Arrhythmic sudden cardiac death (SCD) has an annual prevalence of 1 per 1000 while 75% of the victims suffer from ischemic and 10% from non-ischemic or hypertrophic cardiomyopathy. Altogether, these three entities account for more than 80% of the total SCD victims. Guidelines for implantable cardiac defibrillators are still dominated by LVEF<30% from the MADIT II study. In terms of arrhythmic risk stratification, the PRESERVE-EF study restored in clinical practice the two-step arrhythmic risk stratification approach based on Electrocardiographic non-invasive risk factors (NIRFs) guiding to electrophysiological study. In our times with the multiple cardiac imaging methods and artificial intelligence applications availability, this two-step approach based on integrated arrhythmia mechanisms detection, emerges as an efficient SCD risk stratification paradigm for these three entities but also for the patients with congenital heart disease.

Photovoltaic materials convert light into electrical voltages. So far, most research in the field are focused on how to refine/improve the existing or standard photovoltaic cells to yield more efficient electricity, to reduce weight, to make more flexible shape, or to minimize costs under standard and uniform sunlight illuminations. In this project, we explore and demonstrate a hypothesis that non-uniform light illumination photovoltages can also be generated due to photo doping induced mobile charge carrier density gradient between light and dark areas in either p-type or n-type photo doping semiconductors. The term non-uniform light illumination was coined to refer to subjecting our photo sensing thin film devices to areas of high and low intensities of light illumination simultaneously, with an intention of creating a charge density gradient and therefore a voltage. Specifically, a polymeric composite thin film composed of P3HT (p-type photo doping semiconductor) and PCBM (photo doping electron acceptor and trap) at varying p-doping levels were studied. We observed that the fabricated photovoltaic cells with about 80% PCBM doped P3HT thin film devices exhibited 0.5-1.2 volts photovoltages under non-uniform light illuminations.

We explores the hydrodynamical limit of a homogeneous electron gas, considering the interplay between the infrared limit and phenomenological hydrodynamics. Our study involves interactions generated by non-linear coordinate transformations. The focus begins with an analysis of non-linear coordinate transformations and their impact on normal modes in a harmonic system. The Lagrangian for a harmonic oscillator is used as an illustrative example, highlighting the role of position-dependent effective mass in preventing certain coordinate values. Moving beyond single degrees of freedom, we extend the discussion to a system with several harmonic degrees of freedom, introducing a collective variable. The effective dynamics of this collective variable are defined through a Lagrange multiplier term, emphasizing linearity in the description. Our study extends to the Current Two-Point function (CTP) formalism, introducing matrices and their inverses, such as $\hD$ and $\hD^{-1}$. Further, we delve into the dynamics of current in a homogeneous electron gas at finite density and zero temperature. Green's functions are generated using a functional integral approach, and the effective action is constructed via functional Legendre transformation. The quadratic part of the generator functional is expanded to derive the effective action, leading to the Maxwell equation and the subsequent elimination of the photon field. The resulting effective action for current dynamics is expressed in terms of the Current Two-Point function, paving the way for further exploration of the hydrodynamical aspects of the electron gas. Our study combines theoretical developments and mathematical formalism to provide insights into the hydrodynamical behavior of homogeneous electron gases.

Chronic non-bacterial osteomyelitis (CNO), also known as chronic recurrent multifocal osteomyelitis (CRMO), is a rare autoinflammatory bone disease primarily affecting children and adolescents. This review presents a comprehensive analysis of the intricate relationship between CNO and inflammatory bowel disease (IBD), shedding light on shared pathophysiological mechanisms and clinical management. A thorough literature review was conducted, encompassing 24 case reports involving 40 patients. The demographic distribution of patients revealed a near-equal gender ratio, with a median age of diagnosis at 12 years. The diagnosis patterns showed a higher proportion of CNO as the initial diagnosis, while Crohn's disease was more prevalent than ulcerative colitis. The time interval between the clinical presentations varied, ranging from simultaneous detection to a substantial 15-year gap. Treatment modalities included non-steroidal anti-inflammatory drugs (NSAIDs), steroids, aminosalicylates, and biologic agents, such as infliximab, often overlapping in their use, suggesting shared pathophysiological pathways. Both conditions displayed systemic manifestations, and patients often responded well to immunosuppressive medications. The pathophysiology of CNO involves genetic predisposition, cytokine dysregulation, and osteoclast activation. Dysregulated innate immunity results in immune cell infiltration into bones, causing sterile bone lesions. Notably, emerging evidence hints at a potential link between the microbiome and CNO. In contrast, IBD results from imbalanced mucosal immune responses to the intestinal microbiota. Polymorphisms in the promotor region of IL-10, common cytokines, immune cells, and genetic markers indicate shared immunological and genetic factors between CNO and IBD. Both conditions also involve extraintestinal symptoms. This analysis underscores the need for clinical awareness of the co-occurrence of CNO and IBD, especially among pediatric patients. A deepened understanding of the connections between these seemingly distinct diseases could lead to more effective management and improved patient outcomes.

Recent successes in the field of evolutionary cancer cell biology (ECCB) have brought to a head two of the most important controversies regarding cancer origin. The first concerns the question of whether carcinogenesis is initiated only by genetic alterations, mutations, and driver genes, as the mutational theory teaches. The ECCB, claims that a large number of polyploidy-related cancers (PGCC cancers) are not due to mutations, but rather to inadequate ancient repair mechanisms used by DNA-damaged stem cells for their repair. Somatic mutations are merely secondary. The second controversy, described in the previous article, concerns the non-mutational theory itself: Are non-mutational polyploid cancers an atavism - as previously thought - or rather the effect of an ancient gene regulatory network aGRN that controls genome reprogramming in precancerous DNA-damaged cells as well in the transformed cells. Finally, the unicellular gene module of cancer, of which the aGRN is a part, has evolved along with the multicellular genome during the last 1000 My of evolution. and non-mutated cancer cell systems are under the control of the aGRN. The atavistic theory relies on phylostratigraphic evidence to determine the age of cancer genes. It states that most cancer-like genes arose during the transition period from unicellularity to multicellularity, but also during the early metazoan era. In our opinion, the atavistic theory is flawed and suffers from many misunderstandings. It provides little insight into the origin and coevolution of the cancer cell system and its control by the ancient gene regulatory network aGRN.

Non-systemic oral drugs, which do not get absorbed through the gastrointestinal membrane, are an important group of compounds for targeting diseases residing within the gastrointestinal lumen. However, they require a set of design principles not sufficiently covered by traditional druglikeness metrics, such as Lipinski’s Rule of 5. These druglikeness metrics fail to accurately identify true negative outcomes; such is the requirement for novel cheminformatic based approaches for the discovery of non-systemic small molecules. One such example of these newer metrics is the fraction of SP3-hybridised carbon atoms (fSP3) which has shown promising application as an identifier of poor oral-bioavailability. Herein, we discuss the application of fSP3 in the drug discovery process in a number of case studies, including our own work discovering non-systemic fructose scavengers for the treatment of fructose malabsorption.

Background: Androgenetic alopecia (AGA) and alopecia areata (AA) are most common types of non-cicatricial alopecia. Both diseases have limited effective therapeutic options and affect patients' quality of life. Pharmacogenetic tests can help predict the most appropriate treatment option by evaluating the single nucleotide polymorphisms (SNPs) corresponding to genes related to alopecia. The objective of the study was to evaluate and compare selected SNPs and genes in AA and AGA patients from Romania and Brazil. Materials and methods: We investigated associations between AA and AGA and 45 tag SNPs of 13 genes in 287 Romanian and 882 Brazilian patients. The DNA samples were extracted from saliva using qPCR technique. Results: GR-alpha gene, GPR44-2 gene, SULT1A1 gene and CRABP2 gene were statistically significantly different in Brazil compared to Romania. Minoxidil may be recommended in half of the cases of AGA and AA. Patients with AGA and high expression of SRD5A1 or PTGFR-2 may benefit from Dutasteride, respectively Latanoprost treatment. Most of the studied genes showed no differences between the two population. Conclusion: The DNA analysis of the patients with alopecia may contribute to a successful treatment.

Wine is a processed beverage that offers high nutritional and health benefits. It is produced from grape must, which undergoes fermentation by yeasts (and sometimes lactic acid bacteria) to create a product that is highly appreciated by consumers worldwide. However, if only one type of yeast, specifically Saccharomyces cerevisiae, were used in the fermentation process, the resulting wine would lack aroma and flavor and may be rejected by consumers. To produce wine with a desirable taste and aroma, non-Saccharomyces yeasts are necessary. These yeasts contribute volatile aromatic compounds that significantly impact the wine’s final taste. They promote the release of primary aromatic compounds through a sequential hydrolysis mechanism involving several glycosidases unique to these yeasts. This review will discuss the unique characteristics of these yeasts (Schizosaccharomyces pombe, Pichia kluyveri, Torulaspora delbrueckii, Wickerhamomyces anomalus, Metschnikowia pulcherrima, Hanseniaspora vineae, Lachancea thermotolerans, Candida stellata, and others) and their impact on wine fermentations and co-fermentations. Their existence and the metabolites they produce enhance the complexity of wine flavor, resulting in a more enjoyable drinking experience.

This short report contains a result that characterizes almost global pullback attractor of discrete-time non-autonomous systems. Analogously to the multiple Lyapunov functions approach for switched systems, we show here that existence of multiple Lyapunov densities implies pullback convergence of almost all initial states to the origin for a discrete-time non-autonomous system.

The research and development of non-viral gene therapy has been extensive over the past decade and has received a big push thanks to the successful approval of non-viral gene therapy products in recent times. Despite these developments, gene therapy applications in cancer have been limited. One of the main causes of this has been the imbalance in development of delivery vectors as compared to nucleic acid payloads. This paper reviews non-viral vectors that can be used to deliver nucleic acids for cancer treatment. It discusses various types of vectors and highlights their current applications. Additionally, it also discusses perspective on regulatory landscape to facilitate commercial translation of gene therapy.

With the exponential growth in today’s technology and its expanding areas of application it has become vital to incorporate it in education. One such application is Knowledge Discovery in Databases (KDD) which is a subset of data mining. KDD deals with extracting useful information and meaningful patterns from the database that were not known before. This study is a detailed application of KDD and focuses on analyzing why a particular set of students performed better than others and what factors influenced the results. The study is conducted on a dataset of 480 students and across 16 different features. The authors implemented 4 major classification techniques namely Logistic Regression, Decision Tree, Random Forest and XGB classifier. Obtaining the key features from the top performing ML algorithms that have a major impact on the performance of the student, the study takes these features as a baseline for further analysis. Further data analysis highlights patterns in the data. The study concludes that there are a lot of non-academic factors that influence the overall performance of a student and should be taken into consideration by universities and other relevant bodies.

The sound field properties for non-cavitating marine propellers are studied using FW-H (Ffowcs William-Hawkings) acoustic analogy and BEM (Boundary Element Method) approach. For the first time, the FW-H formula to calculate acoustic pressure generated by the propeller wake sheet is proposed. The corresponding sound signal can be dominant up to several kilometres. Secondly, non-physical fictitious volume flux is observed when the permeable FW-H approach is used together with BEM. The reason is explained and a virtual source correction method is proposed to solve this problem. Furthermore, analytical analyse show that the second thickness term and the first two loading terms in Farassat 1A formula are important, and the others are negligible. The numerical studies show that the permeable FW-H approach produces underestimation when compared to the direct FW-H method, and the underestimation is severer for larger permeable surface and higher frequency. It is also found that the first loading term in Farassat 1A formula is the dominant source term in the direct FW-H method, while the first thickness term is dominant when the permeable FW-H approach is used.

Many ligands directly target adenosine receptors (ARs). Here we review the effects of noncanonical AR drugs on adenosinergic signaling. Non-AR mechanisms include raising adenosine levels by inhibiting adenosine transport (e.g. ticagrelor, ethanol, cannabidiol), affecting intracellular metabolic pathways (e.g. methotrexate, nicotinamide riboside, salicylate, 5‐aminoimidazole‐4‐carboxamide riboside), or undetermined means (e.g. acupuncture). Yet other compounds bind ARs in addition to their canonical ‘on-target’ activity (e.g. mefloquine). The strength of experimental support for an adenosine-related role in a drug’s effects varies widely. AR knockout mice are the ‘gold standard’ method for investigating an AR role, but few drugs have been tested in these mice. Given the interest in AR modulation for treatment of cancer, CNS, immune, metabolic, cardiovascular, and musculoskeletal conditions, it is informative to consider AR and non-AR adenosinergic effects of approved drugs and conventional treatments.

Markets dominate the world’s food systems. Today’s food systems fail to realize the normative foundations of ecological economics: justice, sustainability, efficiency, and value pluralism. I argue that markets, as an institution for governing food systems, hinder the realization of these objectives. Markets allocate food toward money, not hunger. They encourage shifting costs on others, including nonhuman nature. They rarely signal unsustainability, and in many ways cause it. They do not resemble the efficient markets of economic theory. They organize food systems according to exchange value at the expense of all other social, cultural, spiritual, moral, and environmental values. I argue that food systems can approach the objectives of ecological economics roughly to the degree that they subordinate market mechanisms to social institutions that embody those values. But such “embedding” processes, whether through creating state policy or alternative markets, face steep barriers and can only partially remedy food markets’ inherent shortcomings. Thus, ecological economists should also study, promote, and theorize non-market food systems.

