Heat waves are a significant consequence of climate change threatening public health by increased morbidity and mortality. The aim of this study was to estimate individuals’ knowledge, attitudes and practice related to heat waves. We conducted an exploratory cross-sectional study in Greece during September 2023. We employed a convenience sample of 1055 participants. We used the heat wave knowledge, awareness, practice and behavior scale (HWKAPBS) to measure our outcome. We measured several socio-demographic variables, such as gender, age, educational level, etc. as potential determinants. Mean scores for the knowledge, awareness, practice and behavior factors were 12.5, 22.7, 22.2 and 12.1 respectively. Females had higher scores on the four factors compared with males. We found a positive relationship between self-perceived health status and awareness, practice and behavior about heat waves. Similarly, we identified a positive relationship between self-perceived financial status and awareness and behavior about heat waves. Increased age was associated with increased practice score, while increased educational level was associated with increased knowledge score. Additionally, behavior score was higher among participants in urban areas than those in rural areas. We found statistically significant positive correlations between the four factors. Levels of knowledge, awareness, practice and behavior about heat waves were high in our sample. Several socio-demographic variables affect participants’ knowledge, awareness, practice and behavior concerning heat waves.

“Anti-stripping Agents" or "adhesion promoters” can enhance the chemical affinity between as-phalt and aggregate by increasing their mutual attraction. Various forms of anti-stripping agents have been proposed to mitigate pavement stripping, and siloxane-based Zychotherm is one of them. Choosing the appropriate type and dose of anti-stripping additives is no doubt vital to the intended performance. Therefore, it is critically important to determine the dose of the additives used in the modification of asphalt binders. This research developed a feasible detection method that can closely measure the dose (0.05% and 0.1%) of siloxane-based anti-stripping liquid agents. Related test methods including heat combustion test, residue visualization, burning, and ignition were implemented. Heat combustion results showed that with the addition of Zychotherm anti-stripping additive, average heat combustion value decreased by 1.34% and 1.72% for 0.05% and 0.1% Zychotherm modified binder respectively. In the burning and ignition process, the modified binder leaves yellowish substances in the residue, which is an indication of the presence of Zy-chotherm. The weight of the yellowish residue relates more to the quantity of Zychotherm in as-phalt binder.

The solar heat pump system based on photovoltaic photothermal (PV/T) modules is a new technology that integrates photovoltaics and heat reutilization. It can improve the efficiency of photovoltaic conversion and recovery the remaining heat generated during the photoelectric conversion process, thereby improving the comprehensive efficiency of the whole system. Simulink software is a visual simulation tool, which has the advantages of strong applicability, clear simulation structure and calculation process. The design of its graphical programming greatly simplifies the user modeling process and allows for direct viewing of results, therefore improving the simulation efficiency. At present, there is little research on simulation of solar heat pump systems with PV/T modules based on Simulink software. In this paper, the mathematical models of each component contained in the PV/T solar heat pump system were established based on the system working principle, energy conservation equations and some empirical formulas, and then the operation of the system was simulated by the Simulink software. Due to the operation characteristic of PV/T modules is the key influencing factor for the whole system performance, the model and simulation process for PV/T modules were introduced in detail. The results showed that the surface temperature of PV/T modules under different operating conditions was significantly lower than that of ordinary photovoltaic panels, and the temperature change amplitude was lower. As results, the power generation and photovoltaic conversion efficiency were significantly improved.

In the dairy cattle sector, the evaluation of the effects induced by heat stress is still one of the most impactful and investigated aspects as it is strongly connected to both sustainability of the production and animal welfare. On the other hand, more recently, the possibility of collecting large dataset made available by the increasing technology diffusion is paving the way for the application of advanced numerical techniques based on machine learning or big data approaches. In this scenario driven by rapid change there could be the risk of dispersing the relevant information represented by the physiological animal component, which should maintain the central role in the development of numerical models and tools. In the light of this, the present literature review aims to consolidate and synthesize existing research on the physiological consequences of heat stress in dairy cattle. The present review provides, in a single document, an overview as complete as possible of the heat stress-induced responses in dairy cattle with the intent of filling the existing research gap for extracting the veterinary knowledge present in the literature and make it available to those who are developing numerical models and tools.

Laser heat treatment is applied after coating. Evaluation of the results was performed by studying the microstructures by metallographic, SEM/EDX microscopy and the mechanical properties were obtained by microscopic hardness and abrasion resistance. The objective of this study was to investigate the effect of laser heat treatment on the wear resistance of metal coatings. The results show the influence of the microstructure and chemical composition of the electrodes used on the micro-hardness and wear resistance of the metal coatings.

Converting chemical energy from green hydrogen to electricity using Membrane Exchange Protons Fuel cell (PEMFC) is a promising solution in various applications such e-mobility and building facilities. The electrical efficiency of PEMFCs can reach 60%. However, they are immensely sensitive to the working temperature, requiring good thermal management. Active thermal management systems are expensive and energy-consuming. Passive thermal management systems enable PEMFC thermal management without additional energy consumption. Here various passive thermal management technologies are reviewed. Different techniques are thorougly described and critically compared in terms of complexity, efficiency, cooling rate, scope of applicability, and the sizes of PEMFCs to which they apply. The conclusions provide a solid background for further investigations, and recommendations for future work are suggested.

The shortage of precooling equipment in litchi producing regions could lead to a high loss rate, poor quality of litchis. It is urgent to develop a portable precooling device for litchi producing regions. In this study, a novel spray hydrocooler with thermal energy storage (TES) were designed, fabricated, and tested. A simple mathematical model of TES capacity, ice coil thermal resistance and refrigeration system was employed to determine hydrocooler parameters. Then designed the structure of the spray hydrocooler. Maximum charging test was implemented with full TES capacity and litchi spray hydrocooling experiments were carried out at different charging times, spray flow rate, and litchi load with one-third TES capacity. Results showed that: (1) the spray hydrocooler allows for the rapid and effective precooling of litchis; (2) the hydrocooler can precool 299 kg litchis with one-third TES storage, meet the precooling requirements; (3) the effective TES capacity achieved 1.25×108 J at the maximum TES capacity of the hydrocooler, while the energy efficiency ratio (EER) is 2; (4) the precooling capacity was maximum and the average power consumption was minimum when the litchi load was 23 kg and the spray flow rate was 30 L min-1. Longer charging time is the most important factor in increasing precooling capacity and reducing average power consumption.

In this investigation, Cu-Ni alloys for possible fixed dental prostheses (FDPs), with different aluminum additions were produced using vacuum atmosphere. Annealed alloys (He atmosphere) with low aluminum concentration showed a coarse dendritic structure, while samples with high aluminum concentration showed a refined dendritic structure. Structural defects analyses have shown a relative low vacancy concentrations. Hardness value increases approximately five times for the alloyed samples compared with the as-cast and unalloyed samples. Compression test results have shown a noticeable strengthening improvement, mainly in samples heat treated with 10 at % Al, while samples with 5 at % Al presented also acceptable resistance. Results are discussed in terms of dislocation mobility and hardening precipitation mechanism.

The spiral tube heat exchange is widely used in large-scale liquefaction process. However, the research on the friction pressure drop of the two-phase flow in the spiral tube is limited, especially for the offshore sloshing condition. In this paper, an experimental system is designed and built, and the effects of sloshing form (roll, pitch, heave), sloshing period (5-15s), mass flux (200-800 kg/(m2·s)), vapor quality (0.3-0.9) and operating pressure (2-4 MPa) on friction pressure drop of methane/ethane (C1/C2) mixture in spiral tube are studied. The result shows that the growth rate of time-averaged friction pressure drop during condensation under sloshing condition is less than 0, which indicates that sloshing will lead to drag reduction. And under the three sloshing parameters, the growth rate of time-averaged friction pressure drop of C1/C2 is reduced by-5.99%%, 5.97% and -6.70% respectively.

Following the rapid spread of COVID-19 across the globe, the intense response that was demanded of diagnostic centers and research laboratories prompted the use of numerous products and protocols for the management of SARS-CoV-2 specimens. In these settings, proper handling of such infectious specimen is necessary to ensure the safety of personnel and to reduce the risk of active transmission. Our aim was to evaluate the inactivation efficacy of different inactivating methods, notably from commercial lysis buffers available in diagnostic kits. Heat and sodium dodecyl sulfate detergent were also included in our investigations. A cell culture-based assay was used, and supported by molecular qRT-PCR detection, to show in vitro infectivity reduction after inactivation treatment. Overall, all the investigated methods were successful in inactivating SARS-CoV-2. Ten minutes of contact with the commercial buffers completely stopped in vitro SARS-CoV-2 infectivity. Fifteen minutes at 68°C and 30 minutes at 56°C as well as one hour with sodium dodecyl sulfate detergent at 2, 1, 0.5, and 0.1% yielded the same results. These findings demonstrate the reliability of these protocols with regards to biosafety. Inactivation by heat and sodium dodecyl sulfate detergent are rather simple and can be readily available methods for rendering an infectious SARS-CoV-2 specimen inactive, especially in settings where commercial buffers are not available.

Thermal simulations are an important part in the design of electronic systems, especially as systems with high power density become common. In simulation-based design approaches, a considerable amount of time is spent by repeated simulations. In this work, we present a proof-of-concept study of the application of convolutional neural networks to accelerate those thermal simulations. The goal is not to replace standard simulation tools but to provide a method to quickly select promising samples for more detailed investigations. Based on a training set of randomly generated circuits with corresponding Finite Element solutions, the full 3D steady-state temperature field is estimated using a fully convolutional neural network. A custom network architecture is proposed which captures the long-range correlations present in heat conduction problems. We test the network on a separate dataset and find that the mean relative error is around 2 % and the typical evaluation time is 35 ms per sample ( 2 ms for evaluation, 33 ms for data transfer). The benefit of this neural-network-based approach is that, once training is completed, the network can be applied to any system within the design space spanned by the randomised training dataset (which includes different components, material properties, different positioning of components on a PCB, etc.).

We aimed to evaluate the protective effects of acetyl-xylogalactan on the activity of RAW264.7 macrophages against heat stress. To this end, we assessed cell survival, phagocytic activity, in-tracellular Ca2+ level, mitochondria potential exchange, apoptotic assay findings, galactosidase activity and the RNA-seq by NGS and real-time polymerase chain reaction (PCR) expression. In our evaluation of macrophage morphology at 37°C and 41°C, the macrophages showed an oval shape at 41°C , unlike the spindle shape at 37°C. Therefore, 41°C was chosen as the heat stress condition. Subsequently, we designed an experiment to evaluate changes in the RAW264.7 macrophages after acetyl-xylogalactan treatment under heat stress. The survival of RAW264.7 macrophages treated with acetyl-xylogalactan was higher than that of controls that were not treated with acetyl-xylogalactan. Moreover, on the basis of the results of the annexin-V detection assay, the apoptotic activity of macrophages appeared to have reduced after treatment with ac-etyl-xylogalactan. Moreover, treatment with acetyl-xylogalactan resulted in a stronger recovery trend in the intracellular Ca2+ and mitochondrial membrane potential after heat stress. RNA sequencing and real-time polymerase chain reaction (PCR) illustrated that Sarcodia suieae acetyl-xylogalactan could upregulate the expression of the anti-apoptosis Cflar gene and down-regulate the expression of the apoptosis factors Ddit3, and Hyou1 to protect macrophages under heat stress.

Objective On the eve of the summer Olympic Games in Tokyo research focus has shifted on the core temperature responses of elite athletes competing in the heat. In the absence of the field data of core temperature during Olympic sailing competition aim of the present study was to identify core temperature response during the Tokyo 2020 Olympic Test Event. Methods Four elite athletes from Olympic sailing (177.5±5.2 cm, 71.1±7.4 kg, body mass index 22.5±1.4 kg/m2, 24.8±3.7 yrs, VO2max 50.6±7.2 mL/min/kg)): 2 males and 2 females participated in the study. Core temperature was recorded using e-Celsius ingestible capsules, heart rate using a heart rate monitor. Ambient conditions in direct sunlight were measured using portable meteo station. Results Core temperature was recorded at water environment via an ingestible capsule in 4 sailors during the training (T), and competition (C), respectively. Ambient conditions in direct sunlight were hot and humid: during training temperature were 30.9°C±1.7°C and relative humidity 81.4%±2.8%, corresponding to a wet-bulb globe temperature of 41°C±4°C and during competition temperature was 31.2°C±2.3°C and relative humidity 87.2%±4.4%, corresponding to a wet-bulb globe temperature of 45.2°C±8.9°C. Core temperature increased during training reaching higher peak values (38.6°C±0.4°C) and during competition (38.9°C±0.4°C). The highest temperature recorded was 39.4°C (C). Conclusion The current study provides unique information into the core temperature parameters under heat stress in elite Olympic sailors during training and race event.

