Background: 3D virtual reality (VR) Motionless Imagery Exercise through Avatar (MIEA) was developed to improve elderly’s psychological (cognitive and emotional) and physical health. This study observed the impact of this program on the cognitive functions and emotional well-being and the electrophysiological changes in older adults. Methods: This study was conducted using a randomized controlled trial design. The participants included 38 adults, 65 to 84 years of age, who were physically mobile and neurologically healthy. Among them, 19 participants were assigned to the experimental group, who underwent exercises using elderly avatars in a VR virtual exercise program. The other 19 participants were assigned to the control group who underwent the VR program. Both groups engaged in the VR intervention for 20 minutes three times a week, over six weeks. Results: The cognitive functions, including attention restraint, working memory, and phonemic fluency, of the experimental group showed significant improvements compared to the control group. Regarding emotional well-being, the experimental group showed greater self-efficacy. The electrophysiological changes revealed similar patterns to exercise-induced reactions in electromyography of the experimental group after intervention. Conclusions: These findings confirm that participation in 3D VR MIEA enhances cognitive functions and physical self-efficacy among the elderly. Therefore, 3D VR MIEA can be utilized in the rehabilitation therapy of patients or elderly with limited physical activity.

The COVID-19 pandemic profoundly impacted older people in residential aged care facilities (RACFs), especially those with dementia. This retrospective cohort study investigates the impact of the pandemic on agitation incidents within this population in 40 Australian RACFs. We compared pre-pandemic data (January-October 2019) with during-pandemic data (same months in 2020 and 2021) from electronic health records (EHRs) using Python to extract information from nursing notes. Various statistical analyses, including descriptive statistics to summarize the data, and a chi-square test to examine any significant association between the COVID-19 pandemic and the prevalence of dementia and agitation in dementia. Dementia prevalence dropped by 1.98% in 2021 compared to 2019, and by 4.09% compared to 2020 (p < 0.05). Overall agitation symptoms decreased by 20.1% from 2019 to 2021 (p < 0.05), but six specific symptoms increased: resisting (28.98%), wandering (11.78%), restlessness (3.19%), complaining (10.1%), arguing (2.36%), and outbursts (1.74%) (p < 0.05). Conversely, pacing decreased by 15.88% and speaking loudly de-creased by 10.9% (p < 0.05). Over half of the care recipients experienced agitation symptoms 2-5 times each year, increasing from 50.56% in 2019 to 58.28% in 2021 (p < 0.05). It is important to exercise caution regarding the accuracy of these findings due to the reduced opportunity for busy care staff to record behavioral changes caused by the isolation of individuals in their rooms during the pandemic.

Supporting the implementation of school food and nutrition policies (SFNPs) is an international priority to encourage healthier eating among children and youth. Schools are an important intervention setting to promote childhood nutrition, and many jurisdictions have adopted policies, guidelines, and programs to modify the school nutrition environment and promote healthier eating. The purpose of this study was to explore the association between perceived adequacy and capacity for SFNP implementation on food availability and policy adherence in the province of Nova Scotia (NS), Canada, one of the first regions in Canada to launch a comprehensive SFNP. A cross sectional online survey was conducted in 2014-15 to provide a current-state of policy implementation and adherence. Adequacy and capacity for food policy implementation was used to assess policy adherence through the availability of prohibited ‘minimum’ nutrition foods. An exploratory factor analysis was conducted on a selected of available foods and ‘slow’ and ‘quick’ service food composition measures were dichotomized for food availability. Schools with above perceived average adequacy and capacity for policy implementation had more than three times (3.62) greater odds of adhering to a lunch policy, while schools that adhered to a snack and lunch policy had 52% and 82% lower odds of serving quick service foods, respectively. This study identified the need for appropriate adequacy and capacity for policy implementation to ensure policy adherence and improve the school food environment. These findings highlight the potential of SFNPs to have a positive impact on childhood nutrition, but adequately supporting their implementation is critical to ensure their impact.

This study examines the current functioning of Health Care Bioethics Committees (HBCs) in Chile, with the objective of providing recommendations for improving public health care management. Through a comprehensive literature review and a case analysis of the ‘Hospital Clínico de la Universidad de Chile’, the structure, functions and challenges of the CEA are explored. The research reveals the importance of the multidisciplinary composition of the committees, the need for continuing education in bioethics, and the relevance of the consultative role in ethical decision making. The results suggest that the effectiveness of CABs does not necessarily depend on the number of members or the length of their terms of office, but on the quality of their training and experience. It is concluded that for adequate health care management, it is essential to strengthen the role of the CEA in the ethical education of health care personnel and in the development of institutional regulations, as well as to improve their visibility and accessibility within the Chilean health care system.

The early detection of small cracks in large structures is a crucial requirement for the implementation of structural health monitoring (SHM) system with a low transducer density. This work presents the results of the analysis of scattering of a submillimeter notch type defect with semielliptical shape with a groove at constant width 100µm in a 4.1mm thick aluminum plate. The defect is investigated with an ultrasonic guided wave (UGW) A0 mode at 550 kHz to cover long range in a thick plate. The mode selection is obtained by interdigital transducers designed to operate with 5mm central wavelength. The novel contribution is the assessment of the scattering amplitudes at different orientations of the defect when the distance is large as 35 cm in pulse-echo mode or 70 cm in pitch-catch mode. The system model is based on Finite Element Model (FEM) simulations and the results are in good agreement with experimental tests. The detection of the defect is obtained by comparing the scattered signals from the defect with base line signals of the pristine laminate. The analysis of scattering features and the efficient excitation with a probing UGW show the potential implementation in real structural health monitoring (SHM) systems.

Introduction: Guardians play a pivotal role in the management of childhood illness. Their responsibilities include home managing childhood illnesses and supporting continuity of care following healthcare facility treatment. Evidence has shown that guardians' negative experience in health care facilities when accessing under-five childcare services impacts their utilization of such facilities. Exploration of guardians' experiences is important in providing the evidence base necessary for quality childcare and reducing under-five morbidity and mortality. The study aimed to explore the experiences of guardians of children under five regarding the care received in Vhembe healthcare facilities. Methods: A qualitative approach using an interpretative phenomenology analysis (IPA) was used for this study. The study was conducted in eight primary healthcare facilities in the Vhembe district, with the highest headcount for children under five. Sixteen guardians were purposefully sampled for the study. Data analysis was done following the IPA steps of data analysis. Trustworthiness criteria were followed: credibility, confirmability, dependability, authenticity, and transferability. Ethical approval was obtained from the university and the province, followed by permission from the district and the operational managers before data collection. Results: The three emerging themes are associated with participants' positive experiences as they interfaced within the healthcare system: quality care, healthcare environment, support, and empowerment. The ten sub-themes were: timely service provision, availability of medicines, perceived nursing competence and professionalism, person-centred care, welcoming environment, effective communication, positive attitude of healthcare providers, guardians’ satisfaction with care received, guardians' involvement in childcare and community support. Conclusion: It is indeed not always bad. The participants in this study had positive care experiences, which is crucial in the optimal utilization of health care services, resulting in improved health outcomes.

The present study was conducted to evaluate the effects of dietary supplementation of tea polyphenol （TP） on serum hormone, serum enzyme activity, antioxidant-related and immune-related gene expression of laying hens under heat stress. A total of 288 Chinese yellow chicken (186 days old) were randomly distributed among two treatments, each of which included 6 replicates of 24 hens. Dietary treatments were that the basal diet was supplemented with 200 mg / kg tea polyphenol. The study lasted for 7 weeks, including 1 week of adaptation and 6 weeks of the formal test. The content of high-density lipoprotein cholesterol (HDL-C) and total protein (TP) in serum significantly decreased by dietary supplementation with tea polyphenol. Dietary tea polyphenol supplementation improved serum superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) enzyme activity and decreased serum malondialdehyde (MDA) content in treatments compared to the control. However, supplementation of tea polyphenol did not affect the activity of serum catalase (CAT). The results indicated that long-term feeding of tea polyphenols help to increase the amount of hormones (FSH, E2) associated with reproduction in laying hens and thus improve egg production. It also improved the immune function of laying hens in high temperature environments. Adding tea polyphenols to the diet can significantly increase the serum IgG, IgM content of the laying hens and can upregulate the IgA content. Dietary supplementation of tea polyphenols in the laying hens significantly increased the expression of antioxidant enzyme-related genes (SOD, CAT and GPX1) in the liver. Moreover, the addition of tea polyphenols significantly increased the expression of immune-related genes (Interferon-γ (INF-γ), Interleukin 2 (IL-2) and Interleukin 4 (IL-4)) in the spleen. It is concluded that addition of tea polyphenols has a positive effect on antioxidant activity and immune function of laying hens.

The rapid growth of the global wearable technologies market is projected to reach $61.30 billion by 2030 which reflects a shift towards personalised health monitoring embedded in everyday activities. This paper explores the potential of embroidered interdigitated transducer (IDT)-based sensors for non-invasive, continuous monitoring of human biomarkers, particularly glucose levels, in human sweat. The study employs innovative embroidery techniques to create flexible fabric-based sensors with gold-coated IDTs. Experimental results demonstrate the sensor’s capability to detect water droplets and glucose concentrations, showcasing promising applications for health monitoring. The embroidered IDT-based sensors offer a unique approach for seamless integration into clothing, paving the way for personalised, continuous health data capture.

In recent decades, there has been a rising demand for anti-aging interventions aimed at postponing or potentially reversing indicators of skin aging. The use of collagen-based nutraceutical supplements has gained popularity as they have shown promise in enhancing skin health and reducing signs of aging. The aim of this randomized, placebo-controlled, blinded study was to investigate the effects of 2.5 g COLLinstant® LMW, a novel cosmeceutical containing low molecular weight (≤ 1000 Da) collagen peptides, on skin aging and health. The trial was conducted in 80 healthy women aged 30 years and older. They received a daily oral dose of either the food supplement (n = 40) or placebo (n = 40) for six weeks. Skin assessment was performed based on validated objective methods, such as Visioface 1000D (skin wrinkling), cutometry (elasticity and fatigue) and corneometry (skin hydration) at baseline (T0), and at week 6 (T6). After 6 weeks, participants that received collagen had significant improvements in biometric skin wrinkle parameters from baseline, with a reduction in volume by 46%, in area by 44%, and in depth by 9%, along with a greater increase in skin moisturization (by 34%) than those in the placebo group (p &lt; 0.001). The food supplement did not significantly modify skin firmness or fatigue and had only slight beneficial effects on skin elasticity. The investigational product was well tolerated. The observed effects aligned closely with the subjective assessments reported by study participants. The study provides substantiated evidence supporting the efficacy of low molecular weight collagen peptides in restoring altered skin biometric parameters, as objectively assessed. Thus, regular supplementation with this nutraceutical may contribute to achieving smoother and more radiant skin.

Finding, safe and reliable alternatives to fungicides is one of the most actual challenges in agriculture. In this regard, our experiment investigated the effectiveness of different elicitors, botanical extracts and essential oils to control grey mould (Botrytis cinerea) and powdery mildew (Podosphaera aphanis) on strawberry plants. Furthermore, the defence mechanisms activated in plants after treatments were investigated. The trial was conducted in field conditions under plastic tunnel with strawberry plants ‘Elsanta’. In the first experiment, a group of strawberry plants was treated before flowering with elicitors [acibenzolar-S-Methyl – (BTH), chitosan], botanical extracts (seaweed extract, alfalfa hydrolysate) and essential oils (thyme and juniper) to evaluate their ability to reduce the incidence of grey mould infection on flowers. In the second experiment, another group of plants was treated before and after experimental inoculation with P. aphanis. Results indicated that the incidence of flower infected by B. cinerea was significantly reduced by thyme and juniper essential oils, showing values that were not significantly different from the commercial fungicide penconazole (positive control). As a consequence, final yield of essential oil-treated plants was +27% higher as compared to control. No significant differences emerged for other tested products against grey mould. However, gene expression analysis showed an up-regulation of FaEDS1, FaLOX and PR gene expression (FaPR1, FaPR5, FaPR10) in leaves treated with BTH. The other tested natural substances also elicited defence-related genes, however at a lower level than BTH. In the experiment, all treatments applied prior inoculation significantly reduced the incidence and severity of powdery mildew as compared to control. At 28 days after inoculation, chitosan and thyme essential oil applications performed similarly to their positive controls (BTH and penconazole, respectively), showing a significant reduction of disease incidence (by -84 and -92%) as compared to control. Post-inoculum application of essential oils showed similar effective action to fungicide (penconazole) in reducing incidence and severity of powdery mildew. These results indicate that the tested substances could be used as alternatives to fungicides for the control of grey mould and powdery mildew in strawberry, therefore representing a valuable tool for the control of these fungal diseases under the framework of the sustainable agriculture.

Background/Objectives: Nail technicians frequently have musculoskeletal pain, which impairs their job performance. A high-risk profession linked to back discomfort that causes morbidity is nail technician. QEC is a tool used for observing and assessing risks in a work environment. The goal of this research is to assess the ergonomic risks, pain, and their relationship with posture among manicurists. Methods: The 35 nail technicians filled the assessment form which consists of occupational information, pain, European Community Respiratory Health Survey, Nordic Musculoskeletal Questionnaire and QEC worker part. Physicians assessed nail technicians’ workspace and QEC outcomes. Results: It was stated that they worked an average of 61.92±11.09 hours per week, served an average of 11±5 customers per day, and their condition lasted 53.96±36.51 months. There is a strong significant correlation between discomforts, time spent in occupation (p=0,000) and working hours. Manicure, pedicure, unwanted hair removal, correction of eyebrow were considered for ergonomic risk evaluation. Each occupation accompanied repeated bad postures. Most of them were scored in very high risk categorization for back static positions (more than 29 point). Conclusions: This study may be useful for nail technicians seeking ergonomic improvements in the areas of engineering, administration, behavior, or personal.

A vast amount of non-biodegradable waste is generated during mining and processing operations of dimensional stones such as marble. This, over the years has become a global nuisance by damaging the environment through means of more than one. Therefore it has become necessary to find a technique to safely dispose or reuse marble waste. This paper reviews the impact of replacement of the conventional materials by marble waste was studied in terms of fresh, mechanical and durability properties of concrete. The air pollution caused by the dust generated in the process of crushing and extracting marble can cause serious problems to the general physiological functions of plants and it affects human life as well. Therefore, the objectives of this study were to assess the air quality of areas with marble factories and areas without marble factories, where the concentration of particulate matter in terms of total suspended particles (TSP) was determined. This paper also reviews some eco-innovation options considering the pollution caused, consumption of water and electricity and the disposal of marble waste and their waste.

