There are four subtypes of adenosine receptors (ARs), named A1, A2A, A2B and A3, all of which are G protein-coupled receptors. The A2BAR, coupled to both Gαi and Gαq G proteins, is one of the several G-protein-coupled receptors that are expressed in a significantly higher level in some cancer tissues in comparison to adjacent normal tissues. There is growing evidence that the A2BAR plays an important role in tumor cell proliferation, angiogenesis, metastasis, and immune suppression. Thus, A2BAR antagonists are potentially novel attractive anticancer agents. Several antagonists targeting at the A2BAR are currently in clinical trials for various types of cancers. In this review, we first describe the signaling, agonists, and antagonists of the A2BAR. We further discuss the role of the A2BAR in the progression of various types cancers, and the rationale of using A2BAR antagonists in cancer therapy

Understanding the role of risk regions identified by genome-wide association studies (GWAS) have made considerable progress lately referred to the post-GWAS era. Annotation of the genes to the GWAS and fine-mapped functional variants, and understanding their biological pathway/gene networks enrichments is expected to give rich dividend by elucidating the mechanisms underlying prostate cancer. To this aim, we compiled and analysed currently available post-GWAS data on genes identified through GWAS and validated through experimental studies in prostate cancer to investigate molecular biological pathways enriched for assigned functional genes. The results highlight some well-known cancer signalling pathways, antigen presentation process and enrichment in cell growth and development gene networks suggesting prostate cancer may result from the accumulation of the effects of functional variants through multiple gene sets and pathways. The upstream analysis identifies critical transcription factors, which supplements the results regarding the regulatory role of the post-GWAS genes. We also identified the common genes between post-GWAS and three well-annotated prostate cancer Oncomine data in patient samples in order to uncover possible main genes in prostate cancer development/progression. Post-GWAS generated knowledge of gene networks and pathways, if analysed further and targeted appropriately, will have an important impact on clinical management of the disease.

Beta adrenoblockers is a large class of drugs mainly used to manage abnormal heart rhythms. Over the last couples of decades, the anticancer effects of these compounds has been extensively studied. There is much evidence about their activity in non-small cell lung, pancreatic, breast, colorectal, prostate and ovarian cancer. However, the mechanism of beta blockers anticancer activity is still not known, and more detailed studies are needed. The aim of our study was to evaluate the anticancer activity of beta adrenoblockers in non-small cell lung cancer cell lines A549 and H1299. In order to find the relationship with their selectivity to beta adrenoreceptors, in our study we used selective (atenolol, betaxolol, esmolol, metoprolol) and non-selective (pindolol, propranolol and timolol) beta blockers. The effect on cell viability was evaluated by MTT assay and the activity on cell ability to form colonies was tested by clonogenic assay. The type of cell death was evaluated by cell double staining with Hoechst 33342 and Propidium iodide. The most active adrenoblockers against both tested cancer cell lines were propranolol and betaxolol. They completely inhibited lung cancer cell colony formation at 90% of EC50 (half maximal effective concentration) value. Most tested compounds induced cell death through apoptosis and necrosis. In A549 cell lines apoptosis was mainly induced while in H1299 cell line compounds induced both apoptosis and necrosis. There was no correlation established between beta adrenoblocker anticancer activity and their selectivity to beta adrenoreceptors.

Genetic activation of the class I PI3K pathway is very common in cancer. This mostly results from oncogenic mutations in PIK3CA, the gene encoding the ubiquitously expressed PI3Kα catalytic subunit, or from inactivation of the PTEN tumour suppressor, a lipid phosphatase which opposes class I PI3K signalling. The clinical impact of PI3K inhibitors in solid tumours, aimed at dampening cancer-cell-intrinsic PI3K activity, has thus far been limited. Challenges include poor drug tolerance, incomplete pathway inhibition and pre-existing or inhibitor-induced resistance. The principle of pharmacologically targeting cancer-cell-intrinsic PI3K activity also assumes that all cancer-promoting effects of PI3K activation are reversible, which might not be the case. Emerging evidence suggests that genetic PI3K pathway activation can induce and/or allow cells to tolerate chromosomal instability, which – even if occurring in a low fraction of the cell population – might help to facilitate and/or drive tumour evolution. While it is clear that such genomic events cannot be reverted pharmacologically, a role for PI3K in the regulation of chromosomal instability could be exploited by using PI3K pathway inhibitors to prevent those genomic events from happening and/or reduce the pace at which they are occurring, thereby dampening cancer development or progression. Such an impact might be most effective in tumours with clonal PI3K activation and achievable at lower drug doses than the maximum-tolerated doses of PI3K inhibitors currently used in the clinic.

Background: Lung cancer (LC) is a major leading cause of death worldwide. Immunomodulators that target several immune mechanisms have proven to reduce tumor burden in experimental models through induction of the immune microenvironment. We hypothesized that other biological mechanisms may also favor tumor burden reduction in lung cancer-bearing mice treated with immunomodulators. Methods: Tumor weight, area, and immune cells (T, B, macrophages, and TNF-alpha levels, immunohistochemistry) and tumor growth, oxidative stress, apoptosis, autophagy, and sirtuin-1 markers were analyzed (immunoblotting) in subcutaneous tumor of BALB/c mice injected with LP07 adenocarcinoma cells treated with monoclonal antibodies (CD-137, CTLA-4, PD-1, and CD-19, N=9/group) and non-treated control animals. Results: Compared to non-treated cancer mice, in tumors of monoclonal-treated animals, tumor area and weight and ki-67 significantly reduced, while T cell counts, oxidative stress, apoptosis, autophagy, and sirtuin-1 marker increased. Conclusion: Immunomodulators elicited a reduction in tumor burden (reduced tumor size and weight) through decreased tumor proliferation and increased oxidative stress, apoptosis, autophagy, and sirtuin-1 levels, which may have interfered with the immune profile of the tumor microenvironment. Future research should be devoted to the elucidation of the specific contribution of each biological mechanism to the reduced tumor burden.

Tight regulation of gene transcription is essential for normal development, tissue homeostasis and disease-free survival. Enhancers are distal regulatory elements in the genome that provide specificity to gene expression programs and are frequently misregulated in cancer. Recent studies examined various enhancer-driven malignant dependencies and identified different approaches to specifically target these programs. In this review, we describe numerous features that make enhancers good transcriptional targets in cancer therapy and discuss different approaches to overcome enhancer perturbation. Interestingly, a number of approved therapeutic agents such as cyclosporine, steroid hormones, and thiazolidinediones actually function by affecting enhancer landscapes by directly targeting very specific transcription factor programs. More recently, a broader approach to targeting deregulated enhancer programs has been achieved via Bromodomain and Extraterminal (BET) inhibition or perturbation of transcription-related cyclin-dependent kinases (CDK). One challenge to enhancer-targeted therapy is proper patient stratification. We suggest that monitoring of enhancer RNA (eRNA) expression may serve as a unique biomarker of enhancer activity that can help to predict and monitor responsiveness to enhancer-targeted therapies. A more thorough investigation of cancer-specific enhancers and the underlying mechanisms of deregulation will pave the road for an effective utilization of enhancer modulators in a precision oncology approach to cancer treatment.

Inducible genetically defined mouse models of cancer uniquely facilitate the investigation of early events in cancer progression, however there are valid concerns about the ability of such models to faithfully recapitulate human disease. We developed an inducible mouse model of progressive lung adenocarcinoma (LuAd) that combines sporadic activation of oncogenic KRas^G12D with modest overexpression of c-MYC (KM model). Histological examination revealed a highly reproducible transition from adenoma to locally invasive adenocarcinoma within 6 weeks of oncogene activation. Laser-capture microdissection coupled with RNA-SEQ was employed to determine transcriptional changes associated with tumour progression. Upregulated genes were triaged for relevance to human LuAd using datasets from Oncomine and cBioportal. Selected genes were validated by RNAi screening in human lung cancer cell lines and examined for association with lung cancer patient overall survival using KMplot.com. Depletion of progression-associated genes resulted in pronounced viability and/or cell migration defects in human lung cancer cells. Progression-associated genes moreover exhibited strong associations with overall survival, specifically in human lung adenocarcinoma, but not in squamous cell carcinoma. The KM mouse model faithfully recapitulates key molecular events in human lung cancer and is a useful tool for mechanistic interrogation of LuAd progression.

Currently, data regarding optimal treatment modality, response, and outcome specifically for N3 head and neck cancer are lacking. This study aimed to compare the treatment outcomes between definitive concurrent chemoradiotherapy (CCRT) to the neck and upfront neck dissection followed by adjuvant CCRT. 93 N3 squamous cell carcinoma head and neck cancer patients were included. Primary tumor treatment was divided to definitive CCRT (CCRT group) or curative surgery followed by adjuvant CCRT (surgery group). Neck treatment was also classified into two treatment modalities: definitive CCRT to the neck (CCRT group) or curative neck dissection followed by adjuvant CCRT (neck dissection group). Overall, the 2-year overall survival (OS), local recurrence-free survival (LRFS), regional recurrence-free survival (RRFS), and distant metastasis-free survival (DMFS) were 51.8%, 47.3%, 45.6%, and 43.6%, respectively. In both oropharyngeal cancer and nonoropharyngeal cancer patients, in terms of OS, LRFS, RRFS or DMFS no difference was noted regarding primary tumor treatment (CCRT vs. surgery) or neck treatment (CCRT vs. neck dissection). In summary, N3 neck patients treated with definitive CCRT can achieve similar outcomes to those treated with upfront neck dissection followed by adjuvant CCRT. Cautions should be made to avoid overtreatment for this group of patients.

EZH2 overexpression is associated with tumor proliferation, metastasis, and poor prognosis. Targeting and inhibiting EZH2 may be an effective therapeutic strategy for head and neck squamous cell carcinoma (HNSCC). We previously analyzed EZH2 mRNA expression in a well-characterized dataset of 230 (110 original and 120 validation cohorts) human head and neck cancer samples. This study aimed to investigate the effects of inhibiting EZH2, either via RNA interference or via pharmacotherapy, on HNSCC growth. EZH2 upregulation was significantly correlated with recurrence (P < 0.001) and the methylation index of tumor suppressor genes (P < 0.05). DNMT3A was significantly upregulated upon EZH2 upregulation (P = 0.043). Univariate analysis revealed that EZH2 upregulation was associated with poor disease-free survival (log-rank test, P < 0.001). In multivariate analysis, EZH2 upregulation was evaluated as a significant independent prognostic factor of disease-free survival (hazard ratio: 2.085, 95% confidence interval: 1.390–3.127; P < 0.001). Cells treated with RNA interference and DZNep, an EZH2 inhibitor, showed the most dramatic changes in expression, accompanied with a reduction in the growth and survival of FaDu cells. These findings suggest that EZH2 upregulation is correlated with tumor aggressiveness and adverse patient outcomes in HNSCC. Evaluation of EZH2 expression might help predict the prognosis of HNSCC patients.

Production of energy is a main task of cancer cells metabolism, since costs of duplicating are enormous. Although energy is derived in cells by dismantling carbon to carbon bonds of any macronutrient, cancer nutritional needs for energetic purposes have been studied primarily as dependent on glycolysis. Since the end of the last century, awareness of dependence of cancer metabolism on amino acids not only for protein syntheses but also for matching energy needs has grown. The roles of specific amino acids, like glutamine, glycine and serine have been explored in different experimental conditions and reviewed. Moreover, there are epidemiological evidences that some amino acids used as supplement for therapeutic reasons (the branched chain ones) may reduce incidence of liver cancer, and some molecular mechanism has been proposed as functional to their protective action. On the contrary, metabolic signature of some pathology connected with increased risk of cancer, like prolonged hyperinsulinemia in insulin resistant patients, is signed by plasma elevated levels of the same branched chain amino acids, posing puzzling questions to clinicians. Most recently, peculiar formulations of amino acids, deeply different if compared to amino acids compositions normally present in foods, have shown the power to master epigenetics slowing growth or driving cancer cells to apoptotic death, while being even beneficial for normal cells and for animals health and life span. In this review, we will analyze and try to disentangle some of the many knots dealing with complexities of amino acids biology and linked to cancer metabolism.

Curcumin is a promising anti-cancer drug but its applications in cancer therapy are limited due to its poor solubility, short half-life and low bioavailability. In this study, curcumin loaded magnetic alginate / chitosan nanoparticles were fabricated to improve the bioavailability, uptake efficiency and cytotoxicity of curcumin to MDA-MB-231 breast cancer cells. Alginate and chitosan were deposited on Fe3O4 magnetic nanoparticles based on their electrostatic properties. The sizes of the nanoparticles (120-200 nm) were within the optimum range for drug delivery. Sustained curcumin release was obtained use the nanoparticles with the ability to control the curcumin release rate by altering the number of chitosan and alginate layers. Confocal fluorescence microscopy results showed that targeted delivery of curcumin with the aid of magnetic field were achieved. The FACS assay indicated that MDA-MB-231 cells treated with curcumin loaded nanoparticles had a 3-6 folds uptake efficiency to those treated with free curcumin. MTT assay indicated that the curcumin loaded nanoparticles exhibited significantly higher cytotoxicity toward MDA-MB-231 cells than toward HDF cells. The sustained release profiles, enhanced uptake efficiency and cytotoxicity to cancer cells as well as the targeting potential make MACPs a promising candidate for cancer therapy.

Maintenance of the human chromosomes stability requires a tight regulation of DNA replication to duplicate once and only once the entire genome of a single cell. In mammalians cells, origin activation is controlled in space and time by a cell specific and robust program called replication timing. About 100 000 of potential origins are loaded onto the chromatin at the G1 phase but only 20-30% are selected and active during the replication of a given cell. When the replication fork is slowed down by exogenous or endogenous sources, the cell need to activate more origins to complete the replication on time. Thus, the large choice of origins that can be activated may be a key player in the protection of the genome. The aim of this review is to discuss about the role of these dormant origins as housekeepers of the human genome in response to replicative stress.

The increased expression of β4-galactosyltransferase (β4GalT) 4 was closely associated with poor prognosis of colon cancer. Recently, we showed that the expression of the β4GalT4 gene is regulated by the 0.17 kb core promoter region containing one binding site for Specificity protein 1 (Sp1). To develop a novel screening method for anti-colon cancer drugs, two sensor cell lines having the luciferase gene under the control of two β4GalT4 gene promoters that differed in length were established from SW480 human colon cancer cells. The hGT4-0.17-sensor cells possessed the luciferase reporter driven by the 0.17 kb promoter, while the hGT4-0.3-sensor cells possessed the luciferase reporter driven by the 0.3 kb promoter containing one binding site each for colon cancer-related transcription factors including activator protein 2, E2F, caudal-related homeobox transcription factors, and Runt-related transcription factors besides Sp1. Upon treatment with mitogen-activated protein kinase inhibitor U0126, the promoter activities of the hGT4-0.3-sensor cells decreased significantly, while those of the hGT4-0.17-sensor cells unchanged. These results suggest that the responsiveness to U0126 differs between two sensor cell lines due to the different regulation of the luciferase reporters. This study provides the novel screening method for anti-colon cancer drugs by the combination of two sensor cell lines.