Observed ENSO statistics exhibits a non-gaussian behavior, which is indicative of the presence of nonlinear processes. In this paper we use the Recharge Oscillator model (ROM), a largely used Low-Order Model (LOM) of ENSO, as well as methodologies borrowed from the field of statistical mechanics to identify which aspects of the system may give rise to nonlinearities that are consistent with the observed ENSO statistics. In particular, we are interested in understanding whether the nonlinearities reside in the system dynamics or in the fast atmospheric forcing. Our results indicate that one important dynamical nonlinearity often introduced in the ROM cannot justify a non-gaussian system behavior, while the nonlinearity in the atmospheric forcing can instead produce a statistics similar to the observed. The implications of the non-Gaussian character of ENSO statistics for the frequency of extreme El Nino events is then examined.

There is an important role non-human primates (NHP) play in biomedical research. Phylogenetic proximity of any of the NHP species to Homo sapiens assures that much better translatability of research outcomes from model studies involving human diseases can be achieved than from those generated with other pre-clinical systems. Our group and others used during past two decades NHPs in research directed towards viral and autoimmune disorders of the gastrointestinal tract. This review summarizes progress made in the area of enteric viral infections and its applicability to human disease.

Small non-coding RNAs (sRNAs) are ubiquitously found in the three domains of life playing large-scale roles in gene regulation, transposable element silencing, and defense against foreign elements. While a substantial body of experimental work has been done to uncover function of sRNAs in Bacteria and Eukarya, the functional roles of sRNAs in Archaea are still poorly understood. Recently, high throughput studies using RNA-sequencing revealed that sRNAs are broadly expressed in the Archaea, comprising thousands of transcripts within the transcriptome during non-challenged and stressed conditions. Antisense sRNAs, which overlap a portion of a gene on the opposite strand (cis-acting), are the most abundantly expressed non-coding RNAs and they can be classified based on their binding patterns to mRNAs (3’ UTR, 5’ UTR, CDS-binding). These antisense sRNAs target many genes and pathways, suggesting extensive roles in gene regulation. Intergenic sRNAs are less abundantly expressed and their targets are difficult to find because of a lack of complete overlap between sRNAs and target mRNAs (trans-acting). While many sRNAs have been validated experimentally, a regulatory role has only been reported for very few of them. Further work is needed to elucidate sRNA-RNA binding mechanisms, the molecular determinants of sRNA-mediated regulation, whether protein components are involved, and how sRNAs integrate with complex regulatory networks.

This paper examines an important problem in smart grid energy scheduling; peaks in power demand are proportionally more expensive to generate and provision for. The issue is exacerbated in local microgrids that do not benefit from the aggregate smoothing experienced by large grids. Demand-side scheduling can reduce these peaks by taking advantage of the fact that there is often flexibility in job start times. We focus attention on the case where the jobs are non-preemptible, meaning once started, they run to completion. The associated optimization problem is called the Peak Demand Minimization problem and has been previously shown to be NP-hard. Our results include an optimal fixed-parameter tractable algorithm, a polynomial-time approximation algorithm, as well as an effective heuristic that can also be used in an online setting of the problem. Simulation results show these methods can reduce peak demand by up to 50% versus on-demand scheduling for household power jobs.

This paper focuses on the problem of finite-time stabilization of homogeneous, non-Lipschitz systems with dilations. A key contribution of this paper is the design of a virtual recursive Hölder, non-Lipschitz state feedback which renders the non-Lipschitz systems in the special case dominated by a lower-triangular nonlinear system, finite-time stable. The proof is based on a recursive design algorithm developed recently, to construct the virtual Hölder continuous, finite-time stabilizer as well as a C¹ positive definite and proper Lyapunov function that guarantees finite-time stability of the non-Lipschitz non-linear systems.

Background and objectives: sickle cell disease is the most common hemoglobinopathy in the world. It is considered to be a real public health problem. Sickle cell patients are subjected to several factors causing inflammation such as iron metabolism. The study aimed to look for inflammation in children with sickle cell disease in Cameroon, identify the factors associated with inflammation, and raise the consequences for the patient including the iron profile and the profile of the hemogram. Materials and methods: We conducted an analytical cross-sectional study for 03 months. The sickle cell disease patients coming and/or followed at the Hematology Department of the Regional Hospital of Bafoussam and the Central Hospital of Yaoundé have been recruited. The exploration of inflammation was made by determining CRP, IL6, and ferritin concentrations. The hematological parameters and iron profile were evaluated using standard methods. Statistical analysis of the data was performed; Univariate and multivariate logistic regression analyses allowed to identification of factors associated with inflammation in patients, using the statistical tool R version 4.1.1.. The proportions were compared with the chi-square test when the expected numbers were greater than 5 and the Fisher test when not. Results: The frequency of inflammation in the population was 42.3%. Hyperferritinemia was significantly greater (p<0.001) in patients with inflammation compared to the non-inflammatory patients (96.8% and 76.7% respectively). Patients with inflammation showed a significant elevation of iron parameters (p<0.05). In addition, ferritin and IL6 elevation were associated with inflammation during sickle cell disease respectively (Or = 4.96; 95% CI [1.15-36.42]; p=0.056) and (Or =6.23; 95% CI [1.43-45.96]; p=0.030). Conclusions: The elevated iron in plasma is an effect of inflammation in sickle cell patients. Hence the need of controlling inflammation and iron in the latter is necessary.

Epidemiological and clinical evidence have extensively documented the role of obesity in the develop-ment of endometrial cancer. However, the effect of fatty acids on cell growth in endometrial cancer has not been widely studied. Here we reported that palmitic acid significantly inhibited cell proliferation of endometrial cancer cells and primary cultures of endometrial cancer, and reduced tumor growth in a transgenic mouse model of endometrial cancer, in parallel with increased cellular stress and apoptosis and decreased cellular adhesion and invasion. Inhibition of cellular stress by N-acetyl-L-cysteine effec-tively reversed the effects of palmitic acid on cell proliferation, apoptosis and invasive capacity in the endometrial cancer cells. Palmitic acid increased the intracellular formation of lipid droplets in a time- and dose-dependent manner. Depletion of lipid droplets by blocking DGAT1 and DGAT2 effectively increased the ability of palmitic acid to inhibit cell proliferation and induce cleaved caspase 3 activity. Collectively, this study provides new insight into the effect of palmitic acid on cell proliferation, inva-sion and the formation of lipid droplets that may have potential clinical relevance in the treatment of obesity-driven endometrial cancer

This study was to designed to develop sorafenib-loaded polymeric nanoparticles, surface-modified with pluronic F-127 for the effective treatment of hepatocellular (HCC) and renal cell carcinomas (RCC). Poly lactic coglycolic acid (PLGA) was used to encapsulate different concentrations of sorafenib by a simple modified solvent evaporation method applying pluronic F-127 as a surfactant and coating agent. The preformulation and characterization studies were conducted to evaluate the incompatibilities among sorafenib, PLGA and pluronic F-127, and physicochemical properties of the formulations, respectively. The sizes of the coated and plain PLGA nanoparticles were ~140 ± 14.7 nm and ~ 120 ± 10.1 nm, respectively. It has been confirmed from the in vitro release studies that PLGA sustained the release of sorafenib, avoiding the initial burst release, while the in vivo studies demonstared that surface-modified nanoparticles have greater affinity in the target aorgans than plain PLGA nanoparticles and free drug keeping the dose constant (20 mg/kg body weight). The delivery of sorafenib-loaded polymeric PLGA nanoparticles into the target tissues and their pharmacokinetic parameters have been improved significantly compared to the reported formulations.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

BMAP-27 peptide known to exert cytotoxic effects against cancer cells by membrane integrity disruption. In the current investigation, we aimed to study the role of the BMAP-27 peptide in reducing colon cancer cell proliferation and inducing apoptosis. This study utilized both primary and metastatic colon cancer cell lines (SW480 and SW620). Proliferation was measured using CCK-8, and cellular damage was analyzed by lactate dehydrogenase assay. The study assessed apoptosis, cell cycle, and proliferation by measuring the expression of CASPASE3, BAX, BCL-2, TP53, CDK-6, PCNA, Wnt11, AXIN1, and CTNNB1. Additionally, in-silico studies were conducted to determine the binding affinities of BMAP-27 with APC and β-catenin proteins. BMAP-27 peptide reduced colon cancer cell proliferation, upregulated CASPASE3, BAX, TP53, AXIN1 expression, and downregulated BCL-2, CDK-6, PCNA, WNT11, CTNNB1 in both colon cancer cell lines, however, demonstrated higher activity in primary than metastatic colon cancer cells. The molecular dynamic simulation revealed substantial binding affinity of the peptide to adenomatous polyposis coli and β-catenin proteins.BMAP-27 peptide effectively inhibited the proliferation and enhanced apoptosis in the primary than in metastatic colon cancer cells. In-silico findings suggest that BMAP-27 exhibits a strong binding affinity with APC and β-catenin, highlighting its potential role as an anti-colon cancer agent.

In the last two decades many detailed full transcriptomic studies on complex biological samples have been published and included in large gene expression repositories. These studies primarily provide bulk expression signal for each sample, including multiple cell-types mixed within the global signal. The cellular heterogeneity in these mixtures does not allow the activity of specific genes in specific cell types to be identified. Therefore, inferring relative cellular composition is a very powerful tool to achieve a more accurate molecular profiling of complex biological samples. In recent decades, computational techniques have been developed to solve this problem by applying cell deconvolution methods, designed to decompose cell mixtures into their cellular components and calculate the relative proportions of these elements. Some of them, only calculate the cell proportions (supervised methods), while other deconvolution algorithms can also identify the gene signatures specific for each cell type (unsupervised methods). In these work, five deconvolution methods (CIBERSORT, FARDEEP, DECONICA, LINSEED and ABIS) were implemented and used to analyze blood and immune cells, and also cancer cells, in complex mixture samples (using three bulk expression datasets). Our study provides three analytical tools (corrplots, cell-signature plots and bar-mixture plots) that allow a thorough comparative analysis of the cell mixture data. The work indicates that CIBERSORT is a robust method optimized for the identification of immune cell-types, but not as efficient in the identification of cancer cells. We also observed that LINSEED is a very powerful unsupervised method that provides precise and specific gene signatures for each of the five main immune cell-types analyzed: neutrophils and monocytes (in the myeloid lineage), B-cells, NK cells and T-cells (in the lymphoid lineage).

Solid oxide cells are capable of efficiently converting various chemical energy carriers to electricity and vice versa. The urgent challenge nowadays is the faster degradation rate compared with other fuel cell/electrolyzer technologies. To understand the degradation mechanisms, simulation of a solid oxide cell is helpful. Since most previous research developed models using commercial software, such as COMSOL and ANSYS Fluent, a gap for knowledge transfer is being gradually formed between academia and industry due to licensing issues. This paper introduces a multiphysics model, developed by a computational code, openFuelCell2. The code is implemented with an open-source library, OpenFOAM. It accounts for momentum transfer, mass transfer, electrochemical reactions and metal interconnect oxidation. The model can precisely predict I-V curves under different temperatures, fuel humidity and operation modes. Comparison between OpenFOAM and COMSOL simulations shows good agreement. The metal interconnect oxidation is modelled, which can predict the thickness of the oxide scale under different protective coatings. Simulations are conducted by assuming an ultra-thin film resistance on the rib surface. It is revealed that coatings fabricated by atmospheric plasma spraying can efficiently prevent metal interconnect oxidation, with a contribution of only 0.53 \% to the total degradation rate.

Pathologies of the blood brain barrier (BBB) have been linked to a multitude of CNS disorders whose pathology is poorly understood. Cortical spreading depression (CSD) has long been postulated to be involved in the underlying mechanisms of these disease states, yet full understanding remains elusive. This study utilized an in vitro model of the BBB with b.End3 murine endothelial cells to investigate the role of CSD in BBB pathology by characterizing effects of the release of major pronociceptive substances on BBB functional integrity using TEER screening, transcellular uptake, and immunoreactive methods in concert with global proteome and phospho-proteomic approaches. Findings demonstrated relocalization and functional alteration to proteins associated with the cytoskeleton and endothelial tight junctions. Pathologic mechanisms induced by individual substances released during CSD were found to have unique phosphorylation signatures in phospho-proteome analysis, identifying Zona Occludens 1 as a possible pathologic “checkpoint” of the BBB. Utilizing these phosphorylation signatures, possible novel diagnostic methods may be developed for neurological diseases and warrants further investigation.

Viral tropism is most commonly linked to receptor use, but host cell protease use can be a notable factor in susceptibility to infection. Here we review the use of host cell proteases by human viruses, focusing on those with primarily respiratory tropism, particularly SARS-CoV-2. We first describe the various classes of proteases present in the respiratory tract, as well as elsewhere in the body, and incorporate the targeting of these proteases as therapeutic drugs for use in humans. Host cell proteases are also linked to the systemic spread of viruses and play important roles outside of the respiratory tract; therefore, we address how proteases affect viruses across the spectrum of infections that can occur in humans, intending to understand the extrapulmonary spread of SARS-CoV-2.