Poor perinatal mental health can have significant and lasting impacts on a woman’s overall health and the well-being of her children and family. From conception, a baby's behavior, appearance, aversions, and interests can be influenced by the prenatal environment. Thus, the quality of prenatal care is crucial. Factors such as maternal stress, environmental conditions, cravings, mood swings, hormonal changes, and emotional experiences during pregnancy can profoundly affect the baby’s behavior once born. The baby's interaction with the external world begins from conception, not just at birth. For instance, maternal depression can negatively affect both the mental and physical health of the infant. Therefore, fostering a supportive environment for expectant mothers is essential for their health and that of their unborn child. Promoting the mother’s well-being through happiness and comfort is critical.This review paper aims to synthesize current research on maternal-fetal attachment during pregnancy, its evolution, and its postpartum effects on the mother-infant relationship. It will explore how these dynamics change over time, both during pregnancy and after delivery, to provide a comprehensive understanding of the factors influencing attachment and related outcomes. As Alan Soufre, a famous developmental psychologist would state, "Attachment would begin before birth. The mother’s emotional state can shape the child’s development trajectory long before the child is born."

Background: Neurofeedback (NFB) or EEG-Biofeedback is a non-invasive therapeutic method, based on the theory of operating conditioning, and designed to change the functioning of the brain by sending feedback that provides positive or negative reinforcement. The goal is to teach the patient how to perceive specific cortical activation states and how to achieve them on purpose. NFB has been used to treat various mental disorders, including Post-traumatic Stress Disorder (PTSD). Traditional treatments for PTSD have several limitations; very few individuals are willing to relive the traumatic experience. Placing itself as an effective alternative, Neurofeedback allows the unresponsive patient to recourse to an alternative intervention to relieve their symptoms without reliving the anguish of trauma, consequently presuming a lower percentage of drop-out. Considering the importance of integrated approaches to clinical practice, NFB was integrated with Trauma-Informed Motivational Interviewing (TIMI). The TIMI approach is a new therapeutic paradigm for clinical interviews that aims to help users work through their trauma and transform it from a point of weakness to a point of strength. Integrating TIMI with NFB can help overcome the current trend of passive implementation of intervention tools, leading to greater user responsiveness and fewer residual symptoms. To improve treatment adherence, moreover, it has been suggested to incorporate Virtual Reality (VR) into the NFB system. VR, through the "sense of presence," provides a more immersive experience than 2D visualization, potentially resulting in faster cortical training. Lastly, the research protocol aims to focus on a population at high risk of PTSD that is often overlooked in research, such as workers who are victims of occupational PTSD.Methods: The study design involves in-depth analysis of a specific clinical case. Baseline measurements were taken for enrollment and at the following time points: T1 (pre-treatment), T2 (post-treatment), and T3 (follow-up). These measurements included various psychometric assessments to evaluate PTSD symptoms, treatment acceptability, safety, and adherence, as well as biological measures related to the brain's electrophysiological activity.Results and Conclusion: Our research reveals that the synergy between virtual reality-mediated Neurofeedback and trauma-motivational interviewing produces significant results. TIMINB stands out as a low-cost, effective, and completely risk-free procedure. This approach could represent a groundbreaking innovation in the field of Cyberpsychology and psychological therapies.

Cirrhosis is a critical global health issue, responsible for 2.4% of deaths worldwide in 2019. The Global Burden of Disease Study reported a near doubling of decompensated cirrhosis cases from 1990 to 2017. In the U.S., cirrhosis is the 12th leading cause of death and often requires hospitali-zation and procedural interventions for severe complications such as hepatocellular carcinoma, ascites, hepatic encephalopathy, and variceal bleeding. This study aims to identify racial, ethnic, and socioeconomic disparities in receiving critical interventions among U.S. patients with de-compensated cirrhosis during 2020-2021. We conducted a retrospective cross-sectional analysis using 2020-2021 National Inpatient Sample data of adult patients (≥18 years) with cirrhosis-related and cirrhosis complication-related ICD-10 codes and who underwent procedures for cirrhosis-related indications such as esophagogastroduodenoscopy (EGD) for variceal hemor-rhage, transjugular intrahepatic portosystemic shunt (TIPS) for variceal hemorrhage or refractory ascites, hemodialysis for acute kidney failure or hepatorenal syndrome, and liver transplantation We collected data on patient baseline clinicodemographic and procedural outcomes. Statistical analyses included multivariable logistic regression to assess for associations with outcomes. There were significant disparities in procedure utilization: White and Hispanic patients more likely than Black patients to receive EGD and TIPS, while Black and Hispanic patients had higher odds of receiving hemodialysis. Insurance type also influenced access, with Private/HMO insurance holders having higher odds of undergoing procedures. These findings underscore the need for targeted interventions to address healthcare inequities.

World Health Organization recommends adjusting the salt intake as a part of the nine global targets to reduce premature mortality from non-communicable chronic diseases as priority and most cost-effective intervention. In 2006. the main aim of the Croatian Action on Salt and Health was to decrease salt intake for 16% because of its critical intake and consequences on human health. We have organized educative activities for increasing awareness on salt harmfulness, defined food categories of prime interest, collaborate with industries and determine salt intake (24h urine-sodium excretion). It was determined that the proportion of salt in ready-to-eat baked bread should not exceed 1.4%. In the period 2014 –2022, salt in the semi-white bread was reduced 14%, in bakery 22% and in largest meat industry in Croatia 25%. Awareness of the harmfulness of salt on health increased from 65.3% in 2008 to 96.9% in 2023 and salt intake was reduced 15.9%-1.8 grams/day (22.8% men, 11.7% women). In last 18 years a significant decrease in salt intake was achieved in Croatia, awareness of its harmfulness increased, collaboration with food industry established and regulatory documents launched. However, salt intake is still very high underlying the need for continuation of efforts and even stronger activities.

Newborn screening (NBS) is hailed as a public health success, but little is known about long-term outcomes following a positive newborn screen. There has been difficulty gathering long-term follow-up (LTFU) data consistently, reliably, and with minimal effort. Six programs developed and tested a core set of minimal LTFU data elements. After an iterative data collection process and the development of a data collection tool, the group agreed on minimal LTFU data elements. The denominator captured all infants with an NBS diagnosis, accounting for children who moved or died prior to the follow-up year. They also agreed on three LTFU outcomes: if the child was still alive, had contact with a specialist, and received appropriate care specific to their diagnosis within the year. The six programs representing NBS public health programs, clinical providers, and research programs provided data across multiple NBS disorders. In 2022, 83.8% (563/672) of the children identified by the LTFU programs were alive and living in the jurisdiction; of those, 92.0% (518/563) saw a specialist, and 87.7% (494/563) received appropriate care. The core LTFU data elements can be applied as a foundation to address the impact of early diagnosis by NBS within and across jurisdictions.

Health innovations are generally oriented on a techno-economic vision. In this perspective, technologies are seen as an end in themselves, and there is no arrangement between the technical and the social values of innovation. This vision prevails in sanitary crises, in which management is carried out based on the search for punctual, reactive, and technical solutions to remedy a specific problem without a systemic/holistic, sustainable, or proactive approach. This paper attempts to contribute to the literature on the epistemological orientation of innovations in the field of public health. Taking the Covid-19 and Ebola crises as examples, the primary objective is to show how innovation in health is oriented towards a techno-economic paradigm. Second, we propose a repositioning of public health innovation towards a social paradigm that will put more emphasis on the interaction between social and health dimensions in the perspective of social change.

Background: Ovarian, cervical, and endometrial cancers stand as fatal health killers for women's mental and physical health, especially affecting female reproductive systems. Exploiting weakly supervised learning and explainable AI techniques are crucial for fast, accurate, and robust automatic marker detection, efficient prevention, and primary treatment of gynecological tumors. Methods: With respect to the PRIMSA methodology, weakly supervised learning schemes and deep learning-based schemes are investigated in the cross-subject fields of clinical diagnostic imaging and explainable AI technology. Related methods, opening research problems, and challenging subjects are explored in the screening and treatment of gynecological tumors and performing cancer image diagnosis in the latest study. Results: Keynote approaches combining ultrasound medicine, explainable AI, and clinical imaging technology are summarized. In combination with learning-based methods with medical imaging, prospective insights are put forward for refreshed concepts on treatments in the area of gynecological oncology, with a feasible range of applications for their corresponding AI techniques. Conclusions: Explainable AI and deep learning-based approaches are capable of performing accurate classification between benign and malignant tumors, yielding a pathway to care for women's health, improving the survival rate of patients, pacing with disease prediction, and matching the strategic goal of "Healthy China 2030".

Today, issues related to people’s mental health and well-being have been described as a challenge for society, globally as well as in Sweden. This calls for new approaches to mental health promotion. The aim was to evaluate the adequacy of the content and structure, describing experiences of study circles as a means of supporting participants' self-care and self-compassion. The overall design is a descriptive, QUAL+quan design, where quantitative and qualitative results are integrated. Five participants participated in a focus group interview, of whom four completed questionnaires. One individual interview was conducted with the study circle leader. Study circles can be an arena for mental health promotion as learning and sharing of experience contributes to a sense of coherence, as well as self-compassion and a genuine concern for one’s own and others' wellbeing, but not considered an alternative to psychiatric care, for those in need of professional services. Study circles can be a possible means to support self-care and thereby promote mental health in the general population, and a valuable contribution to public health. However, in addition to modifications of the content, further research is needed on the qualifications for study circle leaders as well as the dissemination of study circles.

OCTA is an imaging modality used in the assessment of the retinal vasculature. It operates on the principle of coherence tomography used in standard OCT with the addition of delineating the retinal vascular. This provides a modern non-invasive retinal vascular imaging method compared to conventional dye-based imaging. High quality depth resolution of the superficial and deep capillary networks is possible on OCTA whereas this was not possible prior. OCTA may be limited by image quality degradation from factors such as motion artefact or media opacities, and therefore may not be the investigation of choice for all patient groups. There are multiple potential clinical applications for OCTA in retinal and choroidal vascular disease. Ongoing research is necessary to substantiate the more widespread use of OCTA due to its significant cost burden compared to current modalities.

This paper discusses the application of artificial intelligence in imaging omics, especially in cancer research. Imaging omics enables detailed analysis of spatial and temporal heterogeneity of tumours through high-throughput extraction of quantitative features from medical images such as MRI, PET, and CT. This paper focuses on applying PARKS systems to automate the recognition, segmentation, and extraction of image features, significantly enhancing the capabilities of clinical decision support systems (CDSS). The future direction is to establish a robust network infrastructure for radiology Medication-led Health care (RLHC) to facilitate the development and application of personalised treatment protocols, and to improve diagnostic accuracy, prognosis assessment, and treatment recommendations by uploading quantitative image features to a shared database and comparing them with historical images.

Background: Our previous study highlighted important healthcare access and utilization concerns among new immigrants. Hence, in this study, we aimed to explore the role of public and patient involvement (PPI) may have in enhancing the accessibility and their contribution to migration health studies. Method: An open and in-depth interactive consecutive virtual discussion was conducted among volunteer asylum seekers and refugees from Eritrea and Syria in Switzerland. The novel PPI establishment had three phases; inception, training phase, and contribution phase. Result: At the beginning, the concept of PPI was apprehensive to grasp, as it was a new approach. After training and consecutive discussions, volunteers were ardent to engage actively. Hence, among the prime findings were the PPI's role and effect in raising awareness, PPI's role in exploring and communicating the healthcare system accessibilities and utilization among their community, the impact of PPI in echoing the healthcare needs of their fellow migrants, and PPI's contribution in enhancing and strengthening migration health researches. Conclusion: The PPI volunteers in the study were keen to raise their community's awareness through their networks, and bridge the research gap between researchers and the public.

Subcortical beetles interact with a wide range of semiochemicals released from different sources, including trees, fungi, and insect pheromones. While the attraction of bark beetles, their insect predators, and competitors to bark beetle pheromones is well-studied, the attraction of these beetle communities to other sources of semiochemicals remains poorly understood. We tested the attraction of bark and wood-boring beetles and their predators to host stress volatiles, fungal volatiles, and a mountain pine beetle lure in the field. Host stress volatiles were derived from lodgepole pine trees stressed by three fungal symbionts of mountain pine beetle and two common phytopathogens. Our results showed that bark beetles, particularly mountain pine beetles, show a preference for a combination of fungal volatiles, particularly 2-methyl-1-butanol and mountain pine beetle lures. Without the addition of lures, 2-methyl-1-butanol was also identified as a key fungal volatile in the attraction of mountain pine beetle competitors from the Cerambycidae and Buprestidae families. Predators in the Elateridae and Staphylinidae families showed attraction to host stress volatiles and the healthy tree volatile profile. These findings suggest that these chemicals warrant further field testing for potential use in monitoring and management of subcortical beetle populations.

Introduction: Obstructive sleep apnea (OSA) is not only common in the general population but even more so in patients with tumors of the head and neck region. Untreated, it leads to reduced quality of life, increased daytime sleepiness, and other comorbidities. The aim of this study was to determine the difference in the occurrence of OSA in the patient population with head and neck tumors compared to the general population as represented by the Trend cohort of the Study of Health in Pomerania (SHIP) , and to assess the influence of tumor treatment. Methods: Between July 2018 and December 2021, preoperative polysomnography was conducted in 47 patients with histologically confirmed squamous cell carcinoma in the oropharynx, hypo-pharynx, or larynx. A follow-up polysomnography was performed in 23 patients 2-11 months af-ter completing treatment. The collected data was correlated with tumor treatment and tumor size. Results: Of the included patients, 43 were male and four were female. Age ranged from 54 to 90 years. The pretherapeutic measurement found no significant difference in the prevalence of a pathologically elevated apnea-hypopnea index (AHI) in our patients compared to the SHIP-Trend cohort. In the follow-up measurement after treatment completion, a significant deterioration in AHI was observed. Initially, 70 % of patients had an AHI > 5, after therapy this increased to 87 %. The effect was particularly pronounced in the group of patients with advanced tumor stages who had received primary chemoradiation. Conclusion: OSA is a relevant condition in patients with head and neck cancer. Tumor treatment can lead to an increased occurrence of sleep-related breathing disorders, especially in patients with advanced tumor stages undergoing primary chemoradiation. Additional studies are neces-sary to better understand the exact mechanism involved.