Breast cancer (BC) is the most common malignancy and second only to lung cancer in terms of mortality in women. Despite the incredible progress made in this field, the metastatic breast cancer leaves a poor prognosis. In an era of personalized medicine, there is an urgent need for a better knowledge of the biology leading to the disease, which can lead to the design of always more accurate drugs against patients’ specific molecular aberrations. Among one of the actionable targets is the Fibroblast Growth Factor Receptor (FGFR) pathway, triggered by specific ligands. The FGFRs/FGFs axis offers interesting molecular targets to be pursued in clinical development. This mini-review will focus on the current knowledge of the FGFRs mutations leading to tumour formation and summarizes the state-of-the-art of therapeutic strategies for targeted treatments against the FGFRs/FGFs axis in the context of BC.

TGF-β signaling transduces immunosuppressive biochemical and mechanical signals in the tumor microenvironment. In addition to canonical SMAD signaling, TGF-β can promote tumor growth and survival by inhibiting proinflammatory signaling and extracellular matrix remodeling. In this article, we will review how TAK1 activation lies at the intersection of proinflammatory signaling by immune receptors and anti-inflammatory signaling by TGF-β receptors. Additionally, we will discuss the role of TGF-β in the mechanobiology of cancer. Understanding how TGF-β dampens proinflammatory responses and induces pro-survival mechanical signals throughout cancer development will be critical in designing therapeutics which inhibit tumor progression while bolstering the immune response.

Apoptosis and cell cycle arrest induction are targeted in the strategy of cancer therapy. Furthermore, bacterial toxin such as shiga-like toxin producing Escherichia coli has been suggested to be used as novel therapeutic agent against tumor malignancies either as independent anti-neoplastic agents or in combination treatment with chemo or radiotherapy. The aim of study was to investigate the potency of shiga-like toxin originated from local strains of E. coli O157:H7 as a new cancer therapy. As many as 10 culture cells T47D cell line were subjected by crude extract Shiga like toxin originated from five local isolates of E. coli O157:H7 i.e. KL-48(2), SM-25(1), SM-7(1), DS-21(4), and one isolate ATCC 43894 as a control with IC50 doses, respectively. The treatment was observed for 24 h, with two replications. An FITC-Annexin V and PI assay was used to observe apoptosis and necrosis effect, and simultaneously with cell cycle analysis using propidium iodide (PI) staining. Results of study showed T47D cell treated with Shiga-like toxin from local strain KL-48 (2) show the lowest viable cell, followed by SM 7(1), ATCC 43894, SM-25(1), DS-21(4) and contrary with control with each percentages as 15.20, 16.36, 22.17, 22.64, 33.86, and 94.36%, respectively. The results were also confirmed by the induction of the cell cycle arrest in phase G0-G1 as inactive phase, i.e. 66.41, 63.37, 61.52, 55.36 and 47.28% for T47D cell treated with toxin of KL-48(2), ATCC 43894, SM 25(1), SM 7(1), and DS 21(4), respectively. These results show tendency deleterious effect of Shiga-like toxin from local isolates on T47D cell, so that concluded they have potency as a good anticancer drug in Gb3-expressing breast cancer.

In metastatic pancreatic cancer patients non eligible to surgery, signal-targeted therapies so far failed to show a significant amelioration of survival. These therapeutic options were tested in Phase II/III clinical trials mostly in combination with the reference treatment Gemcitabine. These innovative therapies aim at annihilating the oncogene dependency; they also aim at renormalizing the tumoral stroma to allow immune cell function or re-vascularisation. Transcriptomics and genomics large scale analysis show the great heterogeneity of pancreatic cancers and failed to clearly delineate specific oncogene dependency besides oncogenic Kras. In this review, we will describe the most recent proteomic data in pancreatic tumors and its metastasis, which could help at identifying their major signalling dependencies, as well as explain why they are intrinsically resistant to signal-targeted therapies. We will also discuss why PI3K signalling, as a paradigm of pro-tumorigenic cell signalling and of tumoral adaptative resistance to drugs, is a relevant target in this context.

In metastatic pancreatic cancer patients non eligible to surgery, signal-targeted therapies so far failed to show a significant amelioration of survival. These therapeutic options were tested in Phase II/III clinical trials mostly in combination with the reference treatment Gemcitabine. These innovative therapies aim at annihilating the oncogene dependency; they also aim at renormalizing the tumoral stroma to allow immune cell function or re-vascularisation. Transcriptomics and genomics large scale analysis show the great heterogeneity of pancreatic cancers and failed to clearly delineate specific oncogene dependency besides oncogenic Kras. In this review, we will describe the most recent proteomic data in pancreatic tumors and its metastasis, which could help at identifying their major signalling dependencies, as well as explain why they are intrinsically resistant to signal-targeted therapies. We will also discuss why PI3K signalling, as a paradigm of pro-tumorigenic cell signalling and of tumoral adaptative resistance to drugs, is a relevant target in this context.

Accurate assessment of the breast cancer deterioration degree plays a crucial role in making medical plan, and the important basis for degree assessment is the number of mitoses in a given area of the pathological image. We utilized deep multi-scale fused fully convolutional neural network (MFF-CNN) combing with conditional random felid (CRF) to detect mitoses in hematoxylin and eosin stained histology image. Analyze the characteristics of mitotic detection ----scale invariance and sparsity, as well as the difficulties ---- small amount of data , inconsistent image staining and sample class unbalanced. Based on this, mitotic detection model is designed. In this paper, a tissue-based staining equalization method is used, and to establish an effective training sample set, we select training samples by using CNN. A mitotic detection model fusing multi-level and multi-scale features and context information was designed, and the corresponding training strategy was made to reduce over-fitting. As preliminarily validated on the public 2014 ICPR MITOSIS data, our method achieves a better performance in term of detection accuracy than ever recorded for this dataset.

Sentinel lymph node dissection (sLND) using a magnetometer and superparamagnetic iron oxide nanoparticles (SPIONs) as a tracer was successfully applied in prostate cancer (PCa). Radioisotope-guided sLND combined with extended pelvic LND (ePLND) achieved better node removal, increasing the number of affected nodes or the detection of sentinel lymph nodes outside the established ePLND template. We determined the diagnostic value of additional magnetometer-guided sLND after intraprostatic SPION-injection in high-risk PCa. This retrospective study included 104 high-risk PCa patients (PSA >20 ng/ml and/or Gleason score ≥8 and/or cT2c) from a prospective cohort who underwent radical prostatectomy with magnetometer-guided sLND and ePLND. The diagnostic accuracy of sLND was assessed using ePLND as a reference standard. Lymph node metastases were found in 61 of 104 patients (58.7%). sLND had a 100% diagnostic rate, 96.6% sensitivity, 95.6% specificity, 96.6% positive predictive value, 95.6% negative predictive value, 3.4% false negative rate, and 4.4% false positive rate (detecting lymph node metastases outside the ePLND template). These findings demonstrate the high sensitivity and additional diagnostic value of magnetometer-guided sLND, exceeding that of ePLND through the individualized extension of PLND or the detection of sentinel lymph nodes / lymph node metastases outside the established node template in high-risk PCa.

Praeruptorin A(PA), a naturally existing pyranocumarin, is isolated from the dried root of Peucedanum praeruptorum Dunn. So far the anti-cancer effect and molecular mechanism behind Praeruptorin A action in human cervical cancer HeLa cells remain unknown. In the present study, we find that PA reduces cell proliferation and colony formation of human cervical cancer HeLa cells through inducing cell cycle arrest at G0/G1 phase. PA-upregulated p21 and p27 proteins are observed, accompanied with inhibition of cyclin D1 and S-phase kinase-associated protein 2(Skp2) proteins expression. PA could significantly inhibit migration and invasion of human HeLa cells. Meanwhile, PA significantly reduces invasive protein expression of matrix metalloproteinase-2 (MMP-2), and increases protein expression of tissue inhibitor of metalloproteinase-2 (TIMP-2). PA is observed to possess the capacity in suppressing ERK1/2 activation. PD98059 (ERK specific inhibitor) significantly enhances PA-induced downregulation of MMP-2 expression, and upregulation of TIMP-2 expression. Moreover, we found that PA treatment notably inhibits 12-O-tetradecanoylphorbol-13-acetate(TPA)-upregulated ERK1/2 activation, MMP-2 expression, cellular migration and invasion in human HeLa cells. Taken together, these findings are the first to demonstrate the anti-cancer activity of PA, which may act as a promising therapeutic agent for the treatment of human cervical cancer.

Sinulariolide, a natural product extracted from cultured-type soft coral Sinularia flexibilis, possesses bioactivity against the movement of several types of cancer cell. However, the molecular pathway of its effects on human bladder cancer remain poorly understood. Using a human bladder cancer cell line as an in vitro model, this study investigated the underlying mechanism of sinulariolide against cell migration/invasion in TSGH-8301 cells. We found that sinulariolide inhibited TSGH-8301 cell migration/invasion, and the effect was concentration-dependent. Furthermore, the protein expressions of matrix metalloproteinases (MMPs) MMP-2 and MMP-9, as well as urokinase, were significantly decreased after 24-h sinulariolide treatment. Meanwhile, the increased expressions of tissue inhibitors of metalloproteinases (TIMPs) TIMP-1 and TIMP-2 were in parallel with an increased concentration of sinulariolide. Finally, the expressions of several key phosphorylated proteins in the mTOR signaling pathway were also downregulated by sinulariolide treatment. Our results demonstrated that sinulariolide has significant effects against TSGH-8301 cell migration/invasion, and its effects were associated with decreased levels of MMP-2/-9 and urokinase expression, as well as increased TIMP-1/TIMP-2 expression. The inhibitory effects were mediated by reducing phosphorylation proteins of the PI3K, AKT and mTOR signaling pathway. The findings suggested that sinulariolide is a good candidate for advanced investigation with the aim of developing a new drug for the treatment of human bladder cancer.

The present investigation has been conducted on one hundred tissue fragments of breast cancer, collected and immediately cryopreserved following the surgical resection. The fragments were selected from patients with invasive ductal carcinoma of the breast, the most common and potentially aggressive type of mammary cancer, with the objective to increase the knowledge of breast cancer molecular markers, useful for diagnostic and prognostic categorization of patients, in assessing post-surgical therapeutic regimes. The proteomic screening, by 2D-IPG and mass spectrometry, allowed us to identify two main classes of protein clusters: proteins expressed ubiquitously at high levels in all patients, and proteins expressed sporadically among the same patients. Within the group of ubiquitous proteins, glycolytic enzymes and proteins with anti-apoptotic activity were predominant. Among the sporadic ones, proteins involved in cell motility, molecular chaperones and proteins involved in the detoxification appeared prevalent. The data of the present study indicates that the primary tumor growth is generally supported by two concurrent pathways: the inhibition of apoptosis and the stimulation of cellular proliferation. The second phase of the evolution of the tumor can be prematurely scheduled by the occasional presence of proteins involved in cell motility and in the defenses of the oxidative stress. To our knowledge this report on large-scales proteomics of breast cancer is currently a unique approach in the literature that offers the opportunity to evaluate the presence and recurrence of proteins to be used as prognostic indicators and susceptibility to metastasis in patients operated on for invasive ductal carcinoma of the breast.

Background: Lynch syndrome, the most frequent form of hereditary colorectal cancer and involves mutations in mismatch repair genes. The aim of this study was to identify mutations in MSH6 from 97 subjects negative for mutations in MLH1 and MSH2. Methods: By direct sequencing, we identified 27 MSH6 variants, of which, nine were novel. To verify the pathogenicity of these novel variants we performed in silico and segregation analyses. Results: Three novel variants were predicted by in silico analysis as damaging mutations and segregated with the disease phenotype. While, a novel frameshift deletion variant that was predicted to yield a premature stop codon, did not segregate with the LS phenotype in 3 of 4 cases in the family. Interestingly, another frame-shift variant identified in this study, already described in the literature, also did not segregate with the LS phenotype in 1 of 2 affected subjects in the family. In all affected subjects of both families, no mutation was detected in other MMR genes. Therefore, it is expected that within these families other genetic factors contribute to the disease either alone or in combination with MSH6 variants. Conclusion: We conclude that caution should be exercised in counseling for MSH6-associated LS family members.

Curcumin, found in the rhizome of turmeric, has extensive therapeutic promises via its antioxidant, anti-inflammatory, and antiproliferative properties. Preclinical in vitro and in vivo data have shown curcumin to be an effective treatment for multiple cancers. These effects are drived by curcumin's ability to induce G2/M cell cycle arrest, induction of autophagy, activation of apoptotic pathways, disruption of molecular signaling, inhibition of invasion and metastasis, and by increasing the efficacy of existing chemotherapeutics. Here we focused on the hormetic behaviour of curcumin. Frequently, low doses of toxins and other stressors not only are harmless but also activate an adaptive stress whereas high dose activates acute responses like autophagy and cell death. This phenomenon is referred to as hormesis. Many molecules that cause cell death elicite an initial autophagic step that is a cytoprotective mechanism relying on elimination of dysfunctional structures intracellular, notably by mitophagy. This phenomenon is considered as a primarily protective mechanism against stressors. At higher doses, cells undergo mitochondrial outer membrane permeabilization due to calcium release from the endoplasmic reticulum and die. Herein, we address the complex crosstalk between the induced mitochondrial biogenesis, mitochondrial destabilization accompanied by mitophagy and cell death that can also be at play.

Brain metastases are highly evolved manifestations of breast cancer arising in a unique microenvironment, giving them exceptional adaptability in the face of new extrinsic pressures. The incidence is rising in line with population ageing, and use of newer therapies that stabilise metastatic disease burden with variable efficacy throughout the body. Historically, there has been a widely held view that brain metastases do not respond to circulating therapeutics because the blood-brain-barrier (BBB) restricts their uptake. However, emerging data are beginning to paint a far more complex picture where the brain acts as a sanctuary for dormant, subclinical proliferations that are initially protected by the BBB, but then exposed to dynamic selection pressures as tumours mature and vascular permeability increases. Here, we review key experimental approaches and landmark studies that have charted the genomic landscape of breast cancer brain metastases. These findings are contextualised with the factors impacting on clonal outgrowth in the brain: intrinsic breast tumour cell capabilities required for brain metastatic fitness, and the neural niche, which is initially hostile to invading cells but then engineered into a tumour-support vehicle by the successful minority. We also discuss how late detection, abnormal vascular perfusion and interstitial fluid dynamics underpin the recalcitrant clinical behaviour of brain metastases, and outline active clinical trials in the context of precision management.