The objective of this study was to evaluate biomarkers of heat stress (HS) from automatic milking system (AMS), the relationships between measurements of temperature-humidity index (THI) and reticulorumen ph and temperature and some automatic milking systems parameters in dairy cows (rumination time (RT), milk traits, body weight (BW) and consumption of concentrate (CC)) during summer period. The experiment was carried out on a dairy farm at 54.9587408, 23.784146. Lithuanian Black and White dairy cows (n=365) were selected. The cows were milked with Lely Astronaut® A3 milking robots with free traffic. The rations were calculated to meet physiological requirements of the animals. Daily milk yield, rumination time, body weight, milk fat and protein ratio were collected from the Lely T4C management program for analysis. The pH and temperature of the contents of cow reticulorumen were measured using specific smaX-tec boluses manufactured for animal care. The daily humidity and air temperature in the farm zone were obtained from the adjacent weather station (2 km away). According this study during HS, the higher THI had positive correlation with ML, which show tendencies to increase risk of mastitis, and decrease CC, RT, BW, MY, reticulorumen ph and F/P. Some biomarkers of HS can be milk yield, milk lactose, somatic cell count, concentrate conception, rumination time, body weight, reticulorumen ph and milk fat – protein ratio. We can recommend to monitoring these parameters in the herd management program to identify possibility of heat stress.

Alzheimer’s disease is a prominent neurological disorder, which leads to progressive dementia. The microtubule-associated protein Tau is been considered as one of the major causes of Alzheimer’s disease. Physiologically Tau assists in the stabilization of microtubules, contrary to this the pathological state of Tau results in the formation of neurotoxic tangles of Tau. The posttranslational modifications, such as GSK-3β-mediated Tau phosphorylation results in the generation of Tau pathology. Neuroinflammation generated in Alzheimer’s disease, contributes to elevated body temperature. The aim of present work is to study the effect of high temperature on Tau phosphorylation. The neuroblastoma cells were exposed to heat stress for 40 minutes. The immunofluorescence and western blot studies suggested that high temperature increases the levels of GSK-3β in cells. Heat stressed cells was also observed to have elevated levels of phosphorylated Tau. Additionally, heat stressed cells found to have modulated nuclear transport as the level of Ran was reduced. The results of present work suggested that increased temperature could be considered as a risk factor in Alzheimer’s disease as it elevated the GSK-3β levels in cells thus, resulting in increased Tau phosphorylation.

Energy system optimization models (ESOM) are widely used to inform about energy transition strategies. The heterogeneity of consumers, especially in the heat sector, is rarely considered in these model types. Integrating consumer heterogeneity and behavioral factors into ESOMs may generate new insights for energy policy. In this study a literature review was conducted, identifying empirical data on consumer behavior for adopting residential heating systems. This data was integrated into an ESOM for the German heat sector, combining established methods for integrating consumer heterogeneity and a novel approach for calculating indirect costs, representing behavioral factors. The incorporation of consumer choice leads to a higher diversity in technology market shares in a business as usual and an ambitious measures scenario. Especially, the future role of log wood technologies in the private household sector may have been underestimated in previous studies and should be discussed, when designing policies. Still, these findings need to be handled with care, since the empirical data basis and the methodological basis is limited.

Chronic heat stress (HS), aggravated by global warming, reduces the production efficiency of the buffalo dairy industry. Here, we conducted a proteomic analysis to investigate the adaptation strategies used by buffalo in response to heat stress. Seventeen differentially abundant proteins with known functions were detected using label-free quantification (LFQ), and five of these differentially expressed proteins were validated with parallel reaction monitoring (PRM). These five proteins were associated with various aspects of heat stress, including decreased heat production, increased blood oxygen delivery, and enhanced natural disease resistance. Lipase (LPL), glutathione peroxidase 3 (GPX3), cathelicidin-2 (CATHL2, LL-37), ceruloplasmin (CP), and hemoglobin subunit alpha 1 (HBA1) were shown to play cooperative roles in the tolerance of chronic HS in dairy buffalo. We found that high levels of HBA1 increased blood oxygen transport capacity. Our results increase our understanding of the adaptation of dairy buffalo to chronic heat stress.

We apply the stochastic thermodynamics formalism to describe the dynamics of systems of complex Langevin and Fokker-Planck equations. We provide in particular a simple and general recipe to calculate thermodynamical currents, dissipated and propagating heat for networks of nonlinear oscillators. By using the Hodge decomposition of thermodynamical forces and fluxes, we derive a formula for entropy production that generalises the notion of non-potential forces and makes transparent the breaking of detailed balance and of time reversal symmetry for states arbitrarily far from equilibrium. Our formalism is then applied to describe the off-equilibrium thermodynamics of a few examples, notably a continuum ferromagnet, a network of classical spin-oscillators and the Frenkel-Kontorova model of nano friction.

The future power equipment tends to take hydrogen or middle/low heat-value syngas as fuel for low emission. The heat transfer of film cooled turbine blade shall be influenced more by radiation. Its characteristic of conjugate heat transfer is studied experimentally and numerically in the paper by considering radiation heat transfer, multi-composition gas and TBC. The Weighted Sum of Gray Gases spectral model and Discrete Transfer Model are utilized to solve the radiative heat transfer in the multi-composition field, while validated against the experimental data for the studied cases. It is shown that the plate temperature increases significantly when considering the radiation and the temperature gradient of the film cooled plate becomes larger. It is also shown that increasing percentage of steam in gas composition results in increased temperature on the film-cooled plate. The normalized temperature of the film-cooled plate decreases about 0.02, as the total percentage of steam in hot gas increases per 7%. As for the TBC effect, it can smooth out the the temperature distribution and insulate the heat to a greater extent when the radiative heat transfer becomes significant.

ASTM A743 CA6NM alloy is a martensitic stainless steel typically used in energy industry -runners and hydraulic turbine components- due to its superior toughness, yield and fatigue properties. In both the manufacturing, shielded metal arc welding is applied to join for this grade steels. However, weldability of the steels is limited due to formation of hard and brittle phases such as untempered martensite during welding and post weld heat treatment processes. The formation causes a reduction in toughness. In this study, influence of post-weld heat treatment procedure (single tempering and double tempering) and parameters on microstructure and hardness of AWS410NiMo all weld metal. Hardness tests were conducted from weld metal. Microstructures of the all weld metals subjected to different heat treatment process were characterized.

The color changes corresponding to chromophore structures in lignin caused by exposure of Eucalyptus（Eucalyptus grandis and E. urophylla）to heat were investigated. Eucalyptus wood samples were heated in saturated steam atmospheres for 10 h at 110℃, 130℃, and 150℃. The lignin was isolated before and after heat treatment. The physicochemical properties of the lignin and changes in chromophore structures during heat treatment was evaluated through wet chemical analysis, FTIR, UV-Vis, GPC, XPSand 13C-NMR. The color of the wood became darker and redder with the increase in pressure and temperature. Depolymerization and dehydration reactions occurred via demethoxylation with heat treatment in saturated steam at 110℃ or 130℃. Lignin condensed to form insoluble compounds after heat treatment in saturated steam at 150℃. G units increased and S units decreased through demethylation during heat treatment, as revealed by FTIR and 13C-NMR analysis.

This study examines the optimization of ground source heat pump (GSHP) systems and energy piles for sustainable urban development, with a focus on Southeast Asia. GSHPs, which utilize geothermal energy for indoor HVAC needs, offer a sustainable alternative to traditional systems by utilizing consistent subsurface temperatures for heating and cooling. The study highlights the importance of understanding thermal movement within the soil, especially in soft marine clays prevalent in Southeast Asia, to improve GSHP system efficiency. Using a one-dimensional finite-difference model, the study examines the effects of soil thermal conductivity and density on system performance. The results show that GSHP systems, especially when integrated with energy piles, significantly reduce electricity consumption and greenhouse gas emissions, underscoring their potential to mitigate the urban heat island effect in densely populated areas. Despite challenges posed by the region's hot and humid climate, which could affect long-term effectiveness, the study highlights the need for further study, including field experiments and advanced modeling techniques, to optimize GSHP configurations and fully exploit geothermal energy in urban environments. The study's insights into soil thermal dynamics and system design optimization contribute to the advancement of sustainable urban infrastructure development.

Remote sensing technologies are critical for analyzing the escalating impacts of global climate change and increasing urbanization, providing vital insights into land surface temperature (LST), land use and cover (LULC) changes, and the identification of urban heat island (UHI) and surface urban heat island (SUHI) phenomena. This research focuses on the nexus between LULC alterations and variations in LST and air temperature (Tair), with a specific emphasis on the intensified SUHI effect in Kharkiv, Ukraine. Employing an integrated approach, the study analyzes time-series data from Landsat and MODIS satellites, alongside Tair climate records, utilizing machine learning techniques and linear regression analysis. Key findings indicate a statistically significant upward trend in Tair and LST during summer months from 1984 to 2023, with a notable positive correlation between Tair and LST across both datasets. MODIS data exhibit a stronger correlation R² = 0.879, compared to Landsat R² = 0.663. The application of supervised classification through Random Forest algorithms and vegetation indices on LULC data reveals significant alterations, manifested as a 70.3% increase in urban land, concurrently with a decrement in vegetative cover, especially 15.5% reduction in dense vegetation and a 62.9% decrease in sparse vegetation. Change detection analysis elucidates a 24.6% conversion of sparse vegetation into urban land, underscoring a pronounced trajectory towards urbanization. Temporal and seasonal LST variations across different LULC classes were analyzed using kernel density estimation (KDE) and boxplot analysis. Urban areas and sparse vegetation had the smallest average LST fluctuations, at 2.09°C and 2.16°C, respectively, but recorded the most extreme LST values. Water and dense vegetation classes exhibited slightly larger fluctuations of 2.30°C and 2.24°C, with the bare land class showing the highest fluctuation 2.46°C, but fewer extremes. Quantitative analysis with the application of Kolmogorov-Smirnov tests across various LULC classes substantiated the normality of LST distributions p > 0.05 for both monthly and annual data sets. Conversely, the Shapiro-Wilk test validated the normal distribution hypothesis exclusively for monthly data, indicating deviations from normality in the annual data. Thresholded LST classifies urban and bare lands as warmest classes with 39.51°C, 38.20°C and water by 35.96°C and dense vegetation 35.52°C, sparse vegetation 37.71°C as coldest, a trend consistent annually and monthly. The analysis of SUHI effects demonstrates an increasing trend in UHI intensity, with statistical trends indicating a growth in average SUHI values over time. This comprehensive study underscores the critical role of remote sensing in understanding and addressing the impacts of climate change and urbanization on local and global climates, emphasizing the need for sustainable urban planning and green infrastructure to mitigate UHI effects.

Despite the remarkable success of Carnot’s heat engine cycle in founding the discipline of thermodynamics two centuries ago, false viewpoints of his use of the caloric theory in the cycle still linger, limiting his legacy. An action revision of the Carnot cycle can correct this, showing that the heat flow powering external mechanical work is compensated internally with configurational changes in the thermodynamic or Gibbs potential of the working fluid, differing in each stage of the cycle quantified by Carnot as caloric. Action (@) is a property of state having the same physical dimensions as angular momentum (mrv=mr2ω). However, this property is scalar rather than vectorial, including a dimensionless phase angle (@=mr2ωδφ). We have recently confirmed with atmospheric gases that their entropy is a logarithmic function of the relative vibrational, rotational and translational action ratios with Planck’s quantum of action ħ. The Carnot principle shows that the maximum rate of work (puissance motrice) possible from the reversible cycle is controlled by the difference in temperature of the hot source and the cold sink, the colder the better. This temperature difference between the source and the sink also controls the isothermal variations of the Gibbs potential of the working fluid, that Carnot identified as reversible temperature-dependent but unequal exchanges in caloric. Importantly, the engine’s inertia ensures that heat from work performed adiabatically in the expansion phase is all restored to the working fluid during the adiabatic recompression, less the net work performed. This allows both the energy and the thermodynamic potential to return to the same values at the beginning of each cycle, a point strongly emphasized by Carnot. Our action revision equates Carnot’s calorique, or the non-sensible heat later described by Clausius as ‘work-heat’ exclusively to negative Gibbs energy (-G) or quantum field energy. This action field complements the sensible energy or vis-viva heat as molecular kinetic motion and its recognition should have significance for designing more efficient heat engines or better understanding of the heat engine powering the Earth’s climates.