Replication stress (RS) is a characteristic state of cancer cells as they tend to exchange precision of replication for fast proliferation and increased genomic instability. To overcome the consequences of improper replication control malignant cells frequently inactivate parts of their DNA damage response (DDR) pathways (the ATM-CHK2-p53 pathway), while relying on other pathways which help to maintain replication fork stability (ATR-CHK1). This creates a dependency on the remaining DDR pathways, vulnerability to further destabilization of replication and synthetic lethality of DDR inhibitors with common oncogenic alterations such as mutations of TP53, RB1, ATM, amplifications of MYC, CCNE1 and others. The response to RS is normally limited by coordination of cell cycle, transcription and replication. Inhibition of WEE1 and PKMYT1 kinases, which prevent unscheduled mitosis entry, leads to fragility of under-replicated sites. Recent evi-dence also shows that inhibition of Cyclin-dependent kinases (CDKs), such as CDK4/6, CDK2, CDK8/19 and CDK12/13 can contribute to RS through disruption of DNA repair and replication control. Here, we review the main causes of RS in cancers as well as main therapeutic targets – ATR, CHK1, PARP and their inhibitors.

Cell migration crucial contributor to metastasis, a critical process associated with the mortality of cancer patients. The initiation of metastasis is triggered by epithelial-mesenchymal transition (EMT), along with the changes of the expression of EMT marker proteins. Inflammation plays a significant role in carcinogenesis and metastasis. Lipopolysaccharide (LPS), a typical inflammatory agent, promoted the generation of superoxide through the activation of p-Tyr42 RhoA, Rho-dependent kinase 2 (ROCK2) and the phosphorylation of p47phox. In addition, p-Tyr42 RhoA activated phospholipase D1 (PLD1), with PLD1 and phosphatidic acid (PA) being involved in superoxide production. PA also regulated the expression of EMT maker proteins. Consequently, we have identified MHY9 (Miosin IIA, NMIIA) as a PA-binding protein in response to LPS. MYH9 also contributed cell migration and the alteration of the expression of EMT marker proteins. P-Tyr42 RhoA, PLD1 and MYH9 associated to form a complex, which was distributed in both the cytosol and nucleus. In addition, we have found that p-Tyr42 RhoA and PLD1 associated with the ZEB1 promoter. Taken together, we propose that p-Tyr42 RhoA and PLD1, responsible for producing PA, and PA-bound MYH9 are involved in the regulation of ZEB1 expression, thereby promoting cell migration.

Renal cell carcinoma (RCC), alternative term for kidney cancer, is becoming more common worldwide each year, and there are many different contributing factors. Among all cancers, RCC is the 14th most prevalent; and it ranks as the 14th and 9th most prevalent cancer overall for women and men respectively. RCC cases increased by more than 430,000 in 2020. While disease burdens are highest in Eastern Europe (Belarus and Russia) and North America (Canada and the United States), Africa, Asia, and Latin America are predicted to report increase in prevalence as these regions embrace change in lifestyle. The majority of RCC cases are accidentally found on imaging, and survival is greatly impacted by the disease stage at diagnosis, with a metastatic cancer having a 5-year survival rate of 12%. As a consequence of early discovery and more improved treatments, RCC mortality has declined. The key epidemiologic variables of RCC include vast regional and geographical heterogeneity in prevalence rates, and the cause is largely unclear. Recognized risk factors include smoking, being overweight, having previous episodes of hypertension, and suffering chronic renal illness. Unexpectedly swift, RCC diagnosis and therapy have advanced. RCC prevalence continues to rise although survival rates have sharply improved. Cancer survival and treatment have improved, and more gains are projected as a result of clinical and translational research. In this review, kidney cancer statistics and recent literatures are examined on a global scale. It covered aspects of kidney cancer, including its epidemiology, causes, risk factors, current immunotherapy, chances for prevention, and future planning.

Deep Learning (DL) has made significant advances in computer vision with the advent of Vision Transformers (ViT). Unlike Convolutional Neural Networks (CNNs), ViTs use self-attention to extract both local and global features from image data, and then use residual connections to feed these features directly into a fully networked multilayer perceptron head. In hospitals, hematologists prepare peripheral blood smears (PBSs) and read them under a medical microscope to detect abnormalities in blood counts such as leukemia. However, this task is time-consuming and prone to human error. This study investigates the transfer learning process of Google ViT and ImageNet CNNs to automate the reading of PBSs. The study used two online PBS datasets, PBC and BCCD, and transferred them into balanced datasets to investigate the influence of data amount and noise immunity on both neural networks. The PBC results show that Google ViT is an excellent DL neural solution for data scarcity. The BCCD results show that Google ViT is superior to ImageNet CNNs in dealing with unclean, noisy image data because it is able to extract both global and local features and use residual connections, despite the additional time and computational overhead.

Granular cell tumors (GCTs), known also as Abrikossoff tumors, are rare tumors that originates from Schwann cells that primarily localize in the tongue, skin, and submucosal tissues and involve the gastrointestinal tract in 11% of cases. We present a case of a young woman who first presented to our centre in 2018, for an EGDS to assess a thickening of the esophageal wall, seen on a CT. In that occasion, a diagnosis of Abrikossoff tumor was made. She underwent endoscopic resection with subsequent yearly follow-up without evidence of recurrence. 5 Years later, on a routine colonoscopy, we found numerous white submucosal formations in all of the explored tracts, with a histological examination compatible with GCT. Her daughter presented with a white nodule on her tongue, also diagnosed as GCT. Her daughter was also diagnosed with GCT of the tongue a few months later.

The utilization of fuel cells (FC) in automotive technology has experienced significant growth in recent years. Fuel cell hybrid electric vehicles (FCHEVs) are powered by a combination of fuel cells, batteries, or/and ultracapacitors (UCs). By integrating power converters with these power sources, the FCHEV system can overcome the limitations of using them separately. The performance of an FCHEV is influenced by the efficiency of the power electronics converter controller, as well as the technical efficiency of the power sources. FCHEVs need intricate energy management systems (EMSs) to function effectively. Poor EMS can lead to low efficiency and accelerated fuel cell and battery degradation. The literature discussed various types of EMSs, such as equivalent consumption minimization strategy, classical PI controller, fuzzy logic controller, and Mutative Fuzzy Logic Controller (MFLC). However, comparing different EMSs can be challenging due to the varying vehicle and system parameters, which might lead to false claims being made regarding system performance. This research aims to categorize and discuss the various topologies of FCHEVs, highlighting their pros and cons, and comparing several EMSs based on performance metrics such as State of Charge (SOC) and FC deterioration.

Coffee processing generates a huge amount of waste which contains many natural products. Here, we report the discovery of a panel novel cell-penetrating and metal-ion binding microproteins designated coffeetide cC1a-c and cL1-6 from the husk of two popular coffee plants, Coffea canephora and Coffea liberica, respectively. Combining sequence determination and database search, we showed that the prototypic coffeetide cC1a is a 37-residue, eight-cysteine microprotein with a hevein-like cysteine motif but without a chitin-binding domain. NMR determination of cC1a revealed a compact structure that confers it resistance to heat and proteolytic degradation. Disulfide mapping together with chemical synthesis revealed that cC1a has a ginsentide-like, and not a hevein-like, disulfide connectivity. In addition, transcriptomic analysis showed that the 98-residue micrcoproten-like coffeetide precursor contains a three-domain arrangement like ginsentide precursors. Molecular modeling together with experimental validation revealed a Mg2+ and Fe3+ binding pocket at the N-terminus formed by three glutamic acids. Importantly, cC1a is amphipathic with a continuous stretch of 19 apolar amino acids, and which enables its cell penetration to target intracellular proteins, despite being highly negatively charged. Our findings suggest that coffee by-products could provide a source of ginsentide-like bioactive peptides that have potential to target intracellular proteins.

One of the hallmarks of microgravity-induced effects in several cellular models is represented by the alteration of oxidative balance with the consequent accumulation of Reactive Oxygen Species (ROS). It is well known that male germ cells are sensitive to oxidative stress and to changes of gravitational force even if published data on germ cell models are scarce. To gain more insights into the mechanisms of male germ cell response to altered gravity, a 3D cell culture model has been established from TCam-2 cells, a seminoma-derived cell line considered the only human cell line available to study in vitro mitotically active human male germ cells. TCam-2 cell spheroids were cultured for 24 hours under unitary gravity (Ctr) or simulated microgravity (s-microgravity) conditions, these last ones were obtained using the Random Positioning Machine (RPM). A significant increase in intracellular ROS and mitochondria superoxide anion levels has been observed after RPM exposure. In line with these results a trend of protein and lipid oxidation increase, and increased pCAMKII expression levels were observed after RPM exposure. The ultrastructural analysis by Transmission Electron Microscopy revealed that RPM-exposed mitochondria appeared enlarged and, even if seldom, disrupted. Notably, even the expression of the main enzymes involved in the redox homeostasis appears modulated by RPM exposure in a compensatory way, being GPX1, NCF1, and CYBB downregulated, whereas NOX4 and HMOX1 upregulated. Interestingly, HMOX1 is involved in the heme catabolism of mitochondria cytochromes, and therefore the positive modulation of this marker can be associated to the observed mitochondria alteration. All together, these data demonstrate TCam-2 spheroid sensitivity to acute SM exposure and indicate the capability of these cells to trigger compensatory mechanisms that allow to overcome the exposure to altered gravitational force.

Currently, large cell neuroendocrine carcinoma of the lung (LCNEC) is classified as a rare lung cancer subtype, but given the high incidence of lung cancer, the overall number of cases is considerable. The pathologic diagnosis is based on the microscopic appearance of the tumor cells, the amount of intra-tumoral necrosis, the mitotic rate, and the presence of positive neuroendocrine markers identified by immunohistochemistry. Recently, a subdivision into two main categories was proposed based on mutation signatures involving the RB1, TP53, KRAS, and STK11/LKB1 genes, into SCLC-like (small cell lung cancer-like) and NSCLC-like (non-small cell lung cancer-like) LCNEC. In terms of treatment, surgery remains the best option for resectable, stage I–IIIA cases. Chemotherapy and radiotherapy have conflicting evidence. Etoposide/platinum remains the standard chemotherapy regimen. However, based on the newly proposed LCNEC subtypes, some retrospective series report better outcomes using a pathology-driven chemotherapy approach. Encouraging outcomes have also been reported for immunotherapy and targeted therapy, but the real impact of these strategies is still being determined in the absence of adequate prospective clinical trials. The current paper scrutinizes the epidemiology, reviews the reliability of pathologic diagnosis, discusses the need for molecular subtyping, and reviews the heterogeneity of treatment algorithms in LCNEC.

Background: The intrauterine and early extrauterine development represents a “window of opportunity” in the immunological development. The underlying mechanisms are still poorly understood. The aim of this study was to provide reference values B cell subpopulations in cord blood of term newborns, juveniles and in adults to find the spectrum of their physiological age-related variation. Methods: In this study, we used flow cytometry to evaluate human B lymphocytes and subpopulations in cord blood (n = 10), in peripheral blood from healthy juveniles aged 1 to 17 years (n=20) and from donors aged 24 to 62 years (n = 10). Results: Our findings showed increasing frequencies of IgM memory B cells, class-switched memory B cells, marginal zone B cells and plasmablasts, from cord blood to peripheral blood of juveniles and adults. In con-trast, the percentage of naïve B cells was higher in newborns than in juveniles and adults. The frequencies of were similar in cord blood and peripheral blood of adults. Interestingly, transitional B cells frequencies were similar in cord blood and adults but significantly lower in juveniles. Conclusions: The frequencies of circulating B cell subpopulation are subject to considerable changes during on-togeny, reflecting overlying effects of maturation and of the acquisition of an adaptive immune memory.

Background: Cord blood represents a link between intrauterine and early extrauterine development. Cord blood cells map an important time frame in human immune imprinting processes. It is unknown whether sex of the newborn affects the lymphocyte subpopulations in cord blood. Methods: 9 B and 21 T cell subpopulations were characterized by flow cytometry in human cord blood from 16 male and 21 female newborns, respectively. Results: Except for marginal zone B cells and transitional B cells, B cell count in all subsets was higher in cord blood of male newborns than in female newborns. Frequency of naive thymus negative Th cells was significantly higher in male cord blood whereas the remaining T cell subpopulations showed a higher count in cord blood of female newborns. Conclusion: Our study is the first revealing sex differences in B and T cell subpopulations of human cord blood. These results indicate that sex might have a higher impact for the developing immune system urging the need to expand research in this area.

The use of hydrogen fuel cells as a mobile source of electricity might prove to be a keystone in future decarbonization of heavy duty road and marine transport. Due to complex interplay of various physicochemical processes in the fuel cells, further development of these devices will rely on concerted effort of researchers from various fields, e.g. chemistry, physics, electric and mechanical engineering. This results in knowledge gaps which are filled by the information, dispersed in wide range of literature, but rarely covered in a short and condensed form. To address this issue and with the aim of providing a concise and simple explanation of fuel cell operation, we propose a simple educational model of the most relevant processes in the fuel cell, aimed at proper description of causal relations. The derivation of model equations provides an intuitive understanding of electric potentials acting on protons on the microscopic level and relates this knowledge to the common terminology in fuel cell research community, such as catalyst electric overpotential and internal membrane resistance. The results of the model fit well with experimental data, indicating that a simple description, provided in the paper, is sufficient for intuitive understanding of fuel cell operation.

Dendritic Mesoporous Organosilica Nanoparticles (DMON) are a new class of biodegradable nanoparticles suitable for biomolecules delivery. In order to escape from the endosomes-lysosomes and to deliver biomolecules in the cytoplasm of cells, we studied photochemical internalization (PCI) and photodynamic therapy (PDT) of DMON. We added photosensitizers in the framework of DMON. DMON were also loaded with siRNA or FVIII factor protein. We made four formulations with four different photosensitizers, The photosensitizers allowed to perform imaging of DMON in cancer cells, but the presence of the tetrasulfide bond in the framework of DMON quenched the formation of singlet oxygen. Fortunately one formulation allowed to efficiently deliver proapoptotic siRNA in MCF-7 cancer cells leading to 31% of cancer cell death, without irradiation. For FVIII protein, it was loaded in two formulations with drug loading capacities (DLC) up to 25%. In conclusion DMON are versatile nanoparticles which allowed to load siRNA and to deliver it in cancer cells, and to load FVIII protein with good DLC. Due to the presence of tetrasulfide, it was not possible to perform PDT and PCI.