The gastrointestinal tract is colonized by trillions of different microorganisms, named the gut microbiota, which is key to degrade undigested food such as dietary fibers. The fermentation of these food components leads to the production of short-chain fatty acids (SCFA) acetate, propionate, and butyrate, which exploit several beneficial roles for the host’s health. Their production and absorption happen in different ways in the human intestine and depend on the type of dietary fiber reaching the gut and the microorganisms involved in the fermentation. The supplementation of SCFAs, mostly butyrate, in treating gastrointestinal, metabolic, cardiovascular, and gut-brain-related diseases has been reported in the medical literature. This review aims to give an overview of the production and absorption dynamics of acetate, propionate, and butyrate in the human gut, with a final focus on the role played by these SCFAs on gastrointestinal and metabolic health and the present therapeutic implications.

Carbon monoxide (CO) is a colorless, odorless gas emitted from carbon fuel combustion. In this study we monitored indoor carbon monoxide (CO) levels for 120 homes over three seasons in the North Denver metropolitan region as part of an environmental justice initiative to quantify health and social well-being impacts from a major freeway construction upgrade nearby. Urban outdoor CO levels are typically very low (less than 1 ppm in Denver) due to air pollution control strategies and technologies implemented over the past several decades. However, people can still be exposed to higher than outdoor levels of CO in their homes due to the operation of indoor appliances that use carbon fuels such as natural gas. Our data show that ~10% of the homes had consistent daily average levels of CO above 3.5 ppm and 24-57% of the homes showed peaks greater than 9 ppm. While much higher levels can result in CO poisoning and fatalities, these lower levels of CO have been associated with adverse health impacts, especially pregnant women, and sensitive populations. Our results highlight the need for increasing awareness regarding CO exposures in homes with gas appliances and motivate the transition from non-electrified homes toward electrification.

Over the past decades, overweight and obesity has become a global epidemic and the leading threat for death. To prevent the serious risk, an overweight or obese individual must apply a long-term weight-management strategy to control food intake and physical activities, which is however, not easy. Recently, with the advances of information technology, more and more people can use wearable devices and smartphones to obtain physical activity information, while they can also access various health-related information from Internet online social networks (OSNs). Nevertheless, there is a lack of an integrated approach that can combine these two methods in an efficient way. In this paper, we address this issue and propose a novel mobile-social framework for health recognition and recommendation, namely, H-Rec². The main ideas of H-Rec² include (1) to recognize the individual's health status using smartphone as a general platform, and (2) to recommend physical activity and food intake based on personal health information, life science principles, and health-related information obtained from OSNs. To demonstrate the potentials of the H-Rec² framework, we develop a prototype that consists of four important components: (1) an activity recognition module that senses physical activity using accelerometer, (2) a health status modeling module that applies a novel algorithm to generate personalized health status index, (3) a restaurant information collection module that collects relevant information from OSN, and (4) a restaurant recommendation module that provides personalized and context-aware recommendation. To evaluate the prototype, we conduct both objective and subjective experiments, which confirm the performance and effectiveness of the proposed system.

The study of the concentrations and effects of fine particulate matter in urban areas have been of great interest to researchers in recent times. This is due to the acknowledgment of the far-reaching impacts of fine particulate matter on public health. Remote sensing data have been used to monitor the trend of concentrations of particulate matter by deriving aerosol optical depth (AOD) from satellite images. The Center for International Earth Science Information Network (CIESIN) has released the second version of its global PM_2.5 data with improvement in spatial resolution. This paper revisits the study of spatial and temporal variations in particulate matter in Saudi Arabia by exploring the cluster analysis of the new data. Cluster analysis of the PM_2.5 values of Saudi cities is performed by using Anselin local Moran’s I statistic. Also, the analysis is carried out at the regional level by using self-organizing map (SOM). The results show an increasing trend in the concentrations of particulate matter in Saudi Arabia, especially in some selected urban areas. The eastern and south-western parts of the Kingdom have significantly clustering high values. Some of the PM2.5 values have passed the threshold indicated by the World Health Organization (WHO) standard and targets posing health risks to Saudi urban population.

Age related macular degeneration (AMD) as the name suggest is the timely degradation of the macular area of the eye which can lead to vision impairment, in particular the central vision. Macular is one of the important areas of the eye, present in the retina which controls our central vision. AMD is one of the most common types of irreversible blindness caused in older population of the society in developed countries. AMD is broadly classified as Dry AMD (Non Neovascular AMD) and Wet AMD (Neovascular AMD). Non Neovascular AMD more commonly known as Dry AMD is less aggressive and is very frequent type of AMD caused, it has three stages 1) Early dry AMD, 2) Intermediate Dry AMD, and 3) Late AMD. One the several therapies used to treat AMD is stem cells where Induced pluripotent stem cells (IPSC’s) derived retinal pigment epithelium (RPE) cells was used to treat dry AMD. The use of siRNA that targets Vascular endothelial growth factor (VEGF-A) using different nanotechnology-based delivery system like the organic nanoparticles synthesized liposomes. An upcoming therapy used most widely in recent times is the photodynamic therapy where a photodynamic drug like verteporfin which a benzoporphyrin derivative is used, where the outcome shows great promise in reducing vision loss in wet AMD. This review discusses in details about age related macular degeneration and also its different novel therapies that is been currently used extensively.

Conversational artificial intelligence (AI) has shown strong capabilities in providing low-cost and timely interventions for a wide range of people and increasing well-being. Therefore, this study examined ChatGPT’s efficacy in conducting psychological counseling and its potential for providing accessible psychological interventions, especially in school settings. This study assessed the strengths and limitations of AI to inform future research. Data were generated from ChatGPT’s responses to 80 counseling questions that college students asked during a school counseling setting. All the responses generated during these simulated counseling sessions were then analyzed using three primary metrics—warmth, empathy, and acceptance—following APA guidelines. The analysis adopted several natural language processing methodologies for emotion detection and empathy measurement to quantify ChatGPT’s high efficacy in presenting the appropriate emotions and reactions for counseling. Some responses demonstrated randomness, which is crucial for consideration regarding the use of ChatGPT or relevant technology in psychological counseling. The Discussion section also highlights future directions in the application of conversational AI to enhance students’ mental health.

This article addresses the socioeconomic gradient in immigrant health by exploring immigration status and social capital as key considerations in measurement and development of health-promoting research and practice. This paper also seeks to draw attention to the importance of understanding how researchers approach the study of health disparities affecting minoritized and immigrant populations. A critical examination of the measures used in comparative health research challenges scholars to consider the different pathways through which socio-economic factors impact health and underscores the ethical commitment of health disparities researchers to consider the relevance and implications of their work. Given the reliance on existing data from national population health surveys to test the assumptions of the immigrant paradox, any immigrant-specific measure of SES with limited application to a large, representative sample of immigrants would likely hold little appeal to both researchers and practitioners. Understanding the mechanisms through which socioeconomic status influences immigrant health can allow scholars to address the needs of immigrant populations and advocate more effectively for programs and policies that seek to advance the health of all people.

In the recent years, with the advent of Artificial Intelligence (AI) traditional methods have seen a significant transformation in the agriculture sector, especially in soil management. Soil management involves practices that maintains and improves the physical, chemical as well as the biological properties of the soil. Soil health management is essential for both the environmental conservation and sustainable agriculture production, ensuring the soil productivity and functional aspects associated with the ecosystem. Soil health management is one of the most important aspects of agriculture and food production, hence preserving and enhancing the soil health is an essential factor for supporting agriculture. Integration of Artificial Intelligence (AI) technologies with soil health management offers the potential to enhance agricultural sustainability, productivity, adapt to the climatic changes and resource constraints. The study of AI tools that can help improve soil health management by providing more accurate and efficient monitoring, analysis and decision-making capabilities. This paper studies the potential AI technologies including machine learning, robotics, and remote sensing in enhancing soil health, raising crop yields, and lowering environmental concerns by examining previous research and case studies.

Semantic interoperability facilitates exchange and access of health data that is being documented in EHRs with various semantic features. In the EU, the regulation proposal of European health data space requires development of semantic interoperability. To achieve a fully integrated EHDS ecosystem leveraging the value of health data, stakeholders need to overcome challenges of implementing common standards and other semantic interoperability features. We aimed to research what scientific evidence is available on developing semantic interoperability. Our research questions focused specifically on key features and approaches for semantic interoperability and on possible benefits of these choices. For that purpose, we performed a systematic literature review by defining our study framework based on previous research. Our results consisted of 10 studies where data models, ontologies, terminologies, classifications, and standards were applied for building interoperability. Through increased access to interoperable patient information, a better quality and outcomes in care can be achieved. Better communication based on easily accessible data is facilitated between health professionals and between clinicians and the patients. When heading towards semantic harmonization as outlined in the EHDS proposal, more experiences and analyses are needed to assess how applicable the chosen solutions are for semantic interoperability of European health care data.

Denture wearers often complain about jeopardized function and reduced quality of life due to lack of prosthesis’ retention. Implant retained mandibular overdentures, on 2 non-connected implants (2IOD) are well-proven solutions to overcome these issues. We prospectively assessed 69 patients and scrutinized clinical records until at least 7 years of function. Thirty-six were retained on Locator ® Abutments (LA) and thirty-tree on Ball Abutments (BA). Both systems were compared regarding the type, amount and total cost of required maintenance. One implants was lost, yielding 98.7% survival after 7 years. In total 438 technical issues occurred: 121 (27.35%) in BA and 317 (72.4%) in LA. Out of these, 343 events (78%) were solved chairside: 191 (43.6%) were replacements of retention caps, 113 (25.8%) were minor acrylic repairs, in 26 (5.9%) pressure ulcers had to be relieved and 13 (3%) related to abutments. LA required 179 insert replacements compared to 12 in the BA group. The overall initial treatment cost was 3850 euro. The average total maintenance cost in relation to the initial cost for the LA and BA groups was 19.11% (range 0% - 82.24%) and 18.91% (range 0% - 113.26%) respectively (P=0.540). Conclusions: The 7-years maintenance costs for a 2IOD is acceptable when the patient is regularly checked and professionally maintained. Most events are easily solvable chairside, but a few patients required more expensive interventions, regardless of the type of attachment used.

People are increasingly encouraged to reduce animal food consumption and shift towards plant-based diets, however the implications for children’s health are unclear. In this narrative review of research in high-income settings, we summarize evidence on the increasing consump-tion of plant-based diets in children, and update an earlier systematic review regarding their associations with children’s health outcomes. The evidence indicates that vegan but not vege-tarian diets can restrict growth relative to omnivorous children, and increase the risk of being stunted and underweight although the percentage affected is relatively small. Bone mineral content is reduced in vegetarian and especially vegan children, compared to omnivores. Both vegetarian and vegan children who do not use vitamin B12 supplements manifest with B12 defi-ciency, however supplementation rectifies this problem. Both vegetarians and vegans have lower concentrations of 25 (OH)D if unsupplemented, and lower body iron stores, but usually have normal iron metabolism markers. Both groups are at risk of iodine deficiency and this might affect thyroid health. Children consuming a vegan diet have more favorable lipid profile than omniv-orous children, however the results for vegetarian diet are inconsistent and vary by outcome. Based on the same scientific evidence, national and international dietary recommendations are heterogeneous, with some countries supporting plant-based diets among infants, children and adolescents, and others discouraging them. We offer a research roadmap, highlighting what is needed to provide adequate evidence to harmonize dietary recommendations for plant-based diets in children. A number of measures should urgently be introduced at international and na-tional levels to improve the safety of their use in children.

Previous studies have examined the impact of Internet use on health in China, but they have not adequately addressed the issue of reverse causality or conducted a detailed analysis of health status. This study uses three waves of longitudinal data from the China Family Panel Studies conducted in 2014, 2016, and 2018 to investigate the association between Internet use and health status in China, aiming to address these gaps. The results indicate that Internet use may improve health status, including self-rated health, mental health, and outpatient visits. These effects vary by gender and age group: the positive effect of Internet use on health outcomes is more pronounced for women, and for middle-aged and older generations, compared to men and younger generations. These findings provide new evidence of the beneficial impact of Internet use on health outcomes in China, suggesting that policies promoting Internet utilization could enhance individuals’ health status, particularly among women and middle-aged and older populations.

Aedes aegypti mosquitoes are primary vectors of dengue, yellow fever, chikungunya and Zika viruses. Ae. aegypti is highly anthropophilic and relies nearly exclusively on human blood meals and habitats for reproduction. Socioeconomic factors may influence the spread of Ae. aegypti due to its close relationship with humans. This paper describes and summarizes the published literature on how socioeconomic variables influence the distribution of Ae. aegypti mosquitoes in the mainland United States. A comprehensive search of PubMed/Medline, Scopus, Web of Science, and EBSCO Academic Search Complete through June 12, 2019 was used to retrieve all articles published in English on the association of socioeconomic factors and the distribution of Ae. aegypti mosquitoes. Additionally, a hand search of mosquito control association websites was conducted in an attempt to identify relevant grey literature. Articles were screened for eligibility using the process described in the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines. Initially, 3,493 articles were identified through the database searches and previously known literature. After checking for duplicates, 2,145 articles remained. 570 additional records were identified through the grey literature search for a total of 2,715 articles. These articles were screened for eligibility using their titles and abstracts, and 2,677 articles were excluded for not meeting the eligibility criteria. Finally, the full text for each of the remaining articles (n = 38) was read to determine eligibility. Through this screening process, 11 articles were identified for inclusion in this review. The findings for these 11 studies revealed inconsistent relationships between the studied socioeconomic factors and the distribution and abundance of Ae. aegypti. The findings of this review suggest a gap in the literature and understanding of the influence of anthropogenic factors on the distribution of Ae. aegypti that could hinder efforts to implement effective public health prevention and control strategies should a disease outbreak occur.