The inhibition of heat shock protein 90 (Hsp90) a molecular chaperone for multiple oncogenic client proteins is considered as a promising approach to overcome radioresistance. Since most Hsp90 inhibitors activate HSF-1 that induces the transcription of cytoprotective and tumor-promoting stress proteins such as Hsp70 and Hsp27, a combined approach consisting of HSF-1 knockdown (k.d.) and Hsp90 inhibition was investigated. A specific HSF-1 k.d. was achieved in H1339 lung cancer cells using RNAi-Ready pSIRENRetroQ vectors with puromycin resistance. The Hsp90 inhibitor NVP-AUY922 was evaluated at low concentrations - ranging from 1-10nM - in control and HSF-1 k.d. cells. Protein expression (i.e., Hsp27/Hsp70, HSF-1, pHSF-1) and transcriptional activity was assessed by Western blot analysis and luciferase assays and radiosensitivity was measured by proliferation, apoptosis (Annexin V, active caspase 3), clonogenic cell survival, alkaline comet, γH2AX, 53BP1 and Rad51 foci assays. The k.d. of HSF-1 resulted in a significant reduction of basal and NVP-AUY922-induced Hsp70/Hsp27 expression levels. A combined approach consisting of HSF-1 k.d. and low concentrations of the Hsp90 inhibitor NVP-AUY922 potentiates radiosensitization which involves an impaired homologous recombination mediated by Rad51. Our findings are key for clinical applications of Hsp90 inhibitors with respect to adverse hepatotoxic effects.

Background: Cancer therapies predispose survivors to a high symptom burden. This study utilized mobile health (mHealth) technology to assess the feasibility of collecting daily symptoms from adult survivors of childhood cancer and evaluate symptom fluctuation and associations with future health-related quality-of-life (HRQOL). Methods: A prospective study using an mHealth platform to distribute a 20-item cancer-related symptom survey (5 consecutive days each month) and an HRQOL survey (the day after symptom survey) over 3 consecutive months to participants from the Childhood Cancer Survivor Study. PROMIS-29 Profile and Neuro-QOL assessed HRQOL. Daily symptom burden was calculated by summing the severity (mild, moderate, or severe) of 20 symptoms. Univariate linear mixed-effects models analyzed total, person-to-person, day-to-day, and month-to-month variability for the burden of 20 individual symptoms. Multivariable linear regression analyzed the association between daily symptom burden in the first month and HRQOL in the third month, adjusting covariates. Results: Out of the 60 survivors invited, 41 participated in this study (68% enrollment rate); 83% reported their symptoms ≥3 times and 95% reported HRQOL, both in each week across 3 months. Variability of daily symptom burden differed from person-to-person (74%), day-to-day (18%), and month-to-month (8%). Higher first-month symptom burden was associated with poorer HRQOL related to anxiety (regression coefficient: 6.56; 95%CI: 4.10-9.02), depression (6.32; 95%CI: 3.18-9.47), fatigue (7.93; 95%CI: 5.11-10.80), sleep (6.07; 95%CI: 3.43-8.70), pain (5.16; 95%CI: 2.11-8.22), and cognitive function (-6.89; 95%CI: -10.00 to -3.79) in the third month. Conclusion: Daily assessment reveals fluctuations in symptomology, and higher symptom burden was associated with poorer HRQOL in the future. Utilizing mHealth technology for daily symptom assessment improves our understanding of symptom dynamics and sources of variability.

This study investigated the relationship between fundamental movement skills (FMSs) and health-related fitness (HRF) among first and second graders in South Korean elementary schools. It aimed to provide foundational data for developing physical education programs tailored to the motor development stages and fitness levels of younger elementary school students. In October 2023, FMSs (jumping, running, hopping, static balance, dynamic balance, overhand throwing, and kicking) and HRF (muscular strength, cardiorespiratory endurance, and flexibility) were evaluated among 291 first and second graders. The collected data were analyzed through frequency and multiple regression analyses performed using the SPSS software. The results revealed that higher scores in jumping and hopping are associated with greater muscular strength, cardiorespiratory endurance, and flexibility. Running had no significant effect on HRF elements. Higher scores in static balance (single-leg stance) were associated with increased muscular strength, cardiorespiratory endurance, and flexibility, but dynamic balance (balance beam walking) did not have a significant effect. Higher scores in overhand throwing were associated with greater muscular strength and cardiorespiratory endurance, but kicking did not show a significant association. Overall, these findings emphasize the importance of prioritizing jumping and static balance in physical education for the well-rounded health development of first and second graders.

This narrative review provides a thorough examination of medication-related osteonecrosis of the jaw (MRONJ), encompassing its etiology, the role of drug holidays, and contemporary treatment approaches. By systematically analyzing literature from 2022 to 2023, this paper synthesizes the latest findings and trends in MRONJ research. The study emphasizes the importance of a holistic understanding of MRONJ, beginning with its etiological factors, assessing the therapeutic implications of drug holidays, and evaluating the efficacy of current treatment modalities. This review aims to offer clinicians and researchers a consolidated resource, highlighting the intricacies of MRONJ management and proposing directions for future research. Through this comprehensive approach, the paper seeks to advance the understanding and treatment of MRONJ, ensuring an evidence-based, patient-centric approach in clinical practice.

Human resources management (HRM) development aims at career sustainability. Work-related flow, as originated and defined by Csikszentmihalyi, is a process experienced by those optimally challenged by their work, considered the optimal work-related experience. Happiness is a judgment-dependent state of a pleased satisfaction with one’s current experience that one hopes will continue. PERMA (Positive Emotions, Engagement, Relationships, Meaning, and Accomplishment) represents five measurable factors of positive psychology that constitute well-being. As the optimal work-related experience, flow determines career sustainability compared with either happiness or PERMA factors. HRM development programs focused on happiness or PERMA factors thus represents risk factors regarding an inability to develop career sustainability. Established from this publisher’s founding ongoing concern with sustainability, articles published in MDPI journals with the keywords “flow, Csikszentmihalyi, work” were searched, excluding those pertaining to education, health, leisure, marketing, non-workers, and spirituality. Of 628 results returned, 28 reports were included for potential assessment. Although current studies on flow represented only three, the results regarding flow position it as the best indicator of career sustainability, contrasted to either happiness or PERMA. Consequently, HRM is advised to concentrate on developing practices for assessing and encouraging employees’ engagement with work-related flow in its aim of career sustainability.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

Both scleroderma and immunoglobulin G4-related disease (IgG4-RD) are systemic fibro-inflammatory diseases characterised by lymphoplasmacytic infiltrates. IgG4-RD and systemic Sclerosis (SSc) may share common pathophysiological mechanisms, but no examples of co-occurrence of the diseases have been found. Autologous haematopoietic stem cell transplantation (AHSCT) is implemented in selected rapidly progressive SSc with high risk of organ failure. However, existing guidelines are based on clinical trials that do not represent the entire patient population and exclude critically ill patients with no therapeutic alternatives. Examples of AHSCT in IgG4-RD are absent. We report the case of AHSCT in a female patient with overlapping progressive diffuse SSc and sinonasal IgG4-RD. Despite immunosuppressive therapy, IgG4-RD developed and clinically manifested shortly before AHSCT. Lacking therapeutic alternatives, after 11 years of SSc therapy, the 44-year-old successfully underwent AHSCT. The 63-month follow-up showed regression of symptoms. Only after surgical treatment (bilateral ethmoidectomy, sphenoidotomy, intranasal buccal antrostomy) the initially progressive clinical course of IgG4-RD remained indolent.

Appropriate diagnosis, treatment and care contributes to better service engagement, improvements to wellbeing, cost savings, reductions in morbidity and mortality for people with Alcohol Related Brain Damage. In the North-East of England large amounts of alcohol are consumed, reflected in the number of alcohol-related deaths in the region. However, the pathway for people with Alcohol Related Brain Damage to receipt of diagnosis, treatment and care is unknown and could be unwittingly influenced by stigma. Qualitative in-depth semi-structured interviews were completed with 25 health and social care professionals from organisations involved with people with Alcohol Related Brain Damage recruited via snowball-sampling. Interviews were recorded, transcribed verbatim, coded, and analysed. People with Alcohol Related Brain Damage were stigmatised both by society and professionals which inhibited entry into services therefore Alcohol Related Brain Damage remained underdiagnosed and misdiagnosed. There was no dedicated service but silos with revolving doors and underfunded generic care with long waiting lists typically excluding those with alcohol or neurological problems. Professionals need to be challenged on the assumption that Alcohol Related Brain Damage is self-inflicted via training aimed at challenging unconscious bias. Reducing stigmatising processes associated with Alcohol Related Brain Damage could counteract professionals’ reluctance to provide care.

Pathologic angiogenesis is responsible for much of the vision loss that stems from several chorioretinal vascular diseases including neovascular age-related macular degeneration (nAMD), diabetic retinopathy (DR), and retinal vein occlusion (RVO). Because vascular endothelial growth factor (VEGF) serves as a pivotal angiogenic molecule, it has emerged as the primary target for therapeutic drugs. Current anti-VEGF therapy is dominated by bevacizumab, ranibizumab, and aflibercept, all of which have been available for more than a decade, but new drugs, both biosimilars (Byooviz and Cimerli) and drugs whose primary aim is to decrease treatment burden (brolucizumab, faricimab, and the ranibizumab port delivery system), have been approved. Recent failures (conbercept, abicipar, and KSI-301) emphasize the complexity of drug development and the difficulties faced by innovators. Most therapies under development, including tyrosine kinase inhibitors and gene therapy, include VEGF-A blockade as their primary function and aim to extend durability rather than increase peak efficacy. But even as many new drugs look to extend durability, cost containment with mandated use of biosimilars serves to balance the therapeutic landscape.

The ongoing conflict in Syria and Iraq has caused many residents of these countries to flee. This study explored how these refugees cope with traumatic experiences from pre-migration to post-migration phases and how they develop resilience experiences at the individual, familial, and community levels. Data were collected through individual interviews and analyzed using Interpretative Phenomenological Analysis. A discussion of the findings revealed (1) a cumulative effect of prolonged adversity from pre-migration to resettlement phases; (2) the impacts of post-migration context as it facilitates refugees’ adjustment or leads to re-traumatization through increased marginalization; and (3) finally, an overview of refugees’ ongoing survival. Clinical implications are presented along with policy implications and future directions for research.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: One of the most common occupational health hazard and serious health concern, now a days, recognized is Musculoskeletal disorders (MSDs). The high prevalence among students and teachers is a major cause of decline in their health related quality of life and work performance. This study aimed to identify the prevalence of musculoskeletal disorders among teachers and students during online education. Methods: A cross-sectional survey was conducted among university faculty members and students who were involved in online education during COVID-19. Data collection was carried out electronically through a validated Arabic version of the Nordic Musculoskeletal Questionnaire (NMQ) which is self reported. A total of 175 respondents responded to the questionnaire (response 60%). Results: The prevalence of any part of the body was 90.3%. The commonest site of MSDs for past 12 months was the low back (65.7%), the neck (58.3%), and shoulders (57.7%). Females (80%) suffered more than males (20%). The students reported slightly higher MSDs as compared to teachers (93.1% vs 90.3). Binominal regression analysis showed association of females with low back pain “OR: 2.24 (95% CI): 1.04-4.83; p = 0.03” and neck pain “OR: 2.7 (95% CI): 1.24–5.84; p = 0.012)” while bad posture was associated with pain in upper back “OR: 3.46 (95% CI): 1.73-6.93; p = 0.001”. Conclusion: The faculty members and students are prone to high MSDs during online classes and significant measures should be taken to reduce the prevalence by addressing associated risk factors.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Background: Valid questionnaires to assess dogs’ health-related quality of life (HRQoL) in veterinary practice can improve canine health outcomes and communications between veterinarians and dog caretakers. The Canine HRQoL Questionnaire (HRQoL-Q) and the Human-Canine Bond Questionnaire (HCBQ) were developed and validated to fulfill this need. Methods: A literature review, interviews with veterinarians, and focus groups with caretakers were conducted to generate questionnaire items to develop draft questionnaires, piloted with caretakers to establish content validity. Measurement properties were evaluated using data from a prospective survey study (N = 327). Results: Draft Canine HRQoL-Q and HCBQ measures were developed, including a domain structure, items, recall period, and scale/response options. Refinements were made via iterative cognitive interviews with caretakers. When no additional revisions were indicated and content validity established, the questionnaires were psychometrically tested. Ceiling effects were observed for all items, and factor analyses indicated that pre-specified domains are appropriate. Internal consistency was demonstrated for the HCBQ (α = 0.79–0.86) and all but the canine HRQoL-Q social functioning domain (α = 0.60)). Test-retest reliability for the canine HRQoL-Q was generally moderate-to-good (intraclass correlation coefficients [ICCs] > 0.79). Test-retest reliability for the HCBQ was moderate (ICCs: 0.70–0.79), except the trust domain (ICC: 0.58). Known-groups validity was demonstrated by significant differences (p < 0.05) in scores by health/bonding groups. Convergent validity was supported (r > 0.40) between all domains and the total score for both questionnaires. Conclusions: The Canine HRQoL-Q and the HCBQ are valid, reliable measures of canine HRQoL for use in veterinary clinics and appear to measure related but distinct concepts that contribute to canine health and wellness.