Cardiovascular diseases remain the leading cause of mortality worldwide. Although new therapies are actively being developed and used for cardiovascular pathologies, these attempts have not significantly decreased mortality rates. Regenerative medicine has made enormous progress and set promising approaches over the past half-century. However, since autologous (donor-derived) vascular grafts are lacking, an alternative prosthesis must be constructed for cardiovascular disease patients. In vascular tissue manufacturing and regenerative medicine, scientists seek to improve this significant clinical challenge using bio-fabrication techniques combining additive manufacturing, biomaterials science, and advanced cellular biology. In the last few decades, many improvements and changes in various approaches have helped develop bioengineered concepts that reflect native blood vessels’ structure and function. However, numerous challenges must be overcome to clinically translate the next generation of tissue-engineered vascular transplants. This review provides update on the cell sources, scaffold essential for cardiovascular tissue engineering, and tissue engineering approaches as prospective options for curative therapy for blood vessel disease.

Abstract: Arranged patterns obtained by ultrafast laser processing on the surface of Ti/Cu/Ti/Si and Ti/Zr/Ti/Si thin film systems are reported. Two differently designed multilayer thin films, Ti/Cu/Ti/Si and Ti/Zr/Ti/Si, were deposited on silicon by the ion sputtering method. The bioactive surfaces on these systems involve the formation of laser-induced periodic surface structures (LIPSS) in each of the laser-written lines of mesh patterns on 5x5 mm areas. The formation of nano- and micro-patterns with an ultra-thin oxide film on the surfaces was used to observe the effects of morphology and proliferation of the MRC-5 cell culture line. To determine whether Ti-based thin films have a toxic effect on living cells, an MTT assay was performed. The relative cytotoxic effect as a percentage of surviving cells showed that there was no difference in cell number between the Ti-based thin films and the control cells. There was also no difference in the viability of the MRC-5 cells, except for the Ti/Cu/Ti/Si system, where there was a slight 10% decrease in cell viability.

The multidrug-resistant fungal pathogens belonging to the Candida haemulonii complex and the phylogenetically related species Candida auris are well-known for causing infections that are difficult to treat due to their multidrug-resistance profile. C. auris is even more worrisome due to its ability to cause outbreaks in healthcare settings. These emerging yeasts produce a wide range of virulence factors that facilitate the development of the infectious process. In recent years, the aggregative phenotype has been receiving attention, as it is mainly associated with defects in cellular division and its possible involvement in helping the fungus to escape from host immune responses. In this study, we initially investigated the aggregation ability of 18 clinical isolates belonging to the C. haemulonii species complex and C. auris. Subsequently, we evaluated the effects of physicochemical factors on the fungal aggregation competence. The results demonstrated that cell aggregation was a typically time-dependent event, in which almost all studied fungal isolates exhibited high aggregation after 2 h of incubation at 37°C. The aggregation was not impacted by pH, temperature, -mercaptoethanol (a protein-denaturing agent) and EDTA (a chelator agent). Conversely, proteinase K, trypsin and sodium dodecyl sulfate significantly diminished the aggregation. Collectively, our results demonstrated that the aggregation ability in these opportunistic yeast pathogens is time-dependent, and surface proteins and hydrophobic interactions seem to mediate cell aggregation, since the presence of proteases and anionic detergent affected the aggregation ability. However, further studies are necessary to better elucidate this phenomenon.

Background: Exposure to inorganic arsenic (iAs) remains a global public health problem. The liver is the main target organ of arsenic, leading to arsenic-induced liver fibrosis. Autophagy is involved. Phosphatase and tensin homology deleted on chromosome ten (PTEN) may participate in arsenic-induced liver fibrosis by regulating autophagy, but the exact mechanisms remain unclear. We established a mouse model of arsenic poisoning through the drinking water, and a fibrosis model using the huma stellate cell (HSC) line LX-2, which was exposed to NaAsO₂ for 24h. HE and Masson staining was adopted to observe the degree of liver fibrosis. The cells were transfected using PTEN overexpression plasmid. Western blot and qRT-PCR were used to determine the levels of protein/mRNA expression. The in vivo results were confirmed in HSCs exposed to NaAsO₂, with changes suggesting fibrosis as seen in mice. NaAsO₂ upregulated the expression of the autophagic markers microtubule-associated protein light chain A/B (LC3), recombinant human autophagy effector protein (Beclin-1), hairy and enhancer of split homolog-1 (HES1), but downregulated PTEN. α-smooth muscle actin (α-SMA) expression was significantly upregulated in all NaAsO₂ groups. PTEN overexpression altered NaAsO₂-induced autophagy which LC3, Beclin-1 were downregulated. Notch1, HES1, α-SMA, and collagenⅠexpression were all downregulated in the NaAsO₂ groups. In conclusion, PTEN overexpression might decrease autophagy and inhibit fibrosis progression caused by this toxin. The NOTCH1/HES1 pathway is likely to be involved in this process. Most previous studies did not investigate PTEN and arsenic-induced liver fibrosis specifically. The present study highlights the importance of targeting PTEN for the management of arsenic exposure.

Background Cancer is one of the most concerning public health issues in the world. One of cancer hallmarks wildly accepted is sustaining proliferative signaling, which involved most of the cell cycle biological activities. Centromeric histone, Centromere Protein A (CENPA), a variant of canonical histone H3, plays an essential role in selective chromosome segregation in the cell cycle. However, so far, a systematic pan-cancer bioinformatic analysis has not been done yet. Methods We accessed genome, transcriptome, and clinical information from open databases. The genetic alteration, mRNA expression, functional enrichment, stemness, mutation association, expression in cell populations and cellular locations, cell cycle association, survival association of CENPA, and immune association were analyzed. A prognostic model for glioma patients was constructed as an example application of CENPA as a biomarker. Drugs targeting CENPA in cancer cells were also screened and predicted by the CENPA correlation of drug sensitivity and protein-ligand docking. Results CENPA had low gene mutation in cancers. CENPA was overexpressed in almost all cancer types in TCGA compared to their normal control. CENPA was highly expressed in the nucleus of malignant cells. CENPA was associated with the cell cycle of cancer cells. CENPA is a biomarker for the cell cycle G2 phase in cancer cells. CENPA was a diagnostic and prognostic biomarker across multiple cancer types. The prognosis of glioma with CENPA was reliable and can be applied with other prognostic factors. CENPA was associated with the immune microenvironment. Drugs CD-437, 3-Cl-AHPC, Trametinib, BI-2536, and GSK461364 were predicted to target CENPA in cancer cells. Conclusion CENPA was a cell cycle biomarker in cancers with diagnostic and prognostic value.

Quantum cell automata (QCA) is a nanotechnology that uses a transistor-free structure to design digital circuits and overcome the limitations listed for CMOS circuits. The computing circuits that make up the bulk of computers can be designed and using this technology. Subtractors are a big part of computational circuits. This research deals with the design of a subtractor that due to the innovation in the design of this circuit and the novel arrangement of quantum cells of its kind has caused the number of cells used in the design of the circuit to reach its lowest value compared to previously designed circuits. The size of the circuit as well as the loss power are minimized compared to the circuits designed by the subtractors. Another trait clears of this circuit compared to many previous designs is its single-layer design, which reduces latency and noise in the output waveform. The circuit designed by the QCADesigner simulator is tested and simulated inadition the results are displayed in the simulated waveform. Also, the results of calculations for power dissipation in each QCA cell were evaluated by QCAPro software, which is a powerful tool for estimating power loss simulation. It has less implementation and level (single layer) than Previous designs.

This paper proposes a solution for the development of microclimate monitoring for Low Voltage / High Voltage switchgear using the PRTG Internet of Things (IoT) platform. This IoT-based real time monitoring system can enable predictive maintenance to reduce the risk of electrical station malfunctions due to unfavorable environmental conditions. The combination of humidity and dust can lead to unplanned electrical discharges along the isolators inside a low or medium voltage electric table. If no predictive measures are taken, the situation may deteriorate and lead to significant damage inside and outside the switchgear cell. Thus, the mentioned situation can lead to unprogrammed maintenance interventions that can conduct to the change of the entire affected switchgear cell. Using a low-cost and efficient system, the climate conditions inside and outside the switchgear is monitored and transmitted remotely to a monitoring center. From the results obtained using a 365-day time interval, we can conclude that the proposed system is integrated successfully in the switchgear maintaining process, having as result the reducing of maintenance costs.

Trypanosome brucei, the causative agent of African sleeping sickness, harbours a highly ordered, subpellicular microtubule cytoskeleton that defines many aspects of morphology, motility and virulence. This array of microtubules is associated with a large number of proteins involved in its regulation. Employing proximity-dependent biotinylation assay (BioID) using the well characterized cytoskeleton-associated protein CAP5.5 as a probe we identified CAP50 (Tb927.11.2610). This protein colocalizes with the subpellicular cytoskeleton microtubules but not with the flagellum. Depletion by RNAi results in defects in cytokinesis, morphology and partial disorganization of microtubule arrays. Published proteomics data indicate a possible association of CAP50 with two other, yet uncharacterized, cytoskeletal proteins, CAP52 (Tb927.6.5070) and CAP42 (Tb927.4.1300), which were therefore included in our analysis. We show that their depletion causes phenotypes similar to those described for CAP50 and that they are essential for cellular integrity.

To investigate the effect of acidic nanoparticles on proton conductivity, permeability and fuel cell performance, a commercial Nafion® 117 membrane was impregnated with zirconium phosphates (ZrP) and sulfated zirconium (S-ZrO2) nanoparticles. The tensile test, water uptake, methanol crossover, Fourier-transform infrared spectroscopy (FTIR), X-ray diffraction (XRD), Thermal gravimetric analysis (TGA) and Scanning Electron Microscopy (SEM) were used to assess the ca-pacity of nanocomposite membrane to function in a fuel cell. The modified Nafion® membrane obtained the higher water uptake and a lower water content angle than the commercial Nafion® 117 membrane, indicating that it has a greater impact on conductivity. Under strain rates of 40, 30 and 20 mm/min, the nanocomposite membranes demonstrate more stable thermal deterioration and higher mechanical strength, which offers tremendous promise for fuel cell applications. When compared to 0.113 S/cm and 0.013 S/cm, respectively, of commercial Nafion® 117 and Nafion® ZrP membranes, the modified Nafion® membrane with ammonia sulphate acid had the highest proton conductivity of 7.891 S/cm. When tested using a direct single cell methanol fuel cell, it had the highest power density of 183 m. cm-2 which is better than commercial Nafion® 117 and Nafion® ZrP membranes.

The purine nucleoside analogues cladribine and pentostatin are highly-active first-line therapeutic treatments for hairy cell leukemia (HCL), resulting in complete response rates of 80 to 90%. However, HCL patients continue to relapse, and sooner or later, most require subsequent lines of treatment. This report presents the relapsed patients with classic HCL who were treated with vemurafenib (mostly at the low dose of 240 mg twice daily for 16 weeks) combined with rituximab after the failure of several lines of therapy including cladribine with or without rituximab and moxetumomab pasudotox. Two patients achieved CR MRD (-) after combined treatment with vemurafenib and rituximab, with a hematologic response ongoing after 38 months from the end of treatment in one patient and a relapse of cytopenias occurring after 13 months in the other patient. A third patient normalized her blood counts and this hematologic response, which was not evaluated in the bone marrow at the end of treatment, was lost after 18 months. The last patient died due to infection and multi-organ failure, too early to verify response to vemurafenib. Two patients who had relapsed after vemurafenib and rituximab derived meaningful clinical benefit from retreatment with the same agents, but eventually relapsed again and started indefinite therapy with dabrafenib and trametinib with normalization of the blood counts despite heavy bone marrow infiltration in the only patient so far evaluable. The outcomes of these cases indicate that novel targeted agents, and in particular vemurafenib combined with rituximab, improve the prognosis of HCL patients, even those heavily pretreated with PNAs and moxetumomab pasudotox

The mechanisms involved in immune responses to cancer have been extensively studied for several decades and, considerable attention has been paid to harnessing the immune system's therapeutic potential. Cancer immunotherapy has established itself as a promising new treatment option for a variety of cancer types. Various strategies including cancer vaccines, monoclonal antibodies (mAbs), adoptive T-cell-cancer therapy and immune test therapy have gained prominence through immunotherapy. However, it remains to be accomplished the full potential of cancer immunotherapy. In spite of having startling aspects, the cancer immunotherapies have some difficulties including the inability to effectively targeting the cancer antigens and the abnormalities in patient response. With the advancement of technology, this system has changed the genome-based immunotherapy process in the human body including generation of engineered T cells. Due to its high specificity, CRISPR-Cas9 has become a simple and flexible genome-editing tool to target nearly any genomic locus. Recently, the CD19-mediated CAR-T cell (chimeric antigen receptor T cell) therapy has opened a new avenue for the treatment of human cancer, though low efficiency is a major drawback of this process. Thus, increasing the efficiency of the CAR-T cell (engineered T cells that induce the chimeric antigen receptor) by using CRISPR-Cas9 technology could be a better weapon to fight against the cancer. In this review, we have broadly focused on the use of CRISPR-Cas9 technology for the modification of the T-cell, which can specifically recognize cancer cells and be used as immune therapeutics against cancer. We have also demonstrated the other potential strategies for the treatment of cancer.