Individuals with low health literacy (HL) are known to have poorer health outcomes and to have higher mortality rates compared to individuals with higher HL: hence, the improvement of HL is a key outcome in modern healthcare systems. Healthcare providers are therefore asked to support patients’ literacy skills by encouraging the implementation of autonomy-supportive patient centered communication (PCC), which in turn requires the enhancement of patient engagement. Our main hypothesis is that the well-known relationship between autonomy-supportive PCC and HL is mediated by patient engagement which is known to play a role in HL promotion and that is related to PCC as well. The purpose of this study was to formulate a hypothetical structural equation model (SEM) linking PCC to patient engagement and HL. A cross-sectional survey design was employed involving 1007 Italian chronic patients. The hypothetical model was tested using SEM to verify the hypothesized mediation of patient engagement between PCC and HL. Results show that the theoretical model has a good fit indexes and that patient engagement fully mediates the relationship between PCC and HL. This finding suggests healthcare systems to implement a new paradigm where patients are supported to play an autonomous role in their own healthcare.

Grapevine is one of the most relevant crops in the world being used for economically important products such as wine. Yet, relevant grapevine cultivars are heavily affected by diseases such as the downy mildew disease caused by Plasmopara viticola. Improvements on grapevine resistance are made mainly by breeding techniques where resistance traits are introgressed into cultivars with desired grape characteristics. However, there is still a lack of knowledge on how resistant or tolerant cultivars tackle the P. viticola pathogen. In this study, using a shotgun proteomics LC-MS/MS approach, we unravel the protein modulation of a highly tolerant grapevine cultivar, V. vinifera ‘Regent’, in the first hours post inoculation (hpi) with P. viticola. At 6 hpi, proteins related to defence and to response to stimuli are negatively modulated while at 12 hpi there is an accumulation of proteins belonging to both categories. The co-occurrence of effector-triggered susceptibility (ETS) and effector-triggered immunity (ETI) is detected at both time-points, showing that these defence processes present high plasticity. The results obtained in this study unravel the tolerant grapevine defence strategy towards P. viticola and may provide valuable insights on resistance associated candidates and mechanisms, which may play an important role in the definition of new strategies on breeding approaches.

Obesity is a major public health concern globally, significantly increasing the risk of numerous metabolic and cardiovascular diseases. While lifestyle interventions remain the primary strategy for weight management, pharmacotherapy is increasingly recognized as an essential component for patients with obesity, especially when lifestyle modifications alone are insufficient. Glucagon-like peptide-1 (GLP-1) receptor agonists, originally developed for the management of type 2 diabetes, have emerged as effective agents in promoting weight loss in both diabetic and non-diabetic populations. This literature review examines the efficacy, safety, and mechanisms of action of GLP-1 receptor agonists, focusing on liraglutide and semaglutide, in obesity treatment. Furthermore, it discusses the impact of GLP-1 receptor agonists on obesity-related comorbidities, their comparison with other pharmacological treatments, and future perspectives.

Background: Internal migrants had obstacles in accessing local public health services in China. This study aimed to estimate the utilization of local public health services and its determinants among internal migrants. Methods: Data were from the 2014 and 2015 nationally representative cross-sectional survey of internal migrants in China. Multivariate logistic regressions were used to estimate the relationship between socioeconomic, migration, demographic characteristics and public health services utilization. Results: Internal migrants in more developed eastern regions used less public health services. Those with higher socioeconomic status were more likely to use public health services. The broader and shorter they migrated, the less they used public health services. Compared to migration within the city, migration across provinces is negatively associated with health records (OR=0.88, 95% CI: 0.86-0.90), health education (OR=0.97, 95% CI: 0.94-1.00), and health education on NCDs (OR=0.92, 95% CI: 0.89-0.95) or through Internet channel (OR=0.96, 95% CI: 0.94-0.99). Conclusion: Public health services coverage for internal migrants has seen great improvement due to government subsides. Internal migrants with lower socioeconomic status and across provinces need to be targeted. More attention should be given to the local government in the developed eastern regions in order to narrow the regional gaps.

Purpose The objective of this study was to eliminate any ambiguity by examining the correlation between gut microbiota and both AMD and glaucoma. Methods Mendelian randomization studies were conducted utilizing the data sourced from the GWAS database for the gut microbiome, AMD, and glaucoma. SNP estimates were summarized through five MR methods. We utilized Cochran's Q statistic to evaluate the heterogeneity of the instrumental variables. Additionally, we employed a "leave-one-out" approach to verify the stability of our findings. Results IVW suggests that Eubacterium (oxidoreducens group) and Parabacteroides had a protective effect on AMD. Both weighted median and IVW suggests that Lachnospiraceae (NK4A136 group) and Ruminococcaceae (UCG009) had a protective effect on AMD. However, both weighted median and IVW suggests that Dorea had a risk effect on AMD. Similarly, The IVW of Eubacterium (ventriosum group) showed a risk effect on AMD. The weighted median of Eubacterium (nodatum group), Lachnospiraceae (NC2004 group), and Roseburia had a risk effect on glaucoma. IVW suggested that Ruminococcaceae (UCG004) had a risk effect on glaucoma. Reverse MR analysis found a causal link between Eubacterium (nodatum group) and glaucoma. No causal relationships were found between AMD or glaucoma and the other mentioned bacterial groups. No significant heterogeneity or evidence of horizontal pleiotropy was detected. Conclusions This study found that certain gut bacteria had protective effects on AMD, while others may be risk factors for AMD or glaucoma. Besides, reverse MR found that glaucoma led to increased abundance of certain gut bacteria. Further trials are needed to clarify the specific mechanisms involved.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Seventy-seven percent of Irish primary school children do not meet recommended physical activity (PA) guidelines [1]. The Daily Mile (TDM) is a primary school initiative designed to increase children’s PA output. This study evaluates TDM’s perceived effect on Irish primary school children’s health-related metrics. A mixed-methods study, comprising two data collection phases, used the RE-AIM framework to evaluate TDM [2]. Phase one involved teachers, principals and classroom assistants (n = 191) from TDM-registered schools completing a questionnaire. Two TDM-registered schools participated in phase two where, (i) interviews were conducted with each principal, (ii) a teacher sub-sample (n = 4) participated in a focus group and (iii) a child sub-sample (n = 14) participated in separate focus groups. TDM was perceived to positively impact markers of children’s health, including their PA behaviour, physical fitness and social wellbeing. Inclement weather (66.5%) and a lack of time (56.5%) were reported as the top-ranked implementation barriers. Moreover, TDM’s repetitive nature often left children feeling disinterested and resulted in some teachers modifying the initiative to maintain engagement levels. Maintaining the long-term implementation of TDM and its health benefits in primary schools may require bespoke amendments to the original format to preserve children’s engagement.

Background: The COVID-19 pandemic has sped up digital health transformation across the health sectors to enable innovative health service delivery. Such transformation relies on competent managers with the capacity to lead and manage. However, the health system has not adopted a holistic approach in addressing the health management workforce development needs, with many hurdles to overcome. The objectives of this paper are to present the findings of a three-step approach in understanding the current hurdles in developing a health management workforce that can enable and maximise the benefits of digital health transformation, and to explore ways of overcoming such hurdles. Methods: A three-step, systematic approach was undertaken, including an Australian digital health policy documentary analysis, an Australian health service management postgraduate program analysis, and a scoping review of international literatures. Results: The main findings will guide the formulation of strategies in developing a digitally enabled health management workforce in the digital health era. Conclusions: With the ever-changing landscape of digital health, being able to lead and manage in times of system transformation requires a holistic approach to develop the necessary health management workforce capabilities and system-wide capacity. The evidence would support that this can be achieved with the required system, policy, educational and professional organizational enablers, which drive a digital health focused approach across all the healthcare sectors, in a coordinated and contextual manner.

The access to cardiac rehabilitation (CR) is contingent upon physician referrals, yet these are often inadequate, particularly in low-resource settings. This multi-method study aimed to translate, culturally adapt, and validate the Portuguese version of the Provider Attitudes toward CR and Referral (PACRR-P) scale, as well as to identify key factors influencing CR referral in a Latin American context for the first time. The PACRR was translated into Brazilian-Portuguese through a rigorous process involving independent translation, back-translation, and expert panel review to ensure face, content, and cross-cultural validity. A total of 44 Brazilian physicians completed the questionnaire, allowing for an assessment of internal consistency, criterion validity, and convergent validity. The findings confirmed the face, content, and cultural validity of the 20 translated items, with a mean item clarity rating of 4.8/5. The final version included 17 of the original 19 PACRR-P items, with a Cronbach’s alpha of 0.73. Referral rates were significantly associated with specific PACRR-P items, supporting the scale's criterion validity, while correlations with ReCaRe scores further supported convergent validity. The most prominent barriers to referral were a lack of familiarity with CR site locations, absence of a standard referral form, and lack of automatic referral processes. The PACRR's validity and reliability among Portuguese-speaking providers are preliminarily supported.

Background and Objectives. To examine trends in the links between induced abortion and subsequent mental health problems for U.S. women approaching completed fertility. Materials and Methods. Panel data on a nationally-representative cohort of 3,842 ever-pregnant women assessed at mean ages of 15, 22, 28 and 37 years from the National Longitudinal Study of Adolescent to Adult Health (Add Health) were examined for pregnancy outcome-related mental health disorders, with extensive adjustment for confounders including sociodemographic dif-ferences, mental health history, and unwanted pregnancies. Outcomes were defined using pub-lished diagnostic criteria or validated index for depression, anxiety disorder, post-traumatic stress disorder (PTSD), and suicide ideation (affective problems); alcohol abuse, drug abuse, opioid abuse, and cannabis abuse (substance abuse problems); and summary counts of affective problems, substance abuse problems and total disorders. Results were adjusted for abortion under-reporting using cross-wave analysis. Results. The relative risk of mental health disorder with exposure to induced abortion followed an inverted “V” pattern as women aged to midlife, increasing from Wave III (age 22; IRR 1.41) to Wave IV (age 28; IRR 1.67), then dropping sharply by Wave V (age 37; IRR 1.20). The population at-tributable fraction of mental health disorder due to abortion dropped from 18.1% at Wave IV to 8.0% at Wave V. Unlike previous Waves, at Wave V mental health risk was more strongly reduced by exposure to childbirth (IRR 0.70, 95% CI .63, .78, p < .001). Reduced relative metrics at Wave V were not due to reduced prevalence of mental health disorders for ever-aborting women, which increased from Wave IV to Wave V by 1.7%, but increased much more, by 20.5%, for never-aborting women. Conclusion. At midlife approaching completed fertility, differential negative psychological out-comes for ever-aborting U.S. women remained elevated but reduced from younger ages.

Being forced to live in an area following a catastrophic landslide may adversely impact people's mental well-being. Unprivileged communities such as Adivasis, Dalits, plantation workers, and people with low incomes in Kerala's hilly districts are forced to live in landslide-affected areas despite their fear. This paper examines the fears and concerns of landslide survivors from the marginalized sections of society from a broader framework of the political economy of mental health. This approach aligns with the assertion made by the World Health Organisation that individual factors do not solely determine mental health but are intricately linked to broader social, political, and economic circumstances. Data were collected through in-depth interviews with fatal landslide survivors and key informants [ ]. The study employed thematic data analysis from in-depth interviews of various fatal landslide survivors since 2018. The three major themes unveiled in the analysis are: 1. post-disaster fears, 2. The factors that triggered fear and concern and 3. Socio-economic marginality and mental health. The study asserts that individuals who are poor and unprivileged are highly susceptible to mental health issues associated with landslides.

Patient access to new oncology drugs in Canada is only possible after navigating multiple sequential systemic checkpoints for national regulatory approval, health technology assessment (HTA) and collective government price negotiation. These steps delay access and prevent health care providers from being able to prescribe optimal therapy. Eighteen Canadian oncology clinicians from the medicine, nursing and pharmacy professions met to develop consensus recommendations for defining reasonable government performance standards around process and timeliness to improve Canadian cancer patients’ access to best care. A modified Delphi methodology was used to confirm strong consensus on 30 questions involving five themes: accountability, disparities, endpoints, timeliness, and cost-effectiveness. It was agreed that greater transparency is required across regulatory and HTA processes. Health professionals in oncology are frustrated for their patients because they are unable to deliver the modern guideline-supported therapies they want to provide due to delays in approval or funding. Canadian patients and their health care providers request improvements in timely access to life-saving therapeutics in line with other countries. Clinicians expect urgent improvements in our health systems to give our patients their best chance of survival.

Positive Health (PH) has been described as a promising transformative innovation to address the challenges of promoting well-being and reducing the burden of disease. The aim of this study is to review the current state of knowledge about PH as introduced by Huber et al. (2016) within the available scientific literature. A rapid review of the literature following the Cochrane Rapid Review recommendations. Three databases were searched (PubMed, Google Scholar, and CINAHL). Data were extracted and synthesized using a narrative approach. A total of 55 articles were included. Initial evaluation studies reveal promising results both at individual and collective levels. However, a need is expressed in several articles for further refinement of the conceptualization of PH and ways to make the effects of the PH approach more measurable. Professionals also expressed a desire for a more informed application and elaboration of the PH method across various settings and populations to enhance its effectiveness in practice. This rapid review highlights the transformative potential of PH in shifting from a disease-focused to a health-oriented paradigm of healthcare. It underscores the need for continued research regarding further development of the concept and its practical method, along with the necessity for methodological innovation.

Prostate cancer is the most occurred malignant disease in the male population in over one-half of the countries and still constitutes the fifth leading cause of death in 2020, worldwide. Metastatic prostate cancer is a lethal malignancy that mostly is terminated within several years through the patient's death. Researchers should focus on the phenomenon which is rigorously appertaining to metastatic cascade and operating as an initiator of metastases to provide the knowledge needed to solve the problem of diagnostics and treatment of advanced prostate cancer patients. The epithelial-mesenchymal transition is one such phenomenon. The current review is based mainly on three papers published in 2021, which describe the most important tissue-specific factors managing epithelial-mesenchymal transition and are discussed with scientific papers published in acknowledged journals. The effect of the current review is the specification of profiles of precise tissue factors predicting the progression of the prostate neoplasm to its metastatic stage in a new edition.