For earthquakes (M4.0) occurring along and arond the East Anatolian fault zone and the the Dead Sea fault zone between January 2002 and December 2022, we analyzed the correlation between the Earth's rotation and the earthquake occurrence before the Mw7.8 Gaziantep,Turkey earthquake occurring on 6 February 2023. We statistically evaluate the Earth's rotationally dependent seismicity. The results were judged by the P-value. There was a clear downward trend in the P-values from early 2020 to late 2022 in the study region. Starting in early 2021, the P-value drops below 0.1%, corresponding significant correlation between the Earth's rotation and the earthquake occurrence . We also calculated the spatial distribution of the P-values and obtained a result showing a low P-value area in the vicinity of the northeastern end of the aftershock zone. Although the stress caused by the Earth's rotation is very weak, when the focal medium is loaded to the critical state to release a large earthquake, the stress due to the Earth's rotation could control the earthauqke occurrence. Therefore, the lower P-values obtained in this study indicates the Earth's rotation-related seismicity prior to the Mw 7.8 Turkey earthquake and could be considered as its precursor.

Background: Cancer-related cognitive impairment (CRCI) is one of the most serious side effects of cancer that negatively impact the quality of life of cancer patients and survivors. There is evidence of CRCI in Hodgkin lymphoma patients (HL); however, there is a lack of studies examining the presence of cognitive deficits before starting any treatment in HL patients. Methods: Forty patients (N=40) newly diagnosed with HL (with no previous cancer diagnoses) and 40 healthy controls (N=40) matched for age, sex, education, and premorbid intellect completed the neuropsychological battery and subjective and objective measures of affective distress and quality of life. Results: The results showed impairment in three out of six cognitive domains: verbal memory and learning, speed of processing/ psychomotor speed, and abstraction/executive functions in the HL patients before the initiation of any treatment. Speed of processing/psychomotor speed domain negatively correlated with depression. Conclusion: Impairment in verbal memory and learning and abstraction/executive functions domains in HL patients seems to occur before the initiation of treatment independently of anxiety, depression, or physical symptoms. This suggests that HL itself may cause cognitive deficits in these cognitive domains. However, the underlying causes of CRCI still remain unclear.

Some studies show that patients with mutations in the SNCA gene, which codifies for the alpha-synuclein protein, show a particular phenotype. The effects of SNCA Single Nucleotide Polymorphism (SNPs) in recently diagnosed, drug-naïve patients with PD have been less explored. Therefore, we set out to explore the differences in the clinical characteristics of recently diagnosed drug-naïve sporadic PD patients with or without SNCA rs3910105 or rs356181 SNPs. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data, dementia, psychiatric conditions, a diagnosis change over the first five years from the initial PD diagnosis, or with a familial history of PD. Subjects were evaluated with the MDS-Unified PD Rating Scale (MDS-UPDRS), DAT imaging, the Geriatric Depression Scale (GDS), the State-Trait Anxiety Inventory (STAI), the Montreal Cognitive Assessment (MoCA), the SCOPA-AUT for autonomic function, the Epworth Sleepiness Scale (ESS), the RBD Questionnaire, and the University of Pennsylvania Smell Identification Test (UPSIT). We included 308 PD patients fulfilling all inclusion and exclusion criteria. A logistic regression analysis and Machine-Learning models did not disclose any difference between patients either with or without the SNCA rs3910105 SNP or with or without the SNCA rs3910105 polymorphism. Our results suggest that the SNCA polymorphisms rs3910105 and rs356181 have no impact on the phenotype of idiopathic, sporadic, recently diagnosed, drug naïve PD patients.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

The quality of life (QOL) is an important indicator of human satisfaction and wellbeing. QOL is significantly and persistently affected for patients after a cancer diagnosis. Despite some evidence suggesting that psycho-oncologic interventions can provide lasting benefits, the inclusion of such interventions in cancer therapy is not universal. This article overviews known approaches to the evaluation of QOL in cancer patients and various interventions for improving patients’ outcomes with a focus on the Eastern European regional and specific Romanian context. With a mortality rate above and cancer care performance below the EU average and unequally distributed, Roma-nia urgently needs a national coordination program which is discussed in our review highlighting the main psychological tools needed for the assessment and its challenges towards implementing the program. In the end, we suggest some directions for future development of the psycho-oncologic approach in the context of social, policy and unexpected financial challenges the nation provides

OCTA is an imaging modality used in the assessment of the retinal vasculature. It operates on the principle of coherence tomography used in standard OCT with the addition of delineating the retinal vascular. This provides a modern non-invasive retinal vascular imaging method compared to conventional dye-based imaging. High quality depth resolution of the superficial and deep capillary networks is possible on OCTA whereas this was not possible prior. OCTA may be limited by image quality degradation from factors such as motion artefact or media opacities, and therefore may not be the investigation of choice for all patient groups. There are multiple potential clinical applications for OCTA in retinal and choroidal vascular disease. Ongoing research is necessary to substantiate the more widespread use of OCTA due to its significant cost burden compared to current modalities.

Abuse of amphetamine-related drugs (ARDs) causes traffic accidents, violence, and overdose. In forensic toxicology, analysis for ARDs in biological samples can help identify those driving or performing other tasks under the influence of drugs, clarify the cause of death, and identify recent drug users. In this study, we validated a pseudo-isocratic UPLC-qTOF-MS method following mixed mode cation exchange (MMSPE) extraction for analysis of ARDs in blood. The procedure requires 250 μL of blood to achieve a limit of quantification (LOQ) and detection (LOD) of 20 ng/mL for all analytes. In aged animal blood samples, extraction recoveries of 63-90% and matrix effects of 9-21% were observed. Precision and accuracy for all analytes were within 20% and 89–118%, respectively. The analytical method was developed and validated in accordance with the Scientific Working Group for Forensic Toxicology (SWGTOX) Standard. It has acceptable accuracy and precision for use in doping control and forensic toxicology.

Overweight and obesity adversely affect health-related quality of life (HRQOL) through day-to-day impairments of both mental and physical functioning. It is assumed that polyphenols within the Mediterranean diet may contribute to improve HRQOL. This investigation aimed at studying the effects of a polyphenol-rich ingredient on HRQOL in overweight and obese but otherwise healthy individuals. A randomized, double-blind, placebo-controlled study including 72 volunteers was conducted. Subjects were randomly assigned to receive for a 16-week period either 900 mg/day of the supplement or a placebo. Dietary recommendations were individually determined, and intakes were recorded; daily physical mobility was monitored. Improvement of HRQOL was set as the primary outcome and assessed at baseline and at the end of the investigation, using the Short-Form 36 (SF-36) Health survey. Body composition was analyzed using dual-energy X-ray absorptiometry (DXA). Physical activity level was calculated using International Physical Activity Questionnaire (IPAQ). After 16 weeks, despite there was no adherence to the Mediterranean Diet Serving Score (MDSS), supplemented individuals experienced significant HRQOL improvement (+5.3%; P=0.001), including enhanced perceived physical (+11.2%; P=0.002) and mental health (+4.1%; P=0.021) components; bodily pain, vitality, and general health, being the greatest contributors. Besides, body fat mass significantly decreased (-1.2 kg; P=0.033), mainly within trunk area (-1.0 kg; P=0.002). Engagement in physical activity significantly increased (+1308 Met-min/week; P=0.050). Hence, chronic supplementation with a nutritional diversity and dose of a Mediterranean diet-inspired polyphenol-rich ingredient resulted in a significant amelioration in both perceived physical and mental health, concomitant with the improvement of body composition, in healthy subjects with excessive adiposity.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

Temperature differences between the atmosphere and river water allow rivers to be used as a hydrothermal energy source. The river-water heat pump system is a relatively non-invasive renewable energy source; however, effluent discharged from the heat pump can cause downstream temperature changes which may impact sensitive fluvial ecosystems. In this study, the water temperature recovery distance of the effluent was estimated for a river section in the Han River Basin, Korea, using the heat transfer equation and the Environmental Fluid Dynamic Code (EFDC) model. Results showed that, compared to the EFDC model, the heat transfer equation tended to overestimate the water temperature recovery distance due to its simplified assumptions. The water temperature recovery distance could also be used as an objective indicator to decide the reuse of downstream river water. Furthermore, as the river system was found to support an endangered fish species that is sensitive to water environment changes, care should be taken to exclude the habitats of protected species affected by water temperatures within water temperature recovery distance.

Greenhouse gas (GHG) emission-induced climate change, particularly occurring since the mid-20th century has been considerably affecting short-term weather conditions, such as increasing weather variability, and incidence of extreme weather-related events. Milk production is sensitive to such changes. In this study, we use spatial panel econometric models, Spatial Error Model (SEM) and Spatial Durbin Model (SDM), with a panel dataset at the state-level varying over seasons, to estimate the relationship between weather indicators and milk productivity, in an effort to reduce the bias of omitted climatic variables that can be time-varying and spatially correlated and cannot be directly captured by conventional panel data models. We find an inverse U-shaped effect of summer heat stress on milk production per cow (MPC), indicating that milk production reacts positively to a low-level increase in summer heat stress, and then MPC declines as heat stress continues increasing beyond a threshold value of 72. Additionally, fall precipitation exhibits an inverse U-shaped effect on MPC, showing that milk yield increases at a decreasing rate until fall precipitation rises to 14 inches and then over that threshold milk yield declines at an increasing rate. We also find that, relative to conventional panel data models, spatial panel econometric models could improve prediction performance by leading to smaller in-sample and out-sample root mean squared errors. Our study contributes to the literature by exploring the feasibility of promising spatial panel models and resulting in estimating weather influences on milk productivity with high model predicting performance.

This paper presents a comparative study of heat transfer performance of lattice structured heat sinks. 20 different unit cells were chosen and heat sinks were modelled in nTop with constant unit cell size. Al 6061 alloy was chosen for analysis due to its good thermal conductivity, low weight, low cost, and high strength. Steady state thermal analysis was performed using ANSYS with constant input parameters for all samples. Heat flux and temperature distribution within the heat sinks were analysed. The study aims to provide a comprehensive understanding of the thermal performance of lattice heat sink designs.

In the paper the new, fractional order, state space model of a heat transfer in a one- 1 dimensional metallic rod is addressed. The fractional orders of derivative along space and time 2 are not exactly known and they are described by intervals. The proposed model is the interval 3 expanding of the state space fractional model of the one dimensional heat transfer. It is expected to 4 better describe the reality because interval order of each real process is hard to estimate. Elementary 5 properties of the proposed model are analysed. Theoretical results are experimentally validated using 6 data from real experimental laboratory system.

