures of these compounds were elucidated by comparative spectral analysis of 1HNMR and HR-MS data and was identified as 3-Br-N-methyltyramine (1) and 5,6-dibromo-N,N-dimethyltryptamine (2). The QSI activity of compounds 1 and 2 were evaluated using reporter gene assays for long- and short-chain signals (E. coli pSB1075 and E. coli pSB401) and was confirmed by measuring dose dependent inhibition of proteolytic activity and pyocyanin production in P. aeruginosa PAO1. The obtained results showed the co-existence of QS and QSI in S. spinosulus, a complex network which may mediate the orchestrated function of the microbiome within the sponge holobiont.

Multi-Object Tracking (MOT) is a key technology for Unmanned Aerial Vehicles (UAVs). Traditional tracking-by-detection methods firstly employ an object detector to retrieve targets in each image and then track them based on a matching algorithm. Recently, the popular multi-task learning methods has been dominating this area since they can detect targets and extract Re-Identification (Re-ID) features in a computationally efficient way. However, the detection task and the tracking task have conflicting requirements on image features, leading to the poor performance of the joint learning model compared to separate detection and tracking methods. The problem is more severe when it comes to UAV images due to the presence of irregular motion of large number of small targets. In this paper, we propose a balanced Joint Detection and Re-ID learning (JDR) network to address the MOT problem in UAV vision. To better handle the non-uniform motion of objects in UAV videos, the Set-Member Filter is applied which describes object state as a bounded set. An appearance matching cascade is then proposed based on target state set. Furthermore, a Motion-Mutation module is designed to address the challenges posed by the abrupt motion of UAV. Extensive experiments on the VisDrone-MOT2019 dataset demonstrate that our proposed model, termed as SMFMOT, outperforms state-of-the-arts by a large margin and achieves superior performance on the MOT tasks in UAV videos.

Alopecurus myosuroides (blackgrass) is a problematic weed of Western European winter wheat and its success is largely due to widespread multiple-herbicide resistance. Previous analysis of F2 seed families derived from two distinct blackgrass populations exhibiting equivalent non-target site resistance (NTSR) phenotypes shows resistance is polygenic and evolves from standing genetic variation. Using a CIDER-seq pipeline we show that herbicide resistant (HR) and herbicide sensitive (HS) F3 plants from these F2 seed families as well as the parent populations they were derived from carry extra-chromosomal circular DNA (eccDNA). We identify the similarities and differences in the coding structures within and between resistant and sensitive populations. Although the numbers and size of detected eccDNAs varied between the populations, comparisons between HR and HS blackgrass populations identified shared and unique coding content, predicted genes, and functional protein domains. These include genes related to herbicide detoxification such as Cytochrome P450s, ATP-binding cassette transporters and glutathione transferases including AmGSTF1. eccDNA content was mapped to the Alopecurus myosuroides reference genome, revealing genomic regions at distal end of chromosome 5 and the near center of chromosome 1 and 7 as regions with high number of mapped eccDNA gene density. Mapping to 15 known herbicide-resistant QTL regions showed the eccDNA coding sequences match 12 with four QLT matching HS coding sequences one region only contained HR coding sequences. These findings establish that like other pernicious weeds, blackgrass has eccDNAs that contain homologs of chromosomal genes, and these may contribute genetic heterogeneity and evolutionary innovation to rapidly adapt to abiotic stresses including herbicide treatment.

The landscape of therapeutic measures to treat multiple myeloma has undergone a seismic shift since the dawn of the current century. This has been driven largely by the introduction of new classes of small molecules, such as proteasome blockers (e.g., bortezomib) and immunomodulators (e.g., lenalidomide), as well as by immunotherapeutic agents starting with the anti-CD38 monoclonal antibody daratumumab in 2015. Recently, other immunotherapies have been added to the armamentarium of drugs available to fight this malignancy. These include the bispecifics teclistamab, talquetamab, and elranatamab, and the chimeric antigen receptor (CAR) T-cell products idecabtagene vicleucel (ide-cel) and ciltacabtagene autoleucel (cilta-cel). While the accumulated benefits of these newer agents have resulted in a more than doubling of the disease’s five-year survival rate to nearly 60% and improved quality of life, the disease remains incurable, as patients become refractory to the drugs and experience relapse. This review covers the current scope of anti-myeloma immunotherapeutic agents, both those in clinical use and in development. Included in the discussion are additional monoclonal antibodies (mAbs), antibody-drug conjugates (ADCs), bi- and multi-targeted mAbs, and CAR T-cells and emerging natural killer (NK) cells, including products intended for “off-the-shelf” (allogeneic) applications. Emphasis is placed on the benefits of each along with the challenges that need to be surmounted if MM is to be cured.