Background: Urinary tract infections (UTI) are a significant health concern, particularly in women, with almost half of them experiencing at least one UTI in their lifetime. This problem is further compounded by the high recurrence rate within 6-12 months. Postmenopausal women are especially vulnerable to recurrent UTI due to the natural decline in estrogen levels, which alters the urogenital epithelium and subsequently affects the urogenital microbiome. Methods: This study included 674 female patients that were admited at "Dr. Carol Davila" Central Military Emergency University Hospital in Bucharest over a period of 3 years. Results: Of the 674 women with urinary tract infection, 435 (79.3%) had more than one positive culture, and 239 (35.4%) experienced at least one recurrent urinary tract infection 6-12 months after the initial diagnosis. The mean age of women with urinary tract infection was 63 (± 15.61 years). Recurrent urinary tract infections were most prevalent in those aged 65-80 years (52%). Escherichia coli was detected in 71% of the positive cultures. Conclusions: The management of recurrent urinary tract infections in women presents a complex challenge that necessitates a multifaceted approach. The emerging understanding of the urobiome and its role in bladder health offers promising avenues for developing targeted interventions. As research in this field advances, it is imperative to integrate these new insights into clinical practice to balance traditional antibiotic treatments with novel strategies that consider the intricate microbial ecosystem of the urinary tract.

Previous research suggests that the economic crisis can affect mental health. The purpose of this study was to analyse the association of risk of poor mental health with various socioeconomic, demographic, health, quality of life and social support variables; and to evaluate the contribution of socioeconomic variables most affected by the beginning of the economic crisis (employment situation and income) on the changes in the prevalence of the risk of poor mental health between 2005 and 2010. A study of prevalence evolution in adult population residents of the Valencian Community in the Spanish Mediterranean was conducted. We studied 5781 subjects in 2005 and 3479 in 2010. Logistic regression models have been adjusted to analyse the association between variables. A standardization procedure was carried out to evaluate which part of the changes in overall prevalence could be attributed to variations in the population structure by age, sex, employment status and income between the years under study. The prevalence of GHQ + increased from 2005 to 2010, in both men and women. Several variables were closely associated with the risk of poor mental health (sex, age, country of birth, number of non-mental chronic diseases, social support, disability, cohabitation in couple, employment status, and income). The changes produced as a result of the onset of the economic crisis in income and unemployment (increase in low income and in unemployment rates) contributed to the increase of poor mental health risk. This could confirm the sensitivity of mental health to the economic deterioration caused by the crisis.

Purpose: Post-pandemic management of COVID-19 infections and any emergent outbreaks is as an endemic disease remains a public health concern. Vaccine hesitancy may continue to hamper efforts to respond any new disease outbreaks and future epidemics. This qualitative study aimed to explore factors influencing covid-19 vaccine acceptance and hesitancy in Kenya too gain deeper insights on this issue. Methods: The study was implemented in Western Kenya using key informant interviews. Fourteen (14) key informants were purposively selected for the study. All interviews were transcribed and analyzed using thematic analysis. Interpretation of findings was done within the framework of the Health Belief Model. Key findings: Knowledge was a critical factor in combatting misinformation and fostering vaccine acceptance among participants in this study. Misinformation included rumors that the vaccine lowers immunity and was intended for population control. Cues to action included influence from political and opinion leaders and observing the loss of life among unvaccinated individuals. Perceived barriers to vaccine uptake included fear of vaccine safety, side effects, long waiting times at that time of our study, fear of contracting the COVID-19 at vaccination sites, family/spousal influence on vaccine uptake and fear of the unknown with the vaccine. Conclusion: Findings from this study provides insight into areas for targeted strategies for managing Covid-19 vaccinations and future pandemics. Within the framework of the Health Belief Model, this study identified salient barriers and facilitators of COVID-19 vaccine hesitancy that may be helpful to inform future pandemic response.

Mercury (Hg) analyses in species of fish are performed for two reasons 1) to safeguard human health, 2) to assess environmental quality, since different environmental changes may increase the Hg concentrations in fish. These analyses are important since both natural and human activities can increase these Hg concentrations, which can vary extensively, depending on the species, age and catching location. Unfortunately, humans consuming Hg contaminated fish or other marine foodstuffs cannot taste Hg contamination; this can be only detected by chemical analysis. If the aim of Hg analysis is to protect the health of marine-food consumers, researchers workers must consider the location where the fish were caught and interpret the results accordingly. Health and environmental officials must appreciate that in specific places many local people may have a daily diet almost entirely consisting of fish or other marine foods, and these individuals should not be exposed to high concentrations of Hg. Regional and national health and environmental officials should follow the guidance of international organizations when drawing their final conclusions about whether or not the products are safe to eat.

COVID-19 is a potentially fatal viral infection. This study investigates geography, demography, socioeconomics, health conditions, hospital characteristics, and politics as potential explanatory variables for death rates at the state and county levels. Data from the Centers for Disease Control and Prevention, the Census Bureau, Centers for Medicare and Medicaid, Definitive Healthcare, and USAfacts.org were used to evaluate regression models. Yearly pneumonia and flu death rates (state level, 2014-2018) were evaluated as a function of the governors’ political party using repeated measures analysis. At the state and county level, spatial regression models were evaluated. At the county level, we discovered a statistically significant model that included geography, population density, racial and ethnic status, three health status variables along with a political factor. State level analysis identified health status, minority status, and the interaction between governors’ parties and health status as important variables. The political factor, however, did not appear in a subsequent analysis of 2014-2018 pneumonia and flu death rates. The pathogenesis of COVID-19 has greater and disproportionate effect within racial and ethnic minority groups, and the political influence on the reporting of COVID-19 mortality was statistically relevant at the county level and as an interaction term only at the state level.

Lassa Fever is a deadly viral haemorrhagic disease, causing annually several hundreds of deaths in the Gulf of Guinea. This zoonotic disease is primarily transmitted to humans by rodents of the genus Mastomys, while secondary interhuman transmission accounts for approximately 20% of cases. Although this disease has been endemic in rural zones of the Gulf for hundreds of years, it is also characterised by epidemic outbreaks in the dry season, responsible for heavy death tolls. No licensed vaccine or satisfying treatment is currently available. Disease management is hindered by the incomplete knowledge of the epidemiology and distribution of the disease, resulting from an inadequate health and surveillance system. Additional scientific constraints such as the genetic diversity of the virus and the lack of understanding of the mechanisms of immune protection complexify the development of a vaccine. The intricate socio-economic context in the affected regions, and the lack of monetary incentive for drug development, allow the disease to persist in some of West Africa’s poorest communities. The increase in the number of reported cases and in the fatality rate, the expansion of the endemic area, as well as the threat Lassa Fever represents internationally should urge the global community to work on the disease control and prevention. The disease control requires collaborative research for medical countermeasures and tailored public health policies. Lassa Fever, created by the interconnection between animals, humans, and ecosystems, and embedded in an intricate social context, should be addressed with a ‘One Health’ approach. This article provides an overview of Lassa Fever, focusing on Nigeria, and discusses the perspectives for the control of disease.

Diabetic Foot Ulcer (DFU) is a severe complication of diabetes mellitus (DM), often leading to hospitalization and non-traumatic amputations in the United States. It is particularly prevalent among individuals of Hispanic descent, with a prevalence rate exceeding 10% [1, 2]. The target of this study is to identify markers of severity of DFU. This work follows a strategy that uses first Electronic Health Records and machine learning to identify risk factors reported as measurements of blood tests, such as cholesterol, blood sugar, and specific proteins in a cohort of thousands of patients. After this RNA risk factors are predicted using samples of bulk and single-cell gene expression across patients with different levels of DFU severity. We found the Albu-min/Creatinine Ratio (ACR) test as a key factor in severe DFUs. We also found a cluster of cells that harbor high expression of Apolipoprotein E protein (APOE) and it is significant in non-healing DFU cases. Overall, the study shows how the use of hundreds of thousands of EHR can reduce and inform the search space of molecules in a few samples of bulk-single cell transcriptomics and identify molecular markers of severity of DFU.

Starting from accelerated industrial development, industrial disasters (chemical spills, explosions, nuclear accidents, etc.), which fall under man-made (technological) disasters, increasingly threaten human lives, the environment, and property. Their complexity and far-reaching consequences, both at the local and global levels, require effective management of industrial risks and the disasters themselves (preparedness, mitigation, response, and recovery). For these reasons, the review paper aims to provide a holistic description of the diverse causes, dynamics, and multidimensional consequences of disasters. Additionally, it highlights and explains the key factors that directly or indirectly contribute to their occurrence. Furthermore, it could be said that the paper analyzes existing strategies for managing risks from industrial disasters and systematizes recommendations for improving preventive and reactive measures in high-risk industries. On the other side, the paper utilizes a comprehensive literature review, which involves the systematic identification, review, analysis, and critical evaluation of existing scientific papers, studies, reports, and regulatory documents on industrial disasters. Besides that, it also includes a detailed analysis of well-known industrial disaster cases such as Seveso (Italy, 1976), Bhopal (India, 1984), Chernobyl (Ukraine, then USSR, 1986), and Fukushima (Japan, 2011). The paper emphasizes that industrial disasters are often the result of the combined influence and interaction of technical failures, human errors, and inadequately developed safety procedures. Moreover, it can be highlighted that the design and implementation of preventive measures, such as regular maintenance of technical systems and systematic training and education of employees, are crucial for reducing the likelihood of such catastrophic events. The implications of this review paper are multifaceted and point to the following: the need to reassess current safety practices in industries; reconsider the potential for introducing innovations in preventive technical-technological solutions; examine the thorough implementation of innovative early warning systems, safety procedures, and modern equipment in facilities; improve cooperation between engineers, safety managers, and regulatory workers; reassess the need for additional updates and tightening of regulations regarding the storage, transport, and use of hazardous materials in industry; and improve the management of risks from industrial disasters.

Many children on the autism spectrum engage in challenging behaviors, like aggression, due to difficulties communicating and regulating their stress. Identifying effective intervention strategies is often subjective and time-consuming. Utilizing unobservable internal physiological data to predict strategy effectiveness may help simplify this process for teachers and parents. This study examined whether heart rate data can predict strategy effectiveness. Teachers and coders from the research team recorded behavioral and heart rate data over three months for each participating student on the autism spectrum using the KeepCalm app, a platform that provides in-the-moment strategy suggestions based on heart rate and past behavioral data, across 226 instances of strategy interventions. A binary logistic regression was performed to assess whether heart rate reduction, time to return to heart rate baseline, and documented skills and challenging behaviors predicted strategy effectiveness. Results suggested that heart rate reduction may be a significant predictor, and supported the existing practice of using behavioral patterns as proxies for strategy effectiveness. Additional analyses indicate proactive strategies are more effective and are associated with greater reduction in heart rate, relative to reactive strategies. Further exploration of how internal physiological data can complement observable behaviors in assessing intervention strategy effectiveness is warranted given the novelty of our findings.

This paper presents our approaches for the SMM4H’24 Shared Task 5 on the binary classification of English tweets reporting children’s medical disorders. Our first approach involves fine-tuning a single RoBERTa-large model, while the second approach entails ensembling the results of three fine-tuned BERTweet-large models. We demonstrate that although both approaches exhibit identical performance on validation data, the BERTweet-large ensemble excels on test data. Our best-performing system achieves an F1-score of 0.938 on test data, outperforming the benchmark classifier by 1.18%.

Since the college years represent an important period for forming oral health behaviors during adulthood, it is important that college students establish proper oral health-promoting behaviors. Therefore, this study aims to identify the effects of oral health education experience, knowledge, and practice behaviors on oral health care self-efficacy among college students, as studies related to this topic are scarce. A total of 236 college students participated in a questionnaire survey comprising 21 questions. The collected data were analyzed through a chi-square test, independent-samples t-test, and logistic regression analysis using SPSS version 22.0. Participants with oral health education experience showed higher levels of oral health knowledge and practice behaviors than those who did not, and the odds of them having oral health care self-efficacy was 3.743 higher. Moreover, a one-unit increase in oral health knowledge and practice behaviors was associated with a 1.199 and 1.351 increase in oral health care self-efficacy, respectively. For oral health promotion among college students, oral health care self-efficacy reinforcement programs tailored to college students should be developed. These should focus on expanding oral health education opportunities to promote improvement in oral health care self-efficacy by strengthening oral health knowledge and the motivation to practice oral health behaviors.

This study explored the effectiveness of a virtual music therapy program, based on positive psychotherapy principles, for college students during the COVID-19 pandemic. Twenty-four undergraduate students with partial PTSD were initially assigned to either an experimental group or a control group, with 11 participants in each group by the study's end. The experimental group underwent 15 video sessions of the therapy program, completing one session per weekday over three weeks. The program involved worksheets targeting goals aligned with positive psychology, such as positive affect, life meaning, personal strengths, gratitude, hope, and happiness. Activities included writing music autobiographies, creating and analyzing song lyrics, and exploring various music pieces. The effectiveness of the intervention was measured using the 21-item Depression Anxiety Stress Scale and the Korean Version of Positive Psychological Capital (K-PPC) before, immediately after, and three weeks post-program. The experimental group showed significant improvements in stress, anxiety, depression, self-efficacy, resilience, and the K-PPC total score compared to the control group. These improvements were maintained at the three-week follow-up. The findings suggest that positive psychology-based virtual music therapy can significantly enhance the mental health of highly stressed college students, especially during challenging times like the COVID-19 pandemic.

Incorporating sewage sludge (SS) into soils presents a cost-effective and environmentally friendly option compared to conventional farming practices. However, SS could be perceived as a double-edged sword, as it may contain a broad spectrum of contaminants, posing threats to soil, underground waters, food chains and human health. Even from an epidemiology perspective, the COVID-19 pandemic has instigated debates regarding the potential health risks associated with SS. The handling of SS is emerging as a significant issue in the European Union (EU), primarily due to its increasing utilization and the presence of contaminants such as heavy metals (HMs), microplastics (MPs), Pharmaceuticals in the Environment (PIE), and personal care products (PSPs). The Council Directive 86/278/EEC governs the limits of HMs when SS is utilized in agriculture. However, the Directive is enacted diversely throughout EU member states (MS), with their national legislations highlighting differences, gaps and various approaches in implementing the Council Directive. The Directive, which has been in force since 1986, has not undergone any significant revisions until the recent disclosure of a revised version in May 2023. The executive summary of the evaluation of the Council Directive 86/278/EEC (SWD-2023) – {final 158} specifies maximum concentrations of six HMs in SS among its regulatory measures. This article delves into capturing the current legal framework that defines and delimits the processes and obligations of EU MS regarding SS's management, treatment, and agriculture amendment. The primary objective is to explore the qualitative and quantitative differences/discrepancies between the MS National legislation and point out discontinuities and gaps, thus setting forward a cohesive step for future revisions and updates of the relevant legislation. Part of the article's results reflect the different approaches to permissible limits of HMs concentrations in the EU MS and between international organizations such as the Food and Agriculture Organization (FAO) and the World Health Organization (WHO). Moreover, the total absence of MPs and other Common Soil Pollutants (antibiotics, pharmaceuticals, etc.) limit values are evidence of the gaps in the current legislative framework.