Desmoplastic small round cell tumor (DSRCT) is an extremely rare, aggressive sarcoma affecting adolescents and young adults with male predominance. Generally, it originates from serosal surface of abdominal cavity. The hallmark characteristic of DSRCT is the EWSR1-WT1 gene fusion. This translocation up-regulates the expression of PDGFRα, VEGF and other proteins related to tumor and vascular cell proliferation. Current management of DSRCT includes a combination of chemotherapy, radiation and aggressive cytoreductive surgery plus intra-peritoneal hyperthermic chemotherapy (HIPEC). Despite advances in multimodal therapy, outcomes remain poor since the majority of patients present disease recurrence and die within 3 years. The dismal survival makes DSRCT an orphan disease with urgent need of new drugs. The treatment of advanced and recurrent disease with tyrosine kinase inhibitors, such as pazopanib, sunitinib, and mTOR inhibitors have been evaluated in small studies. Recent works using comprehensive molecular profiling of DSRCT identified potential therapeutic targets. In this review, we aim to describe the current studies conducted to better understand DSRCT biology and to explore the new therapeutic strategies under investigation in preclinical models and in early phase clinical trials.

Understanding the biology underlying the mechanisms and pathways regulating pancreatic β-cell development is necessary to understand the pathology of diabetes mellitus (DM), which is characterized by the progressive reduction in insulin producing β-cell mass. Pluripotent stem cells (PSCs) can potentially offer an unlimited supply of functional β-cells for cellular therapy and disease modeling of DM. Homeobox protein NKX6.1 is a transcription factor (TF) that plays a critical role in pancreatic β-cell function and proliferation. In human pancreatic islet, NKX6.1 expression is exclusive toβ-cells and is undetectable in other islet cells. Several reports showed that activation of NKX6.1 in PSC-derived pancreatic progenitors (MPCs), expressing PDX1 (PDX1⁺/NKX6.1⁺), warrants their future commitment to monohormonal β-cells. However, further differentiation of MPCs lacking NKX6.1 expression (PDX1⁺/NKX6.1^-) results in an undesirable generation of non-functional polyhormonal β-cells. The importance of NKX6.1 as a crucial regulator in MPC specification into functional β-cells directs attentions to further investigating its mechanism and enhancing NKX6.1 expression as a mean to increase β-cell function and mass. Here, we shed light on the role of NKX6.1 during pancreatic β-cell development and in directing the MPCs to functional monohormonal lineage. Furthermore, we address the transcriptional mechanisms and targets of NKX6.1 as well as its association with diabetes.

Background: Sickle cell disease is a major public health issue in the DRC while it is still poorly understood by health professionals. The objective of this study was to assess the knowledge and practices of Congolese physicians treating sickle cell disease (SCD) in order to identify areas for improvement in clinical care. Methods: This is a descriptive observational study conducted on Congolese physicians using a questionnaire. Participants were evaluated on a pre-established answer grid. Results: A total of 460 physicians participated, including 81 women (18%) with an average age of 35 years (range 25–60 years). Most physicians were general practitioners. Although self-assessment of their level of knowledge on SCD was estimated as average to good, less than half of the participants (n= 460; 46%) reported adequate management of vaso-occlusive crisis but only 1% of them had received specific training on SCD. Most physicians reported difficulties both in terms of diagnostic (65%) and management (79%) options of SCD patients. This study showed also that 85% of them did not have access to diagnostic tools for SCD. Conclusions: Insufficient knowledge on SCD, poor diagnostic and treatment options may contribute to morbidity and mortality of patients living in the DRC. Interventions aiming at improving physician’s knowledge, patient’s follow-up and treatment access are needed. Specific training alongside existing programs (HIV, malaria), early diagnosis of the disease, and creation of patients’ advocacy groups should improve SCD patient’s care.

Although decision making strategy based on clinico-histopathological criteria is well established, renal cell carcinoma (RCC) represents a spectrum of biological ecosystems characterized by distinct genetic and molecular alterations, diverse clinical courses and potential specific therapeutic vulnerabilities. Given the plethora of drugs available, the subtype-tailored treatment to RCC subtype holds the potential to improve patient outcome, shrinking treatment-related morbidity and cost. The emerging knowledge of the molecular taxonomy of RCC is evolving, whilst the antiangiogenic and immunotherapy landscape maintained and reinforced their potential. Although several prognostic factors of survival in patients with RCC have been described, no reliable predictive biomarkers of treatment individual sensitivity or resistance have been identified. In this review, we summarize the available evidence able to prompt more precise and individualized patient selection in well-designed clinical trials, covering the unmet need of medical choices in the era of next-generation anti-angiogenesis and immunotherapy.

The use of circulating cell-free (cf) DNA to monitor cancer progression and response to therapy has significant potential but there is only limited data on whether this technique can detect the presence of low frequency subclones that may ultimately confer therapy resistance. In this study, we sought to evaluate whether whole-exome sequencing of cfDNA can accurately profile the mutation landscape of metastatic melanoma. We used whole-exome sequencing (WES) to identify variants in matched tumor-derived genomic (g) DNA and plasma-derived cfDNA isolated from a cohort of 10 metastatic cutaneous melanoma patients. WES parameters such as sequencing coverage and total sequencing reads were comparable between gDNA and cfDNA. There was significant concordance between gDNA and cfDNA based on the total number of variants identified and the degree of overlap in variants which was independent of the site of tumor biopsy. The mutant allele frequency of common single nucleotide variants was lower in cfDNA reflecting lower read depth and dilution of circulating tumor DNA in the circulation by other cfDNA species. In addition to known melanoma driver mutations, several other melanoma-associated mutations were found to be concordant between matched gDNA and cfDNA. This study highlights that WES of cfDNA can capture clinically-relevant mutations present in melanoma metastases, but does not appear to provide any additional unique information on tumor heterogeneity. Targeted deep sequencing may be required to detect low frequency genomic aberrations known for predicting therapy resistance.

As a part of our ongoing research on endophytic fungi, we have isolated a sesterterpene mycotoxin, fusaproliferin (FUS), from Fusarium solani strain associated with the plant Aglaonema hookerianum Schott. FUS showed rapid and sub-micromolar IC₅₀ against pancreatic cancer cell lines. Time dependent survival analysis and microscopy imaging showed rapid morphological changes in cancer cell lines 4 hours after incubation with FUS. This provides a new chemical scaffold that can be further developed to obtain more potent synthetic agents against pancreatic cancer.

This research focuses on the effect of trampling on vegetation in high-mountain ecosystems through the electromagnetic spectrum’s interaction with plant pigments, cell structure, water content and other substances that have a direct impact on leaf properties. The most heavily visited part of the High Tatras in Poland was divided into polygons and, after selecting the dominant species within alpine swards, a detailed analysis of trampled and reference patterns was performed. An ASD FieldSpec 3 was used to acquire high-resolution spectral properties of plants, their fluorescence and the leaf chlorophyll content with the ts-ta temperature index and fraction of accumulated radiation in the range of photosynthesis (fAPAR) used as reference data. The results show that, along tourist trails, vegetation adapts to trampling with the impact depending on the species. A lower chlorophyll value was confirmed by a decrease in fluorescence, and the state of cellular structures was degraded in trampled compared to reference species, with a lower leaf reflectance. Also, at the extreme, trampling can eliminate certain species such as Luzula alpino-pilosa.

Background: Menarche as an important parameter in assessment of scoliosis progression in girls is proven to be dependent on geographical latitude. The aim of the study was to determine whether the age of menarche differs in scoliotic and non-scoliotic Balkan girls and the relation between menarche and laterality of scoliotic curves. Participants and methods: Retrospective study with three groups: scoliotic, non-scoliotic and control group. Patients data collection and analysis was approved by the Ethical committee of the Institute. Statistical analysis: Program SPSS 24 was used and included One-way ANOVA, Fisher’s and Chi-squared test to compare different groups. Statistical significance was defined as p&lt;0,05. Results: No statistically significant difference was found in age of menarche between the three groups (p=0,168). In scoliotic postmenarchal group, primary right curve was dominant in 54,80%, while in scoliotic premenarchal group primary left curve was dominant in 60,09% (p&lt;0,01). Conclusion: In Bosnia &amp; Herzegovina and Serbia Balkan girls, there was no significant difference in age of menarche between scoliotic and non-scoliotic girls. A significant difference was found in laterality of primary curve in premenarchal and postmenarchal scoliotic girls.

The global context of research for new sustainable energy storage technologies makes it a very active sector with significant scientific and economic challenges. Indeed, due to the irregular development of renewable energies and the shutdown of traditional power facilities, it is difficult to maintain a stable balance in terms of supply and demand: energy storage can help in particular for substantial changes in the latter. Metal air batteries have a higher energy density and are safer than other available energy storage devices. Based on the existing and proven lead-acid battery technology, this paper proposed an open cell foam manufactured by the Excess Salt Replication process for use as an anode for lead-air battery cellsies with sulphuric acid as the electrolyte. This will save lead and reduce the battery weight. A 25% antimonial lead alloy was used to produce open cell foams with a cell diameter between 2 mm and 5 mm for the antimonial lead-air battery. Preliminary results of the effective electrical conductivity of self-discharged primary battery cells, measured experimentally, showed that all antimonial lead foam-air battery cellsies performed better than that made from the same dense non porous antimonial lead alloy. This is generally due to their important specific surface area where oxidation-reduction reactions took place. A correlation between the effective electrical conductivity and the cell diameter has been established and the highest conductivity was obtained with a cell diameter of 5mm. The feasibility of such an electrical system has been demonstrated.

Our previous study demonstrated that mesenchymal stem/stromal cells (MSCs) induced the differentiation of myeloid-derived suppressor cells (MDSCs) in the bone marrow (BM) under inflammatory conditions. In the present study, we aimed to explore the signaling pathway in BM cells responsible for MDSC generation. RNA-seq revealed that the mitogen-activated protein kinase (MAPK) pathways, among biochemical pathways, exhibited the highest number of differentially expressed genes in BM cells with MSC coculture relative to those without. Western blot confirmed strong phosphorylation of c-Jun N-terminal kinase (JNK) in BM cells cocultured with MSCs under GM-CSF stimulation, whereas p38 kinase activation remained unaltered by MSCs. Inhibition of JNK by SP600125 significantly abolished the expression of Arg1 and Nos2, the hallmark genes of MDSCs, as well as Hif1α, a molecule mediating monocyte functional re-programming into suppressive phenotype, in MSC-cocultured BM cells, while increasing TNF-α in response to lipopolysaccharides stimulation. Furthermore, JNK inhibition markedly abrogated the effect of MSCs on the production of TGF-β1, TGF-β2 and IL-10 in BM cells. These results suggest that MSCs induce MDSC differentiation in BM during inflammation, at least in part, through the activation of the JNK MAPK signaling pathway.

Sweetpotato is an important miscellaneous grain crop in China, which is threatened by a variety of diseases and insect pests in the process of cultivation and production. sweetpotato stem rot is one of the common sweetpotato diseases, which seriously affects the yield and quality of sweetpotato. However, there are few studies on the mechanism of resistance to stem rot in sweetpotato. In this study, transcriptome sequencing analysis was carried out on the samples at different stages (T1, T2, T3) of stem rot pathogen infecting Xushu 48, and 44839 (T1-VS-T2), 81436 (T1-VS-T2) and 61932 (T2-VS-T3) differentially expressed genes (DEGs) were obtained. The DEGs were mainly concentrated in Alanine, aspartate and glutamate metabolism (ko00250), Carbon fixation in photosynthetic organisms (ko00710) and Amino sugar and nucleotide sugar metabolism (ko00520) and some candidate genes related to plant pathogen infection, such as receptor-like protein kinase (RLK5, RLK7), LRR receptor-like serine/threonine-protein kinase (SERK1), bHLH137, ERF9, MYB73 and NAC053, were screened. The results of this study provide genetic resources for the research on stem rot resistance of sweetpotato and provide theoretical basis for sweetpotato resistance breeding.

Mixed lineage leukemia 1 (MLL1) introduces 1-, 2- and 3-methylation into histone H3K4 through the evolutionarily conserved set domain. In this study, bovine embryonic stem cells (bESCs, named bESCs-F7) were established from the in vitro fertilized (IVF) embryos by Wnt signaling inhibition, while its contribution to endoderm in vivo is limited. To improve the quality of bESCs, MM-102, an inhibitor of MLL1, was applied to the culture. The results showed that MLL1 inhibition along with GSK3 and MAP2K inhibition (3i) at the embryonic stage did not affect bESCs establishment and pluripotency. MLL1 inhibition improves the pluripotency and differentiation potentials of bESCs via up-regulation of stem cell signaling pathways such as PI3K-Akt and WNT. MLL1 inhibition decreases H3K4me1 modification at promoters in bESCs and altered the distribution of DNA methylation in bESCs. In summary, MLL1 inhibition enables bESCs to acquire better pluripotency, and its application may provide high quality pluripotent stem cells for domestic animals.