This study uses machine learning to predict the convergence results of the Duffing equation with and without damping. The Duffing equation represents a nonlinear second-order differential equation with interesting behavior in undamped free vibration and forced vibration with damping. Convergence alternates randomly between 1 and -1 in undamped free vibration, depending on initial conditions. For forced vibration with damping, multiple factors influence vibration patterns. We utilize the fourth-order Runge-Kutta method to collect convergence results for both conditions. Machine learning techniques, specifically the long short term memory (LSTM) and LSTM-Neural Network (LSTM-NN) method, are employed to predict these convergence values. The LSTM-NN model is a hybrid approach that combines the LSTM method with the addition of hidden layers of neurons. Both the LSTM and LSTM-NN models are thoroughly explored and analyzed in this research. The research process involves three stages: data preprocessing, training, and verification. The results show that the LSTM-NN model becomes more adept at predicting binary datasets, boasting an impressive accuracy of up to 98%. However, when it comes to predicting multiple solutions, the traditional LSTM method outperforms the LSTM-NN approach.

This paper proposes a multimodal fusion 3D target detection algorithm based on the attention mechanism to improve the performance of 3D target detection. The algorithm utilizes point cloud data and information from camera. For image feature extraction, the ResNet50+FPN architecture extracts features at four levels. Point cloud feature extraction employs the voxel method and FCN to extract point and voxel features. The fusion of image and point cloud features is achieved through regional point fusion and regional voxel fusion methods. After information fusion, the Coordinate attention mechanism and SimAM attention mechanism extract fusion features at a deep level. The algorithm's performance is evaluated using the DAIR-V2X dataset. The results show that compared to the Part-A2 algorithm, the proposed algorithm improves the mAP value by 7.9% in BEV view and 7.8% in 3D view at IOU=0.5 (cars) and IOU=0.25 (pedestrians and cyclist). At IOU=0.7 (cars) and IOU=0.5 (pedestrians and cyclist), the mAP value of the SECOND algorithm is improved by 5.4% in the BEV view and 4.3% in the 3D view, compared to other comparison algorithms.

Cell identity is determined by chromatin structure and the profiles of gene expression, which are dependent on chromatin accessibility and DNA methylation of regions critical for gene expres-sions, such as enhancers and promoters. These epigenetic modifications are required for mamma-lian development and are essential for the establishment and the maintenance of the cellular iden-tity. DNA methylation was once thought to be a permanent repressive epigenetic mark, but sys-tematic analysis in various genomic contexts reveals a more dynamic regulation than previously thought. In fact, both active DNA methylation and demethylation occur during cell fate commit-ment and terminal differentiation. To link methylation signatures of specific genes to their ex-pression profiles, we have determined the methyl-CpG configurations of the promoters of five genes switched on and off during murine postnatal brain differentiation by bisulfite-targeted se-quencing. We report here the structure of significant, dynamic and stable methyl-CpG profiles as-sociated with silencing or activation of expression of genes during brain postnatal differentiation. Strikingly, these methylation cores mark different mouse brain areas and cell types derived from the same areas during postnatal differentiation.

A nonlinear MEMS multimass sensor is investigated. The MEMS design consists of an array of nonlinear microcantilevers clamped to a shuttle mass which, in turn, is attached to a linear spring and a dashpot. The microcantilevers are made of a polymeric hosting matrix reinforced by aligned carbon nanotubes (CNT) with different CNT volume fractions in each cantilever so as to suitably tune the frequency bandwidth of the device. The advantages of a single input-single output (SISO) system are here exploited for the design, actuation and detection principles as in previous literature.

We find at least 4 quantum properties that are indeed universal in some number systems; and we can use them for quantum consciousness. Using the sets B={0,1}, N, Z, or Q has the +4 quantum properties that one can trust, as archetypes of easy communication to friends and foes, to ignoranti or cognoscenti, and for quantum computing. This paper proposes the use of Bayesian geometry to reduce the space of possible results, reducing or increasing initial beliefs by successive experimentation. This is exemplified in biology and mathematics, and can be applied to physics and other sciences. The conclusion is that an experimental fact can be absolutely verified. Any mathematical choice (as verified by computers) militating against R=Q, is under an absolutely low chance to succeed. Infinitesimals are denied based on 3^16 independent factors. This is not a probabilistic result, but based on reduction of the Bayes geometry for updating beliefs. This work applies to non-probabilistic and unknown phenomena, such as those found in oscillations (neutrino, health), evolution, and quantum computing, denies Gödel's uncertainty, and solves the liar's paradox by reflection. This connects different scientific fields with one another, in an internet, i.e., in a network of connections of multiple open networks, using the set Q, resembling a hologram, and includes entanglement.