Caveolin-1 (Cav-1) is 22 kDa caveolae protein, acts as a scaffold within caveolar membranes. It interacts with alpha subunits of G-protein and thereby regulates their activity. Earlier studies reported elevated or up-regulated levels of caveolin-1 in the serum of prostate cancer patients. Secreted Cav-1 promotes angiogenesis, cell proliferation and anti-apoptotic activities in prostate cancer patients. Cav-1 upregulation is mainly related to prostate cancer metastasis. Keeping above facts in view, the present study was designed to explore Cav-1 as a target for prostate cancer therapy using computational approach. Molecular docking, structural base molecular modelling and molecular dynamics simulations were performed to investigate Cav-1 inhibitors. A predictive model was generated and validated to establish a stable structure. ZINC database of biogenic compounds was used for induced fit docking (IFD) and high throughput virtual screening. The H-bond interactions of the compounds with active site residues of Cav-1 were estimated by IFD and 100 ns long molecular dynamic simulations. The reported compounds showed significant binding and thus can be considered as potent therapeutic inhibitors of Cav-1. This study provides a valuable insight into biochemical interactions of Cav-1 for therapeutic applications and warrants for experimental validation of the predicted ‘active(s)’.

The increasing frequency of male cancer coupled with the reduction in male fertility seen worldwide motivated us to seek a potential evolutionary link between these two phenomena, concerning the reproductive transcriptional modules observed in cancer and the expression of cancer-testis-antigens (CTA). The phylostratigraphy analysis of the human genome allowed us to link the early evolutionary origin of cancer by reproductive life cycles of the unicellulars and early multicellulars, potentially driving soma-germ transition, female meiosis and parthenogenesis of polyploid giant cancer cells (PGCCs), with the expansion of the CTA multi-families, very late during evolution. CTA adaptation was aided by retrovirus domestication in the unstable genomes of mammals, for protecting male fertility in stress conditions, particularly that of humans, as compensation for the energy consumption by a large complex brain which also exploited retrotransposition. We found that the early and late evolutionary branches of human cancer are united by the immunity-proto-placental network, which evolved in the Cambrian and shares stress regulators with the finely-tuned sex determination system. We further propose that social stress and endocrine disruption caused by environmental pollution with organic materials, which alter sex determination in male foetuses and further spermatogenesis in adults, bias the development of PGCC-parthenogenetic cancer by default.

The most common type of head and neck cancer (HNC) is head and neck squamous cell carcinoma (HNSCC). It describes a heterogenous neoplastic disease that arises from the mucosal epithelium of the of the upper respiratory system and the gastrointestinal tract. It is characterized by high morbidity and mortality, being is the eighth most common cancer worldwide, with 931,931 newly diagnosed cases and 467,125 deaths according to the latest Global Cancer Statistics (GLOBOCAN) data. Despite the use of modern low-invasive surgical techniques and application of promising new chemoradiotherapies or combination treatment, the frequency of recurrences and the five-year survival of these patients remains unsatisfactory. The microenvironment of head and neck cancer comprises various cells that regulate neoplastic expansion. It is believed that the mesenchymal stromal cells (MSCs) present in the tumour milieu play a key role in the modulation of tumour initiation, development and progression, in the regulation of cancer treatment response, survival rates, patient outcomes and long-term prognosis; they also influence the resistance to cisplatin-based chemotherapy, the gold standard for advanced HNSCC. MSCs, are multipotent, heterogeneous, mobile cells, which meet specific stemness criteria defined by the International Society for Cellular Therapy (ISCT). Although no MSC-specific markers exist, they can be recognized based on several others, such as CD73, CD90 and CD105, while lacking the presence of CD45, CD34, CD14 or CD11b, CD79α, or CD19 and HLA-DR antigens; they share phenotypic similarity with stromal cells and their capacity to differentiate into other cell types. In the tumour niche, MSC populations are characterized by cell quiescence, self-renewal capacity, low reactive oxygen species production and the acquisition of epithelial-to-mesenchymal transition properties, they may play a key role in the process of acquiring drug resistance, and thus treatment failure. MSCs must also demonstrate plastic adherence in vitro and be able to differentiate into specific mesodermal cell types after stimulation i.e., adipocytes, chondrocytes, and osteoblasts when cultured under well-defined conditions. The present narrative review examines the links between mesenchymal stromal/stem cells and HNC, as well as the different mechanisms involved in the development of resistance to current chemo- and radiotherapies in HNSCC. It provides an overview of the current literature, including key opinion-forming systematic reviews, as well as cross-sectional, longitudinal, prospective and interventional studies based on cell culture models in vitro, animal or in vivo models of HNSCC; it also examines the possibilities of pharmacological targeting of stemness-related chemoresistance in HNSCC. It describes promising new strategies to optimize chemoradiotherapy with the potential to personalize patient treatment approaches, and highlights future therapeutic perspectives in HNC. The data concerning tumour-associated MSCs is arranged according to increasing clinical credibility.

Immune checkpoint receptors play a crucial role in steering tumor progression, prompting a focused investigation into the role of TIM3 in breast cancer. Analysis of TCGA BRCA data unveiled diverse correlations between TIM-3 expression and immune cell infiltration across subtypes. In our in-house cohort studied through IHC, significant changes in TIM3 expression with tumor grades were observed. Higher TIM3 expression correlated with increased disease-free survival in pan breast cancer, marking the first revelation of TIM3's positive role in pan BC prognosis. The study indicates that alluring TIM3 response, rather than suppression, may enhance breast cancer prognosis.

Microstructured surfaces are renowned for their unique properties, such as waterproofing and low adhesion, making them highly applicable in the biomedical field. These surfaces play a crucial role in influencing cell response by mimicking the native microenvironment of biological tissues. In this study, we engineered a series of biomimetic micropatterned surfaces using polydimethylsiloxane (PDMS) to explore their effects on primary breast cancer cell lines, contrasting these effects with those observed on conventional flat surfaces. The surface topography was varied to direct cells’ attachment, growth, and morphology. Our findings elucidate that surface-free energy is not merely a background factor but plays a decisive role in cell dynamics, strongly correlating with the spreading behaviour of breast cancer cells. Notably, on micropillar surfaces with high surface-free energy, an increase in the population of cancer cells was observed. Conversely, surfaces characterised by lower surface-free energies noted a reduction in cell viability. Moreover, the structural parameters, such as the gaps and diameters of the pillars, were found to critically influence cellular dispersion and adherence, underscoring the importance of the microstructures’ topography in biomedical applications. These insights pave the way for designing advanced microstructured surfaces tailored to specific cellular responses, opening new avenues for targeted cancer therapies and tissue engineering.

Gc protein-derived Macrophage Activating Factor (GcMAF), a powerful immunostimulant endowed with anti-cancer and anti-angiogenetic activities, offers significant advantages when combined with radiation therapy. A stronger immune response improves the effectiveness of radiation therapy by allowing the body to better eliminate residual cancer cells after treatment. In addition, by boosting the immune system, GcMAF mitigates some of the immunosuppressive side effects of radiation therapy, leading to faster recovery. In order to fully exploit the potential of GcMAF in cancer therapy, knowledge of the molecular interactions with its receptor is essential. This study proposes the first extracellular domain (residues 1-34) of the CCR1 protein as the GcMAF receptor. The CCR1 gene, expressed in monocytes and 168 other cell types or tissues, encodes this transmembrane protein. Electrostatic and hydrophobic interactions, along with hydrogen bonds mediate the molecular interactions between the TPT^420-GalNAcELAK (or TPK⁴²⁰ELAK) sequences of GcMAF (or Gc2 protein variant) and the TTEDYDTTT sequence of its receptor.

Hydroalcoholic extracts from Malbec and Torrontés wine pomace (Vitis vinifera L.) originating from the high-altitude vineyards of Argentina's Calchaquí Valleys were characterized. Total phenolics, hydroxycinnamic acids, orthodiphenols, anthocyanins, non-flavonoid phenolics, total flavonoids, flavones/flavonols, flavanones/dihydroflavonols, and tannins were quanti-fied through spectrophotometric methods, with Malbec extract exhibiting higher concentra-tions in most of phytochemical groups when compared to Torrontés. HPLC-DAD identified more than 30 phenolic compounds in both extracts. Malbec displayed superior antiradical ac-tivity (ABTS cation, nitric oxide, and superoxide anion radicals), reduction power (iron, copper and phosphomolybdenum), hypochlorite scavenging, and iron chelating ability, compara-tively to Torrontés. The cytotoxicity assessments revealed that Torrontés affected the viability of HT29-MTX and Caco-2 colon cancer cells by 70% and 50%, respectively, at the highest tested concentration (1 mg/mL). At the same time, both extracts did not demonstrate acute toxicity in Artemia salina or in red blood cell assays at 500 µg/mL. Both extracts inhibited the lipoxygen-ase enzyme, with Malbec also reducing the tyrosinase activity and neither inhibited the xan-thine oxidase. The substantial phenolic content and diverse biological activities in Calchaquí Valleys' pomaces underline their potentialities to be valorized for pharmaceutical, cosmetic, and food industries.

Colorectal cancer is one of the most common causes of cancer mortality worldwide, and innovative drugs for the treatment of colorectal cancer are continually being revealed. 5-Fluorouracil (5-FU) is a common clinical chemotherapeutic drug. Acquired resistance to 5-FU is a clinical challenge in colorectal cancer. Parecoxib is a selective COX-2-specific inhibitor, which has been demonstrated to inhibit metastasis in colorectal cancers in our previous study. This study aimed to investigate the synergistic antimetastatic activities of parecoxib to 5-FU in human colorectal cancer cells and determine the underlying mechanism. parecoxib and 5-FU synergistically suppressed metastasis in colorectal cancer cells. Treatment with the parecoxib /5-FU combination induced an increase in E-cadherin and decrease in β-catenin. The parecoxib/5-FU combination could inhibit MMP-9 and MMP-2 expression and MMP-9 activity, and the NF-κB pathway might be suppressed as well. Mechanistic analysis denoted that the parecoxib/5-FU combination hindered the essential molecules of the PI3K/Akt route to obstruct metastatic colorectal cancer. Furthermore, the parecoxib/5-FU combination could inhibit reactive oxygen species. Our work showed the antimetastatic capacity of the parecoxib/5-FU combination for colorectal cancers via targeting the PI3K/Akt /NF-κB pathway.

Breast cancer stands as a predominant health concern for women globally. As mammography is the primary screening tool for breast cancer detection, improving the detection of breast cancer at screening could save more lives. This mammography re-view paper provides a systematic review of computer-aided techniques during a specific time frame for the segmentation and classification of microcalcification, evaluating image processing, machine learning, and deep learning techniques. The systematic review is meticulously carried out, adhering closely to the preferred reporting items for Systematic Reviews and Meta-Analysis (PRISMA) guidelines. This article focuses on mammographic breast cancer detection approaches based on automated systems, discussed chronologically from 1970 through 2023. This article encompasses the breadth of artificial intelligence-based methods from the most primitive to the most sophisticated models. Image processing and machine learning-based methods are compre-hensively reviewed. The evaluation of a deep learning architecture based on self-extracted features for classification tasks demonstrated outclass performance. Large-scale datasets required for a broader and in-depth analysis of novel methods for breast cancer detection are also discussed in this article. This research work is aligned with the United Nations' sustainability de-velopment goals.

In bacteria, enzymes usually comprise of enzymatic domains only. In eukaryotes/mammals, and here particularly in context of signal transduction, proteins with enzymatic functions contain additional modules promoting interactions with cooperating signaling proteins. Often such protein-protein interaction domains, such as SH2- and SH3-domains, help to localize the enzymatic function (e.g. kinase, phosphatase) to another protein, cellular compartment, or membrane nanodomain. In such cases, the interaction domain(s) serve(s) the enzymatic function. However, there are molecular situations in which an interaction domain fulfills its task completely independent of the protein´s enzymatic function and in this review, we call such function the adapter function of an enzyme. Though many stories can be told, we will concentrate on several proteins playing crucial roles in cells of the immune system, such as BTK, PI3K, and SHIP1, as well as in cancer cells, such as proteins of the RAS/ERK MAPK pathway. We will also discuss how these adaptor functions of enzymes determine or even undermine the efficacy of targeted therapy compounds, such as ATP-competitive kinase inhibitors, thereby highlighting the need to develop pharmacological approaches, such as PROTACs, that eliminate the entire protein. We also review how genetic kock-out and knock-in approaches can be leveraged to identify adaptor functions of signaling proteins.

(1) Background: The lateral arm flap has been the very useful choice in the reconstruction of small- to medium-sized defects like hand, extremity, oral head and neck area reconstructions. Its versatile characteristics and surgical feasibility allow this flap to be widely applied, but the reconstructive potential in facial subunit after tumor ablative procedures has never been reported. In this study, we aimed to utilize the advantages of the flap to treat facial temple subunit defect reconstruction. (2) Methods: Between 2020 and 2023, 12 patients underwent temple reconstruction with lateral arm free flaps after malignant tumor wide excision. There were 7 women and 5 men, and the mean patient age was 60.6 years old. Among the patients with cancer, 6 had squamous cell carcinoma, 5 had basal cell carcinoma and 1 had myxofibrosarcoma. All the flaps were elevated under general anesthesia. Aloprostadil(PGE1, Eglandin®) were administered postoperatively. (3) Results: All the flap types were fasciocutaneous type with varied sizes from 3 × 4 to 5 × 7 cm (Average size of flap 22.7cm2) were utilized. The average pedicle length was 6.1cm. The versatility of the lateral arm flap enabled successful coverage of all cases with no specific complications. Good functional outcome and range of motion in the recipient arm were obtained after surgery. (4) Conclusion: The authors successfully verified the advantages of lateral arm flaps in the treatment of medium sized facial subunt temple defect reconstruction.

Oral cancer represents a significant global public health challenge, contributing substantially to cancer incidence and mortality. Despite established risk factors such as tobacco use and alcohol consumption, early detection remains crucial for effective treatment. This study introduces a novel approach using a transistor-based biosensor system for detecting the P90 (CIP2A) protein. We have tested the presence of CIP2A in human leukoplakia samples that can rise into oral squamous cell carcinoma. The method employs commercially available glucose test strips functionalized with P90 antibodies, providing high sensitivity and a low limit of detection, which is five orders lower than commercial ELISA kits. A specially designed printed circuit board (PCB) facilitates accurate measurements, and the device's performance is optimized through characteristic tests. Human sample testing validates the biosensor's effectiveness in distinguishing samples after cell lysis. This study contributes to advancing accurate and cost-effective diagnostic approaches for oral pre-cancer and cancer tissues.