Bone marrow-derived mesenchymal stem cells (BMSCs) have been considered a promising therapeutic approach to cardiovascular disease. This study intends to compare the effect of BMSCs through a standard active cardiac support device (ASD) and intravenous injection on global myocardial injury induced by isoproterenol. BMSCs were cultured in vitro, and the transplanted cells were labeled with a fluorescent dye CM-Dil. Isoproterenol (ISO) was injected into the rats; two weeks later, the labeled cells were transplanted into ISO-induced heart-injury rats through the tail vein or ASD device for five days. The rats were sacrificed on the first day, the third day, and the fifth day after transplantation to observe the distribution of cells in the myocardium by fluorescence microscopy. The hemodynamic indexes of the left ventricle were measured before sacrificing. H&E staining and Masson’s trichrome staining were used to evaluate the cardiac histopathology. In the ASD groups, after three days of transplantation, there were many BMSCs on the epicardial surface, and after five days of transplantation, BMSCs were widely distributed in the ventricular muscle. But in the intravenous injection group, there were no labeled-BMSCs distributed. In the ASD+BMSCs-three days treated group and ASD+BMSCs -five days-treated group, left ventricular systolic pressure (LVSP), the maximum rate of left ventricular pressure rise (+dP/dt), the maximum rate of left ventricular pressure decline (-dP/dt) increased compared with model group and intravenous injection group (P<0.05). By giving BMSCs through ASD device, cells can rapidly and widely distribute in the myocardium and significantly improve heart function.

Soybean (Glycine max L.) is a vital leguminous crop known for its rich nutritional profile, includ-ing high protein and oil content, making it a valuable resource in global agriculture and human nutrition. In Pakistan due to regulatory issues non-GMO soybean is grown therefore, the universal herbicide control method is not applicable. Similarly, for other crops, specific herbicides are avail-able but for soybean no crop specific herbicide is present. A comprehensive study was conducted over two growing seasons, in 2022 and 2023, at Agronomic Research Farm University of Agri-culture Faisalabad. The research involved 16 different treatments, including both six pre-emergence and eight post-emergence herbicides as well as a control group and weedy check. Findings of this study showed that critical importance of weed management in soybean cultiva-tion, as unchecked weed infestation can lead to substantial yield losses. Among the pre-emergence herbicide S-Metolachlor + Pendimethalin performed best and showed higher plant height (54.33 cm & 53.67 cm), 100 grain weight (11.57 g & 12 g), seed yield plant-1 (13.07 g and 12.87 g), lower Susceptibility Index (10%), higher weed control percentage (91.21% & 95.65%) higher weed con-trol efficiency (92.02% & 93.43%), herbicide efficiency index (27.54% & 32.48%) and lower weed index (18.16% & 21.70%) during 2022 and 2023 respectively. However, in post emergence herbi-cide the Fluizefop-p-butyl is most effective herbicide due to less crop injury 10% Susceptibility In-dex, higher plant height (42.67 cm & 44 cm), whole plant weight (93.33 g & 95 g), 100-grain weight (11.40 g & 11.77 g), seed yield plant-1 (12.87 g & 13.13 g), higher weed control percentage (91.12% & 91.03%) higher weed control efficiency (89.73% & 92.36%, herbicide efficiency index (21.18% & 30.41%) and lower weed index (19.42% & 20.08%) in both 2022 and 2023 respectively. Notably, herbicides such as S-Metolachlor + Atrazine + Mesotrione, Topramezone, Mesosulfu-ron-methyl + Iodosulfuron-methyl sodium and Mesotrione + Atrazine led to complete plant mor-tality, resulting lethal to soybean. The findings of this study support the hypothesis that screened the best suitable herbicides with less plant injury, and higher efficiency index. So, it is recom-mended that the application of S-Metolachlor + Pendimethalin as PRE and Fluizefop-p-butyl as POST showed the least injury and best weed control results with higher grain yield.

In our country, the aging society is rapidly progressing, with an increase in patients with chronic kidney disease (CKD) and those undergoing dialysis, coupled with the aging of the population. As a result, the number of individuals with cognitive impairment (CI) is rising, and addressing this issue has become an urgent problem. One characteristic of dementia in CKD patients is the high frequency of vascular dementia, making the prevention through the management of classical risk factors such as hypertension, diabetes mellitus, dyslipidemia, smoking, etc., associated with atherosclerosis and arteriosclerosis. Other effective measures, including the use of renin-angiotensin system inhibitors, addressing anemia, exercise therapy, and lifestyle improvements, have been reported. Incidence and progression of CI may also be influenced by the type of dialysis or kidney replacement therapy, with reports suggesting that long-duration dialysis, low-temperature hemodialysis, peritoneal dialysis, and kidney transplantation (KTx) can have a possible preferable effect on preserving cognitive function.

Millions of people worldwide are affected by diabetes, a chronic disease that continuously grows due to abnormal glucose concentration levels present in the blood. Monitoring blood glucose concentrations is therefore an essential diabetes indicator to aid in the management of the disease. Enzymatic electrochemical glucose sensors presently account for the bulk of glucose sensors in the market. However, their disadvantages are that they are expensive and are dependent on environmental conditions, hence affecting their performance and sensitivity. To meet the increasing demand, non-enzymatic glucose sensors based on chemically modified electrodes for the direct electrocatalytic oxidation of glucose are a good alternative to the costly enzymatic-based sensors currently on the market, and the research thereof continues to grow. Nanotechnology-based biosensors have been explored for their electronic and mechanical properties, resulting in enhanced biological signalling through the direct oxidation of glucose. Copper oxide and copper sulfide exhibit attractive attributes for sensor application, due to their non-toxic nature, abundance, and their unique properties. Thus, in this review, copper oxide and copper sulfide-based materials, are evaluated based on their chemical structure, morphology, and fast electron mobility as suitable electrode materials for non-enzymatic glucose sensors. The review highlights the present challenges of non-enzymatic glucose sensors that have limited their deployment into the market.

An increase in Spodoptera species was reported in Bt soybean fields expressing Cry1Ac insecticidal proteins in Brazil, requiring additional management with chemical insecticides. Here, we evaluated the dose effects of flubendiamide and thiodicarb on Spodoptera cosmioides (Walker, 1858), Spodoptera eridania (Stoll, 1782), Spodoptera albula (Walker, 1857) and Spodoptera frugiperda (J. E. Smith, 1797) (Lepidoptera: Noctuidae) that survived on MON 87751 × MON 87708 × MON 87701 × MON 89788, expressing Cry1A.105, Cry2Ab2 and Cry1Ac; MON 87701 × MON 89788 soybean, expressing Cry1Ac; and non-Bt soybean. On unsprayed Cry1A.105/Cry2Ab2/Cry1Ac soybean, only S. frugiperda showed ~60% mortality after 10 d, whereas S. cosmioides, S. eridania and S. albula showed >81% mortality. Surviving larvae of all species on this Bt soybean showed &gt;80% mortality when exposed to the field label dose of flubendiamide (70 mL/ha) or thiodicarb (400 g/ha) or at 50% of these doses. In contrast, all four species had <25% and <19% mortality on Cry1Ac and non-Bt soybean, respectively. Surviving S. cosmioides, S. eridania and S. albula on these soybean types presented >83% mortality post-exposure to both dose levels of flubendiamide and thiodicarb. Some S. frugiperda larvae surviving on Cry1Ac and non-Bt soybean sprayed with a 50% dose of either insecticide developed into adults. However, L1 larvae developing on Cry1Ac soybean leaves sprayed with flubendiamide and L2 larvae on this soybean sprayed with thiodicarb had a prolonged immature stage, and females lower fecundity, which are likely to impact its population growth on soybean.

QTc interval measurement is a widely used screening tool to assess the risk of cardiac diseases, arrhythmias, and is a useful biomarker for pharmacovigilance. However, interpretation of QTc is difficult in neonates due to hemodynamic maturational changes and uncertainties on reference values. To describe trends in QTc values throughout infancy (1 year of life), and to explore the impact of (non)-maturational changes and medicines exposure, a structured systematic review (PROSPERO CRD42022302296) was performed. In term neonates, a decrease was observed over the first week of life, whereafter values increased until two months of age, followed by a progressive decrease until six months. A similar pattern, with longer QTc values was observed in preterms. QTc is influenced by cord clamping, hemodynamic changes, therapeutic hypothermia, illnesses and sleep, not by sex. Cisapride, domperidone and doxapram result in QTc prolongation in neo-nates. Further research in this age category is needed to improve primary screening practices, earlier detection of risk factors and precision pharmacovigilance.

The aims of the study are: a) Describe the reactogenicity of WHO-approved two mRNA (Pfizer-BioNTech, Moderna) and two non-RNA vaccines (Oxford-AstraZeneca, Sinovac) among lactating mother and baby pairs; and b) compare and contrast the reactogenicity between mRNA and non-mRNA vaccines. A cross-sectional, self-reported survey was conducted amongst 1784 lactating women who received COVID-19 vaccinations. The most common maternal adverse reaction was a local reaction at the injection site; the largest minority of respondents, 43.7% (780/1784), reported experiencing worse symptoms when receiving the second dose compared to the first dose. There were no major reported adverse effects or behavioural changes in the breastfed infants. Among the respondents who received non-mRNA COVID-19 vaccinations, a majority reported no change in lactation but those who did more commonly reported an increase in milk supply, decrease in milk supply and pain in the breast. The more commonly reported lactation changes (fluctuations in breastmilk supply and pain in the breast) for the non-mRNA vaccines were similar to that of respondents who received mRNA vaccines. Our study, with a large cohort and wide geographical and racial mix, further augments earlier reported findings that COVID-19 vaccines are safe for breastfeeding mothers and her children.

There is a need to search for new antifungals, especially for the treatment of the invasive Candida infections, caused mainly by C. albicans. These infections are steadily increasing at an alarming rate, mostly among immunocompromised patients. The newly synthesized compounds (3a-3k) were characterized by physico-chemical parameters and investigated for antimicrobial activity using the microdilution broth method to estimate minimal inhibitory concentration (MIC). Additionally, their antibiofilm activity and mode of action together with the effect on the membrane permeability in C. albicans were investigated. Biofilm biomass and its metabolic activity were quantitatively measured using crystal violet (CV) staining and tetrazolium salt (XTT) reduction assay. The cytotoxic effect on normal human lung fibroblasts and hemolytic effect were also evaluated. The results showed differential activity of the compounds against yeasts (MIC = 0.24-500 µg/mL) and bacteria (MIC = 125-1000 µg/mL). Most compounds possessed strong antifungal activity (MIC = 0.24-7.81 µg/mL). The compounds 3b, 3c, and 3e, showed no inhibitory (at 1/2 MIC) and eradication (at 8 x MIC) effect on C. albicans biofilm. Only slight decrease in the biofilm metabolic activity was observed for compound 3b. Moreover, the studied compounds increased the permeability of the membrane/cell wall of C. albicans and their mode of action may be related to action within the fungal cell wall structure and/or within the cell membrane. It is worth noting that the compounds had no cytotoxicity effect on pulmonary fibroblasts and erythrocytes at concentrations showing anticandidal activity. The present studies in vitro confirm that these derivatives appear to be a very promising group of antifungals for further preclinical studies.

Non-Alcoholic Fatty Liver Disease (NAFLD) is a term that covers a range of hepatic disorders involving fat deposits in the liver. NAFLD begins with simple steatosis and progresses into non-alcoholic steatohepatitis (NASH) characterised by inflammation, fibrosis, apoptosis, oxidative stress, lipid peroxidation, mitochondrial dysfunction and release of adipokines and pro-inflammatory cytokines. Oxidative stress and antioxidants are known to play a vital role in the pathogenesis and severity of NAFLD/NASH. A number of oxidative stress and antioxidant markers are employed in the assessment of the pathological state and progression of the disease. In this article, we review several biomarkers of oxidative stress and antioxidants that have been measured at clinical and experimental levels. The levels/ activity in various models reviewed are also included. Also included is a comprehensive description of oxidative stress, sources and contribution to the pathogenesis of NAFLD/NASH

Whole body electromyostimulation (WB-EMS) is frequently presented as a safe and attractive training technology, however evidence for this description is vague. Thus, the present study aimed to provide an overview of different aspects related to safety and attractiveness of WB-EMS in non-athletic cohorts. A systematic review of the literature according to PRISMA searched five electronic databases, two study registers and google scholar without language restrictions. Briefly, WB-EMS studies that reported adverse effects, loss to follow, withdrawal or attendance rates in non-athletic cohorts were included. Finally, 58 eligible studies were eligible. All studies applied low-frequency WB-EMS predominately 1-2x 20-25 min/week. Seventeen studies provided a superimposed protocol. While no study (n=56) reported serious adverse effects, four studies observed abnormal laboratory findings, albeit without clinical relevance. Loss to follow-up (10±11%) and withdrawal rate (5±6%) of WB-EMS trials were low, but did not differ from data for the non-training (10±12% and 4±6%) or exercise control groups (12±11% and 7±8%). In parallel, we observed high attendance rates (94±7%) in the WB-EMS groups that again did not relevantly vary from findings for the exercising control groups (n=20; 91±7%). WB-EMS can indeed be considered as a safe and attractive training technology for non-athletic cohorts, be it with or without health problems.