This research paper aims to evaluate and model the performance of rice husk gasifier cook stoves for household energy use, a byproduct of rice milling. The study aims to address environmental issues and promote the use of rice husk as a renewable energy source and pest repellent in stoves. The study compared insulated and non-insulated gasifier stoves using rice husk gasification. The study compared the start-up time of insulated and non-insulated gasifier stoves, where the insulated stove showed a lower start-up time, but there was no significant difference at a 5% probability level. The temperature change also was not significant, as heat transfer and temperature change started when the husk was ignited. The burner stoves had different size and volume. The maximum operated or flame temperature was 1,190.30oC at room or minimum temperature of 27.33 oC, whereas the average temperature was 758.916oC for the non-insulated type of gasifier stove. The insulated gasifier stove also observed maximum and average temperatures of 518.30 oC and 289.014oC respectively at the same room temperature. The operating time of stoves directly influences the fuel consumption rate, specific gasification rate, and combustion zone rate of stoves. The fuel consumption rate has a significant effect on the type of gasifier stove, with the maximum rates being 3.820 and 2.099 kg/hr. The time to consume rice husks to gasify them depends on the density of the rice husk, reactor volume, and fuel consumption rate. The average specific gasification rate for insulated and non-insulated stoves is 106.45 and 120.63 kg/m2h, respectively. The fuel or rice husk holding capacity of each type of stove is significant at a 5% level, with the amount of rice husk and biochar produced being 1.18kg and 0.27kg for insulated stoves, and 2.511kg and 0.688kg for non-insulated stoves, respectively. The performance of gasifier stoves varies based on the bio char conversion rate, with non-insulated stoves producing a higher bio char mass per rice husk. Multiple regression analysis was used to model the relationship between time elapse with temperature and heat energy. The Squirrel-2020 data logger was used to measure the temperature produced by burning rice husks in the reactor of the stove as well as related generated and losses of heat. A relationship between the heat energy produced and the operating time of gasifier stoves was conducted to estimate the model. The cubic polynomial model was found to be the best predictive model fit for all variables of this study.

The gastrointestinal tract has a pivotal role in nutrient absorption, immune function, and overall homeostasis. The ileum segment of the small intestine plays respective roles in nutrient breakdown and absorption. The purpose of this study was to investigate the impact of heat-induced oxidative stress and the potential mitigating effects of an astaxanthin antioxidant treatment on the ileum of broilers. By comparing the growth performance and gene expression profiles among three groups- thermal neutral, heat stress and heat stress with astaxanthin, under two temperature conditions of 21-22°C and 32-35°C, this research aims to elucidate the role of astaxanthin in supporting homeostasis and cellular protection in the ileum. Results showed both treatments under heat stress experienced reduced growth performance, while the group treated with astaxanthin showed a slightly lesser decline. Results further showed the astaxanthin treatment group significantly upregulated in the cytoprotective gene expression for HSF2, SOD2, GPX3, and TXN, as well as the upregulation of epithelial integrity genes, LOX, CLDN1 and MUC2. In conclusion, our experimental findings demonstrate upregulation of cytoprotective and epithelial integrity genes suggests astaxanthin may effectively enhance the cellular response to heat stress to mitigate oxidative damage, and contribute to cytoprotective capacity.

Driven by mounting environmental apprehensions stemming from the over dependence on fossil fuels in energy and transportation sectors, extensive exploration into alternative energy sources, particularly biomass, has stimulated profound research on harnessing the potential of computational and mathematical techniques. This comprehensive survey delves into optimal models and strategies, unveiling their pivotal role in the design of biomass gasification processes.of hydrogen through biomass gasification. In this study, we aim to provide a comprehensive overview of the computational and mathematical techniques employed in optimizing biomass gasification processes, with a specific focus on enhancing hydrogen yield. Through an extensive literature review, various models and strategies will be examined, including thermodynamic analysis, kinetic modeling, reactor design, and process optimization. By uncovering the power of these techniques, we aim to contribute to the advancement of sustainable and efficient biomass utilization for the hydrogen-based future economy.This paper aims to provide an updated and comprehensive coverage of the investigations conducted on the potential of producing hydrogen from biomass through gasification. To achieve this, we incorporate the latest works that have utilized numerical modeling, simulation, optimization techniques, process heat integration, and co-generation in their studies. By encompassing these aspects, we aim to offer a broader and more in-depth re-appraisal of the subject matter. This will ensure that readers gain a holistic understanding of the advances made in the field and the potential for sustainable hydrogen production of biomass gasification.Through a meticulous re-appraisal and analysis of each subject, we can identify their respective strengths and areas that require further research effort. By thoroughly examining numerical modeling, simulation, optimization techniques, process heat integration, and co-generation, we can assess their effectiveness and applicability in the context of biomass gasification for hydrogen production. This analysis shed light on the areas where these techniques excel, as well as pinpoint limitations or gaps in current understanding. By identifying these areas, we can highlight the need for further research and development, enabling us to make significant advancements in biomass gasification processes and pave the way for a sustainable and efficient hydrogen-based future economy..

The study aimed to determine the effect of heat stress (HS) on reproductive parameters [calving to first service (CTFS) and first service conception rate (FSCR)] and general physiological responses [rectal temperature (RT) and respiratory rate (RR)] in tropical Holstein Friesian dairy cows raised in Ratchaburi province, Thailand. Cows were divided into a moderate HS (n = 22) and a mild HS (n = 22) group. Cycling cows were detected and injected with PGF2α at the beginning of the experimental period. Reproductive and physiological parameters were recorded. The average temperature humidity indices experienced by the cows were 80.67 ± 0.79 and 77.81 ± 1.09 for the moderate and mild HS groups, respectively. Cows showed significantly lower RT and RR in the mild (38.47 ± 0.21°C and 41.04 ± 4.55 bpm, respectively) than in the moderate HS group (38.87 ± 0.15°C and 51.17 ± 10.52 bpm). Under mild HS, cows showed a better response to injection of PGF2α than those under moderate HS. The percentage of cows that ovulated after being induced by PGF2α and showed estrus signs was higher in the mild than the moderate HS groups (54.55% versus 18.18%). Furthermore, the FSCR of cows under mild HS tended to be higher than in the moderate HS group (54.55 % and 42.11%, respectively), while the average CTFS interval was significantly shorter under mild than moderate HS (69.47 ± 18.18 and 84.60 ± 27.68, respectively). These results indicate that HS impairs reproductive performance in cross-bred Holstein cows, especially in moderate HS conditions.

A novel concept of a finned piston system is presented and analyzed where the compression heat is continuously extracted from the compression chamber. The resulting compression characteristic moves in direction of an isothermal process, reducing so the temperature of the compressed fluid in the compression chamber and reducing the necessary mechanical work for the process. The finned piston concept consists in an integrated heat exchanger inside of the chamber and being constituated of imbricated flat fins placed on the stator part and on the mobile piston. The internal heat exchange surface is strongly increased in comparison with a classical piston/cylinder. The energetic performance of the new system is evaluated with the help of simulation. Pressures, forces and temperature of the compressed gas are simulated as well as the mechanical work needed. The different curves are compared with adiabatic and isothermal characteristics.

CoCrFeNiMn high-entropy alloy coatings were prepared on compacted graphite iron（CGI） through plasma cladding to strength the CGI substrate. The effects of heat treatment temperatures and times on the microstructure and mechanical properties of the CoCrFeNiMn coatings were investigated. After heat treatment, a single FCC phase was remained in the coating as compared to the deposited one, with smaller dendrites, larger dendritic spacing and more Cr-rich compounds precipitated between dendrites. The coatings’ microhardness was increased after heat treatment. After heat treated at 660°C for 90 minutes, the coating had the highest microhardness of 563±6.9 HV0.2, the lowest frictional coefficient of 0.71 and the smallest wear mass loss of 1.12 mg, and it had the best wear resistance.

Heat dissipation from Li-ion batteries is a potential safety issue for large-scale energy storage applications. Maintaining low and uniform temperature distribution, and low energy consumption of the battery storage is very important. We studied the fluid dynamics and heat transfer phenomena of a single cell, 16-cell modules, battery packs, and cabinet through computer simulations and experimental measurements. The results show that the temperature distribution of single cell is relatively uniform when the cell is facing the air flow. In a module, very high air flow rate and large gap between the cells can reduce the cell temperature. A pack with a good thermally conductive case is very important to ensure good heat dissipation of the battery module. Due to limited space in the cabinet, additional air inlets and outlets can be opened outside of the cabinet to slightly lower the pack temperature. Installing fins outside the cabinet can also slightly reduce the temperature inside the cabinet. Liquid cooling medium, such as water, is much better than the air-cooling medium.

The plate heat exchanger (PHE) is a component that provides heat to be transferred from hot water to domestic cold water without mixing them with high efficiency. Over the lifetime of the PHE, cyclic pressures act on the brazing points and the plates, and this may lead to fatigue failure. The fatigue behaviour of the PHE, designed by using copper-brazed 316L stainless steel, was investigated in this study. First, the fatigue tests under the load ratio R = 0.1 were performed on the Vibrophore 100 testing machine to obtain the S-N curve of the analysed brazed joint. Based on the obtained experimental results, an appropriate material model of the analysed brazed joint has been created, which was validated with numerical calculation in the framework of a program code Ansys. A validated material model was then used for the subsequent numerical analysis of PHE. In order to carry out a numerical calculation using the finite element method (FEM), a 3D model of the heat exchanger was created based on the previous scanning of PHE-geometry. Thereafter, the geometry was parameterised, which allowed us to perform parametric simulations (monitoring different responses depending on the input geometry). Numerical simulations were carried out in the framework of the Ansys software, whereby the obtained results were analysed, and the responses were appropriately characterised according to previously determined load cases.

Aircraft heat exchangers play a crucial role in maintaining thermal balance and ensuring that essential components operate efficiently and safely. In this context, it is highly relevant to gain knowledge about the deterioration and the predominant damage mechanisms of these components. In this study, two different non-destructive methods are employed to analyze the damage initiation of a heat exchanger part during fatigue test. On the one hand, Acoustic Emission technique is employed using membrane-free microphones capable of capturing a broad bandwidth. The acoustic events were classified by a machine learning algorithm to determine their source and damage mechanisms. On the other side, Digital Image Correlation (DIC) allowed the measurement of the strain evolution along the test and more precisely, redistributions were considered as damage indicators. As a result, it was identified that AE served as early damage indicator as the cumulative number of events was in good agreement with the severity of the damage. With respect to classification two clear clusters ascribed to different type of events were identified. In the case of DIC, strain redistributions gave clear indications of damage or deterioration but at a later stage compared to AE

Molybdenum tailings powder (MTs) is an industrial waste that contains more than 85% contents of SiO2, Al2O3, CaO, and Fe2O3. Therefore, MTs has the potential pozzolanic activity and can be used as a mineral admixture in cementitious materials. In order to understand the influence of MTs as an admixture on the cement hydration process, the hydration heat and hydration kinetics of the composite cementitious materials (CCMs) were investigated by an isothermal calorimeter and the Krstulovic-Dabic model. Furthermore, the influences of fly ash (FA), slag (SL) and MTs on hydration heat at the same content were compared and analyzed. Results show that proper amount of MTs can promote the hydration of CCMs. When the content of MTs is not more than 15%, the second exothermic peak of CCMs appears earlier and the peak heat release increases. However, when the content of MTs exceeds 15%, the second exothermic peak of CCMs is delayed and the peak heat release decreases. The cumulative heat release of CCMs gradually decreases with an increasing content of MTs. When the replacement of MTs, FA, and SL is 15% respectively, the addition of MTs enhances the second exothermic peak of CCMs compared to FA and SL. The final heat release of MTs is higher than that of FA, but lower than that of SL. The hydration process of CCMs undergoes three stages: nucleation and crystal growth (NG), interactions at phase boundaries (I), and diffusion (D). The incorporation of MTs shortens the NG stage and I stage.

This paper investigates the polarization and heat generation characteristics of batteries under different ambient temperatures and discharge rates by means of using a coupled electric-thermal model. The study found that the largest percentage of polarization is ohmic polarization, followed by concentration polarization and electrochemical polarization. The values of the three types of polarization are generally small and stable under normal-temperature environments and low-discharge rates. However, they increase significantly in low-temperature environments and high-discharge rates and continue to rise during the discharge process. Additionally, ohmic heat generation and polarization generation also increase significantly under these conditions. Reversible entropy heat is less sensitive to ambient temperature but increases significantly with the increase of the discharge rate. Ohmic heat generation and polarization heat generation contribute to the total heat generation of the battery at any ambient temperature, while reversible entropy heat only contributes to the total heat generation of the battery at the end of discharge.