Causation concepts for work-related musculoskeletal disorders vary among authors and academic disciplines. Major causation concepts are single-event and repetitive motion. The aim of this short communication is to share findings from a recent survey, conducted by the U.S. Bureau of Labor Statistics of United States employers about work-related musculoskeletal cases, and more specifically, about whether the employers regard the cause of their employee’s musculoskeletal problem as being from a single exposure or from multiple exposures. Recommendations are offered for using terminology consistent with employer understandings.

Introduction: congenital ureteral stenosis is one of the leading causes of impaired urinary drainage and subsequent dilatation of urinary collecting system, known as hydronephrosis or ureterohy-dronephrosis. Mechanism that leads to obstruction is not clearly known. Multiple studies in rat models have shown increased angiotensin 11 and TGFβ levels in obstructed ureteral tissue. The aim of the study is to investigate expression of fibrosis related genes in obstructive and normal ureteral tissue. Material and methods: it is a monocentric study in which nineteen patients were selected prospec-tively. 17 patients of which underwent Hynes-Anderson pyeloplasty due to the PUJO, 2 patients underwent ureteroneocystostomy due to ureterovesical junction obstruction (UVJO) and 6 patients were chosen for control group: 5 underwent nephrectomies due to the kidney tumor and 1- upper pole heminephrectomy due to the duplex kidney with normal pyeloureteric junctions in all. Tissue RNA was chemically extracted after freezing the biopsy samples in liquid nitrogen, with cDNA synthesis performed immediately after nucleic acid isolation. qPCR to evaluate the relative expres-sion of Tgfb1, Mmp1, Timp1, Pai1, Ctgf and Vegfa was performed. Expression levels of Gapdh and Gpi genes (geometric average) were used to calculate the relative expression of the investigated genes. Outliers were removed prior to calculating confidence intervals for the experimental groups, and Wilcoxon rank-sum test was performed to determine statistical significance of the differences. Results: significant differences between healthy and stenotic tissue samples in Ctgf gene expression levels were observed, with the samples from afflicted tissue showing lower expression. No statistical difference in expression levels of Tgfb1, Timp1, Vegfa, Mmp1, Pai1 was found. Discussion and conclusions: These findings suggest that tissue fibrosis similar to other tissues and organs is not the leading cause of stenosis, at least at the moment of surgery. Decreased CTGF ex-pression is indicative of developmental origin of obstruction.

The vacuolar H+-ATPase is a multisubunit enzyme which plays an essential role in the acidification and functions of lysosomes, endosomes, and synaptic vesicles. Many genes encoding subunits of V-ATPases, namely ATP6V0C, ATP6V1A, ATP6V0A1 and ATP6V1B2, have been associated with neurodevelopmental disorders and epilepsy. The autosomal dominant ATP6V1B2 p.Arg506* variant can cause both deafness, congenital, with onychodystrophy, autosomal dominant (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS). Some but not all individuals with this truncating variant have intellectual disability and/or epilepsy, suggesting incomplete penetrance and/or variable expressivity. To further explore the impact of the p.Arg506* variant in neurodevelopment and epilepsy, we generated Atp6v1b2emR506* mutant mice and performed standardized phenotyping using the International Mouse Phenotyping Consortium (IMPC) pipeline. In addition, we assessed the EEG profile and seizure susceptibility of Atp6v1b2emR506* mice. Behavioral tests revealed that the mice present locomotor hyperactivity and show less anxiety-associated behaviors. Moreover, EEG analyses indicate that Atp6v1b2emR506* mutant mice have interictal epileptic activity and that both heterozygous (like patients) and homozygous mice have reduced seizure thresholds to pentylenetetrazol. Our results confirm that variants in ATP6V1B2 can cause seizures and that the Atp6v1b2emR506* heterozygous mouse model is a valuable tool to further explore the pathophysiology and potential treatments for vacuolar ATPases-associated epilepsy and disorders.

Abstract: Windtech device is a novel tool for measuring the sensation of the ‘cold’. Cold poses numerous challenges for industrial operations, human survival, and living convenience. The impact of the cold is not possible to be quantified just based on temperatures; however other factors such as wind speed, humidity, irradiance have to be taken into consideration. Efforts have been made to develop combined indices such as wind chill temperature (WCT), AccuWeather RealFeel®, and others. The presented article discusses these along with the industrial standards that emphasize on the quantification of the ‘cold’. The following article introduces the Windtech device and its operating principle involving ‘heated temperature’, where the ‘heated temperature’ is affected by environmental parameters including ambient temperature, humidity, wind velocity, and irradiance. The discussed Windtech device is calibrated for operation according to the ISO 11079:2007 standard.

Objective: To examine the associations between menstruation features and symptoms and hormone-immune-metabolic biomarkers. Methods: Forty-one women completed questionnaires assessing characteristic menstruation symptoms, duration of menstrual cycle and number of pads used/day and completed the Daily Record of Severity of Problems (DRSP) during the consecutive days of their menstrual cycle. Menses-related symptoms (MsRS) were computed from the sum of 10 pre- and post-menses symptoms and the menstruation blood and duration index (MBDI) was computed based on the daily number of pads and duration of menses. We assayed serum levels of various biomarkers at days 7, 14, 21, and 28 of the subjects’ menstrual cycle. Results: MBDI was significantly associated with a) MsRS including low abdominal cramps, and gastro-intestinal (GI) and pain symptoms (positively); b) plasma levels of haptoglobin (Hp), CCL5, insulin growth factor (IGF)-1, and plasminogen activator inhibitor (PAI)1 (all positively); and c) estradiol and paraoxonase (PON)1 arylesterase activity (both inversely). MsRS were significantly predicted by CCL5 and IGF-1 (both positively) and progesterone (inversely). Low-abdominal cramps, and gastro-intestinal and pain symptoms were associated with lower progesterone levels. The MBDI+MsRS score was significantly predicted by the cumulative effects of (in descending order of importance): Hp, IGF-1, PON1 arylesterase, estradiol and PAI. Conclusion: Menstruation-related features including estimated blood loss, duration of menses, cramps, pain and GI symptoms are associated with hormone-immune-metabolic biomarkers, which mechanistically may explain those features. Women with an increased MBDI+MsRS index ≥ 0.666 percentile may be considered to have menstruation-related distress, including dysmenorrhea symptoms.

Disease related malnutrition (DRM) is prevalent in hospitals and is associated with increased care needs, prolonged hospital stay, delayed rehabilitation and death. Nutrition care process related activities such as screening, assessment and treatment has been advocated by scientific societies and patient organizations but implementation is variable. We analyzed the cross-sectional nutritionDay database for prevalence of nutrition risk factors, care processes and outcome for medical patients. In 59126 medical patients included between 2006-2015 the prevalence of recent weight loss (45%), history of decreased eating (48%) and low actual eating (53%) was more prevalent than low BMI (8%). Each of these risk factors was associated with a large increase in 30 days hospital mortality. Nutrition care processes increases slightly with presence of risk factors but never done in more than 50% of patients. Only a third of patients not eating in hospital receive oral nutritional supplements or artificial nutrition. We suggest that political action should be taken to raise awareness and formal education on all aspects related to DRM for all stakeholders, to create and support responsibilities within hospitals, and to create adequate reimbursement schemes. Collection of routine and benchmarking data is crucial to tackle DRM.

The link between language processing and motor systems has been the focus of increasing interest to Cognitive Neuroscience. Some classical papers studying Event Related Potentials (ERPs) induced by linguistic stimuli have found differences in electrophysiological activity when comparing action and non-action words; more specifically, a bigger p200 for action words. On the other hand, a series of studies have validated the use of a grip force sensor (GFS) to measure language-induced motor activity during both isolated words and sentence listening, finding that action words induce an augmentation in the grip force around 250-300 ms after the onset of the stimulus. The purpose of the present study is to combine both techniques to assess if the p200 is related to the augmentation of the grip force measured by a GFS. We measured ERP and GFS changes elicited by listening to action and non-action words while maintaining an active grasping task in 10 healthy subjects. Our results show that the amplitude of the p200 in central electrodes is correlated to the augmentation in the GFS around 300 ms induced by linguistic stimuli. To our knowledge, this is the first study where the electrophysiological activity and the changes in the grip force induced by auditory language processing are put together, opening new venues of interpretation for the sensorimotor interaction in language processing.

The mechanization of agricultural activities has led to indiscriminate deposition of toxic xenobiotics, including organophosphates in the biomes, and this has led to intoxication characterized with deleterious oxidative and neuronal changes. This study investigated the consequences of oxidative and neurogenic disruptions that follow exposure to two organophosphates, chlorpyrifos (CPF) and dichlorvos (DDVP) on neuro-cognitive performance and anxiety-like behaviors in rats Thirty-two adult male Wistar rats (150 – 170g) were randomly divided into 4 groups, orally exposed to normal saline (NS), DDVP (8.8mg/kg), CPF (14.9mg/kg) and DDVP+CPF for 14 consecutive days. On day 10 of exposures, anxiety-like behaviors and amygdala dependent fear learning were assessed using Open Field and Elevated Plus Maze paradigms respectively, while spatial working memory was assessed on day 14 in the Morris water maze paradigm, following 3 training trials each on days 11, 12 and 13. On day 15, the rats were euthanized, and their brains excised, hippocampus and amygdala removed, 5 of which were homogenized and centrifuged to analyze nitric oxide (NO) metabolites, total reactive oxygen species (ROS), and acetylcholinesterase (AChE) activity, and the other three processed for histology (cresyl violet stain) and proliferative marker (Ki67 immunohistochemistry). Marked (p≤0.05) loss in body weight, AChE depletion, and overproduction of both NO and ROS were observed after repeated exposure to individual and combined doses of CPF and DDVP. Insults from DDVP exposure appeared more severe owing to the observed greater losses in the body weights of exposed rats. There was also a significant (p≤0.05) effect on the cognitive behaviors recorded from the exposed rats, and these deficits were related to the oxidative damage and neurogenic cell loss in the hippocampus and the amygdala of the exposed rats. Taken together, these results provided an insight that oxidative and neurogenic damages are central to the severity of neuro-cognitive dysfunction and increased anxiety-like behaviors that follow organophosphate poisoning.

Concerning the hippocampal mechanisms that simultaneously function to map environmental position and to generate episodic memories, a developing consensus emerged by the early 21st century. The hippocampus was recognized as embodying the primary location of personal narrative development, with the ability to create stable and coherent narrative largely representing the mental health of individuals. Determining recent advances regarding the relationship among the hippocampus, narrative, and mental health, a limited, six-database review was conducted for peer reviewed articles published since 2019. Of the 127 records located, 14 reports were included for study. The results support the necessity of creating and maintaining a stable and coherent narrative as fundamental to human mental health such that facts will be distorted in personal accounts, sleep will be disrupted, and DNA altered to retain one’s personal narratives. With narrative development fundamental to human mental health, a goal of interventions concerning hippocampal function and positive health outcomes is enhancing personal narratives in providing individuals with the ability to construct and recall those that are robust and effective. One such intervention that has proven successful in this regard, the Health Narratives Research Process, is outlined with its most recent results presented, offering opportunity for further such research.

Many measles endemic countries with suboptimal coverage levels still rely on vaccination campaigns to fill immunity gaps and boost control efforts. Depending on local epidemiological patterns, national or targeted campaigns are implemented, following which post-campaign coverage surveys (PCCSs) are conducted to evaluate their performance, particularly in terms of reaching previously unvaccinated children. Due to limited resources, PCCS surveys are designed to be representative at coarse spatial scales, often masking important heterogeneities in coverage that could enhance the identification of areas of poor performance for follow up via routine immunization strategies. Here, we undertake geospatial analyses of the 2021 measles PCCS in Nigeria to map indicators of coverage measuring the individual and combined performance of the campaign and routine immunization (RI) at 1x1 km resolution and the ward and district levels in 13 states. Using additional geospatial data sets, we also produced estimates of numbers of unvaccinated children during the campaign and numbers of measles-containing vaccine (MCV) zero-dose children before and after the campaign at these levels and within health facility catchment areas. Our study revealed that although the campaign reduced the numbers of MCV zero-dose children in all the districts, areas of suboptimal campaign and RI performance with considerable numbers of zero-dose children remained. Our analyses further identified wards and health facility catchment areas with higher numbers of unvaccinated children within these areas. Our outputs provide a robust evidence base to plan and implement follow-up RI strategies and to guide future campaigns at flexible and operationally relevant spatial scales.

Objective: To investigate whether the relationships between acute care occupational therapy (OT) and physical therapy (PT) utilization and community discharge are moderated by functional or physical performance at discharge among individuals hospitalized with traumatic brain injury (TBI). Setting: 14 acute care hospitals in the state of Colorado. Participants: We studied 5,599 adults hospitalized with TBI between June 2018 and April 2021. Design: In a secondary analysis of de-identified electronic health record (EHR) data, multivariable moderation logistic regression models were performed to calculate odds ratios (ORs) for the likelihood of community discharge among patients who utilized OT/PT services. Main Measures: Functional (activities of daily living [ADL]) and physical (mobility) performance at discharge, OT and PT utilization, and community discharge status. Results: Overall, 67% of patients discharged to the community. The mean age of the sample was 55 years (SD = 20 years). Most participants were male (64%) and non-Hispanic white (72%). Mean hospital length of stay was 6 days (SD = 6 days). Both OT and PT utilization (OT: OR= 1.21, 95% CI [1.11, 1.33]; PT: OR= 1.22, 95% CI [1.14, 1.30]) and discharge ADL and mobility scores (ADL: OR= 1.34, 95% CI [1.30, 1.39]; mobility: OR= 1.38, 95% CI [1.33, 1.42]) were significantly and positively associated with community discharge. The OT and PT utilization-by-discharge ADL and mobility interaction terms yielded slightly negative, but statistically significant moderation effects in both models (ORs= 0.99, 95% CIs [0.98, 1.00]); indicating the magnitude of the OT and PT utilization effect diminished as ADL and mobility scores increased. Several sociodemographic characteristics and clinical factors were also independently associated with community discharge in both models (p-values

Purpose of review: In this review, we discuss the importance of digital health equity and how social determinants of health (and intersectionality with race, ethnicity, and gender) affect cardiovascular health-related outcomes in digital health trials. We propose strategies to improve digital health equity as we move to a digitally-connected world for healthcare applications and beyond.Recent findings: Digital health has immense promise to improve population health by reaching individuals in their homes, at their preferred times. However, initial data demonstrate decreased patient engagement and worse cardiovascular outcomes for racial and ethnic minorities, leading to unequal uptake of digital health technologies. In addition, while women generally have higher uptake of technology, they are less likely to be referred by clinicians for digital health interventions. We highlight several exemplar trials and analyze their methodology for replication in future digital health research.Summary: The promise of digital health equity has not been reached due to exclusionary practices. Specific focus must be placed on societal/governmental policies that enable digital inclusion, particularly of racial and ethnic minority populations and women, to ensure that the expansion of digital health technologies does not exacerbate existing health disparities.