It has been well established that hypertension is considered as a predominant risk factor for the development of cardiovascular diseases. Despite the link between hypertension and cardiovascular diseases, hypertension may directly affect the cardiac function leading in heart failure, mostly with preserved ejection fraction (HFpEF). There are echocardiographic findings indicating hypertensive heart disease (HHD) defined as altered cardiac morphology (left ventricular concentric hypertrophy, left atrium dilatation) and function (systolic or diastolic dysfunction) in patients with persistent hypertension irrespective of cardiac pathologies to which it contributes, such as coronary artery disease and kidney function impairment. In addition to classical echocardiographic parameters, novel indices, like speckle tracking of the left ventricle and left atrium, 3D volume evaluation, myocardial work in echocardiography may provide more accurate and reproducible diagnostic and prognostic data in patients with hypertension. However, their use is still underappreciated. An early detection and prompt therapy of HHD will greatly improve the prognosis. Hence, in the present review, we shed light on the role of echocardiography in the contemporary diagnostic and prognostic approach of HHD.

Federated learning trains a neural network model using the client's data to maintain the benefits of centralized model training, while maintaining the privacy. However, if the client data are not independently and identically distributed (non-IID) because of different environments, the accuracy of the model may suffer from client drift during training owing to discrepancies in each client's data. This study proposes a personalized federated learning algorithm based on the concept of multitask learning to divide each client model into two layers: a feature extraction layer and a category prediction layer. The feature extraction layer maps the input data to a low-dimensional feature vector space. Furthermore, the parameters of the neural network are aggregated with those of other clients using an adaptive method. The category prediction layer maps low-dimensional feature vectors to the label sample space, with its parameters remaining unaffected by other clients to maintain client uniqueness. The proposed personalized federated learning method produces faster learning model convergence rates and higher accuracy rates for the non-IID datasets in our experiments.

Finding the roots of an equation is a fundamental problem in diverse fields. Optimization problem leads to non-linear equations for calculating the roots of the equation efficiently. Numerical iterative techniques are frequently applied when analytic solution is not available. Hybrid techniques to find roots of an equation is new to this fundamental problem. Recently, some attempts emerged to design hybrid algorithms for efficient solutions. A new heuristic algorithm is designed which is an intuitive approach to hybridization. In this paper, we implement two new algorithms: (1) a new BTsection algorithm blending the Bisection and Trisection algorithm, (2) a hybrid algorithm, that promises to be more efficient than the existing hybrid algorithms. The new hybrid algorithm is a blend of BTsection algorithm and Regula Falsi algorithm. The implementation results validate that the new algorithm, Hybrid4, surpasses the efficiency of existing hybrid algorithms Hybrid1, Hybrid2, and Hybrid3 algorithms. This paper contributes an essential hybrid algorithm to the repertoire of hybrid root finding algorithms.

Perinatal brain injury is a major public health problem burdened with high morbidity, mortality and severe neurological sequelae. Despite advances in neonatal life-saving technologies, neonatal encephalopathy lacks specific and effective treatment. Therefore, mechanisms of central nervous system changes associated with perinatal brain injury have been a hot topic of neonatology research. In recent years, researchers have shifted more focus from neurons themselves to perineuronal cells and intercellular interactions. As a member of the nervous system network, astrocytes are one of the dominant glial cells that regulate ion homeostasis, blood flow, and antioxidant function in the brain. Their changes in molecular mechanisms (e.g., alterations in RNA regulatory networks) during brain injury storms deserve further attention. Non-coding RNAs participate in and promote reactive pathophysiologic changes in astrocytes. The review summarizes and discusses the role of non-coding RNAs in astrocytes in recent years in studies of neonatal brain injury. It focuses on the most studied disease-related ncRNAs: miRNAs, lncRNAs and circRNAs, and hopes to provide possible directions for pathophysiological studies and therapeutic approaches of neonatal brain injury.

(1) Background: OCT imaging has been used to assess enamel demineralization in dental research but is not yet developed enough to qualify as a diagnostic technique in clinics. The current capabilities of most commercial acquisition software allow for visual and qualitative assessment. There is a need for a fast and verified batch-processing algorithm for segmenting and analyzing the de-mineralized enamel. This study suggests a GUI MATLAB algorithm for processing and quantitative analysis of the demineralized enamel. (2) Methods: A group of artificially demineralized human enamels was in vitro scanned under the OCT, and ROI frames were extracted. By using a selected intensity threshold colormap, inter- (Ie) and intra- (Ia) prismatic demineralization can be segmented. A set of quantitative measurements for average demineralized depth, average line profile, and integrated reflectivity can be obtained for an accurate assessment. Real and simulated OCT frames were used for algorithm verification. (3) Results: A strong correlation between automated and known Excel measurements for the average demineralization depth was found (R² > 0.97). (4) Conclusions: OCT image segmentation and quantification of the enamel demoralization zones are possible. The algorithm can assess the future development of a real-time assessment of dental diagnostics using an oral probe OCT.

This publication delves into the intricate world of human communication, extending beyond the realm of spoken and written language to explore the profound influence of non-verbal communication. Focusing on body language—comprising gestures, facial expressions, postures, and movements—it reveals the pivotal role it plays in conveying emotions, intentions, and psychological states. The rapidly evolving fields of neuroscience and cognitive science are investigating the neural mechanisms and cognitive processes that underpin the interpretation and utilization of these non-verbal cues. Notably, the amygdala's involvement in processing emotional facial expressions has provided a neurological foundation for our emotional understanding in non-verbal communication. Concurrently, cognitive psychology sheds light on how perception, attention, and memory influence our interpretation of non-verbal cues and communication strategies.In our modern, technologically advancing society characterized by global interconnectivity and cultural diversity, the significance of non-verbal communication, especially in digital and virtual contexts, is paramount. The transformation of non-verbal expression into digital symbols like emoticons and emojis raises questions regarding its ability to maintain authenticity and emotional understanding. This publication endeavors to comprehensively explore the fundamental role of body language and non-verbal communication in contemporary society. By integrating insights from psychology, neuroscience, social sciences, and digital technologies, it aims to elucidate the underlying mechanisms guiding non-verbal communication. Additionally, it delves into the implications of non-verbal communication across diverse domains, including interpersonal communication, the workplace, politics, advertising, and the virtual world.The research presented herein strives to offer a thorough understanding of interpersonal dynamics, relationships, and social behavior, with the goal of promoting the development of more effective, conscious, and ethically guided communication strategies. Ultimately, this analysis aspires to inspire further interdisciplinary research and reflection, addressing emerging challenges and fully leveraging the potential of non-verbal communication in modern society. This, in turn, guides our path towards a communication landscape that is more inclusive, authentic, and empathetic.

Heart transplantation (HT) represents the mainstream therapy of end-stage heart failure for selected patients with a median survival of more than 10 years after surgery and substantial improvement in quality of life. Current guidelines suggest a variety of examinations including invasive (coronary angiography and endomyocardial biopsy (EBM) and non-invasive methods (echocardiography, stress echocardiography, computed tomography, PET and MRI) to monitor HT patients. Guidelines do not specify the timing of echocardiographic evaluations and do not recommend echocardiography as an alternative to serial EMB in rejection monitoring [2]. They still recommend as gold standard coronary angiography to be done 1 year after surgery and every 2 years after. In this review we will discuss the advantages of non-invasive techniques over the invasive ones for an adequate follow-up of HT patients.

In terms of obtaining fuels as well as chemicals with or without catalysts at different conditions, the plum seed stands out as an alternative biomass source. Under varying heating rates (10, 50, and 100ºC min-1) and pyrolysis temperatures (400, 450, 500, 550 and 600 °C), the plum seed was pyrolysed at constant sweep gas flow at a constant rate (100 cm3min-1) in a tubular fixed bed reactor. According to the results, an oil yield reaching to a maximum of %45 was procured at the heating rate of 100 ºCmin-1 and the pyrolysis temperature of 550ºC in non-catalytic procedure. The catalytic pyrolysis was carried out in optimum conditions with two selected commercial catalysts, namely ZSM-5 and PURMOL-CTX and clinoptilolite (natural zeolite, NZ) with catalyst ratio of 10 % of raw material. Along with the catalyst addition, the quantity and the quality of bio-oil increased including the calorific value, removal of oxygenated groups, and hydrocarbon distribution. An increase related to the desirable products like phenols, alkene, and alkane and a decrease in undesirable products like acids were observed in the presence of catalysts. When all the results are considered and evaluated, using zeolite materials in the pyrolysis as catalysts is a recommendable option to achieve enhanced chemicals and fuels.

Fermented food matrices, including beverages, can be defined as the result of the activity of complex microbial ecosystems where different microorganisms interact according to different biotic and abiotic factors. Certainly, in industrial production the technological processes aim to control the fermentation to place safe foods on the market. Therefore, if food safety is the essential prerogative, consumers are increasingly oriented towards a healthy and conscious diet driving the production and consequently the applied research towards natural processes. In this regard, the aim to guarantee safety, quality and diversify of products should be reached limiting or avoiding the addition of antimicrobials or synthetic additives using the biological approach. In this paper, following the recent re-evaluation of non-Saccharomyces yeasts (NSYs) has been re-viewed the bio-protectant and biocontrol activity with a particular focus on their antimicrobial power, probiotic features and promoting functional aspects. In this review, the authors would underline the contribution of NSYs in all food production chain and its role in the technological and fermentative features for their practical and useful use as biocontrol agent in food preparations.

Here I describe an overlooked form of non-biological paralife (i.e., near-life) that has been evolving on Earth for millions of years, and is currently in the final stages of transitioning into a new form of life. Any consideration of non-biological life or paralife is complicated by the fact that there is no consensus among biologists for the definition of life. This ambiguity has caused disagreement about whether subcellular reproduction systems like viruses are a form of life, despite having genomes, mutations, heritable phenotypes and system-improving evolution. To resolve this problem, I develop a definition of life that is entirely functional and independent of any of the structural idiosyncrasies of biological life on Earth: an order-generating system controlled by internally-encoded information that perpetuates itself by functioning to counteract its entropic decay. Using this definition, subcellular transposons, plasmids, and viruses are paralife because they match the definition of life in all ways except that they induce their order-generating functioning by a living host rather through their own self-sustaining production system. Using this functional definition of life, I show that utility- products (UPs) like fabricated hand tools are part of induced-reproduction systems that have features equivalent to biological genomes, mutations, heritable phenotypes, and a process of system-improving evolution. The perceived benefit of utility-products causes them to induce their reproduction by a biological life-form (humans). For these reasons, human utility products are functionally just as close to being a form of life as subcellular transposons, plasmids, and viruses, i.e., they are Utility-Product paralife (UP-parlife). I also show that some forms of UP-paralife are currently evolving into mechanical life that is capable of both self- sustaining reproduction and system-improving evolution without outside assistance. This transition requires the development of a high level of factory and/or UP automation and artificial intelligence (AI) that is capable of complex reasoning, imagination and creativity. Finally, I consider the influence of UP-life and UP-paralife on the development of the level of structural complexity in the universe, and I briefly speculate about how these non-biological forms of life and paralife will influence the expansion of scientific knowledge about the universe.

Reliable quantification of pulmonary arterial pressure is essential in the diagnostic and prognostic assessment of a range of cardiovascular pathologies including rheumatic heart disease, yet an accurate and routinely available method for its quantification remains elusive. This work proposes an approach to infer pulmonary arterial pressure based on scientific machine learning techniques and non-invasive, clinically available measurements. A 0-D multicompartment model of the cardiovascular system was optimized using several optimization algorithms, subject to forward-mode automatic differentiation. Measurement data were synthesized from known parameters to represent the healthy, mitral regurgitant, aortic stenosed and combined valvular disease situations with and without pulmonary hypertension. Eleven model parameters were selected for optimization based on 95 % explained variation in mean pulmonary arterial pressure. A hybrid Adam and limited-memory Broyden-Fletcher-Goldfarb-Shanno optimizer yielded the best results with input data including valvular flow rates, heart chamber volume changes and systematic arterial pressure. Mean absolute percentage errors ranged from 1.8 % to 3.78 % over the simulated test cases. The model was able to capture pressure dynamics under hypertensive conditions with pulmonary arterial systole, diastole, and mean pressure average percentage errors of 1.12 %, 2.49 % and 2.14 %, respectively. The relatively low errors highlight the potential of the proposed model to recover pulmonary pressures for diseased heart valve and pulmonary hypertensive conditions.

Background: Studies have demonstrated the link between vitamin D-related genetic variations and non-skeletal outcomes. We aimed to identify all available data on the association of vitamin D-related genetic variations with non-alcoholic fatty liver disease (NAFLD). Methods: Potentially eligible studies were identified from Embase and Medline databases from inception to June 2022 using search strategy that comprised terms for “Vitamin D” and “NAFLD”. Eligible study must report the association between vitamin D-related genetic variations and presence, severity or response to treatment of NAFLD. Data were extracted from each eligible study. Results: A total of 3,495 articles were identified. After systematic review, twelve studies were in-cluded. A total of 26 genetic variations were identified. Presence of NAFLD was associated with variations of GC (rs222054, rs222020, rs10011000, rs7041), VDR (rs2228570, rs11168287, rs10783219, rs4752), CYP24A1 (rs3787557, rs6068816, rs2296241, rs2248359) and CYP27B1 (rs4646536). Severity of NAFLD was associated with variations of GC (rs4588), VDR (rs2228570, rs4334089), CYP2R1 (rs10741657), DHCR7 (rs1544410, rs3829251, rs12785878) and CYP24A1 (rs3787557, rs6068816, rs6097809, rs6127119, rs2248359, rs3787554, rs4809960, rs6022999). Response to calcitriol treatment was associated with variation of VDR (rs10735810). Conclusions: Multiple vitamin D-related genetic variations were associated with NAFLD, indi-cating the role of vitamin D in the pathogenesis of NAFLD.