Wilms tumor (WT), the most prevalent type of renal cancer in children, exhibits overall survival rates exceeding 90%. However, chemotherapy resistance, which occurs in approximately 10% of WT cases, is a major challenge for the treatment of WT, particularly for advanced-stage patients. In this study, we aimed to discover potential mutation markers and drug targets associated with chemotherapy resistance in advanced stage WT. We performed exome sequencing to detect somatic mutations and molecular targets in 43 WT samples, comprising 26 advanced stage WTs, of which 7 cases are chemotherapy-resistant. Our analysis revealed four genes (ALPK2, C16orf96, PRKDC, and SVIL) that correlated with chemotherapy resistance and reduced disease-free survival in ad-vanced-stage WT. Additionally, we identified driver mutations in 55 genes within the chemo-therapy-resistant group, including 14 druggable cancer driver genes. Based on the mutation profile of the resistant WT samples, we propose potential therapeutic strategies involving platinum-based agents, PARP inhibitors, and antibiotic/antineoplastic agents. Our findings provide insights into the genetic landscape of WT and offer potential avenues for targeted treatment, particularly for patients with chemotherapy resistance.

(1) Background: Breast cancer is the leading malignancy worldwide and in Ghana it has a poor overall survival. However, approximately 50% of cases are early stage disease and with advances in breast cancer treatment and improvement in survival, quality of life (QOL) becomes as im-portant as treatment of the disease. (2) Methodology: This was a cross-sectional study of survivors who had breast conserving surgery (BCS), mastectomy only (M) and mastectomy with breast re-construction (BRS) from 2016 to 2020 at a tertiary hospital in Ghana, comparatively assessing their QOL using EORTC QLQ C-30 and EORTC QLQ BR-23. (3) Results: The study participants had an overall Global Health Status (GHS) median score of 83.3 [IQR: 66.7-91.7] with no significant differences between the surgery types. The BRS group had a statistically significant lower median scores for the Functional scale (82.8 and 51.0) and the highest scores for the Symptomatic scale (15.7 and 16.5). Body image was significantly lowest for the BRS group 83.3 [68.8-91.7] and highest 100 [91.7-100] for the BCS group (p < 0.001). (4) Conclusion: There is a need to develop support systems tailored at improving the QOL of breast cancer survivors taking into consideration the type of surgery performed.

Results from the phase III Keynote-024 clinical trial have established Pembrolizumab monotherapy as the first-line standard of care for patients with metastatic NSCLC who have PD-L1 expression ≥ 50%, EGFR and ALK wild-type. However, given the differences between patients treated in routine clinical practice and within a clinical trial, real-world data are needed to confirm the treatment benefit in standard practice. Given the lack of data on large cohorts of patients with long follow-up, we designed a retrospective observational study of patients with NSCLC who were treated with Pembrolizumab, starting from its reimbursement eligibility until December 2020. The primary endpoints were to assess PFS and OS using the Kaplan-Meier method, treatment response and safety. We followed 880 patients (median follow-up: 35.1 months) until February 2022. Median PFS and OS were 8.6 months (95% CI: 7.6-10.0) and 25.5 months (95% CI: 21.8-31.6), respectively. We also found that ECOG PS, PD-L1 expression and smoking habit were prognostic factors for PFS, while age, sex, ECOG PS, smoking habit and histology had an impact on OS. Multivariable analysis confirms prognostic role of PD-L1 for PFS and ECOG for both PFS and OS. 39.9% of patients reported an adverse event, but only 6.3% of patients discontinued therapy due to toxicity. Our results suggest a long-term benefit of Pembrolizumab in the first-line setting as well as a safety profile consistent with the results of Keynote-042. Many collected variables appear to influence clinical outcome, but results from these exploratory unadjusted analyses should be interpreted with caution.

In breast cancer, epithelial-mesenchymal transition (EMT) is positively associated with programmed death ligand 1 (PD-L1) expression and immune escape, and TWIST1 induces EMT and cancer metastasis. However, how TWIST1 regulates PD-L1 and immune evasion is unknown. This study analyzed TWIST1 and PD-L1 expression in breast cancers, investigated the mechanism for TWIST1 to regulate PD-L1 transcription, and assessed the effects of TWIST1 and PD-L1 in cancer cells on the cytotoxicity of CD8+ effector T cells. Interestingly, TWIST1 expression is associated with high-level PD-L1 in triple negative breast cancers (TNBCs). Overexpression and knockdown of TWIST1 robustly upregulates and downregulate PD-L1 expression, respectively. TWIST1 binds to the PD-L1 promoter and recruits the TIP60 acetyltransferase complex in a BRD8-dependent manner to promote PD-L1 expression, which drives immune escape of breast cancer cells by accelerating the exhaustion of CD8+ T cells. Accordingly, knockdown of TWIST1 or BRD8 or blockade of PD-L1 with a PD-L1 antibody significantly enhances CD8+ T cells to inhibit breast cancer cell growth. These results demonstrate that TWIST1 directly induces PD-L1 expression in breast cancer cells to drive immune evasion. Targeting TWIST1, BRD8 or PD-L1 in TNBC should facilitate CD8+ T cell-mediated immune therapy. TWIST1 may also serve as a biomarker for anti-PD-L1 immunotherapy.

We have been encouraging practicing gynecologists to adopt molecular diagnostics tests, PCR, and cancer biomarkers, as an alternative enabled by these platforms to traditional Papanicolaou and colposcopy tests, respectively. An aliquot of liquid-based cytology was used for the molecular test [high-risk HPV types, (HR HPV)], another for the PAP test and still one more for the p16/Ki67 dual stain cytology. A total of 4,499 laboratory samples were evaluated, and we found that 25.1% of low-grade samples and 47.9% of high-grade samples after PAP testing had a negative HR HPV-PCR result. In those cases, reported as Pap-negative, 22.1% got a positive HR HPV-PCR result. Dual staining with the p16/Ki67 biomarkers in samples was positive for HR HPV, and 31.7% were also positive for these markers. Of the PCR results positive for any of these high-risk HPV subtypes, n 68.3% we did not to find evidence for the presence of cancerous cells, highlighting the importance of performing dual staining with p16/Ki67 after PCR, to avoid unnecessary colposcopies. Encountered challenges are a deep-rooted social reluctance in Mexico to abandon traditional Pap smears and the opinion of many specialists, we still believe that colposcopy continues to be a preferred procedure over dual staining protocol.

Background Homologous recombination deficiency (HRD) evolved into a major diagnostic marker in high grade ovarian cancer (HGOC) predicting the response to poly (Adenosine diphosphate-ribose) polymerase inhibitors (PARPi) and also platinum-based therapy. In addition to HRD, the type of peritoneal tumor spread influences treatment response and patient survival; miliary type tumor spread has poorer predicted outcome than non-miliary type tumor spread. Methods Known methods for HRD assessment were adapted for our technical requirements and the Predictive-value Integrated Genomic Instability Score (PIGIS) for HRD assessment evolved as an outcome. PIGIS was validated in HGOC samples from 122 patients. We used PIGIS to analyze whether the type of tumor spread correlated with HRD status and whether this had an impact on survival. Results We demonstrated that PIGIS can discriminate HRD positive from HRD negative samples. Tumors with miliary tumor spread are HRD negative and have a very bad prognosis with a progression free survival (PFS) of 15.6 months and an overall survival (OS) of 3.9 years. However, HRD negative non-miliary spreading tumors in our cohort had a much better prognosis (PFS 35.4 months, OS 8.9 years), similar to HRD positive tumors (PFS 34.7 months, OS 8.9 years). Conclusions Our results indicate that in a predominantly PARPi naïve cohort the type of tumor spread might be a better predictor of response to platinum sensitivity than HRD. It remains to be determined, whether this also applies for sensitivity to PARPi.

Lung cancer is the leading cause of cancer death worldwide therefore studies about the etiological factors and carcinogenesis are important.The aim of the study is to detect the presence and types of Human papilloma virus (HPV) in lung cancer and non-tumoral lung and Epidermal Growth Factor Receptor (EGFR) mutation prevalance in lung cancer with Polymerase Chain Reaction (PCR) method.Fifty patients who were histopathologically diagnosed lung cancer and 7 patients with non-neoplastic lung disease were enrolled in the study. HPV positivity was detected in 75.4% of the patients. The rate of high-risk HPV positivity was 100% in adenocarcinomas, 64.5% in squamous cell carcinomas, and 57% in non-neoplastic lung. HPV 51 was the most frequent type followed by HPV 16 (43.9%). There was no statistically significant relationship between HPV infection and age, gender and smoking history and EGFR mutation. The prevalence of HPV positivity is variable in lung cancer in different studies and this may be due to many factors including HPV detection methods, number of patients, geographic regions. New studies about the role of HPV infection need to be performed in order to obtain information about the use of prophylactic and theurepatic agents in lung cancer.

Alteration in heparan sulfate (HS) biosynthesis has been described to impact a range of pivotal processes involved in cancer progression. HS 3-O-sulfotransferase 3B1 (HS3ST3B1) catalyzes the reaction of 3-O-sulfation within HS chains. Over the past few years, a growing number of studies has reported a tumor-promoting effect of this HS-modifying enzyme in various cancers. Consistent with these studies, we previously reported that HS3ST3B1 overexpression increased survival and resistance to apoptosis in MDA-MB-231 breast cancer (BrCa) cells. In the present study, we further investigated the biological and clinical significance of HS3ST3B1 expression in BrCa. Interrogation of public databases revealed that high expression levels of HS3STB1 are associated with invasive and mesenchymal-like phenotype in BrCa cells and predict poor clinical outcome in BrCA patients with chemotherapy. In vitro, HS3ST3B1 overexpression increased the invasive properties of MDA-MB-231 cells and enhanced chemo-resistance to conventional anticancer drugs. Mechanistically, we found that the advantage given by HS3ST3B1 was linked to the expression and activation of PDGF-Rβ. Silencing the expression of this receptor reversed the effects driven by HS3ST3B1 overexpression. Altogether, our results suggest that HS3ST3B1 may play an important role in the progression of aggressive BrCa and offer a potentially druggable target for therapeutic application.

DNA Topoisomerase IIa (Top2A) is a nuclear enzyme that is a cancer drug target, and there is interest in identifying novel sites on the enzyme to inhibit cancer cells more selectively and to reduce off-target toxicity. The C-terminal domain (CTD) is one potential target, but it is an intrinsically disordered domain, which prevents structural analysis. Therefore, we set out to analyze the sequence of Top2A from 105 species using bioinformatic analysis including the PSICalc algorithm, entropy analysis, and other approaches. Our results demonstrate that large (10th-order) interdependent clusters are found including non-proximal positions across the major domains of Top2A. Further, CTD-specific clusters of 3rd, 4th, and 5th-order were identified that included positions that had been previously analyzed via mutation and biochemical assays. Some of these clusters coincided with positions that when mutated either increased or decreased relaxation activity. Finally, sites of low entropy (i.e., high information content) were identified and mapped as key positions in the CTD. Included in the low entropy sites are phosphorylation sites and charged positions. Together, these results help to build a clearer picture of the critical positions in the CTD and provide potential sites/regions for further analysis.

Background: Penile squamous cell carcinoma (PSCC) is classified into two prognostically distinct types: human papillomavirus (HPV)-associated and HPV-independent. Conversely, the impact of p53 status on prognosis remains controversial. We correlated HPV and p53 status with prognosis in a large series of PSCC patients. p53 was analysed according to a recently described immunohistochemical (IHC) pattern-based framework that includes two normal (scattered, mid-epithelial) and four abnormal patterns (diffuse, basal overexpression, cytoplasmic and null) and closely correlates with TP53 mutational status. Methods: A total of 122 patients with surgically treated PSCC in three hospitals in Barcelona, Spain, were included. Based on HPV in situ hybridization and p16 and p53 IHC expression, the tumors were classified into three molecular types: HPV-associated, HPV-independent/p53 normal, and HPV-independent/p53 abnormal. All patients were followed for at least 22 months (median 56.9 months), and disease-specific survival (DSS) was analysed. Results: Thirty-six tumors (29%) were HPV-associated, 35 (29%) were HPV-independent/p53 normal, and 51 (42%) were HPV-independent/p53 abnormal. Disease-related deaths were observed in 3/36 (8%), 0/35 (0%) and 14/51 (27%) of the patients, respectively (p&lt;0.001). A total of 7/14 deaths in the latter group were patients with tumors showing p53 patterns not recognized in the classical p53 IHC interpretation (basal, null, cytoplasmic). According to our multivariate analysis, HPV-independent/p53 abnormal tumors and advanced stage were associated with impaired DSS (hazard ratio=23.4, 95% confidence interval [CI]= 2.7-3095.3; p=0.001 and 16.3, 95% CI=1.8-2151.5; p=0.008, respectively). CONCLUSION: Compared with patients with HPV-associated and HPV-independent/p53-normal PSCC, patients with HPV-independent/p53 abnormal PSCC have worse clinical outcomes. p53 IHC results define two prognostic categories in HPV-independent PSCC: HPV-independent/p53-normal tumors as low-risk tumors, whereas HPV-independent/p53-abnormal tumors as aggressive neoplasms.

The application of artificial intelligence to point-of-care testing (POCT) disease detection has become a hot research field, in which breath detection which detects the patient's exhaled VOCs combined with sensor arrays of Convolutional Neural Network (CNN) algorithms as a new lung cancer detection is attracting more researchers' attention. However, due to low accuracy, high complexity computation and large number of parameters make the CNN algorithms difficult transplant to the embedded system of POCT devices. A lightweight neural network (LTNet) in this work is proposed to deal with this problem, and meanwhile, achieve high-precision classification of acetone and ethanol gases, which are respiratory markers for lung cancer patients. Compared to currently popular lightweight CNN models such as EfficientNet, LTNet has fewer parameters (32K) and its training weight size is only 0.155 MB. LTNet achieved an overall classification accuracy of 99.06% and 99.14% in the own mixed gas dataset and the University of California (UCI) dataset, which are both higher than that of the five existing models’, and it also offers the shortest training (844.38s and 584.67s) and inference time (23s and 14s) in the same validation set. Compared to the existing CNN models, LTNet is more suitable for resource-limited POCT devices.

Cancer diagnosis stands at the cusp of a profound transformation, driven by the burgeoning capabilities of Artificial Intelligence (AI) and Machine Learning (ML). This comprehensive review illuminates the extraordinary impact of AI and ML in the field, unraveling their multifaceted roles in the realm of oncology. In the arena of cancer diagnosis, AI and ML serve as invaluable allies, empowering healthcare professionals with unparalleled tools for precision and efficiency. Notably, AI's prowess in analyzing medical images, including radiological scans and pathology slides, elevates the early detection of malignancies to new heights. Coupled with its ability to dissect genomic data, AI tailors therapeutic strategies to the individual, promising optimized treatment outcomes. However, the incorporation of AI and ML into clinical practice necessitates a careful navigation of ethical considerations, data privacy, and regulatory landscapes. Safeguarding patient data, ensuring transparency, and addressing algorithmic biases emerge as pivotal challenges that require vigilant attention. Yet, the future of AI and ML in cancer diagnosis is brimming with promise. The integration of multi-modal data, real-time monitoring, and Explainable AI (XAI) methods holds the potential to enrich diagnostic capabilities and engender patient trust. Global collaboration and data sharing initiatives are fostering the development of robust AI models. Furthermore, AI's role in cancer prevention, identifying high-risk individuals and enabling targeted preventive strategies, is poised to revolutionize healthcare. AI and ML are forging a path toward an era of unparalleled accuracy, efficiency, and personalization in cancer diagnosis. Challenges notwithstanding, these technologies bear the promise of fundamentally reshaping patient care, elevating outcomes, and advancing the fight against cancer. The ongoing exploration and responsible implementation of AI and ML in oncology will be pivotal in harnessing their full potential and paving the way for a brighter future for cancer patients.