The present short communication aimed to determine the effects of vegetable cultivation on health. We conducted a qualitative study using responses to an open-ended question that was part of a survey on regional differences on vegetable intake. Participants in this study were residents of Gunma Prefecture, Japan, and were aged between 20–74 years. In the questionnaire, we asked: “Aside from increasing vegetable intake, how does vegetable cultivation affect your health?” We were able to categorize the answers into six subcategories related to physical health, mental health, and social well-being.

Background: Drinking and smoking have economic consequences and are the main risk factors of mortality and morbidity. Disease-specific deaths attributable to using substances present the primary health indicator in this study. This analysis focuses on mortality in productive age, 15 to 64 years since those deaths are considered the highest economic burden. Method: In the analytical part, data from the Registry of deaths of the Czech Republic for 1994 to 2017 were used. The number of deaths attributable to smoking and drinking was calculated using attributable fractions, based on literature review. This research aimed to reveal the gender differences in deaths attributable to drinking and smoking, according to age, and the differences in deaths regarding smoking or drinking. Results: The mortality attributable to smoking and drinking differs across age groups and genders. The highest median share of tobacco-related deaths is in the age group, 60—64 years. The highest median share of alcoholic deaths is in the age group of 50—54 years. Conclusions: There are significant differences between genders in both, smoking and drinking. A prevention program should be targeted to different age groups.

Background: The potential of Artificial intelligent (AI) models to process and interpret large health datasets at scale could revolutionize public health and epidemiology, providing a foundation for public health. Ethics has been recognized as a priority concern in the development and deployment of AI. Because AI technology can jeopardize patient safety, privacy, and posing a new set of ethical problems that must be addressed. Objectives: We aim to provide a holistic view on what are the different ethical and legal principles that was addressed in the included studies regarding the use of AI in public health and what are the ethical challenges that can arise.Methods: Following PRISMA guideline, five bibliographic databases were used in our search: PubMed, Scopus, JSTOR, IEEE Xplore, and Google Scholar from 2015 to February 2022. Four reviewers carried out study selection and data extraction, and the data extracted was synthesized by a narrative approach. Results: This review included 23 unique publications out of a total of 1123 items that were initially identified. Different ethical principles regarding the uses of AI in public health and community health were identified and discussed distinctly in the current review. The common ethical and legal themes that this review focused on are equity, bias, privacy and security, safety, transparency, confidentiality, accountability, social justice, and autonomy. In addition, five ethical challenges were mentioned. Conclusion: Research regarding ethical and legal principles and challenges about using AI in public health specifically consider a new filed, because all previous themes are concerning the physical and patients’ area where it focuses only on the clinical settings.

Emerging infectious diseases are a major threat to biodiversity and an important public health issue. West Nile virus (WNV) is an emerging vector-borne zoonotic arbovirus that is currently broadening its distribution in Europe. The evidence of WNV circulating in resident and migratory species has implications for both animal and public health, and should therefore be studied in depth. An integrated surveillance program, namely in birds, is essential for reducing the risk of infection in human populations within the One Health principles. In the present study, wild birds admitted to wildlife rehabilitation centres in Portugal were sampled. Two-hundred and eight blood samples were assayed serologically to antibodies to WNV, by using a commercial ELISA kit. An overall seroprevalence of 19.6% (95% confidence interval [CI]: 13.7-26.7%) was observed. Antibodies to WNV were detected in 13 (35.1%) different species of wild birds. Accipitriformes (26.7%; 95% CI: 18.5-36.2%) and Strigiformes (26.7%; 95% CI: 14.6-42.0%) were the orders with the highest seroprevalence recorded. There were no statistically significant differences (p = 0.725) between the geographical regions (NUTS II) studied, but statistically significant difference (p = 0.017) was found between gender (male: 34.4%; female: 4.8%). A higher seroprevalence was found in adults (32.1%) compared to juvenile birds (9.3%) (p = 0.014), and age was considered a risk factor to WNV infection in wild birds (odds ratio 1.4; 95% CI: 0.5–4.0). More epidemiological studies are needed in Portugal, since the actual spread of the WNV throughout the country is unknown.

The study aimed to evaluate for the first time the degree of contamination of soil and crops with major and trace elements (Cd, Co, Cr, Cu, Ni, Pb, Zn, F, Na, Mg, Si, P, Cl, Fe, Al) in agricultural lands situated in the Lower Danube Basin, Galati and Braila counties (SE Romania), impacted by the steel industry. Soil samples from two depths (0–5 cm and 5–30 cm), as well as leaves and seeds of wheat, corn, and sunflower, were collected from 11 different sites. Along with elemental and mineralogical analysis, performed by HR-CS AAS, PIGE, SEM-EDX and ATR-FTIR, the soil pH, texture, organic matter, electric conductivity and CaCO3 content were investigated. The results showed that the levels of Cr (83.270–383.100 mg kg-1), Cu (17.110–68.151 mg kg-1), Ni (30.157–55.656 mg kg-1), and F (319–544 mg kg-1) in soil exceeded the Romanian regulations for sensitive use of the land. The pollution indices (Igeo, EF, PI, PERI) indicate that the soil is moderate to highly contaminated with Cr, Ni and Cu, while CSI and mERMQ indices suggested a relatively low risk for metal contamination. The concentrations of elements in plant tissues and bioaccumulation factors (BFs) show the soil-plant relation and health risk, but also the elemental selectivity of vegetal compartments. Thus, the results showed that wheat plants tend to exclude the bioaccumulation of certain elements in their tissues, while for Zn and Cu, the bioaccumulation pattern is different. In the case of corn, most BFs were below 1, indicating limited phytoaccumulation capacity. However, exceptions were observed for Cd, Zn, and Cu. Sunflower BFs indicate higher bioconcentration of Cu, Cd, and Zn in both the leaves and seeds compared to other elements. Chromium (Cr) contributes to non-carcinogenic dermal contact and ingestion hazards, with children being more susceptible to the adverse effects of this contaminant.

Objective: To employ Latent Class Analysis (LCA) to investigate dietary intake patterns among Sudanese children aged 0 to 2 years and to examine the association of these patterns with sociodemographic factors. Methods: This study leveraged the Sudan Multiple Indicator Cluster Survey (MICS) 2014 data to uncover dietary intake patterns among 7,362 children using latent class analysis (LCA). We investigated class memberships concerning demographic and socioeconomic factors. The model's adequacy was determined using several fit indices, including BIC, AIC, entropy, CAIC, and SABIC, providing a holistic evaluation of the model's accuracy in capturing dietary behaviors. Results: Three latent classes were identified: Class 1 (55%) with an average nutrition composition, Class 2 (28%) with limited nutrition composition, and Class 3 (17%) with good nutrition composition. Significant associations were found between latent class membership and sociodemographic factors, particularly mother's education level and household wealth. The three-class solution provided the best balance between model fit and class distinction. Conclusions: The LCA revealed distinct dietary intake patterns and underscored the influence of sociodemographic factors on child nutrition. The findings suggest that targeted nutritional interventions should be developed according to the specific needs of different latent classes. The study also highlights the utility of LCA as a robust statistical and machine learning tool in public health research, capable of informing tailored interventions and policies for improving child nutrition. Implications: The study emphasizes the importance of maternal education and socio-economic status in shaping dietary behaviors of children in Sudan. It implies the need for policies that address educational disparities, food security, and economic development as part of comprehensive nutritional interventions.

Interprofessional learning (IPL) is essential to prepare healthcare trainees as the future public health workforce. WHIRL was an innovative IPL intervention that engaged multi-professional teams of volunteer healthcare trainees (n=20) to deliver health checks (n=464), including tailored advice and signposting, to employees in the UK construction industry (across 21 events, 16 sites, 10 organisations) as part of an ongoing research programme called Test@Work. Volunteers undertook a four-part training and support package of trainer-led education, observations of practice, self-directed learning and clinical supervision, together with peer mentoring. In a one-group post-test only design, IPL outcomes were measured using the Inventory of Reflective Vignette - Interprofessional Learning (IRV-IPL), and the psychometric properties of the IRV-IPL tool were tested. WHIRL demonstrably improved healthcare trainees’ interprofessional skills in all five areas of collaboration, coordination, cooperation, communication, and commendation. The IRV-IPL tool was found to be a valid and reliable measure of interprofessional competencies across three scenarios; before and after health promotion activities, and as a predictor of future health promotion competence. This industry-based workplace IPL programme resulted in attainment of health check competencies, and bridged the gap between research, education and clinical practice.

Plants are continuously exposed to environmental challenges, including pollutants, pesticides, and heavy metals, collectively termed xenobiotics. These substances induce oxidative stress by generating reactive oxygen species (ROS), which can damage cellular components such as lipids, proteins, and nucleic acids. To counteract this, plants have evolved complex metabolic pathways involving both enzymatic and non-enzymatic mechanisms to detoxify and process these harmful compounds. Oxidative stress in plants primarily arises from the overproduction of ROS, including hydrogen peroxide (H2O2), superoxide anions (O2•−), singlet oxygen (1O2), and hydroxyl radicals (•OH), by-products of metabolic activities such as photosynthesis and respiration. Exposure to xenobiotics significantly elevates ROS levels, causing cellular damage and disrupting metabolism. Plants employ a robust antioxidant defense system featuring enzymatic antioxidants like catalase (CAT), superoxide dismutase (SOD), and various peroxidases (POD). These enzymes collaborate to scavenge ROS, minimizing their detrimental effects. Additionally, plants produce numerous non-enzymatic antioxidants, such as flavonoids, phenolic acids, vitamins C and E, which neutralize ROS and regenerate other antioxidants, providing comprehensive protection against oxidative stress. Xenobiotic metabolism in plants involves three phases: Phase I (modification), Phase II (conjugation), and Phase III (compartmentalization), facilitated by enzymes like cytochrome P450 monooxygenases (CYPs), transferases such as glutathione S-transferases (GSTs), and ATP-binding cassette (ABC) transporters. Plant secondary metabolites, including alkaloids, terpenoids, and flavonoids, significantly contribute to detoxification and antioxidant defense. Understanding these oxidative processes and xenobiotic metabolism pathways in plants is crucial, as it offers insights into developing plant-based strategies to mitigate environmental pollution impacts and improve human health through enhanced detoxification and antioxidant mechanisms, as we discuss in this review.

Objective: Mechanical bowel preparation is essential for the visualisation of the colon during colonoscopy, and previous studies have identified changes in gut microbiota composition after bowel preparation and colonoscopy. Considering the gut microbiota is increasingly implicated in mood, we aimed to explore the potential impact of this intervention on mood and the microbiota-gut-brain axis. Methods: We conducted a pre-post intervention study, with timepoints of one week before and one month after bowel preparation and colonoscopy, in community-dwelling adults referred for colonoscopy. Our primary outcome was change in average Hospital Anxiety and Depression Scale depression sub-scores using generalised estimating equations. We also examined changes in average anxiety, stress, and quality of life scores, and faecal microbiota composition and potential function using 16S rRNA sequencing. We further explored associations between changes in depressive symptoms and the gut microbiota and conducted post-hoc analyses to explore potential effect modifiers. Key Results: 59 participants were included in the analyses. Depressive symptoms decreased one-month post-procedure compared to baseline (adjusted β=−0.64; 95%CI: −1.18, −0.11). Irritable bowel syndrome (IBS) appeared to moderate this relationship (1.78; 0.292, 3.26); depressive symptoms increased in those with, and decreased in those without, IBS. Changes in gut microbiome composition included reduced alpha diversity, modest effects on beta-diversity, and increases in genera associated with potential health benefits, one-month post-procedure compared to baseline. Increases in the CLR-transformed abundance of Ruminococcaceae UCG-009 were associated with improvements in depressive symptoms. Conclusions: There is preliminary evidence of a potential mental health effect of bowel preparation and colonoscopy, which may be associated with changes to the gut microbiota. There may also be a differential mental health impact of this procedure for those with and without IBS. Considering the limitations of our study, further research is required to confirm these findings and their clinical relevance.

Structural health monitoring has been studied by a number of researchers as well as various industries to keep up with the increasing demand for preventive maintenance routines. This work presents a novel method for reconstruct prompt, informed strain/stress responses at the hot spots of the structures based on strain measurements at remote locations. The structural responses measured from usage monitoring system at available locations are decomposed into modal responses using empirical mode decomposition. Transformation equations based on finite element modeling are derived to extrapolate the modal responses from the measured locations to critical locations where direct sensor measurements are not available. Then, two numerical examples (a two-span beam and a 19956-degree of freedom simplified airfoil) are used to demonstrate the overall reconstruction method. Finally, the present work investigates the effectiveness and accuracy of the method through a set of experiments conducted on an aluminium alloy cantilever beam commonly used in air vehicle and spacecraft. The experiments collect the vibration strain signals of the beam via optical fiber sensors. Reconstruction results are compared with theoretical solutions and a detailed error analysis is also provided.

Antimicrobial resistance (AMR) is an increasingly pressing threat to human, animal, and environmental health. Reducing the use of antibiotics in agriculture has been identified as a key way to curb the spread of AMR. However, the effect of such policies on AMR prevalence, and their broader impacts on agricultural, health, and economic outcomes at the population level have proven very difficult to estimate and compare. This paper draws on and formalises ideas presented at the JPIAMR New Perspectives on Bacterial Drug Resistance workshop in June of 2022. With reference to emerging literature on the topic, it proposes a quantitative framework for estimating the relevant causal relationships needed to quantify the cross-sectoral impacts of AMR policies in agriculture, and for comparing these outcomes in like terms in a way which can feed directly into policy decision-making, notably without prohibitive data requirements. The ability of researchers to apply frameworks such as this will be increasingly necessary in order to holistically capture the impacts of AMR policies and to situate them in the broader policy context; especially where the mechanisms of transmission are opaque or complex, where data availability is limited; and where policymakers must allocate scarce resources among many competing objectives.