In this paper a new monolithic Eulerian formulation in the framework of non-classical continuum is presented for the analysis of fluid-strucutre interaction problems. In this respect, Cosserat continuum theory taking into account the micro-rotational degrees of freedom of the particles is considered. Continuum description of the model and variational formulation of the governing flow dynamics for non-classical -fluid-structure interaction nCFSI is presented. The model is analyzed by computing a well known benchmark problem by Hecht and Pironneau [16]. The algorithmic description is presented and implemented using FreeFEM++. Code is validated with the benchmark solution of Turek and Hron [38] in case of flow around a flag attached with cylinder. New microstructral behavior of the solution is studied and numerical simulations and results are shown in the form of figures. Some interesting feature of the flow is observed and microstructural characteristics are discussed.

Steel is one of the essential materials in the world's civilization. It is essential to produce many products such as pipelines, mechanical elements in machines, vehicles, profiles, and beam sections for buildings in many industries. Until the '50s of the 20th century, steel products required a complex process known as ingot casting; for years, steelmakers focused on developing and simplifying this process. The result was the con-tinuous casting process (CCP); it is the most productive method to produce steel. The CCP allows producing significant volumes of steel sections without interruption and is more productive than the formal ingot casting process. The CCP begins by transferring the liquid steel from the steel-ladle to a tundish. This tundish or vessel distributes the liquid steel, by flowing through its volume, to one or more strands having wa-ter-cooled copper molds. The mold is the primary cooling system, PCS, solidifying a steel shell to withstand a liquid core and its friction forces with the mold wall. Further down the mold, the rolls drive the steel section in the SCS. Here the steel section is cooled, solidifying the remaining liquid core, by sprays placed in every cooling segment all around the billet and along the curved section of the machine. Finally, the steel strand goes towards a horizontal-straight free-spray zone, losing heat by radiation mechanism, where the billet cools down further to total solidification. A moving torch cutting-scissor splits the billet to the desired length at the end of this heat-radiant zone.

Time-domain spectroscopy (TDS) in the Terahertz (THz) frequency range is gaining in importance in nondestructive testing of dielectric materials. One application is the layer thickness measurement of a coating layer. To determine the thickness from the measurement data, the refractive index of the coating layer must be known in the surveyed frequency range. For perpendicular incidence of the radiation, methods exist to extract the refractive index from the measurement data itself without prior knowledge. This paper extends these methods for non-perpendicular incidence, where the polarization of the radiation becomes important. Furthermore, modifications considering effects of surface roughness of the coating are introduced. The new methods are verified using measurement data of a sample of Inconel steel coated with yttria-stabilized zirconia (YSZ) and with COMSOL simulations of the measurement setup. To validate the thickness measurements, scanning electron microscopy (SEM) images of the layer structure are used. The results show good agreement with an average error of 1% for the simulation data and under 4% for the experimental data compared to reference measurements.

Discovery of microRNAs (miRNAs) twenty years ago, has advocated a new era of “Molecular Genetics”. About 2000 miRNAs are present, that regulate one third of the genome. MiRNAs dysregulated expression may contribute to several diseases including tumor growth. Their presence in body fluids, reflecting levels alteration in various cancers, merit circulating miRNAs as the “next generation biomarkers” for early stages tumor diagnosis and/or prognosis. Herein, we performed a comprehensive literature search focusing on the origin, biosynthesis and role of miRNAs and summarized the foremost studies centering on miRs value as non-invasive biomarkers in different non-communicable diseases, including various cancer types. Moreover, during chemotherapy many miRNAs were linked to multidrug resistance, via modulating numerous biological processes and/or pathways that will be highlighted as well.

(1) Aim of the study was to investigate the spatial and temporal characteristics of the airflow created by two commercially available non-contact tonometers, the CorvisST and the Ocular Re-sponse Analyser. (2) The airflow pressure was measured using a MEMS pressure sensor to inves-tigate the spatial and temporal distribution. The airflow from the CorvisST and Ocular Response Analyser were mapped to a 600µm and a 1mm resolution grid, respectively. (3) Central airflow pressure of the CorvisST (96.4 ± 1.4)mmHg was higher than the Ocular Response Analyser (91.7 ± 0.7)mmHg. The duration of the air-puffs also differed, with the CorvisST showing a shorter du-ration (21.483 ± 0.2881)ms than the ORA (23.061 ± 0.1872)ms. The rising edge of the CorvisST airflow pressure profile demonstrated a lower gradient (+8.94mmHg/ms) compared to the Oc-ular Response Analyser (+11.00mmHg/ms). Both had similar decay response edges; CorvisST -11.18mmHg/ms, Ocular Response Analyser -11.65mmHg/ms. (4) The study presents a valid method to investigate physical dimensions of the airflow pressure of non-contact tonometers. Novel findings relating to the magnitude, duration and spatial characteristics of the respective airflow pressures are reported. It is anticipated that this information will better inform clinical studies and theoretical models relating to ocular biomechanics.

The goal of this study is to better understand the relation between the practice of Mindfulness and the sexual activity, sexual satisfaction and erotic fantasies of Spanish-speaking participants. This research focuses on the comparison between people who practice Mindfulness versus naïve people, and explores the practice of Mindfulness and its relation with the following variables about sexuality: body awareness and bodily dissociation, personal sexual satisfaction, partner and relationship-related satisfaction, desire, subjective sexual arousal, genital arousal, orgasm, pain, attitudes towards sexual fantasies and types of sexual fantasies. The sample consisted of 106 selected adults, 32 men and 72 women, who completed six measures on an online survey platform: a) Mindfulness Attention Awareness Scale (MAAS), b) Scale of Body Connection (SBC), c) New Sexual Satisfaction Scale (NSSS), d) Scale of Sexual Activity in Women (SSA-W) and Men (SSA-M), e) Hurlbert Index of Sexual Fantasy (HISF), f) Wilson's Sex Fantasy Questionnaire. In the MAAS, Body Awareness subscale (SBC), NSSS, SSA-W and SSA-M, HISF and intimate fantasies subscale (Wilson’s questionnaire), people in the Mindfulness condition showed higher scores and these differences were statistically significant. These results may have relevant implications in the sexuality of clinical and non-clinical samples.

Economists have long been interested in examining inflation-growth nexus. Nevertheless, the nature of their relationship and the optimal level of inflation threshold for economic growth have still remained controversial in both theoretical and empirical works. Accordingly, this study investigates the existence of threshold effects of inflation on economic growth in Ethiopia over the period 1975-2018 using a Two-regime Threshold Auto-regressive (TAR) model. The study mainly departs from previous works since it estimates sector-specific inflation threshold level in food and non-food sectors. Our preliminary analyses clearly reveal that inflation in food sector has become more volatile, less-persistent and key contributor to the general inflation as compared to its non-food counterpart. Further, The TAR model results and robustness checks indicate the existence of inflation threshold in a range of 9-10%. In particular, the threshold level for food inflation is 10% and 8% for non-food inflation. In all cases, our results robustly confirm growth-detrimental effects of inflation after the threshold levels. After all, this study suggests the need for considering specific behaviors of food and non-food prices, and implementing appropriate fiscal and monetary policies to bring inflation down to a single-digit level.

Two opposed p–n diodes are connected with another junction that causes cancellation of the electric field in the depletion layer of each diode by the field of the other diode. This derived quantum diode is called the A system. Another dual diode, constructed by the same process but with the p- and n-types positioned as duality, called the B system. When a bias voltage is applied between the A and B systems, Lorentz conservation imparts a momentum (i.e., a wave number) to the carriers in the absence of any internal voltage. Thus, a superconducting bias current density appears without the need for cooling. The reappearances of electron–hole pairs on the junction surfaces are assumed to be described by entire wavefunctions normalized by the band gap. Based on the bias superconducting current, NOT and NAND gates were constructed from the quantum diode systems. Numerical calculations revealed that the constant phases of the entire wavefunctions of the p-and n-types converged. Accordingly, it was clarified that Bose–Einstein condensation and the Meissner effect (described by the London equation) occurred in the quantum diode systems. Moreover, the systems exhibited rectification characteristics and a switching speed of the order of 10^-14 s. Combining this switching property with the large bias superconducting current (of the order of several V), we developed NOT and NAND gates with direct quantum correlations among many qubits, which are unaffected by random and thermal noises. These gates have memorization and initialization properties and are compatible with existing and accumulating programing algorithms. Moreover, when harvesting a divergent current output from these systems, the bias superconducting current and memorization property preserve the formed quantum correlations.

Multiple preventive vaccines are being developed to counter the COVID-19 pandemic. The leading candidates have now been evaluated in non-human primates (NHPs) and human Phase 1 and/or Phase 2 clinical trials. Several vaccines have already advanced into Phase 3 efficacy trials, while others will do so before the end of 2020. Here, we summarize what is known of the antibody and T-cell immunogenicity of these vaccines in NHPs and humans. To the extent possible, we compare how the vaccines have performed, taking into account the use of different assays to assess immunogenicity and inconsistencies in how the resulting data are presented. We also summarize the outcome of SARS-CoV-2 challenge experiments in immunized macaques, while noting variations in the protocols used, including but not limited to the virus challenge doses.

Information theory provides robust measures of multivariable interdependence, but classically does little to characterize the multivariable relationships it detects. The Partial Information Decomposition (PID) characterizes the mutual information between variables by decomposing it into unique, redundant, and synergistic components. This has been usefully applied, particularly in neuroscience, but there is currently no generally accepted method for its computation. Independently, the Information Delta framework characterizes non-pairwise dependencies in genetic datasets. This framework has developed an intuitive geometric interpretation for how discrete functions encode information, but lacks some important generalizations. This paper shows that the PID and Delta frameworks are largely equivalent. We equate their key expressions, allowing for results in one framework to apply towards open questions in the other. For example, we find that the approach of Bertschinger et al. is useful for the open Information Delta question of how to deal with linkage disequilibrium. We also show how PID solutions can be mapped onto the space of delta measures. Using Bertschinger et al. as an example solution, we identify a specific plane in delta-space on which this approach’s optimization is constrained, and compute it for all possible three-variable discrete functions of a three-letter alphabet. This yields a clear geometric picture of how a given solution decomposes information

Non-pharmacological interventions in the fight against COVID 19 include: a) suppression, which facilitates its extinction; and b) mitigation, which reduces its speed of spread. Left unmitigated, the intensive care unit bed capacity (ICU) is exceeded over its maximum supply, resulting in increased deaths. Suppression has shown in simulation models the potential for decreasing ICU occupation below its surge limit, effectively decreasing mortality. However, for avoiding a rebound in transmission, suppression must be maintained intermittently until a vaccine is available (which may take up to 2 years). The objective of this paper was to describe the mortality patterns observed in Spain, Italy and South Korea for discussing a hypothetical combined public health policy and socioeconomic model that could potentially reduce mortality while reducing the economic impact of this pandemic in Spain. The plan is based on a progressive-voluntary reinstatement to work of the population exposed to the lowest risks (healthy non-immune family units <50 y/o and immune population) and it depends on having sufficiently available ICU beds for providing adequate support. This model, if proven correct for Spain, could eventually be followed by other countries facing a similar impact of the present pandemic.

From experimental studies of protein folding, it is now clear that there are two types of folding behavior, i.e., two-state folding and non-two-state folding, and understanding the relationships between these apparently different folding behaviors is essential for fully elucidating the molecular mechanisms of protein folding. This article describes how the presence of the two types of folding behavior has been confirmed experimentally, and discusses the relationships between the two-state and the non-two-state folding reactions, on the basis of available data on the correlations of the folding rate constant with various structure-based properties, which are determined primarily by the backbone topology of proteins. Finally, a two-stage hierarchical model is proposed as a general mechanism of protein folding. In this model, protein folding occurs in a hierarchical manner, reflecting the hierarchy of the native three-dimensional structure, as embodied in the case of non-two-state folding with an accumulation of the molten globule state as a folding intermediate. The two-state folding is thus merely a simplified version of the hierarchical folding caused either by an alteration in the rate-limiting step of folding or by destabilization of the intermediate.

This study evaluates eight-year ownership costs for battery electric vehicles (BEV) versus non-plugin hybrid vehicles using forecasting to estimate future electricity and conventional gasoline prices and incorporating these in a multiple design of experiments simulation. Results suggest that while electric vehicles are statistically dominant in terms of variable costs over an 8-year life-span, high-performance hybrid non-plugins achieve variable fuel costs nearly as good as low-performing electric vehicles (those attaining only 3 miles per kilowatt hour) and that these hybrid acquisition costs are (on average) lower yet the vehicles retain higher residual values. In general, the six smallest ownership costs are split evenly between hybrid and electric vehicles; however, inflation for conventional regular gasoline is estimated to outstrip inflation per kilowatt hour. Thus, non-plugin hybrid cars are likely to require considerably more advanced engineering to keep pace.

The relationship between economic growth, growth volatility and financial sector development continues to attract attention in the theoretical and empirical literature. Over time, some studies hypothesize that finance has a causal linear relationship with growth. Recently several other authors contradict this claim and argue that the relationship that exists between finance and growth is nonlinear. We investigate these claims for Nigeria for the period between 1970 and 2015, using semi-parametric econometric methods, Hansen sample splitting techniques and threshold estimator. We observed no evidence of ‘Too much finance’ as claimed by many researchers in recent times. We show that the relationship between financial development and economic growth is U-shaped. This is equally true for the relationship between financial development and growth volatility. We also discuss policy implications of our findings and recommend financial innovations and decentralization of stock exchanges to boost access to financial services, in addition, improved regulation to enhance financial market efficiency.