Marine microalgae are a rich reservoir of natural compounds, including bioactives. Nonetheless, these organisms remain fairly unexplored despite their potential biotechnological applications. Culture collections with diverse taxonomic groups and lifestyles are a good source to unlock this potential and discover new molecules for multiple applications such as the treatment of human pathologies or the production of aquaculture species. In the present work extracts from 33 strains (including 20 dinoflagellates, 4 diatoms and 9 strains from other 7 algal classes), cultivated under identical conditions were examined for antiviral, antibacterial, anti-inflammatory and anti-cancer activities. Among these, antiviral and anti-inflammatory activities were detected in a few strains while antibacterial tests showed positive results in most assays. In turn, most trials did not show any anti-cancer activity. Wide differences were observed between species within the same class, in particular dinoflagellates which were better represented in this study. These preliminary findings pave the way for in-depth characterization of extracts with highest signals in each test, identification of compounds responsible of the biological activities found, and a further screening of the CCVIEO culture collection.

Background: Cell proliferation and the cell cycle are fundamental to tumor development, with mitosis playing a crucial role in cell division. Understanding the complexities of the cell cycle and mitosis is critical for cancer research, especially in the context of developing therapeutic strategies. Objective: This review highlights mitotic poisons as potential anti-cancer pharmacotherapeutics, particularly their structural and functional group diversity presenting opportunity for semi-synthesis of new derivatives with multi-target mechanisms relevant for cancer pharmacotherapeutics. Also, the review explores naturally occurring mitotic poisons and inhibitors of microtubule-dependent molecular motors as promising cancer pharmacotherapeutics. Methods: A comprehensive review of literature from 2004 to 2023 was conducted, covering studies on cell proliferation, mechanism of cell cycle regulation, mitosis, cytokinesis, and anti-cancer drug development. The published literature was collected primarily from PubMed, Scopus, Medline, Web of Science Core Collections, Google Scholar and other relevant scientific databases using keywords including but not limited to mitotic poisons and cancer, sources of mitotic poisons, mechanism of mitotic poisons, targets of mitotic poisons and structural diversity of mitotic poisons. The efficacy and limitations of various mitotic poisons and their impact on different cancer types were examined. Recent advancements in targeted therapeutic interventions for various cancers were also explored. Results: The effectiveness and limitations of mitotic poisons, including Taxanes, Epothilones, Colchicine, Vinca alkaloids, Berberine, Laulimalide, and Pseudolaric acid B, were highlighted. Drugs targeting mitotic kinases such as CDKs, Aurora kinases, PLK1, and WEE1 inhibitors were reported. Inhibiting kinesin motor proteins such as Eg5 and KIF15 to interfere with spindle formation and cell division were discussed, along with specific genomic alterations in KIF genes and the discovery of KIFC1 as potential for future research and drug development. Conclusion: Targeting microtubules and mitotic kinases, along with inhibiting kinesin motor proteins, show promise for cancer pharmacotherapeutics. The combination of targeted therapies, patient stratification based on biomarkers (such as low alpha-1 acid glycoprotein and high p63 expression), and exploration of alternative natural sources of mitotic poisons and analogues can significantly advance cancer pharmacotherapy to improve patient outcomes.

Focused microwave breast hyperthermia (FMBH) employs a phased antenna array to perform beamforming that can focus microwave energy at targeted breast tumors. Selective heating of the tumor endows the hyperthermia treatment with high accuracy and low side effects. The effect of FMBH is highly dependent on the applied phased antenna array. This work investigates the effect of polarizations of antenna elements on the microwave focusing results by simulations. We explore two kinds of antenna arrays with the same number of elements using different digital realistic human breast phantoms. The first array has all the elements’ polarization in the vertical plane of the breast while the second array has half elements’ polarization in the vertical plane and the other half in the transverse plane, i.e., cross polarization. In total 96 sets of different simulations are performed, and the results show that the second array leads to a better focusing effect in dense breasts than the first array. This work is very meaningful for the potential improvement of the antenna array for FMBH, which is of great significance for the future clinical applications of FMBH. The antenna array with cross polarization can also be applied in micro-wave imaging and sensing for biomedical applications.

Chromosomal instability (CIN), defined by variations in the number or structure of chromosomes from cell to cell, is recognized as a distinctive characteristic of cancer, associated with the ability of tumors to adapt to challenging environments. CIN has been recognized as a source of genetic variation that leads to clonal heterogeneity (CH). Recent findings suggest a potential association between CIN and CH with the prognosis of BC patients, particularly in tumors expressing the epidermal growth factor receptor 2 (HER2+). In fact, information on the role of CIN in other BC subtypes, including luminal B BC, is limited. Additionally, it remains unknown whether CIN in luminal B BC tumors, above a specific threshold, could have a detrimental effect on the growth of human tumors, or if low or intermediate CIN levels could be linked to a more favorable BC patient prognosis when contrasted with elevated levels. Clarifying these relationships could have a substantial impact on risk stratification and the development of future therapeutic strategies aimed at targeting CIN in BC. This study aimed to assess CIN and CH in tumor tissue samples from ten patients with luminal B BC, and compared them with established clinicopathological parameters. The results of our study show that luminal B BC patients exhibit intermediate CIN and stable aneuploidy, both of which correlated with lymphovascular invasion. These findings suggest that evaluating CIN, CH and aneuploidy could improve risk stratification, the prediction of clinical outcomes and future therapeutic approaches in luminal B BC patients.

The high prevalence of thyroid nodules and increased availability of neck ultrasound have led to an increased incidence of diagnostic thyroid fine needle aspirations, with approximately 20% yielding indeterminate results. The recent availability of molecular tests has helped guide the clinical management of these cases. This paper aims to review and compare three main commercially available molecular cytology platforms in the U.S. – Afirma GSC, Thyroseq GC, and ThyGeNEXT+ThyraMIR. Sequential improvements of the Afirma GSC and Thyroseq GC tests have led to higher positive and negative predictive values, sensitivity, and specificity. Comparative studies revealed similar diagnostic performance between these tests, with considerations for factors such as cost and processing time. Thyroseq GC provides detailed genomic information and specific management recommendations. ThyGeNEXT+ThyraMIR, though less studied, presents promising results, particularly in miRNA analysis for weak driver mutations. Challenges in interpreting results include variations in reporting and the evolving nature of testing platforms. Questions persist regarding cost-effectiveness and the utility of ultrasound characteristics in selecting candidates for molecular testing. While molecular testing has primarily served diagnostic purposes, advancements in understanding genetic alterations now offer therapeutic implications. FDA-approved options target specific genetic alterations, signaling a promising future for tailored treatments.

Cadmium (Cd) is an environmental toxicant of worldwide public health significance. Diet is the main non-workplace Cd exposure source other than smoking. The intestinal absorption of Cd involves the transporters for iron, zinc, copper, and calcium. These metal transporters essentially determine the body burden of Cd because only 0.001-0.005% of Cd accumulated in the body can be excreted in urine each day. The International Agency for Research on Cancer listed Cd as a human lung carcinogen. Current evidence, however, suggests that environmental Cd may increase the prevalence of many types of cancer, notably lung, liver, breast, pancreas, and kidney. A two-year bioassay that mimics a lifelong exposure demonstrates Cd caused neoplasms in multiple tissues of mice. Also, several non-tumorigenic human cell lines underwent malignant cell transformation, when they were exposed to a sublethal dose of Cd for a prolonged time. Cd does not directly damage DNA, but it can profoundly affect gene expression through its interactions with various proteins, and Cd can thus be viewed as a transcription modulator. The present review highlights epidemiological studies that connected an enhanced risk of various neoplastic diseases to chronic exposure to environmental Cd. Special emphasis is on the impact of body iron stores on the absorption rate of Cd, and its implications for breast cancer prevention in highly susceptible subpopulation groups of women. Resistance to cell death and other cancer phenotypes acquired during Cd-induced cancer-cell transformation, under in vitro conditions, are briefly discussed. The potential role for ZnT1 efflux transporter in cellular acquisition of tolerance to Cd cytotoxicity are highlighted.

De-escalation is currently taking place both in surgical and systemic treatment of breast cancer. The introduction of trastuzumab, the first monoclonal antibody against the HER2 receptor over 20 years ago was a milestone in the treatment of HER2 positive breast cancer and marked the beginning of a new era in targeted tumor therapy. In the sense of de-escalation, omitting non-targeted cytotoxic chemotherapy altogether is often hailed as the ultimate goal of oncological research. Especially in case of small, node-negative, HER2 positive early breast cancer, it remains a challenge for clinicians to establish the safest and most efficient treatment plan while considering the significant potential for toxic side effects associated with chemotherapy and HER2 targeted therapy, and the generally excellent prognosis. In this context, several ongoing studies are currently assessing chemotherapy-free regimens as part of strategies aimed at de-escalating therapy in the field of HER2 positive early breast cancer. Despite promising early results from these studies, combination of anti-HER2 treatment with chemotherapy backbone remains standard of care.

Ganoderma lucidum, commonly known as the "Lingzhi" or "Reishi" mushroom, has long been recognized for its potential health benefits, and medicinal properties in traditional Chinese medicine. In recent years, the emerging field of nanotechnology has opened up new possibilities in order to use the remarkable properties of G. Lucidum at the nanoscale. The unique combination of bioactive compounds present in G. Lucidum, such as triterpenoids, polysaccharides, and peptides, has inspired interest in leveraging their therapeutic potential through nanotechnological approaches. Various nanomaterials, including nanoparticles, nanofibers, and nanocomposites, have been employed to encapsulate and deliver these bioactive components to target cells or tissues, enhancing stability, controlled release, and consequently their bioavailability. Nanotechnology-based strategies have been investigated for the efficient extraction and purification of bioactive compounds from G. Lucidum. The use of nanoscale materials has facilitated the extraction process, enhancing the yield and purity of the active components. Additionally, nanocarriers and nanoformulations have been developed to protect these sensitive bioactive compounds from degradation, ensuring their stability during storage and transportation. The use of G. Lucidum-based nanomaterials has shown promising results in several biomedical applications. Nanoparticles loaded with bioactive compounds derived from G. Lucidum have exhibited potent anticancer activity by targeting cancer cells, inducing apoptosis, and inhibiting tumor growth. Additionally, nanotechnology-based formulations have demonstrated immunomodulatory effects, promoting the activation of immune cells and enhancing the body's defense mechanisms. GL, combined with the potential of nanotechnology, presents an exciting frontier in the development of novel therapeutic and biomedical applications. The utilization of nanomaterials for extraction, delivery, and integration of bioactive compounds from G. Lucidum has shown immense potential for improving drug delivery, tissue engineering, and disease treatment. Further research and development in this interdisciplinary field are warranted to fully exploit the synergistic benefits offered by G. Lucidum, and nanotechnology, ultimately leading to innovative solutions for human health and well-being.

Cancer patients undergoing major interventions face numerous challenges, including the adverse effects of cancer and the side effects of treatment. Cancer rehabilitation is vital in ensuring cancer patients have the support they need to maximise treatment outcomes and minimise treatment-related side effects and symptoms. The Active Together service is a multi-modal rehabilitation service designed to address critical support gaps for cancer patients. The service is located and provided in Sheffield, UK, an area with higher cancer incidence and mortality rates than the national average. The service aligns with local and regional cancer care objectives and aims to improve clinical and quality of life outcomes of cancer patients by using lifestyle behaviour change techniques to address their physical, nutritional, and psychological needs. This paper describes the design and initial implementation of the Active Together service, highlighting its potential to support and benefit cancer patients.

Background: Breast cancer is a commonly diagnosed cancer worldwide. Human MutT homolog 1 (MTH1) is found to be elevated in breast tumors and cancer cells are addicted to MTH1 for sur-vival. Pharmacological inhibition of MTH1 may be potentially beneficial in the treatment of breast cancer. Methods: MA-24 was screened by malachite green colorimetric assay from MTH1 inhibitors and the kinetic characteristics of MA-24 was assessed. Binding features of MA-24 with MTH1 was as-certained through molecular docking, and cytotoxic activity of MA-24 was validated in vitro and in vivo. Target engagement assays, comet assay and western blot confirmed that the intracellular target and mechanism of MA-24. Results: MA-24 with potent antitumor bioactivity both in vitro and in vivo. MA-24 competitively inhibited the MTH1 and further induce DNA strand breaks, leading to increased apoptosis of cancer cells depending on upregulation of cleaved-caspase 3 – cleaved-PARP axis. Especially, MA-24 exhibited a powerful efficacy and safety in vivo (tumor growth inhibition rate: 61.8%). Conclusions: MA-24 possesses a broad spectrum of breast cancer cytotoxicity and offered valuable insights for overcoming the challenges of chemotherapy-related toxicity, which holds great po-tential for further development MA-24 as an anti-cancer drug.

Breast cancer is the most common cancer among women worldwide, and estrogen receptor-positive (ER+) breast cancer accounts for a significant proportion of cases. While various treatments are available, endocrine therapies are often the first-line treatment for this type of breast cancer. However, the development of drug resistance poses a significant challenge in managing this disease. ESR1 mutations have been identified as a common mechanism of endocrine therapy resistance in ER+ breast cancer. The first-generation selective estrogen receptor degrader (SERD) fulvestrant has shown some activity against ESR1 mutant tumors. However, due to its poor bioavailability and need for intramuscular injection, it may not be the optimal therapy for patients. Second-generation SERDs have been developed to overcome these limitations. These newer drugs have improved oral bioavailability and pharmacokinetics, making them more convenient and effective for patients. Several oral SERDs are now in phase III trials for early and advanced ER+ breast cancer. This review summarizes the background of oral SERD development, the current status, and future perspectives.

In Caucasians, basal cell carcinoma, a type of non-melanoma skin cancer, is most often found on the nose. This presents challenges for surgeons due to anatomical, functional, and aesthetic concerns. The study aimed to evaluate the distribution of tumor localization, size, morphological subtypes, surgical outcomes, radicality levels, and their correlation with recurrence rates. The research utilized data from the Hygiene Institute Health Information Centre. A retrospective analysis encompassed 343 cases of nasal skin cancer over a four-year period from January 1, 2019, to December 31, 2022. The research cohort comprised 252 female and 91 male participants, averaging 75,2 years old. Tumors were most found on the left sidewall of the nose (25.4%) and the dorsum (24.8%). The infiltrative morphological subtype was predominant (70.8%). Standard surgical excision with fasciocutaneous plastic was the preferred surgical procedure. Radical excision was achieved in 79.0% of lesions, while 16.9% were incompletely excised. Non-radically excised tumors exhibited a significantly higher recurrence rate (24.1%) compared to those with radical excision (6.3%). In nasal reconstruction, diverse surgical techniques are essential for precise adaptation based on factors like tumor characteristics and patient needs. Despite surgeons' careful adherence to excision guidelines, the potential for non-radical procedures cannot be entirely eliminated.