The aim of this study was to evaluate the emulsification properties of garlic water-soluble compounds (GWSC) after heat treatment (10 min at 95 °C) or pH adjustments (2.5, 3.5 and 7.8). After the various treatments, the extracts were used as such or filtrated (0.45 µm) and 10% soybean oil-in-water emulsions were prepared using low (0.48%) or high (6.55% wt/wt) extract concentrations. Whereas at low GWSC concentration, both heating or acidifying resulted in the formation of bigger oil droplet sizes (i.e. from d32=0.36 µm using unmodified extract, to d32=7–22 µm µm at pH 2.5 with or without extract filtration), the effects were opposite at the highest GWSC concentration. In the latter, heat treatment clearly reduced the droplet size as observed from the micrographs as well as the degree of creaming, though the occurrence of depletion and/or bridging flocculation was still strong. The acidification of the extract at this high GWSC concentration, significantly reduced the droplet size as observed from the micrographs but a strong flocculation was observed. Removal of protein aggregates, and possibly also saponin micelles from the extract, resulted in an obvious increase in emulsion droplet size. This research brings valuable insights on the study and utilisation of novel natural food emulsifiers from plant sources.

Climate and its fluctuations have wide-ranging impacts on the tourism industry. High temperatures, as a typical meteorological and climatic factor, influence tourists' travel intentions and spatial behavior. This study conducted a descriptive analysis and market trend analysis of Chinese tourism during periods of high temperatures, revealing several key findings. Firstly, tourists seeking respite from summer heat exhibit a preference for short-distance trips and resource-rich destinations. Secondly, heat-escape tourism products undergo changes over time, gradually shifting towards mountainous areas and waterfront locations. Furthermore, taking Shanghai Disneyland as a case study demonstrates that the holiday system holds greater significance than temperature constraints. Despite experiencing a significant decline in the quality of their tourist experience in high-temperature environments, long-distance travelers are not deterred from choosing pre-booked tourism products by sudden bouts of hot weather.

Plasma plays an important role in semiconductor processes. With the recent miniature and integration, the control of plasma became essential for the success in critical dimension of a few nanometers and etch narrow and deep holes with high aspect ratios. Recently, the etching process has reached physical limitations due to a significant increase in wafer surface temperature under the elevated amount of RF power, affecting not only the warpage phenomenon but also etching uniformity and etching profiles. Therefore, the plasma characteristics are identified using invasive single Langmuir probe (SLP) for wafer temperature diagnosis. Optical data is obtained through a non-invasive optical emission spectroscopy (OES) and the plasma parameters are derived to compare and verify with the SLP. Two variables, electron temperature and electron density, are substituted for the heat flux formula to derive the heat flux according to its location. Using a wafer-type temperature sensor, check the derived heat flux values and compare trends. Such studies are expected to be able to calculate heat flux values in real time, anticipate wafer temperatures, and solve existing problems.

Dairy cattle predicted by genomic breeding values to be heat tolerant are known to have less milk production decline and lower core body temperature increases in response to elevated temperatures. In a study conducted at the University of Melbourne’s Dookie Robotic Dairy Farm during summer, we identified the most 20 heat-susceptible and 20 heat-tolerant cows in a herd of 150 Holstein Friesian lactating cows based on their phenotypic responses (changes in respiration rate, surface body temperature, panting score, and milk production). Hair samples were collected from the tip of the cows' tail following standard genotyping protocols. The results indicated variation in feed saved and HT genomic estimated breeding values (GEBVs) (P≤0.05) across age, indicating a potential for their selection. As expected, the thermotolerant group had higher GEBVs for HT and feed saved but lower for milk production. In general, younger cows had superior GEBVs for Balanced Performance Index (BPI), Type Weighted Index (TWI) and Australian Selection Index (ASI), whilst older cows were superior in fertility, feed saved (FS) and HT. The study demonstrated highly significant (P≤ 0.001) negative correlations (-0.28 to -0.74) between HT and GEBVs for current Australian Dairy cattle selection indices (BPI, TWI, ASI, HWI) and significant (P≤ 0.05) positive correlations between HT and GEBVs for traits like FS (0.45) and fertility (0.25). Genomic selection for HT will help improve cow efficiency and sustainability of dairy production under hot summer conditions. However, a more extensive study involving more lactating cows across multiple farms is recommended to confirm the associations between the phenotypic predictors of HT and GEBVs.

Near space environment is the airspace at an altitude of 20 km-100 km, where complex conditions such as low temperature, low pressure, high wind speed and solar radiation exist. As one of the important meteorological parameters, temperature is crucial for space activities, but the influence of the complex environment makes the error of conventional temperature measurement methods large. Therefore, a new microbridge temperature sensor was designed that can reduce solar radiation and achieve a fast response. And through simulation analysis, the three factors influencing the temperature errors of Joule heat, solar radiation heat and aerodynamic heat were investigated. And the influence of temperature error is reduced by optimizing the installation position of the sensor. Through the temperature error model, the error value in the actual measurement value is removed, to realize the high accuracy detection of near-space temperature.

Heat and power cogeneration plants based on fuel cells are interesting systems for energy- conversion at low environmental impact. Different fuel cells have been proposed, but experimental testing rigs are expensive and the development of commercial systems is time consuming if based on fully experimental activities. Furthermore, tight control of operation of fuel cells is compulsory to avoid damage, which must be based on accurate models, able to predict the cell behaviour and prevent stresses and shut-down. Some selected examples of steady state, dynamic and fluid dynamic modelling of different types of fuel cells are proposed, mainly PEMFC and SOFC type. The general ideas behind the thermodynamic, kinetic and transport description are recalled, with some examples of models derived for single cells, stacks and integrated power co-generation units.

Steel is one of the essential materials in the world's civilization. It is essential to produce many products such as pipelines, mechanical elements in machines, vehicles, profiles, and beam sections for buildings in many industries. Until the '50s of the 20th century, steel products required a complex process known as ingot casting; for years, steelmakers focused on developing and simplifying this process. The result was the con-tinuous casting process (CCP); it is the most productive method to produce steel. The CCP allows producing significant volumes of steel sections without interruption and is more productive than the formal ingot casting process. The CCP begins by transferring the liquid steel from the steel-ladle to a tundish. This tundish or vessel distributes the liquid steel, by flowing through its volume, to one or more strands having wa-ter-cooled copper molds. The mold is the primary cooling system, PCS, solidifying a steel shell to withstand a liquid core and its friction forces with the mold wall. Further down the mold, the rolls drive the steel section in the SCS. Here the steel section is cooled, solidifying the remaining liquid core, by sprays placed in every cooling segment all around the billet and along the curved section of the machine. Finally, the steel strand goes towards a horizontal-straight free-spray zone, losing heat by radiation mechanism, where the billet cools down further to total solidification. A moving torch cutting-scissor splits the billet to the desired length at the end of this heat-radiant zone.

Understanding the mechanism for heat tolerance is important for the hot pepper breeding program to develop heat-tolerant cultivars in changing climate. This study was conducted to investigate physiological and biochemical parameters related to heat tolerance and to determine leaf heat damage levels critical for selecting heat-tolerant genotypes. Seedlings of two commercial cultivars, heat-tolerant ‘NW Bigarim’ (NB) and susceptible ‘Chyung Yang’ (CY), were grown in 42 °C for ten days. Photosynthesis, electrolyte conductivity, proline content were measured among seedlings during heat treatment. Photosynthetic rate was significantly reduced in ‘CY’ but not in ‘NB’ seedlings in 42 °C. Stomatal conductivity and transpiration rate was significantly higher in ‘NB’ than ‘CY’. Proline content was also significantly higher in ‘NB’. After heat treatment, leaf heat damages were determined as 0, 25, 50 and 75% and plants with different leaf heat damages were moved to a glasshouse (30–32/22–24 °C in day/night). The growth and developmental parameters were investigated until 70 days. ‘NB’ was significantly affected by leaf heat damages only in fruit yield while ‘CY’ was in fruit set, number and yield. ‘NB’ showed fast recovery after heat stress compared to ‘CY’. These results suggest that constant photosynthetic rate via increased transpiration rate as well as high proline content in heat stress condition confer faster recovery from heat damage of heat-tolerant cultivars in seedlings stages.

Over the last decade, there has been a growing interest in the use of a wide range of phytoadditives to counteract the harmful effects of heat stress in poultry. Willow (Salix spp.) is a tree with a long history. Among various forms, willow bark is an important natural source of salicin, β-O-glucoside of saligenin, but also of polyphenols (flavonoids and condensed tannins) with antioxidant, antimicrobial and anti-inflammatory activity. In light of this, the current review presents some literature data aiming to: (1) describe the relationship between heat stress and oxidative stress in broilers, (2) present or summarize literature data on the chemical composition of Salix species, (3) summarize the mechanisms of action of willow bark in heat-stressed broilers, (4) present different biological effects of the extract of Salix species in different experimental models.

The widely adopted temperature for solid solution heat treatment (ST) for the conventionally fabricated Inconel 718 is 1100 °C for a hold time of 1 h or less. This ST scheme is however not enough to dissolve Laves and annihilate dislocations completely in samples fabricated with Laser metal powder bed fusion (L-PBF) additive manufacturing (AM)-Inconel 718. In spite this, the highest hardness obtained after aging for ST temperatures (970 - 1250 °C) is at 1100 °C/1h [1]. The unreleased residual stresses in the retained lattice defects are potentially affecting other properties of the material. Hence, this work aims to investigate if a longer hold time of ST at 1100 °C will lead to complete recrystallization while maintaining the strength after aging or not. For this study, L-PBF-Inconel 718 samples were ST at 1100 °C at various hold times (1, 3, 6, 9, 16 or 24 h) and aged to study the effects on microstructure and hardness. In addition, a sample was directly aged to study the effects of bypassing ST. The samples (ST and aged) gain hardness by 43 – 49 %, depending on hold time. A high density of annealing twins evolved during 3 h of ST and the quantity only slightly varies for longer ST.

Nanofluids are a novel class of heat transfer fluid that plays a vital role in industries. In mathematical investigations, these fluids are modeled in terms of traditional integer-order partial differential equations (PDEs). It is recognized that traditional PDEs cannot decode the complex behavior of physical flow parameters and memory effects. Therefore, this article intends to study the mixed convection heat transfer in nanofluid over an inclined vertical plate via fractional derivatives approach. The problem in hand is modeled in connection with Atangana-Baleanu fractional derivatives without singular and local kernel having strong memory. The human blood is considered as base fluid dispersing carbon nanotube (CNTs) (single-wall carbon nanotubes (SWCNTs) and multi-wall carbon nanotubes(MWCNTs )) into it to form blood-CNTs nanofluid. The nanofluids are considered to flow in a saturated porous medium under the influence of an applied magnetic field. The exact analytical expressions for velocity and temperature profiles are acquired using the Laplace transform technique and plotted in various graphs. The empirical results indicate that the memory effect decreases with increasing fractional parameters in the case of both temperature and velocity profiles. Moreover, the temperature profile is higher for blood-SWCNTs by reason of higher thermal conductivity whereas, this trend is opposite in case of velocity profile due densities difference.

This paper emphasises on the analogous modelling of hardwood (Acacia) pyrolysis. The effect of physical characteristics of hardwood chips on the pyrolysis is examined through the conservation of solid mass fraction of biomass. The chip size of G30 and G50 are used in the pyrolysis reactor. In the analogous situation, the fixed bed is assumed to be a wooden slab with a porosity equivalent to the voidage of bed. The bulk density, the length of the bed and the porosity are some of the physical attributes of a fixed bed used to determine the variation of solid mass of the hardwood across the fixed bed. The four-temperature sensors separated from each other by 80 mm are used to determine the temperature along the length of the pyrolysis unit. The heating element of 2 kWe is used to initiate the pyrolysis of biomass. The experiments are conducted in three different stages. The ONORM standard chips, G30 and G50, and the combination of them are separately pyrolysis to determine the validity of a model for different sizes of chips. The proposed model is also used to establish the relationship between the kinetics of pyrolysis and decomposition of the hardwood.

We report on the development of several different thin-film functional material systems prepared by RF magnetron sputtering at Edith Cowan University nanofabrication labs. We conduct research on the design, prototyping, and practical fabrication of high-performance magneto-optic (MO) materials, oxide based sensor components, and heat regulation coatings for advanced construction and solar windows.