Precision Agriculture is the ability to handle variations in productivity within a field and maximize financial return, optimize resource utilization and minimize impact of the environment. It is also the process of automated data collection, cloud storage and utilization to build robust decision support system. In case of Ethiopia, due to poor communication infrastructure coverage and absence of the state-of-the-art technology in the agriculture sector, implementing precision farming system is a challenging tasks in the domain area. In this work, we proposed a fusion of multiple sensors using IOT and IIOT infrastructure to collect critical data from farming fields to develop precision farming facility for decision makers. The main purpose was to monitor weather variability, automate irrigation process, extract critical soil properties. In addition, we have used time series data collected from sensor devices to build forecasting model. Fusion of multiple IoT device provide a mechanism in the agriculture area to deal with real-time monitoring of crops. It is cost-effective technology and required low-energy with edge computing sensor device. We employed the Message Queuing Telemetry Transport (MQTT) protocol to connect the Industrial/Internet of Things (I/IoT) to the cloud server. The communication between system user and sensor device has been done via cloud using Node-RED platform, web android APIs. The cloud-based Eco-system allows us to aggregate, visualize, and analyze live streams output from each sensor in real-time manner. Finally, we have built time series forecasting model using records collected by each sensor device. Using the multi-variate time series data-set, we have obtained about 99 forecasting accuracy on some important variables. Finally, we have developed mobile and web-based application for the end-user to monitor the proposed system remotely.

Sea surface salinity (SSS) is one of the Essential Climate Variables (ECVs) as defined by the Global Climate Observing System (GCOS). Acquiring high-quality SSS datasets with high spatial-temporal resolution is cruicial for research on the hydrological cycle and earth climate. This study assessed the quality of SSS data provided by four high-resolution ocean reanalysis products, including the Hybrid Coordinate Ocean Model (HYCOM) 1/12° global reanalysis, the The Copernicus Global 1/12° Oceanic and Sea Ice GLORYS12 Reanal-ysis, the Simple Ocean Data Assimilation (SODA) reanalysis, the ECMWF Oceanic Reanalysis System 5 (ORAS5) product and the Estimating the Circulation and Climate of the Ocean Phase II (ECCO2) reanalysis. Regional comparison in the Mediterranean Sea shows that reanalysis largely depicts the accurate spatial SSS structure away from river mouths and coastal areas but slightly underestimates the mean SSS values. Better SSS reanalysis performance is found in the Levantine Sea while larger SSS uncertainties are found in the Adriatic Sea and the Aegean Sea. The global comparison with CMEMS level-4 (L4) SSS show generally con-sistent large-scale structures. The mean ΔSSS between monthly gridded reanalysis data and in situ analyzed data is -0.1 PSU in the open seas between 40°S and 40°N with the mean Root Mean Square Deviation (RMSD) generally smaller than 0.3 PSU and the majority of correlation coefficients higher than 0.5. Comparison with collocated buoy salinity shows that reanalysis products well captures the SSS variations at the locations of tropical moored buoy arrays at weekly scale. Among all the four products, the data quality of HYCOM re-analysis SSS is highest in marginal sea, GLORYS12 has the best performance in the global ocean especially in tropical regions. Comparatively, ECCO2 has the overall worst performance to reproduce SSS states and variations by showing the largest discrepancies with CMEMS L4 SSS.

Background: The human mind is multimodal. Yet most behavioral studies rely on century-old measures such as task accuracy and latency. To create a better understanding of human behavior and brain functionality, we should introduce other measures and analyze behavior from various aspects. However, it is technically complex and costly to design and implement the experiments that record multiple measures. To address this issue, a platform that allows synchronizing multiple measures from human behavior is needed. Method: This paper introduces an opensource platform named OpenSync, which can be used to synchronize multiple measures in neuroscience experiments. This platform helps to automatically integrate, synchronize and record physiological measures (e.g., electroencephalogram (EEG), galvanic skin response (GSR), eye-tracking, body motion, etc.), user input response (e.g., from mouse, keyboard, joystick, etc.), and task-related information (stimulus markers). In this paper, we explain the structure and details of OpenSync, provide two case studies in PsychoPy and Unity. Comparison with existing tools: Unlike proprietary systems (e.g., iMotions), OpenSync is free and it can be used inside any opensource experiment design software (e.g., PsychoPy, OpenSesame, Unity, etc., https://pypi.org/project/OpenSync/ and https://github.com/moeinrazavi/OpenSync_Unity). Results: Our experimental results show that the OpenSync platform is able to synchronize multiple measures with microsecond resolution.

As the number of ships for marine transportation increases with the advancement of global trade, encountering multiple ships in marine traffic becomes common. This situation raises the risk of collision of the ships; hence this paper proposes a novel Fuzzy-logic based intelligent conflict detection and resolution algorithm, where the collision courses and possible avoiding actions are analyzed by considering ship motion dynamics and the input and output fuzzy membership functions are derived. As a conflict detection module, the Collision Risk (CR) is measured for each ship by using a scaled nondimensional Distance to the Closest Point of Approach (DCPA) and Time to the Closest Point of Approach (TCPA) as inputs. Afterwards, the decisions for collision avoidance are made based on the calculated CR, encountering angle and relative angle of each ship measured from others. In this regard, the rules for the Fuzzy interface system are defined in accordance with the COLREGs, and the whole system is implemented on the MATLAB Simulink platform. In addition, to deal with the multiple ship encounters, the paper proposes a unique maximum-course and minimum-speed change approach for decision making, which has been found to be efficient to solve Imazu problems, and other complicated multiple-ship encounters.