(1) Background: P-cadherin (CDH3) is a transmembrane protein that plays a crucial role in maintaining the structural integrity of epithelial tissue and homeostasis. Its role in carcinogenesis remains a subject of debate, as its behavior can vary depending on the molecular context and the specific tumor cell model under study. In this study, we explored the role of P-cadherin in head and neck squamous cell carcinoma (HNSCC) and the mechanism underlying its function. (2) Methods: We analyzed P-cadherin expression in HNSCC patients using The Cancer Genome Atlas (TCGA) database. For in vitro functional analysis, we conducted proliferation, migration, invasion, and western blot assays after either suppressing or overexpressing P-cadherin. For in vivo functional analysis, we utilized mouse xenograft models. (3) Results: P-cadherin was significantly overex-pressed in tumor samples compared to normal samples in the TCGA-HNSCC cohort. P-cadherin knockdown resulted in decreased proliferation, migration, and invasion compared to control cells, while P-cadherin overexpression increased cell proliferation and migration in HNSCC cells. We discovered that c-Met functioned as an upstream regulator of P-cadherin. Surprisingly, we found that P-cadherin knockdown increased the phosphorylation of c-Met and STAT3. Combining P-cadherin siRNA with the c-Met inhibitor SU11274 resulted in a more effective reduction in HNSCC cell growth, both in vitro and in vivo, compared to either treatment alone. (4) Conclusions: Our study uncovered a previously unknown aspect of P-cadherin-mediated c-Met regulation. The enhanced activation of c-Met/STAT3 following P-cadherin inhibition could be responsible for the survival of resistant tumor cells. Therefore, dual inhibition of P-cadherin and c-Met may be a potentially effective approach for treating HNSCC.

: Nanotechnology has expanded what can be achieved in our approach to cancer treatment. The ability to produce and engineer functional nanoparticle formulations to elicit higher incidences of tumor cell radiolysis has resulted in substantial improvements in cancer cell eradication while also permitting multi-modal biomedical functionalities. These radiosensitive nanomaterials utilize material characteristics, such as radio- blocking/absorbing high-Z atomic number elements, to mediate localized effects from therapeutic irradiation. These materials thereby allow for subsequent scattered or emitted radiation to produce direct (e.g., damage to genetic materials) or indirect (e.g., protein oxidation, reactive oxygen species formation) damage to tumor cells. Using nanomaterials that activate under certain physiologic conditions such as the tumor micro-environment can selectively target tumor cells. These characteristics combined with biological interactions that can target the tumor environment allow for localized, radio-sensitization while mitigating damage to healthy cells. This review explores the various nanomaterial formulations utilized in cancer radiosensitivity research. Emphasis on inorganic nanomaterials showcase the specific material characteristics that enable higher incidences of radiation while ensuring localized cancer targeting based on tumor micro-environment activation. The aim of this review is to guide future research in cancer radiosensitization using nanomaterial formulations and to detail common approaches to radiosensization, as well their relations to commonly implemented radiotherapy techniques.

Next-generation cancer and oncology research needs to take full advantage of the multi-modal structured, or graph, information, with the graph datatypes ranging from molecular structures to spatially resolved imaging and digital pathology to biological networks to knowledge graphs. Graph Neural Networks (GNNs) efficiently combine the graph structure representations with the high predictive performance of deep learning, especially on the large multi-modal datasets. In this review article, we survey the landscape of recent (2020-present) GNN applications in the context of cancer and oncology research, and delineate six currently predominant research areas. Subsequently, we identify the most promising directions for future research. We compare GNNs with graphical models and "non-structured" deep learning, and devise the guidelines for cancer and oncology researchers or physician-scientists asking the question of whether they should adopt the GNN methodology in their research pipelines.

Lung cancer (LC) stands as the foremost cause of cancer-related fatality rates worldwide. Early diagnosis significantly enhances patient survival rate. Nowadays, low dose computed tomography (LDCT) is widely employed on chest as a tool for large-scale lung cancer screening. Nonetheless, a large amount of chest radiographs causes an onerous burden on radiologists. Some computer-aided diagnostic (CAD) tools can provide insights to medical images for diagnosis and augmenting diagnostic speed. However, due to variation in parameter settings across different patients, substantial discrepancies in image voxels persist. We find different voxel-size causing a compromise between model generalization and diagnostic efficacy. This study investigates the performance disparities of diagnostic models trained on original images and LDCT images reconstructed to different voxel-sizes but isotropic. The application is to differentiate a nodule to be benign or malignant. Using 11 features, a support vector machine (SVM) is trained on LDCT images with an isotropic voxel having side-length of 1.5 mm for 225 patients in house. The result yields a favorable model performance with an accuracy of 0.9596 and an area under the receiver operating characteristic curve (ROC/AUC) of 0.9855. In addition to furnish CAD tools for clinical applications, future research is encouraged to include LDCT images from multi-centers.

Once discovered, cancer stem cells have become a hot topic in the research of cancer therapy. These cells possess stem cell-like self-renewal and differentiation capacities and are important factors that dominate cancer metastasis, therapy- resistance and recurrence. What's worse, their own characteristics make them difficult to be eliminated. Colorectal cancer is the third most common cancer and the second leading cause of cancer death worldwide. Targeting colorectal cancer stem cells (CRCSCs) can inhibit colorectal cancer metastasis, enhance therapeutic efficacy, and reduce recurrence. Here, we introduced the origin, marker proteins, identification, cultivation and research techniques of CRCSCs, summarized the signaling pathways that regulate the stemness of CRCSCs, such as Wnt, JAK/STAT3, Notch, and Hh signaling pathway. In addition to these, we also reviewed anti-CRCSC drugs targeting signaling pathways，markers，and other regulators in recent years. These will help researchers gain insight into the current agents targeting to CRCSCs, explore new cancer drugs, and propose potential therapy.

Breast cancer is a common malignant tumour and studies have shown that early and accurate detection is crucial for patients. With the maturity of medical imaging and deep learning development, significant progress has been made in breast cancer classification, which greatly improves the accuracy and efficiency of classification. This review focuses on deep learning, migration learning, GAN, and lifelong learning to elaborate and summarise the important roles arising from breast cancer detection. This review also examines the dataset and labeling issues required for breast cancer classification. In conclusion, at the end of the article, we look at future directions for breast cancer classification research, including cross-migration learning, multimodal data fusion, model interpretability, and lifelong learning, and also explore how to provide personalized treatment plans for patients.

Recent studies suggest that PEBP1/RKIP and YY1, despite having distinct molecular functions, may interact and mutually influence one another's activity. They exhibit reciprocal control over each other's expression through regulatory loops, prompting the hypothesis that their interplay could be pivotal in cancer advancement and resistance to drugs. To delve into this interplay's functional characteristics, we conducted a comprehensive analysis using bioinformatics tools across a range of cancers. Our results confirm the association between elevated YY1 mRNA levels and varying survival outcomes in diverse tumors. Furthermore, we observed differing degrees of inhibitory or stimulatory effects of these two genes in various cancer pathways, along with correlations between their mRNA expression and immune infiltration. Additionally, YY1/PEBP1 expression (or methylation) displayed connections with genomic alterations across cancer types. Notably, we uncovered links between YY1/PEBP1 and different indicators of immunosuppression, such as immune checkpoint blockade response, and T-cell dysfunction/exclusion levels, across different patient groups. Overall, our findings underscore the significant role of the interplay between YY1 and PEBP1 in cancer progression, influencing genomic changes, tumor immunity or the tumor microenvironment. Additionally, these two gene products appear to impact the sensitivity of anticancer drugs, opening new avenues for cancer therapy.

Background: Epithelial-mesenchymal transition (EMT) is a biological process where epithelial cells lose their adhesive properties and gain invasive, metastatic, and mesenchymal properties. Maintaining the balance between epithelial and mesenchymal stage is essential for tissue homeo-stasis. Many of the genes promoting mesenchymal transformation has been identified; however, our understanding of the genes responsible for maintaining the epithelial phenotype is limited. Our objective was to identify genes responsible for maintaining the epithelial phenotype and in-hibiting EMT. Methods: RNA seq was performed using an vitro model of EMT. CTGF expres-sion was determined by qPCR and Western blot analysis. Knockout of CTGF was done using the CTGF sgRNA CRISPR/CAS9. Tumorigenic potential was determined using NCG mice. Results: Knocked-out of CTGF in epithelial ovarian cancer cells leads to the acquisition of functional characteristics associated with the mesenchymal phenotype such as Anoikis resistance, cytoskel-eton remodeling, increased cell stiffness, and acquisition of invasion and tumorigenic capacity. Conclusions: We identified CTGF is an important regulator of the epithelial phenotype, and its loss is associated with early cellular modifications required for EMT. We describe a novel role for CTGF, regulating cytoskeleton and the extracellular matrix interactions necessary for conserva-tion of epithelial structure and function. These findings provide a new window to understand the early stages on mesenchymal transformation

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

Breast cancer is the most common malignancy in women worldwide. The pathogenesis of this disease is closely related to the estrogen receptor alpha subtype (ERα). Therefore, it is of great importance to develop effective inhibitors of ERα activity for the treatment of breast cancer. In this paper, we propose a novel ensemble machine learning model for quantitative structure-activity relationship of anti-breast cancer drugs, which can effectively predict drug activity in small samples with multiple characteristic variables. To avoid the problem of over-fitting caused by low-correlation independent variables, the scoring mechanism of random forest was improved by incorporating three relevance indicators, including the maximum mutual information number, Pearson correlation coefficient and distance correlation coefficient, and 20 optimal molecular descriptors were selected. The Bayesian hyperparameter optimization method was used to optimize the parameters of multiple linear regression (MLR), support vector regression (SVR), and extreme gradient boosting (XGBoost), respectively. The AdaBoost strong learner was constructed by combining the weak learner with the weighted linear addition method. The results show that the proposed ensemble learning model has the best prediction performance compared to the three basic learner models and the CNN-LSTM combination prediction model. The root mean square error was reduced by 7.60%-26.51%. The mean relative error was reduced by 6.46%-30.92%. Goodness of fit increased by 9.57%-36.94%. Finally, the biological activities of 50 candidate compounds for ERα inhibitors were predicted, and it was found that 4-[2-benzyl-1-[4-(2-pyrrolidin-1-ylethoxy)phenyl]but-1-enyl]phenol had an excellent biological activity value pIC50, which had the potential to be an ERα inhibitor. The model proposed in this paper has good prediction accuracy, which can provide an effective reference for the discovery and development of anti-breast cancer drugs.

Frontal Temporal Dementia (FTD) is a neurological disorder known to have less therapeutic options. So far only a few biomarkers are available for FTD that can be used as potential comorbidity targets. To this end, in the present study we aim to identify potential biomarkers or susceptible genes for FTD that show comorbidities with diseases such as COVID-19 and Breast Cancer. Gene expression Omnibus datasets containing FTD expression profiles from African American and white ethnicity background were included in our study. In FTD samples of GSE193391 dataset, we identified 305 DEGs with 168 genes being up-regulated and 137 genes being down-regulated. We conducted comorbidity analysis for COVID-19 and Breast cancer followed by analysis of potential drug interactions, pathogenicity, analysis of genetic variants and functional enrichment analysis. Resulting genes AKT3, GFAP, ADCYAP1R1, VDAC1, and C4A showed significant transcriptomic alterations in FTD and significant comorbidity status with COVID-19 and Breast cancer. Functional pathway analysis revealed that these comorbid genes were significantly enriched in the pathways such as glioma, JAK/STAT signaling, systematic lupus erythematosus, neurodegeneration-multiple diseases and neuroactive ligand-receptor interaction. Overall, from these results, we concluded that these genes could be recommended as potential therapeutic targets for the treatment of comorbidities in FTD.

Perfluorohexane sulfonate (PFHxS) is a widely detected replacement for legacy long-chain perfluoroalkyl substances (PFAS) in the environment and human blood samples. Its potential toxicity led to its recent classification as a global regulated persistent organic pollutant. Although animal studies have shown a positive association between PFHxS levels and hepatic steatosis and hepatocellular hypertrophy, the link with liver toxicity, including end-stage liver cancer, remains inconclusive. In this study, we examined the effects of PFHxS on the proliferation of human hepatocellular carcinoma (HCC) cells, Hep3B and SK-Hep1. Cells were exposed to different PFHxS concentrations for 24–48 hr to assess viability and 12–14 days to measure colony formation. Viability of both cell lines increased at PFHxS concentrations <200 μM, decreased at >400 μM, and were highest at 50 μM. Colony formation increased at <300 μM and decreased at 500 μM PFHxS. Consistent with the effect on HCC proliferation, PFHxS increased expression of proliferating cell nuclear antigen (PCNA) and cell-cycle molecules (CDK2, CDK4, cyclin E, and cyclin D1). In summary, PFHxS exhibited a biphasic effect on HCC cell proliferation, promoting survival and proliferation at lower concentrations and being cytotoxic at higher concentrations. This suggests that PFHxS potentially exacerbates HCC progression.

Aortic valve stenosis and malignancy frequently coexist and share the same risk factors as atherosclerotic disease. Data reporting the prognosis of patients with severe aortic stenosis and cancer are limited. Tailoring the correct and most optimal care for cancer patients with severe aortic stenosis is complex. Cancer patients may be further disadvantaged by aortic stenosis if it interferes with their treatment by increasing the risk associated with oncologic surgery and compounding the risks associated with cardiotoxicity and heart failure (HF). Nowadays, several therapeutic options are available for aortic valve stenosis (surgical valve replacement , transcatheter valve implantation, balloon valvuloplasty, or medical therapy), but in presence of malignancy, the use of one of these versus the others should be decided on a case-by-case approach, depending on cancer stage and associated treatment, expected outcome, comorbidities and after an accurate physical examination and Doppler-echocardiography which are the key tools for diagnosing and evaluating aortic stenosis. The current review considers the available data on the association between aortic stenosis and cancer, and therapeutic options.