Patients with Parkinson’s Disease (PD) experience REM sleep behavior disorder (RBD) more frequently than healthy controls. RBD is associated with torpid disease evolution. To test the hypothesis that differential genetic signatures might contribute to the torpid disease evolution in PD patients with RBD. We compared the rate of genetic mutations in PD patients with or without probable RBD. Patients with a clinical diagnosis of PD in the Parkinson’s Progression Markers Initiative (PPMI) database entered the study. We excluded those with missing data or a diagnosis change over the first five years from the initial PD diagnosis. Probable RBD (pRBD) was confirmed by a REM Sleep Behavior Disorder Screening Questionnaire score &gt;5 points. Logistic regression and Machine Learning (ML) algorithms were used to relate Single Nucleotide Polymorphism (SNPs) in PD-related genes with pRBD. We included 330 PD patients fulfilling all inclusion and exclusion criteria. The final logistic multivariate model revealed that the following SNPs increased the risk of pRBD: GBA_N370S_rs76763715 (OR, 95% CI: 3.38, 1.45-7.93), SNCA_A53T_rs104893877 (8.21, 2.26-36.34), ANK2. CAMK2D_rs78738012 (2.12, 1.08-4.10), and ZNF184_rs9468199 (1.89, 1.08-3.33). Conversely, SNP COQ7. SYT17_rs11343 reduced pRBD risk (0.36, 0.15-0.78). The ML algorithms led to similar results. The predictive models were highly specific (95-99%) but lacked sensitivity (9-39%). We found a distinctive genetic signature for pRBD in PD. The high specificity and low sensitivity of the predictive models suggest that genetic mutations are necessary but not sufficient to develop RBD in PD. Additional investigations are needed.

(1) Background: With continuous globalization and modernization of people's lives, lifestyle has changed dramatically, with decreased physical activity and increased unhealthy eating patterns in many nations throughout the world. With the COVID-19 pandemic and changes taking place in people’s health and lifestyles around the world, the need for rehabilitation is expected to rise in the coming years.(2)Methods: This paper analyzes the integration model of sports and health care using theoretical analysis, literature reviews, logical reasoning, and other methods.(3)Results: The integration of sports and health care in China has entered the stage of practical implementation after many years of development, forming a few representative integration patterns. Governments, communities, community hospitals, hospitals, and third-party institutions are the main participants, with the community playing an important role in the integration. Pharmacies, sports venues, and schools with sufficient staff have a relatively low participation rate.(4)Conclusion: The grading treatment has been applied in health management and sports rehabilitation, based on the development of digital medicine, a government-led grading treatment model of "health management center" can promote the participation of multiple subjects in the integration of sports and health care, solving the problems existing in the current integration process to a certain extent.

Indigenous Peoples in Canada are disproportionately affected by chronic hepatitis C virus (HCV) infection. HCV prevalence in Indigenous Peoples is estimated at approximately five to 10-fold higher than it is in non-Indigenous persons, while the reported rate of newly diagnosed HCV cases in First Nations communities was six times the respective rate in the general Canadian population in 2022. This review explores the reasons underlying the disproportionate burden of hepatitis C virus (HCV) infection in Indigenous Peoples, including significant over-representation of Indigenous Peoples in the major risk categories for HCV acquisition, such as substance abuse, incarceration, homelessness or inadequate shelter, and disruption of family/social supports. The impact of these risk factors is aggravated by many access barriers to healthcare services despite the availability of universal healthcare system and free curative antiviral therapies. These stem from the legacy of colonialism, discrimination and disenfranchisement, and are exacerbated by racism in the justice and healthcare systems, stigmatization and victimization. Recent recognition of historical harms and early steps towards nation-to-nation reconciliation along with support for culturally safe, wholistic and Indigenous People-led wellness programs instill hope that elimination strategies to eradicate HCV infection in Indigenous populations will be successful in Canada.

Previous research has already examined the relationship between Future Anxiety, a construct recently introduced in Italy, and mental health in young adults, although possible mediating variables in this relationship have so far never been investigated. The present study attempts to fill this gap by exploring the incidence of Future Anxiety on psychological distress in a group of 302 young Italian adults (18 - 30 years; M = 21.9; SD = 2.6), presenting and evaluating the simultaneous mediating effect of Intolerance of Uncertainty and Non-Pathological Worry.Findings highlighted how Future Anxiety had a positive and significant direct effect on Stress and Depression, but not on Anxiety. In the three serial mediation models proposed, Intolerance of Uncertainty and Non-Pathological Worry mediated the relationship between Future Anxiety and mental health outcomes. The results also confirmed the hypothesized serial mediation effect by highlighting how young adults with greater Future Anxiety experienced more Intolerance of Uncertainty, which positively affected Non-Pathological Worry levels and, in turn, exacerbated psychological distress. Finally, results indicated that female participants experienced more Stress, Anxiety, and Depression in relation to Future Anxiety compared to males. Starting from the review of main references on this subject, the results discussed provide new insights for understanding youth psychological distress. Finally, practical implications for the design of supportive interventions for this study’s target group are proposed.

Dust inhalation is a huge concern in the mining environment and within all its operations. In fact, dust to be one of the most serious occupational hazards in the mining industry. Coal and crystalline silica dust are the causes of serious, sometimes fatal lung diseases such as pneumoconiosis, which affects coal miners, as well as silicosis, tuberculosis, chronic bronchitis, emphysema, chronic obstructive pulmonary disease, and chronic renal disease, which affect coal and other types of miners. The resulting effects both affect workers and nearby communities. The mining industry has in the past, employed several approaches to reduce effects of dust. But these strategies have often been ineffective because the grass withers during the dry season and sprayed water is rapidly absorbed or evaporates. This paper endeavors to review information on dust in the mining environment and how it is a nuisance to workers and communities and establish what strategies exist for this.

Whole-brain radiation therapy and stereotactic radiosurgery are two treatment modalities commonly utilized to treat brain metastases (BMs). The aim of this study is to retrospectively analyze the main radio-oncologic and clinical-demographic aspects of a cohort of BM patients treated with Volumetric Modulated Arc Therapy for radiosurgery (VMAT-RS). This is a cross-sectional observational design study with retrospective review of medical records of patients with brain metastases treated with VMAT- RS between 2012 and 2018. Clinical and demographic data, with special attention to sex, age, primary tumor, brain tumor-related epilepsy (BTRE), number and brain location of BMs, Karnofsky Performance Status (KPS), the updated DS-GPA prognostic index and the survival estimated according to the Kaplan-Meier model from the date of radiosurgery were analyzed. One hundred and twenty-one patients with 229 BMs were treated with VMAT-RS. Patients presented 1-4 BMs, which were treated with 5 non-coplanar VMAT arcs. Sixty-eight percent of the patients had lung cancer and 35% of the BMs were in the frontal lobe. Proportion of local control was 88.5%. BTRE prevalence was 30.6%. The median survival time (MST) was 7.7 months. In the multivariate analysis of the Cox Regression model KPS70 (HRKPS&lt;70=2.59; p=0.001) and higher DS-GPA (HRDS-GPAII =0.55, p=0.022; HRDS-GPAIII-IV =0.38, p=0.006) were associated with improved survival. In the univariate analysis, primary tumor, age and the presence of metastases in the posterior fossa (PFBMs) were also significative. In conclusion, the VMAT-RS is a technique with an overall survival comparable to other radiosurgery techniques. The median survival is significantly longer in those with higher KPS and DS-GPA. Other variables such as the type of primary tumor, age and PFBMs could also influence survival, although further studies are needed.

Deregulation of cell growth and development lead to cancer, a severe condition that claims millions of lives worldwide. Targeted or selective approaches used during cancer treatment determine the efficacy and outcome of the therapy. In order to enhance specificity and targeting and better treatment options for cancer, novel and alternative modalities are currently under development. Photodynamic therapy has the potential to eradicate cancer and combination therapy would yield even greater outcomes. Nanomedicine-aided cancer therapy shows enhanced specificity for cancer cells and minimal side-effects coupled with effective cancer destruction both in vitro and in vivo. Nanocarriers used in drug-delivery systems are well able to penetrate cancer stem cell niche, simultaneously killing cancer cells and eradicate drug-resistant cancer stem cells, yielding therapeutic efficiency up to 100 fold against drug-resistant cancer in comparison with free drugs. Safety precautions should be considered when using Nano-mediated therapy as the effects of extended exposure to biological environments are still to be determined.

Wind turbines are associated with noise pollution and make a significant impact on social and environmental stability. The surrounding activities affect the noise pollution in residential locations. It is significantly important that wind power asset owners proactively consider the impact to the surrounding environment while constructing and in the operational phase of wind farms. This will enable the investigation of potential solutions for mitigating public inconvenience. Regulatory authorities regularly demand that asset owners take noise level measurements to investigate the consequences to the public and the environment from wind farms; however, the local authorities do not consider low-frequency noise generation. This manuscript presents a noise risk assessment approach using fuzzy set theory. In this study, two wind farms were selected which are located in the north-central region of Sri Lanka and studied during the southwest monsoon, northeast monsoon and inter-monsoon seasons. Noise data were collected from wind turbines near the residential areas to investigate their impact on the environment and society. To perform noise risk assessment proactively in populated areas, and to identify the risk, a fuzzy logic-based expert system was presented in this study.

Polycystic ovary syndrome (PCOS) usually comes along with metabolic disturbances attributed to androgen excess and obesity, but the contribution of each has not been defined, and the occurrence of metabolic disturbances is frequently not investigated. We evaluated 99 PCOS and 41 non-PCOS women. Clinical biomarkers of glucose-, liver-, and endothelial-related metabolic alterations were measured; participants were categorized into four groups according with obesity (OB) and hyperandrogenemia (HA) statuses: Healthy (no-HA, lean), HA (HA, lean), OB (no-HA, OB), and HAOB (HA, OB). Metabolic disturbances were highly frequent in PCOS women (70%). BMI correlated with all biomarkers, while free testosterone (FT) only with glucose- and hepatic-related indicators. Despite insulin sensitivity and liver enzymes were associated with FT, women with obesity exhibited lower M [coeff = 8.56 – 0.080(FT) –3.71(Ob); p &lt;0.001)] and higher aspartate aminotransferase (coeff = 26.27 + 0.532(FT) + 8.08(Ob); p = 0.015)] than lean at the same level of FT. Women with obesity exhibited greater risk of metabolic disorders than lean, independently of hyperandrogenemia. Clinicians are compelled to search for metabolic alterations in PCOS women; obesity must be handled in all cases, but hyperandrogenemia needs to be managed also in those with glucose- or liver-related disturbances.

Abstract: Background: In contrast to conventional definitions, the contemporary conceptualization of adulthood emphasizes psychological characteristics over sociodemographic milestones. Concurrently, there is a growing proposition that individuals' perceptions of adulthood exert a substantial influence on the mental well-being of adolescents and adults. However, empirical examination of this hypothesis has been notably limited to date. Method: This study applied some adulthood markers, and multiple mental health indices (including Well-being, Optimism, Alexithymia, Satisfaction with life, Goldberg's index of mental health, Dark triad, and dimensional personality disorders) to a community sample comprising 1772 individuals in Spain, spanning ages from 16 to 93 years. Results: The findings support the overarching hypothesis, as perceptions of adulthood exhibit significant associations with almost all measured mental health indices, especially with those conforming a factor of Negative emotions. These associations persist even after accounting for age and socioeconomic status, and in alignment with the psychological paradigm of adulthood, they demonstrate stability across different age cohorts. Conclusions: The study establishes that such perceptions of adulthood represent a modifiable factor contributing to positive mental health. The implications of these findings for the formulation of public policies aimed at promoting mental health in the context of adulthood are deliberated, as well as a number of future studies.

Objective: This study aimed to determine impact of eHealth literacy on health promotion activities and preventive health practice among adolescents. Methods: This cross-sectional study was conducted between March and May 2022 with 706 adolescents in Çorum, Turkey. A face to face questionnaire form including socio demographic characteristics, preventive health practices, eHealth Literacy scale and Adolescent Health Promotion Scale were used. The data of the research were analyzed with the SPSS 22.0 program. Percentage, mean, Pearson Correlation analysis and multiple regression analysis were used in the analyzes. The p<0.05 value was considered statistically significant in the evaluations. Results: In the study, 55.8% were female and the mean age of the whole group was 16.09±2.63 years. The mean score of eHealth Literacy scale was 29.40±6.29. The mean of the total scores obtained from the Adolescent Health Promotion Scale was 137.97±21.87. Among the adolescents 96.0% didn’t use alcohol and 81% didn’t smoke. The rate of annual weight measure was 68.8%. Measurements of annual blood pressure, annual blood iron, annual cholesterol, annual dental examination and regular exercise rate were below 50%. There was a significant positive correlation between eHealth literacy and the Adolescent Health Promotion Scale (p<0.001). Multiple linear regression analysis was performed to predict eHealth literacy using the variables of Adolescent Health Promotion and preventive health practices. eHealth literacy was positively and significantly predicts health promotion behaviors (β= 0.27, t (695)= 7.54, p<0.001). eHealth literacy increased annual weight measurement by more than 0.13 (β=0.13), the annual blood iron measurement by more than 0.16 (β=0.16), annual dental examination by more than 0.11 (β=0.11). Conclusions: Adolescents ehealth literacy was high and effected via health promotion activities and preventive health practices. Developing eHealth litracy interventions will be important for environments with a high concentration of adolescents (schools, courses). Also, primary health care services should be entegrated with school environment.

Suboptimal nutrition is a leading cause of cardiometabolic disease and mortality. Biological sex is a variable that can play a role in individual response to nutritional factors and may modulate the impact of nutrition on disease. This narrative review explores the intricate interplay between sex, nutrition, and health outcomes, and the consequent importance of considering sex in nutrition research, dietary recommendations, and disease management. We examine the impact of sex on how various dietary patterns, including the Mediterranean diet, macronutrient content and quality, Western diet, and energy restriction associate with or affect metabolic health and disease risk. Understanding how sex influences the response to the diet can inform precision nutrition interventions and approaches for disease prevention and management.