This paper predict and effectively control the temperature distribution of the steady-state and transient states of anisotropic four-layer composite materials online, knowing the density, specific heat, heat conductivity and thickness of the composite materials. Based on the transfer function, a mathematical model was established to study the dynamic characteristics of heat transfer of the composite materials. First of all, the Fourier heat transfer law was used to establish a one-dimensional Fourier heat conduction differential equation for each composite layer, and the Laplace transformation was carried out to obtain the system function. Then the approximate second-order transfer function of the system was obtained by Taylor expansion, and the Laplace inverse transformation was carried out to obtain the transfer function of the whole system in the time domain. Finally, the accuracy of the simplified analytical solutions of the first, second and third order approximate transfer functions was compared with computer simulation. The results showed that the second order approximate transfer functions can describe the dynamic process of heat transfer better than others. The research on the dynamic characteristics of heat transfer in the composite layer and the dynamic model of heat transfer in composite layer proposed in this paper have a reference value for practical engineering application. It can effectively predict the temperature distribution of composite layer material and reduce the cost of experimental measurement of heat transfer performance of materials.

Carbonous nanomaterials are promising additives for composite coatings for heat-dissipation materials because of their excellent thermal conductivity. Here, copper/carbonous nanomaterial composite coatings were prepared using nanodiamond (ND) as the carbonous nanomaterial. The copper/ND composite coatings were electrically deposited onto copper substrates from a continuously stirred copper sulfate coating bath containing NDs. NDs were dispersed by ultrasonic treatment, and the initial bath pH was adjusted by adding sodium hydroxide solution or sulfuric acid solution before electrodeposition. The effects of various coating conditions—the initial ND concentration, initial bath pH, stirring speed, electrical current density, and the amount of electricity—on the ND content of the coatings were investigated. Furthermore, the surface of the NDs was modified by hydrothermal treatment to improve ND incorporation. A higher initial ND concentration and a higher stirring speed increased the ND content of the coatings, whereas a higher initial bath pH and a greater amount of electricity decreased it. The electrical current density showed a minimum ND content at approximately 5 A/dm². Hydrothermal treatment, which introduced carboxyl groups onto the ND surface, improved the ND content of the coatings. A copper/ND composite coating with a maximum of 3.85 mass% ND was obtained.

Regional heat capacity change is calculated from the ratio between the addition or subtraction of heat (ΔQ) with the increase or decrease in temperature (ΔT) region. The purpose of this study is to calculate the regional heat capacity change due to the changes of land cover composition with forest, shrubs, oil palm plantation and bare soil using Landsat-5 TM satellite data on 1994, 2000 and 2010. Total area that used on ​​this study is 12971 ha. In 1994-2000, 4 % of forest area and 2% shrubs were increased, followed by additional of biomass forest 4.01 tons/ha and 2.83 tons/ha for shrubs. The increased of forest area and biomass (tons/ha) caused by forest and shrubs growth processing towards climax that added the canopy volume. So that, the regional heat capacity in 1994 amounted 19384 MJC^o-1 increased to 19929 MJC^o-1 in 2000. Data observation for 2000-2010 showed that forest area decreased by 66% due to forest’s clearing into oil palm plantations (47%), shrubs (8%) and bare soil (11%). But, plant’s biomass continue to increased, i.e 1.48 ton/ha for forest, 2.73 tons/ha for shrubs and 4.63 tons/ha for bare soil. Before 2000, there was no land cover by oil palm plantations, so the increasing rate from this land was the biggest than the three other lands, amounting to 122.29 tons/ha. Decreasing in the percentage of forest area does not cause a decrease in the heat capacity of the region. Intensive maintenance on oil plam plantation such as water management, fertilizer and planting space made it biomass productivity and ability to save the heat is greater than the forest. As the result, in 2010 regional heat capacity increased to 22508 MJC^o-1.

This paper evaluates the potential of solar concentration technologies—compound parabolic collector (CPC), linear Fresnel collector (LFC) and parabolic trough collector (PTC)—as an alternative to conventional sources of energy for industrial processes in Latin America, where high levels of solar radiation and isolated areas without energy supply exist. The analysis is addressed from energy, economic and environmental perspective. A specific application for Argentina in which fourteen locations are analyzed is considered. Results show that solar concentration technologies can be an economically and environmentally viable alternative. Levelized cost of energy (LCOE) ranges between 2.5 and 16.9 c€/kWh/m² and greenhouse gas (GHG) emissions avoided range between 33 and 348 kgCO₂/(m²·year). CPC technology stands out as the most recommendable technology when the working fluid temperature ranges from 373K to 423K. As the working fluid temperature increases the differences between the LCOE values of the CPC and LFC technologies decrease. When 523K is reached LFC technology is the one which presents the lowest LCOE values for all analyzed sites, while the LCOE values of PTC technology are close to CPC technology values. Results show that solar concentration technologies have reached economic and environmental competitiveness levels under certain scenarios, mainly linked to solar resource available, thermal level requirements and solar technology cost.

The urbanization effects on land surface phenology (LSP) have been investigated by many studies, but few studies focused on the temporal variations of urbanization effects on LSP. In this study, we used the MODIS EVI, MODIS LST data and China’s Land Use/Cover Datasets (CLUDs) to investigate the temporal variations of urban heat island intensity and urbanization effects on LSP in Northeast China during 2001–2015. Land surface temperature (LST) and phenology differences between urban and rural areas represented the urban heat island intensity and urbanization effects on LSP, respectively. Mann-kendall nonparametric test and Sen's slope were used to evaluating the trends of urbanization effects on LSP and urban heat island intensity. The results indicated that the average land surface phenology (LSP) during 2001–2015 was characterized by high spatial heterogeneity. The start of the growing season (SOS) in old urban area had become earlier and earlier than rural area and the differences of SOS between urbanized area and the rural area changed greatly during 2001–2015 (−0.79 days/year, p < 0.01). Meanwhile, the length of the growing season (LOS) in urban and adjacent areas had become increasingly longer than rural area especially in urbanized area (0.92 days/year, p < 0.01), but the differences of the end of the growing season (EOS) between urban and adjacent areas did not change significantly. Next, the UHII increased in spring and autumn during the whole study period. Moreover, the correlation analysis indicated that the increasing urban heat island intensity in spring contributed greatly to the increases of urbanization effects on SOS, but the increasing urban heat island intensity in autumn did not lead to the increases of urbanization effects on EOS in Northeast China.

Modelling water vapour flow, heat transfer and porosity in porous adsorbent is somewhat challenging simulation problem. Primary macroscopic water vapour flow models, such as Darcy's law, fail to predict the pressure drop entirely correctly for the reason that many of flow parameters not considered because of the simplifications that remain made for the multi-scale structure of the porous adsorbents. For one to develop a good physical understanding of such water vapour flows and the accuracy of existing 3D simulation models, there is a need for some accurate 3D geometry to be studied. This present work describes two-phase water vapour flow and adsorption/ desorption performed on porous adsorbent by a Dynamic vapour sorption (DVS). The CFD simulation results are associated with experiments results. It is decided that for such complex porous adsorbent CFD simulation problems the use of COMSOL Multiphysics and SolidWorks flow simulation will be utilised.

The paper is focused on researching the behavior of heating companies in connection with current developments in the electricity market and flexibility in the context of market behavior. The work assesses the increase in profitability through the creation of a technical-economic model using an objective function with profit maximization. The paper objective is presented the procedure and methodology for creating a model using the basic scheme of production processes integrated into the system platform. The result of the work is a comparative analysis of modelled cases of implemented operation deployment according to a defined period and modelling modes in selected time series. The description of individual outputs demonstrates the economic advantage of using combinations of modes of combined electricity and heat production, and non-combined electricity and heat production, including the use of the heat suppression mode because of overproduction of electricity.

Pancreatic cancer is a refractory cancer with limited treatment options. Various cancer types are resistant to the tumor necrosis factor-related apoptosis-inducing ligand (TRAIL). Eugenol, the main component of clove oil, exhibits anticancer, anti-inflammatory, and antioxidant effects. However, no studies have reported that eugenol increases TRAIL sensitivity by upregulating death receptor (DR) expression. Here, we aimed to investigate eugenol as a potent TRAIL sensitizer. Increased apoptosis and inhibition of cell proliferation was observed in pancreatic cancer cells treated with eugenol and TRAIL compared with those treated with eugenol alone. Eugenol upregulated the expression of DR5, inhibited FLICE-inhibitory protein (FLIP), an anti-apoptotic protein, and increased p53, a tumor suppressor protein. In addition, eugenol induced the generation of reactive oxygen species (ROS) and caused endoplasmic reticulum (ER) stress. C/EBP-homologous protein (CHOP) knockdown using siRNA decreased the expression of DR5 and reduced the combined effects of eugenol and TRAIL. These results demonstrate that eugenol enhances TRAIL-induced apoptosis by upregulating DR5 through the ROS-mediated ER stress-CHOP pathway, enhancing ER stress by inducing p53 and downregulating FLIP expression. This suggests that eugenol has the potential to treat pancreatic cancer by increasing cell sensitivity to TRAIL.

We analyze a time-delayed SIQR model that considers the transportation-related infections and entry-exit screening. This model aims to determine the measures for preventing and controlling major emergent infectious diseases and the associated costs. We calculate the basic reproduction number (R0), apply the linearization method, and construct an appropriate Lyapunov function to determine the stability of the disease-free equilibrium in the local and global. We collect COVID-19 infection data from two regions in the United States in 2020 for data fitting, obtain a set of optimal parameter values, and show that the model is suitable for simulating the outbreak and spread of emerging infectious diseases. We find that transportation-related infections increase the basic reproduction number, enhancing the impact on disease spread. Entry-exit screening effectively suppress the spread of disease by reducing the basic reproduction number. Furthermore, we investigate the influence of the incubation period on disease and find that a shorter incubation period results in a shorter duration but a larger scale of infection, and the peaks are reduced. We conduct a sensitivity analysis of the R0 and propose three measures to prevent the spread of new infectious diseases based on the most sensitive parameters: wearing masks, implementing urban closures, and administering medication to sick but not yet hospitalized patients promptly. In the case of COVID-19, we use Pontryagin’s minimum principle to get time-varying control measures to control the spread of the outbreak. Optimal control effectively controls the development and deterioration of the disease. Finally, several control measures are compared through cost-effectiveness analysis, and the results show that wearing masks is the most cost-effective measure. Our study provides some practical guidance for controlling the spread of major emerging infectious diseases.

Survival of Medulloblastoma (MB) depends on various factors, including the gene expression profiles of MB tumor tissues. In this study, we identified 967 MB survival related genes (SRBs) using the gene expression dataset of Cavalli et al. (2017) and the Cox proportional hazards regression model. Notably, the SRGs were over-represented on chromosomes 6 and 17, known for the abnormalities monosomy 6 and isochromosome 17 in MB. The most significant SRG was HMGA1 (high mobility group AT-hook 1), which is a known oncogene and a histone H1 competitor. High expression of HMGA1 was associated with worse survival, primarily in the Group 3γ subtype. The high expression of HMGA1 was unrelated to any known somatic copy number alteration. Most SRGs on chromosome 17p were associated with low expression in Group 4β, the MB subtype with 93% deletion of 17p and 98% copy gain of 17q. Pathway analysis showed that both chromosomes 6 and 17 included SRGs related to telomere maintenance and provide a rationale for testing telomerase inhibitors in Group 3 MBs. We conclude that HMGA1, along with other SRGs on chromosome 6 and 17 warrant further investigation as potential therapeutic targets in selected subgroups or subtypes of MB.

This study aimed to investigates obesity-related glomerulopathy (ORG) at cellular, structural, and transcriptomic levels. Thirty Wistar rats were randomized into two groups: control (n=15) and study groups (n=15) that were fed a standard (SD) and high-fat diet (HFD), respectively. After 10 weeks, the weight, kidney function, histological features, and transcriptomic changes were assessed. HFD group exhibited increased weight gain (55.8% vs 29.2%; P< 0.001) and albuminuria (10384.04 ng/ml vs 5845.45 ng/ml; P<0.001) compared to controls. The HFD group exhibited early stages of ORG lesions, with a predominance of mesangial matrix increase and podocyte hypertrophy (PH). These lesions correlated with differentially expressed (DE) genes and miRNAs. Functional analysis showed that four DE miRNAs in the kidneys of the HFD group negatively regulated the PTEN gene, which promotes podocyte endocytosis of lipids in ORG. Among these four miRNAs, miR-205 was upregulated in the urine of the HFD group. HFD-fed Wistar rats developed early stages of ORG, with a specific targetome of miRNAs and gene expression. The upregulation of miR-205 in the kidney and its isolation in urine are associated with lipid endocytosis in podocytes, which could become a plausible biomarker of the early stages of ORG and lead to future therapeutic research.