Lysophosphatidic acid (LPA) is a promising biomarker candidate to screen for ovarian cancer (OC) and potentially stratify and treat patients according to disease stage. LPA is known to target actin-binding protein gelsolin that is a key regulator of actin filament assembly. Previous studies have shown that the phosphate headgroup of LPA alone is inadequate to bind to the short chain of amino acids in gelsolin known as the PIP2-binding domain. Thus, the molecular-level detail of the mechanism of LPA binding is poorly understood. Here, we model LPA binding to the PIP2-binding domain of gelsolin in the gelsolin-actin complex through extensive ten microsecond atomistic molecular dynamics (MD) simulations. We predict that LPA binding causes a local conformational rearrangement due to LPA interactions with both gelsolin and actin residues. These conformational changes are a result of the amphipathic nature of LPA, where the anionic phosphate, polar glycerol and ester groups, and lipophilic aliphatic tail mediate LPA binding via charged electrostatic, hydrogen bonding, and van der Waals interactions. The negatively-charged LPA headgroup binds to the PIP2-binding domain of gelsolin-actin while its hydrophobic tail is inserted into actin, creating a strong LPA-insertion pocket that weakens the gelsolin–actin interface. The computed structure, dynamics, and energetics of the ternary gelsolin–LPA–actin complex confirms that a quantitative OC assay is possible based on LPA-triggered actin release from the gelsolin-actin complex.

Background: This study assessed the nephrotoxicity of oral BRAF inhibitors (BRAFi), regorafenib (REG) and encorafenib (ENC), in metastatic colorectal cancer (mCRC), through an analysis of re-ports from the US Food and Drug Administration's Adverse Event Reporting System (FAERS) da-tabase. Methods: A descriptive and disproportional analyses were performed for all reports with ENC and REG as the primary suspect. Results: A total of 379 reports had at least one renal ADR, mainly related to REG (93.1%). Potential safety signals for REG particularly included chromaturia (n = 44; ROR = 12.00, CI 95% = 8.92-16.16; IC = 2.36, IC025-IC075 = 2.06-2.66), hydronephrosis (10; 8.70, 4.67-16.19; 1.85, 1.23-2.47), nephrotic syn-drome (7; 5.73, 2.73-12.03; 1.47, 0.73-2.21), renal impairment (53; 4.16, 3.17-5.45; 1.39, 1.12-1.66), dys-uria (19; 3.06, 1.95-4.81; 1.06, 0.61-1.52), renal failure (38; 1.66, 1.20-2.28; 0.49, 0.17-0.81), and acute kidney injury (AKI) (43; 1.46, 1.08-1.97; 0.37, 0.07-0.67). For ENC, consistent disproportionalities were observed for AKI (n = 11; ROR = 3.79, CI 95% = 2.09-6.90; IC = 1.32, IC025-IC075 = 0.72-1.91) and dysuria (4; 6.50, 2.43-17.39; 1.86, 0.88-2.85). Conclusions: These findings highlighted some not extensively reported renal ADRs that required further investigations to better characterize the safety profile of BRAFi in patients with mCRC.

Breast cancer (BC) is the most common malignancy and the second cause of cancer specific death in women from high-income countries. More than 70% of all breast cancer are hormone receptor-positive BC, and elevated estrogen circulating in blood has been proved to be a strong risk for BC development. This is due to its contribution to enhance proliferation of cancerous cells, angiogenesis and metastasis stimulation and therapy resistance. The estrogen (E) metabolism–gut microbiome axis is functional with underlying individual variations in E levels. It is reasonable that the estrobolome (bacterial genes whose products are capable of metabolizing E) could contribute to the risk of hormone-driven malignancies including BC and may serve as a potential biomarker and target. Gut microbial β -glucuronidase (GUS) enzymes have been suggested to be involved in the estrobolome. Furthermore, bacterial GUS enzymes within the gastrointestinal tract have been postulated to contribute to hormone breast cancer. In this review, we discuss the recent knowledge about the role of GUS enzyme in the pathogenesis of breast cancer. We focus on the role of GUS in (i)-the microbioma and estrogen metabolism, (ii) diet, estrobolome, and the BC development, (iii) other activities of the bacterial β-glucuronidase, and (iv) the new molecular target for BC therapeutic application.

Locally advanced rectal cancer (LARC) has traditionally been treated with trimodality therapy consisting of neoadjuvant radiation +/- chemotherapy, surgery and adjuvant chemotherapy. There is currently a clinical need for biomarkers to predict treatment response and outcomes, especially during neoadjuvant therapy. Liquid biopsy in the form of circulating tumour cells (CTCs) and circulating nucleic acids in particular microRNAs (miRNA) are novel, highly stable and clinically relevant regulators of disease. We studied a prospective cohort of 52 patients with LARC, and obtained samples at baseline, during treatment, and post-treatment. We enumerated CTCs during chemoradiation at these three time-points, using the IsofluxTM CTC Isolation and detection platform. We then subjected the isolated CTCs to miRNA expression analyses, using a panel of 106 miRNA candidates. We identified CTCs in 73% of patients at baseline, and numbers fell during treatment and miRNA expression profiles also changed during treatment. Between baseline and during treatment (week 3) time-points three microRNAs (hsa-miR-95, hsa-miR-10a and hsa-miR-16-1*) were highly differentially expressed. Importantly, hsa-miR-19b-3p and hsa-miR-483-5p were found to correlate with good response to treatment. The latter (hsa-miR-483-5p) was also found to be differentially expressed between good responders and poor responders. They represent potential predictive biomarkers and a potential miRNA-based treatment strategy. In this study, we demonstrate that CTCs are present and can be isolated in the non-metastatic early stage cancer setting, and their associated miRNA profiles can potentially be utilized to predict treatment response.

Canine mammary tumors (CMTs) are among the most common disease in female dogs and share similarities with human breast cancer, which have placed these animals as a model of study in comparative oncology. Metabolic reprogramming is one of them and is known as a hallmark of carcinogenesis whereby cells undergo adjustments to supply the high bioenergetic and biosynthetic demands of rapidly proliferating cells. However, such alterations are also vulnerabilities that may serve as therapeutic strategies which have been tested mostly in human clinical trials, but poorly explored in CMTs. In this dedicated review, we compilated the metabolic changes described for CMTs emphasizing the metabolism of carbohydrates, amino acids, lipids, and mitochondrial function. We observed here key factors associated with the presence and aggressiveness of CMTs, such as the increase in glucose uptake followed by enhanced anaerobic glycolysis via upregulation of glycolytic enzymes, changes in glutamine catabolism due to overexpression of glutaminases, raise in fatty acid oxidation and distinct effects depending on the lipid saturation, in addition to mitochondrial DNA which is a hotspot for mutations. Therefore, more attention should be paid to this topic given that targeting metabolic fragilities could improve the outcome of CMTs.

D-type cyclins encode G1/S cell cycle checkpoint proteins, that play a crucial role in defining cell cycle exit and progression. Precise control of cell cycle exit is vital during embryonic development, with defects in the pathways regulating intracellular D-type cyclins resulting in abnormal initiation of stem cell differentiation in a variety of different organ systems. Furthermore, stabilisation of D-type cyclins is observed in a wide range of disorders characterised by cellular over-proliferation, including cancers and overgrowth disorders. In this review, we will summarise and compare the roles played by each D-type cyclin during development and provide examples of how their intracellular dysregulation can be an underlying cause of disease.

Esophageal cancer is a formidable challenge in the realm of cancer treatment. Conventional methods such as surgery, chemotherapy, and immunotherapy have demonstrated limited success rates in managing this disease. In response, targeted drug therapies have emerged as a promising strategy to improve outcomes for patients. These therapies aim to disrupt specific pathways involved in the growth and development of esophageal cancer cells. This review explores various drugs used to target specific pathways, including cetuximab and monoclonal antibodies (gefitinib) that target the epidermal growth factor receptor (EGFR), trastuzumab that targets human epidermal growth factor receptor 2 (HER-2), drugs targeting the vascular endothelial growth factor receptor (VEGFR), mTOR inhibitors, and cMET inhibitors. Additionally, the article discusses the impact of drug resistance on the effectiveness of these therapies, highlighting factors such as cancer stem cells, cancer-associated fibroblasts, immune-inflammatory cells, cytokines, hypoxia, and growth factors. While drug targeting approaches do not provide a complete cure for esophageal cancer due to drug resistance and associated side effects, they offer potential for improving patient survival rates.

Cancer is a devastating disease, causing tremendous morbidity and mortality each year. Cancer can be considered as a genetic disease in the sense that instabilities in protooncogenes and tumor suppressor genes are among the hallmarks of cancer progression and metastasis. However, a particular cancer can express different proteins in different patients, making cancer a heterogeneous disease. This heterogeneity in part influences treatment resistance and failure. Therefore, it is crucial to understand the mechanism by which cancer cells develop and enhance resistance to different agents. This review aims to present the general paradigm and recent updates on cancer cell resistance to different antitumor agents. It demonstrates that tumor resistance results from a myriad of factors, including tumor microenvironment, supporting immune cells, and cancer stem cells. This interaction contributes to cancer cells overcoming the therapeutic effects of different classes of antitumor agents, such as cytotoxic chemotherapeutics, targeted agents, and immunotherapies. With the development of advanced molecular analysis, specialized genomic assessment has assisted clinicians and researchers in choosing selected agents combating cancer cells. Together, this approach can potentially reduce treatment toxicity, health system burden, and financial costs while improving patient quality of life. Understanding the exact mechanism of drug resistance in cancer cells can open the way to new effective and less toxic therapeutics.

The appearance of brain metastasis is the most serious complication of breast cancer with mostly fatal outcomes. To reach the brain, tumor cells need to pass the blood-brain barrier (BBB). The molecular mechanisms underlying penetration of the BBB are largely unknown. Previously we found that tumor-infiltrating T lymphocytes enhance the development of brain metastasis of estrogen receptor-negative (ER-) breast cancer. In the current study, we investigate the contribution of T lymphocytes and the IFN- pathway in enabling breast cancer cells to pass the in vitro BBB. CD8+ cells display the strongest stimulatory effect on breast cancer cell passage. We show that inhibition of the IFN- receptor in MDA-MB-231 breast cancer cells, or neutralization of soluble IFN-, impairs the in vitro trespassing of breast cancer cells. Importantly, we validated our findings using gene expression data of breast cancer patients. CXCL-9,-10,-11/CXCR3 axis, dependent on IFN- signaling activity, was overexpressed in primary breast cancer samples of patients who developed brain metastasis. The data support a role for T-lymphocytes and the IFN- pathway in the formation of brain metastasis of ER- breast cancer, and offer targets to design future therapies for preventing breast cancer cells to cross the BBB.

Recent reports suggest that dysregulation of lipid metabolism is a key feature of the most invasive cancers. To identify potential biomarkers of tumor aggressiveness, we compared the proteomes of two experimental models of malignant mesothelioma in rats exhibiting different invasive properties. Quantitative changes between the most invasive, M5-T1, versus the least invasive, F4-T2, first led to a list of 424 proteins. A second step, cross-comparing this list with 433 proteins distinguishing invasive vs non-invasive tumors, led to identifying 88 proteins that specifically increased and 157 that decreased, respectively, characterizing the most aggressive M5-T1 tumor. Among the 15 mitochondrial proteins found in these lists, the very long-chain specific acyl-CoA dehydrogenase, encoded by the Acadvl gene and involved in fatty acid beta oxidation, appeared to play an important role in the metabolic reprogramming of the tumor microenvironment. Immunohistochemical staining of tumor sections confirmed increased expression of Acadvl in the M5-T1 tumor. Finally, the dramatic increase and decrease, observed in 25 and 17 proteins, respectively, suggested the existence of a strong link between mitochondrial events and modifications of the extracellular matrix, immune cell components or other subcellular compartments. These findings highlight some important aspects of the tumor microenvironment changes linked to aggressiveness.

It was found that patients with comorbidities of obesity and diabetes have a high risk of breast cancer occurrence and face worse breast cancer outcomes. Though several reports showed the reinforced link between obesity, diabetes, and prediabetes with breast cancer, the underlying molecular mechanism is still unknown. The present study aimed to investigate the underlying molecular link between increased risks of breast cancer due to coincident diabetes or obesity using a spontaneous obese rat model with impaired glucose tolerance (WNIN/GR-Ob rat). A single dose of solubilized DMBA suspension (40 mg/kg body weight) was orally administered to the animals at the age of 60 days to induce breast tumors. The tumor incidence, latency period, tumor frequency, and tumor volume were measured. Histology, immunohistochemistry, and immunoblotting were performed to evaluate the tumor morphology and expression levels of signal molecules. It was observed that the onset of breast tumor and latency period per tumor development were early in GR-Ob rats compared to respective lean rats. It was found that 62% of obese rats were bearing tumors, and in comparison, only 21% of the lean animals developed breast tumors. Overexpression of ER, PR, Ki67, and p53 markers was observed in tumor tissues of obese rats in comparison with lean rats. The levels of the hallmarks of cell proliferation and angiogenesis involved in IGF-1/PI3K/Akt/GSK3β/β-catenin signaling pathway molecules were upregulated in obese rat breast tumors compared to lean rats. Furthermore, obesity with prediabetes is associated with changes in IGF-1 signaling and acts on PI3K/Akt/GSK3β/β-catenin signaling, which results in quick cell proliferation and development of breast tumors in obese rats than the lean rats. These results indicate that the onset of the tumor and its development was faster in a spontaneous obese rat model with impaired glucose tolerance than their lean counterparts, with a higher percentage of tumor incidence.

Colon cancer is a common malignancy of digestive tract and has high incidence and mortality worldwide. As a normal flora in the human gastrointestinal tract, lactic acid bacteria have been proved to have health benefits, such as immune-regulation, anti-infection, and anti-tumor. In the present study, the inhibitory effects of 19 heat-inactivated plant-derived lactic acid bacteria on human colon cancer cell HCT116 were investigated. The results showed that heat-inactivated plant-derived lactic acid bacteria strain 729 had the strongest inhibitory effect on HCT116 cells among all tested bacteria. Treatment with heat-inactivated bacteria strain 729 could inhibit the proliferation of HCT-116 cells in dose-dependent manner, with 54.52% inhibition at a final concentration of 1×10⁸ CFU/mL. Moreover, the heat-inactivated bacteria strain 729 could block the cell cycle, induce apoptosis, and promote cellular ferroptosis by downregulating the expression of GPX4 and xCT at protein level. According to the 16S rDNA sequencing, the plant-derived lactic acid bacteria strain 729 was Lactobacillus plantarum. Collectively, the results indicates that lactic acid bacteria strain 729 may be developed as special ingredients targeting colon cancer, but further in vivo studies are required.

Erectile dysfunction (ED) is a common and feared complication of radical prostatectomy (RP) for prostate cancer. Recently, tissue engineering is being attempted for post-prostatectomy ED, with controlled interactions between cells, growth factors, and extracellular matrix (ECM) being important for nerve regeneration's structural integrity. In this study, we evaluated the effects of biomechanical ECM patch on human bone marrow-derived mesenchymal stem cells (hBMSCs) morphology and behavior in bilateral cavernous nerve injury (BCNI) rat model. The ECM patch, made of decellularized human fibroblast-derived ECM (hFDM) and a biocompatible polyvinyl alcohol (PVA) hydrogel, was tested with human bone marrow-derived mesenchymal stem cells (hBMSCs) on a bilateral cavernous nerve injury (BCNI) rat model. In vitro analysis showed that the hFDM/PVA + hBMSCs patches significantly increased neural development markers. In vivo experiments demonstrated that the rats treated with the hFDM/PVA patch had higher ICP/MAP ratio, a higher ratio of smooth muscle to collagen, increased content of nNOS, higher levels of eNOS protein expression, and a higher cGMP level compared to the BCNI group. These results indicate that the hFDM/PVA patch is effective in promoting angiogenesis, smooth muscle regeneration, and nitrergic nerve regeneration, which could contribute to improved erectile function in post-prostatectomy ED.

Colorectal cancer remains one of the most commonly diagnosed cancers. Advanced rectal cancer patients receive neoadjuvant radiochemotherapy as well as surgery and suffer under reduced health-related quality of life due to various side effects. We were interested in the role of the COVID-19 pandemic and how it affected those patients’ quality of life. A total of 489 advanced rectal cancer patients from the University Hospital Erlangen in Germany were surveyed between May 2010 and March 2022 and asked to fill out the EORTC QLQ-C30 and QLQ-CR38 questionnaire over eight different time points: in the beginning, during and after radiochemotherapy, right before surgery and in yearly intervals after surgery for up to four years. Answers were converted to scores to compare the COVID-19 period to the time before March 2020 focusing on the follow-ups, the developments over time – including by sex and age - and the influence of the TNM cT-stage. Overall, a trend of impaired functional and symptom scores was found across all surveys with few significances (body image -10.6 percentage points (pp) after one year; defecation problems +13.5 pp, insomnia +10.2 pp and weight loss +9.8 pp after three years; defecation problems +11.3 pp after four years). cT4-stage patients lost significantly more weight than their cT1-3-stage counterparts (+10.7 to 13.7 pp). Further studies should be conducted to find possible causes and develop countermeasures for future major infectious diseases.

In the last two decades many detailed full transcriptomic studies on complex biological samples have been published and included in large gene expression repositories. These studies primarily provide bulk expression signal for each sample, including multiple cell-types mixed within the global signal. The cellular heterogeneity in these mixtures does not allow the activity of specific genes in specific cell types to be identified. Therefore, inferring relative cellular composition is a very powerful tool to achieve a more accurate molecular profiling of complex biological samples. In recent decades, computational techniques have been developed to solve this problem by applying cell deconvolution methods, designed to decompose cell mixtures into their cellular components and calculate the relative proportions of these elements. Some of them, only calculate the cell proportions (supervised methods), while other deconvolution algorithms can also identify the gene signatures specific for each cell type (unsupervised methods). In these work, five deconvolution methods (CIBERSORT, FARDEEP, DECONICA, LINSEED and ABIS) were implemented and used to analyze blood and immune cells, and also cancer cells, in complex mixture samples (using three bulk expression datasets). Our study provides three analytical tools (corrplots, cell-signature plots and bar-mixture plots) that allow a thorough comparative analysis of the cell mixture data. The work indicates that CIBERSORT is a robust method optimized for the identification of immune cell-types, but not as efficient in the identification of cancer cells. We also observed that LINSEED is a very powerful unsupervised method that provides precise and specific gene signatures for each of the five main immune cell-types analyzed: neutrophils and monocytes (in the myeloid lineage), B-cells, NK cells and T-cells (in the lymphoid lineage).

Dietary iron assimilation is critical for health and essential to prevent iron deficient states and related comorbidities, such as anemia. The bioavailability of iron is limited, while its absorption and metabolism are tightly controlled to keep body iron stores within a relatively narrow range. Genetic inactivation of the iron hormone hepcidin causes hereditary hemochromatosis, an endocrine disorder of iron overload characterized by chronic hyperabsorption of dietary iron, with deleterious clinical complications if untreated. The impact of high dietary iron intake and elevated body iron stores in the general population is not well understood. Herein, we summarize epidemiological data suggesting that high intake of heme iron, which is abundant in meat products, poses a risk factor for metabolic syndrome pathologies, cardiovascular diseases, and some cancers. We discuss clinical relevance and potential limitations of data from cohort studies, as well as the need to establish causality and elucidate molecular mechanisms.

In recent years, new therapies have been developed based on molecules that target mo-lecular mechanisms involved in both the initiation and maintenance of the oncogenic process. Among these molecules are the poly (ADP-ribose) polymerase 1 (PARP1) inhibitors. PARP1 has emerged as a target with great therapeutic potential for some tumor types, drawing attention to this enzyme and resulting in many small molecule inhibitors of its enzymatic activity. Thus, many PARP inhibitors are currently in clinical trials for the treatment of homologous recombina-tion (HR)-deficient tumors, BRCA-related cancers, taking advantage of synthetic lethality. In ad-dition, several novel cellular functions unrelated to its role in DNA repair have been described, including post-translational modification of transcription factors, or acting through pro-tein-protein interactions as a co-activator or co-repressor of transcription. Previously, we report-ed that this enzyme may play a key role as a transcriptional co-activator of an important compo-nent of cell cycle regulation, the transcription factor E2F1. Here, we show that PARP inhibitors, which interfere with its activity in cell cycle regulation, do so without affecting its enzymatic function.

Background Cancer is one of the most concerning public health issues in the world. One of cancer hallmarks wildly accepted is sustaining proliferative signaling, which involved most of the cell cycle biological activities. Centromeric histone, Centromere Protein A (CENPA), a variant of canonical histone H3, plays an essential role in selective chromosome segregation in the cell cycle. However, so far, a systematic pan-cancer bioinformatic analysis has not been done yet. Methods We accessed genome, transcriptome, and clinical information from open databases. The genetic alteration, mRNA expression, functional enrichment, stemness, mutation association, expression in cell populations and cellular locations, cell cycle association, survival association of CENPA, and immune association were analyzed. A prognostic model for glioma patients was constructed as an example application of CENPA as a biomarker. Drugs targeting CENPA in cancer cells were also screened and predicted by the CENPA correlation of drug sensitivity and protein-ligand docking. Results CENPA had low gene mutation in cancers. CENPA was overexpressed in almost all cancer types in TCGA compared to their normal control. CENPA was highly expressed in the nucleus of malignant cells. CENPA was associated with the cell cycle of cancer cells. CENPA is a biomarker for the cell cycle G2 phase in cancer cells. CENPA was a diagnostic and prognostic biomarker across multiple cancer types. The prognosis of glioma with CENPA was reliable and can be applied with other prognostic factors. CENPA was associated with the immune microenvironment. Drugs CD-437, 3-Cl-AHPC, Trametinib, BI-2536, and GSK461364 were predicted to target CENPA in cancer cells. Conclusion CENPA was a cell cycle biomarker in cancers with diagnostic and prognostic value.

This study was performed to synthesize multimodal radiopharmaceutical designed for the diagnosis and treatment of prostate cancer. To achieve this goal, Super Paramagnetic Iron Oxide (SPIO) nanoparticles were used as a platform for targeting molecule (PSMA-617) and for complexation of two scandium radionuclides, 44Sc for PET imaging and 47Sc for radionuclide therapy. TEM and XPS images showed that the Fe3O4 NPs have a uniform cubic shape and a diameter from 38 to 50 nm. The Fe3O4 core are surrounded by SiO2 and an organic layer. The saturation magnetization of the SPION core was 60 emu/g. However, coating the SPIONs with silica and polyglycerol reduces the magnetization significantly. The obtained bioconjugates were labeled with 44Sc and 47Sc, with a yield higher than 97%. The radiobioconjugate exhibited high affinity and cytotoxicity towards the human prostate cancer LNCaP (PSMA+) cell line, much higher than for PC-3 (PSMA-) cells. High cytotoxicity of the radiobioconjugate was confirmed by radiotoxicity studies on LNCaP 3D-spheroids. In addition, the magnetic properties of the radiobioconjugate should allow for its use in guide drug delivery driven by magnetic field gradient.

Apoptosis, also known as the programmed death of cells, is responsible for maintaining the homeostasis of tissues and this function is carried out by caspases. The process of apoptosis is carried out via two distinct pathways: the extrinsic pathway, which is governed by death receptors, and the intrinsic pathway, also known as the mitochondrial pathway. The BCL-2 protein family encoded by the BCL-2 gene, located at the 18q21.33 chromosomal location, is in charge of regulating the intrinsic pathway, which is responsible for inducing cell death via the permeabilization of the mitochondrial membrane and the release of apoptosis - inducing components. The BCL-2 homology (BH1, BH2, BH3, BH4) domains of this family proteins are crucial for their functioning and their common BH domains allow interactions between members of the same family and can also serve as indications of pro- or anti-apoptotic activity. A direct correlation may be shown between the overexpression of BCL-2 and the postponement of cell death. It has been determined that a change in the expression of BCL-2 is the root cause of a variety of malignancies, including lung, breast, melanoma, and chronic lymphocytic leukemia, Multiple Sclerosis, Diabetes. In this review, we discuss the therapeutic potential of regulating BCL-2 family connections and their relevance to health and disease.

Glioblastomas (GBM) are most common, primary brain tumors in adults. Despite advances in neurosurgery, radio- and chemotherapy, the median survival of GBM patients is 15 months. Recent large-scale genomic, transcriptomic and epigenetic analyses have shown the cellular and molecular heterogeneity of GBMs, which hampers the outcomes of standard therapies. We have established 13 GBM-derived cell cultures from fresh tumor specimens and characterized them molecularly using RNAseq, immunoblotting and immunocytochemistry. Evaluation of proneural (OLIG2, IDH1R132H, TP53 and PDGFRα), classical (EGFR) and mesenchymal markers (CHI3L1/YKL40, CD44 and phospho-STAT3), as well as expression of pluripotency (SOX2, OLIG2, NESTIN) and differentiation (GFAP, MAP2, β-Tubulin III) markers revealed the striking inter-tumor heterogeneity of primary GBM cell cultures. Upregulated expression of VIMENTIN, N-CADHERIN and CD44 at mRNA/protein levels suggested increased epithelial to mesenchymal transition (EMT) in most studied cell cultures. The effects of temozolomide (TMZ) or doxorubicin (DOX) were tested in three GBM-derived cell cultures with different methylation status of the MGMT promoter. Amongst TMZ- or DOX-treated cultures the strongest accumulation of apoptotic markers: caspase 7 and PARP were found in WG4 cells with methylated MGMT suggesting that its methylation status predicts vulnerability to both drugs. As many GBM-derived cells showed high EGFR levels, we tested the effects of AG1478, an EGFR inhibitor, on downstream signaling pathways. AG1478 caused decreased levels of phospho-STAT3, thus inhibition of active STAT3 augmented antitumor effects of DOX and TMZ in cells with methylated and intermediate status of MGMT. Altogether, our findings show that GBM-derived cell cultures mimic the considerable tumor heterogeneity and identifying patient-specific signaling vulnerabilities can assist in overcoming therapy resistance, by providing personalized combinatorial treatment recommendations.

Abstract. Marek's disease virus is an oncogenic avian herpesvirus and the problem of oncogenicity of this virus for humans remains unexplored. This pathology appeared in broiler chickens of 30 days and older, that is from now on the contact with poultry meat carries the risk of infecting people. This article analyzes the risks of the emergence of the epidemic potential of the Marek's disease virus in the Russian Federation taking into account the characteristics of modern pig and poultry farming. It was found that COVID 19 can serve as an additional factor in reducing the resistance of the population to herpesvirus infections. The COVID 19 epidemic is accompanied by folic acid deficiency which also increases the risk of contamination of diseases associated with DNA viruses, including an extended risk of animal viruse infection. Since, according to our estimates, Marek's disease occurred in at least 25% of broiler poultry farms in the Russian Federation, a possible expand in mortality from neoplasms of the reproductive system for the Russian Federation as a whole can contribute to the dynamics of oncological diseases of reproductive organs and breast cancer. Since 2011 a contagious form of intestinal pathology, vesicular enteritis, has widely spread at poultry farms in the Russian Federation. During periods of extending incidence of vesicular enteritis, we recorded cases of inflammation of the facial nerves and subfebrile temperature in contact persons, bursts of oncological diseases in veterinary personnel (ovarian cancer, breast cancer), abnormal and synchronous increases in the incidence of infectious larengotracheitis and Marek's disease in chickens under the age of 40 days which requires additional monitoring studies.

The current study aimed to investigate the antitumor effects and potent mechanism of cytokine-induced killer (CIK) cells combined with irreversible electroporation (IRE) via an in vitro function assay in an in vivo Panc02 cell–bearing mouse model. We established an in vitro culture assay for CIK cells and determined the proportions of different peripheral lymphocytes. The antitumor effect of the combination of IRE and CIK cells in a Panc02 pancreatic-cancer (PC) subcutaneous-xenograft model was investigated; tumor size and mouse survival rates were recorded. We used flow cytometry (FCM) to analyze the proportion of intratumoral lymphocytes, the expression of chemokine receptors, and the proliferative activity of CIK cells. The proportion of cells that were positive for clusters of differentiation 3 and 8 (CD3+CD8+) and the proportion of CD3+CD56+ cells were both significantly increased after 21 days of in vitro culture. Combined IRE/CIK cell treatment significantly inhibited tumor growth and increased the survival rate of Panc02 cell–bearing mice. Furthermore, infiltration of lymphocytes into tumor tissue was significantly increased by this combination therapy compared with the untreated group or monotherapy group. In addition, IRE significantly enhanced the expression of chemokine receptors elicited by, and the proliferative activity of, CIK cells. In conclusion, IRE combined with CIK cells showed superior antitumor efficacy in a PC subcutaneous-xenograft model, which we attributed to the promotion of lymphocytic infiltration, as well as to upregulation of chemokine receptor expression and of regulators of CIK cell proliferation.

Previously, we reported that MTH1 inhibitors TH588 and TH1579 selectively induce oxidative damage and kill Ras expressing or transforming cancer cells, as compared to non-transforming immortalized or primary cells. While this explains the impressive anti-cancer properties of the compounds, the molecular mechanism remains elusive. Oncogenes induce replication stress, re-sulting in under replicated DNA and replication continuing into mitosis, where TH588 and TH1579 treatment cause toxicity and incorporation of oxidative damage. Hence, we hypothesized that oncogene-induced replication stress explains the cancer selectivity. To test this, we overex-pressed c-Myc in human epithelial kidney cells (HA1EB), resulting in increased proliferation, polyploidy and replication stress. TH588 and TH1579 selectively kill c-Myc overexpressing clones, enforcing the cancer cell selective killing of these compounds. Moreover, the toxicity of TH588 and TH1579 in c-Myc overexpressing cells is rescued by transcription, proteasome or CDK1 inhibitors, but interestingly not by nucleoside supplementation. This suggest that cancer selectivity is unrelated oncogene-induced replication stress. We conclude that the molecular toxi-cological mechanisms how TH588 and TH1579 kill c-Myc overexpressing cells have several com-ponents and involves MTH1-independent proteosomal degradation of c-Myc itself, c-Myc driven transcription and CDK activation, and is likely unrelated to oncogene-induced replication stress.