Objective To investigate nailfold capillary parameters in community-dwelling individuals aged over 60 years who have hypertension and do not exercise regularly. Furthermore, the study examined the correlations between capillary function and other health-related indicators. Design A single- center pilot trial Setting Faculty of Health, Tsukuba University of Technology, Japan Participants hypertensive community-dwelling elderly people Intervention Microcirculation was observed before and 1 min after arm-curl exercise by means microscopy of capillary with non-exercised limb. Additionally, we examined other health-related indicators. Outcome measures: Acute effects of reperfusion on nailfold density, flow, and diameters. Secondary outcomes included the correlations between microvascular parameters and other health-related indicators. We hypothesized that brief exercise could enhance microcirculation reperfusion and correlate with other health-related parameters.　 Results: There were 20 participants with a mean (SD) age of 67.1 (5.8) years. The capillary flow rate changed from 2.3±6.7 to 2.7±0.2 log µm/s (P

.Background: Negative outcomes associated with medications (NOM) and drug-related problems (DRP) significantly impact individuals with kidney replacement therapy (KRT) given the complexities of managing kidney disease and associated comorbidities. The present study aims to assess the frequency of NOMs/DRPs among KRT patients and identify contributing factors. Methods: A cross-sectional study was conducted at the Virgen de las Nieves University Hospital (Granada, Spain), involving 117 outpatient adults with KRT. Data were collected from February 2021 to July 2023 using electronic records, semi-structured interviews (Dáder Method), and discussions with nephrology specialists. NOMs/DRPs were identified following treatment guidelines. Binary logistic regression determined associated factors (p-value < 0.05). Results: Across 117 patients, 2,436 NOMs and 3,303 DRPs were identified, averaging 20.82 NOMs and 28.23 DRPs per patient. Prevalent NOMs included untreated conditions (58.95%), quantitative ineffectiveness (35.43%), and non-quantitative safety problems (5.13%). Dominant DRPs were undertreated conditions (37.63%), wrong dose/posology/length (33.00%), risk of adverse drug reactions (ADR) (16.14%), and non-adherence (6.87%). Patients with ADR, undertreated condi-tions, and anemia were associated with quantitative ineffectiveness. Risk of ADR and vitamin D deficiency/insufficiency correlated with non-quantitative safety problems. Conclusions: KRT pa-tients exhibited a substantial prevalence of NOMs/DRPs. Further research is needed to deepen our understanding of these complexities for improved patient care.

Background: Micronutrient deficiencies are common at the time of cancer diagnosis and are associated with worse prognosis. Little is known about them in cancer rehabilitation. Methods: Data from routine health related quality of life (HRQOL) were analyzed at an inpatient cancer rehabilitation center. Rehabilitation patients completed the EORTC QLQ-C30 questionnaire before and after multidisciplinary rehabilitation treatment, and three month after discharge. Selenium and zinc status was measured in whole blood at these three time points. In case of selenium deficiency up to 600 µg selenium per day as sodium selenite was supplemented. Results: A total of 271 patients (breast, colon, and pancreatic cancer) were included in the analysis. There was clinically meaningful improvement in many domains of the EORTC QLQ-C30 during rehabilitation. However, effect often waned in the three months after. Prevalence for selenium deficiency varied between 34 to 90 percent depending on cancer type (breast &lt; colon &lt; pancreas). In contrast, zinc deficiency was rare. Daily selenium supplementation of 600 µg was more efficient to correct selenium deficiency compared to 300 µg selenium per day. Rehabilitation and increasing selenium status after rehabilitation were associated with improved global quality of life, physical and emotional functioning, and fatigue. In cancer patients with decreasing selenium status, values of global quality of life, physical and emotional functioning, and fatigue were back to the values at the beginning of rehabilitation. Conclusions: Selenium deficiency is common in cancer patients admitted to a cancer rehabilitation clinic. Selenium supplementation during rehabilitation effectively corrected selenium deficiency in most cases. The positive effects of rehabilitation persisted longer, when selenium status did not decrease after rehabilitation.

: Molecular targeting strategies have been used for years to control cancer progression and are often based on targeting various enzymes involved in metabolic pathways. Keeping that in mind, it is essential to know the role of each enzyme in a particular metabolic pathway. In this review, we are providing in-depth knowledge of various enzymes such as ceramidase, sphingosine kinase, sphingomyelin synthase, dihydroceramide desaturase, and ceramide synthase, which are associated with multiple types of cancer that depend on ceramide metabolism. Focus has also been given to discussing physicochemical properties of well-studied inhibitors of natural products origin and their related structures for these enzymes. Targeting ceramide metabolism exhibited promise in mono and combination therapies at preclinical stages to prevent cancer progression and paved the way for the significance of sphingolipid metabolism in cancer treatments. Targeting ceramide metabolizing enzymes will help the medicinal chemist to design potent and selective small molecules for treating cancer progression at various levels.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

The root system plays an irreplaceable role in plant growth. Its improvement can increase crop productivity. However, such system is still mysterious for us. The underlying mechanism has not been fully uncovered. The investigation on proteins related to the root system is an important means to complete this task. In the previous time, lack of root-related proteins makes it impossible to adopt machine learning methods for designing efficient models for the discovery of novel root-related proteins. Recently, a public database on root-related proteins was set up and machine learning methods can be applied in this field. In this study, we proposed a machine learning based model, named Graph-Root, for identification of root-related proteins. The features derived from protein sequences and one network were extracted, where the former features were processed by graph convolutional neural network and multi-head attention, and the later features abstracted the linkage between proteins. These features were fed into the fully connected layer to make prediction. The 5-fold cross-validation and independent tests suggested its good performance. It also outperformed the only one previous model, SVM-Root. Furthermore, the importance of each feature type and component in the proposed model was investigated.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

Hypertension (HT) is a very common risk factor and a frequent cause of morbidity and mortality worldwide mainly due to much increase in overweight (OW) and obesity that manifests in various forms of cardiovascular disease (CVD). There are a number of factors that may cause overweight hypertension (OHT). However, we planned to conduct the present work to study the HT and OHT men for finding the variation, interrelationship and association of important cytokines mainly serum leptin (Lep) and tumor necrosis factor-alpha (TNF-α), serum testosterone (ST), total cholesterol (TC) and inflammatory status by measuring interleukin-6 (IL-6). Three groups of subjects, the normal controls (NC; n:98; age range: 51-60 years), HT (n: 97; age range: 51-60 years) subjects, and OHT (n: 97; age range: 51-60 years) subjects were studied. Comparisons for Lep, ST, TNF-α, IL-6 and TC levels for the subject groups showed significant variations. The ST indicated significant difference only for NC vs. OHT. The IL-6 gave significant difference for NC vs. OHT and HT vs. OHT. The one-way ANOVA showed significant difference among groups for BMI, TC, IL-6, TNF-α, ST and Lep levels. Significant positive linear correlation for all groups among Lep, TNF-α, IL-6 and TC were found. The ST against TC for HT and OHT groups presented non-significant negative linear correlations. The ST showed significant negative linear correlation with other variables. Conclusively, the present study uncovers the interactive impact of serum leptin, TNF-α, testosterone, total cholesterol and IL-6 in hypertensive and overweight-related hypertensive men.

To date, the impact of COVID-19 vaccination on formerly menstruating women remains unknown. For this reason, a retrospective observational cross-sectional study was conducted (N= 548) using an online survey. General characteristics, medical history, and adverse events following COVID-19 vaccination were recorded. In comparison with the first dose, significantly higher percentages of respondents experienced menstrual-related disturbances (dose 1: 38.5% vs. dose 2: 44.8%; McNemar=9.15; mid P-value=0.002), as well as the simultaneous occurrence of two or more of these symptoms (dose 1: 11.2% vs. dose 2: 15.3%; McNemar=13.53; mid P-value=0.044) after receiving the second one. Among them, those related with the length and flow stand out, being of long-term nature in about 17-20% of cases. Interindividual factors influencing this unexpected event after receiving the dose 1 may include weight (AOR 1.02, CI 95% 1.01–1.03, P&lt;.001), perimenopause (AOR 2.28, CI 95% 1.37–3.77, P=.001), pre-existing diagnoses of non-autoimmune rheumatic/articular conditions (AOR 0.31, CI 95% 0.10–1.00, P=0.05), hormonal contraceptive use (AOR 0.25, CI 95% 0.07-0.82, P=0.02), suffering from other vaccine side effects − such as arm pain (AOR 0.61, CI 95% 0.39–0.95, P=0.03), headache (AOR 0.53, CI 95% 0.35 – 0.80, P=.003), swollen glands (AOR 0.29, CI 95% 0.15 – 0.60, P=.001) and nauseas (AOR 0.35, CI 95% 0.14 – 0.86, P=0.02) – and the number of previous pregnancies (AOR 2.70, CI 95% 1.54 – 4.76, P=.001). Formerly menstruating women may experience long-term menstrual-related disturbances following COVID-19 vaccination.

This study analyses key aspects of the professional life of primary school teachers in a southern European context. In the social changes of last two decades profoundly impacted the well-being of teachers putting a strain on their ability to adapt to sometimes unfair working conditions. For this purpose twenty teachers (M = 38.85; DS = 9.17) were interviewed from different areas of Italy, data were analyzed using the Grounded Theory Method. Through data analysis were summa-rize and emphasize eight core themes. The results show the effects of a gradual impoverishment of the recognition of the role of teacher, highlighting the difficulty for teachers of renegotiating more flexible workload assessments and of reinforcing psycho-emotional skills for the development of a teaching methodology attentive to the psycho-emotional needs of pupils. Schools emerge as a rigid working context, in which a competent organizational function is often absent. Practical psychological implications are discussed.

Tyrosine kinase inhibitors (TKI) and immune checkpoint inhibitors (ICI) significantly improve the outcomes of patients with advanced clear cell renal cell carcinoma (ccRCC), but high-grade toxicities can occur, particularly during combination therapy. Herein, we report a patient with advanced metastatic ccRCC, who developed grade 4 cholestasis during combined therapy with nivolumab and cabozantinib. After the exclusion of common disorders associated with choles-tasis and a failure of corticosteroids (CS), a liver biopsy was performed that demonstrated severe ductopenia. Consequently, a diagnosis of vanishing bile duct syndrome related to TKI and ICI administration was made, resulting in CS discontinuation and ursodeoxycholic acid administra-tion. After a 7-months follow-up, liver tests had returned to normal values. Immunological studies revealed that our patient had developed robust T-cells and macrophages infiltrates in his lung metastasis, as well as in skin and liver tissues at the onset of toxicities. At the same time, peripheral blood immunophenotyping revealed significant changes in T-cell subsets suggesting their potential role in the pathophysiology of the disease.

Grapevine is one of the most relevant crops in the world being used for economically important products such as wine. Yet, relevant grapevine cultivars are heavily affected by diseases such as the downy mildew disease caused by Plasmopara viticola. Improvements on grapevine resistance are made mainly by breeding techniques where resistance traits are introgressed into cultivars with desired grape characteristics. However, there is still a lack of knowledge on how resistant or tolerant cultivars tackle the P. viticola pathogen. In this study, using a shotgun proteomics LC-MS/MS approach, we unravel the protein modulation of a highly tolerant grapevine cultivar, V. vinifera ‘Regent’, in the first hours post inoculation (hpi) with P. viticola. At 6 hpi, proteins related to defence and to response to stimuli are negatively modulated while at 12 hpi there is an accumulation of proteins belonging to both categories. The co-occurrence of effector-triggered susceptibility (ETS) and effector-triggered immunity (ETI) is detected at both time-points, showing that these defence processes present high plasticity. The results obtained in this study unravel the tolerant grapevine defence strategy towards P. viticola and may provide valuable insights on resistance associated candidates and mechanisms, which may play an important role in the definition of new strategies on breeding approaches.

The 2030 Agenda sets out seventeen Sustainable Development Goals (SDGs). The educational goal is to promote the education of citizens on sustainable development, among other things. Educating today's digital citizens on sustainability means training them for justice and social activism, commitment and political engagement. However, research into the subject shows a lack of consistency in the education of university students. This paper presents a study of students of Education, on education on sustainability through the practice of active and critical digital citizenship. A quasi-experimental method was used to learn about the behaviours of digital citizens, and intervention was carried out by means of an SDG-focused workshop and observation of the final level of commitment. The results show a positive level of commitment and digital activism around content related to sustainable development, which can be addressed from the university syllabus in a cross-curricular way.