For several millennia, doctors and healers used therapeutic ingredients extracted from minerals, plants, and animals. Among the active remedies derived from animals, the placenta was among the most popular ones. The use of placenta-based remedies has retained its significance in our time. The placenta-based therapeutics are indicated for stimulating immunity, wound healing, reduction of skin pigmentation, treatment of various patients suffering from gynecological disorders, etc. By the beginning of the 21st century, the majority of specific functions and chemical ingredients of the placenta were identified and described. However, only now active proteins and peptides with molecular weight of about ten kDa were revealed. Presumably, they play an essential role during the therapeutic application of placental extract. Hopefully, this discovery will start a new era in the research and clinical application of organotherapeutic remedies, including placenta.

Two clear-air over-the-horizon propagation mechanisms affecting Automatic Identification System (AIS) detection range are considered. Comparison results are presented between the path loss due to tropospheric ducting and path loss due to tropospheric scattering (troposcatter) for the AIS frequencies. The calculations are based on the well-known parabolic equation approximation to the wave equation, in which a simple troposcatter formula is incorporated. In most studied cases the ducting assures significantly greater reduction of path loss than troposcatter even when the AIS frequencies are not well trapped in the duct. Emphasis is placed on elevated trapping layers and some features that may make ducting propagation less favorable in terms of increasing the AIS detection range are discussed.

Male infertility is a condition that has always been less studied and known than female infertility. Male infertility is increasingly present and increasingly dignosticated. Although several causes are known, to date about 40% of the causes are considered idiopathic. The worldwide denatality, can only be slowed if awareness campaigns are implemented on all the diseases that can alter fertile potential, especially in young adolescents. Male infertility is, in addition, associated with several medical conditions, in particular the association between infertility and testicular cancer, cardiovascular disease, autoimmune diseases and genetic diseases is well known. For this reason, fertility preservation should not be proposed or be only oncological in nature, but there are several diagnosable pediatric pathologies associated with altered fertile potential to whose patients we could offer a gamete preservation pathway. In this paper we propose our experience on fertility preservation in pediatric andrological diseases.

In 1911, A. Einstein suggested that gravity affects at the electromagnetic radiation originating from the distant sources, namely, it shifts the spectral lines in the red side of the spectrum and derived the gravitational redshift formula. A modern science claims that Einstein’s formula is mathematically immaculate. We show that this is not true: in fact, this formula is approximate. Using the law of conservation of mechanical energy, we derived two exact formulas оf the gravitational redshift.

This paper proposes a reconceptualization of the hierarchical understanding of the human organism, challenging the conventional idea of the supremacy of the nervous system. We argue that symbiotic coexistence and functional interdependence among all systems provide the human body with remarkable resistance to the universal tendency of entropy. We first examine the basis of cellular life, referring to ATP and DNA, essential substances that resist the entropic tendency through complex energy mechanisms. Next, we analyze the collaboration between the body's systems, highlighting the critical role of erythrocytes, which constitute 83.9% of the total cells (24.9 trillion), in the context of energy maintenance and homeostasis. We challenge the conventional view that the nervous system, composed of neurons and glial cells, which together make up 0.6% of the total cells (0.17 trillion), occupies the apex of a biological hierarchy, arguing that the nervous system is merely a component of a broader, interdependent mechanism. Finally, we provide a detailed description of human cellular composition, emphasizing the importance of each cell type in the functional context, thus contributing to the totality of the organism. With this, we present a vigorous appeal for the realization of critical reassessments of fundamental premises in human biology.

Investigating the potential impact of composting and recycling waste on income distribution are crucial to promote a fairer and more sustainable fresh tomato supply chain (FTSC). Therefore, this study aims to explore the potential of gaining extra income from recycling tomatoes waste generated along the FTSC and to calculate the contribution of extra income from recycling tomato waste to reduce income inequality along the FTSC. Data were collected from 136 greenhouse tomato producers, 60 wholesalers, 18 exporters, 120 domestic retailers, 22 overseas retailers, and 3 recycling facilities in Türkiye. Marketing cost, absolute marketing margin, relative marketing margin and net profit margin were used when economically analyzing the FTSCs. Research results showed that the net profit share of the producer decreased associated with the increasing number of intermediaries. Research results also showed that revenue gained from composting and recycling of product loss and waste increased the welfare of greenhouse producer more than other supply chain actors. When taking into account the revenue from composting and recycling of wastes, producers increased their net profit by 9.85% at first FTSC, while that of second and third FTSCs were 8.29% and 9.21%, respectively comparing to the prevailing conditions. The contribution of extra revenue from composting and recycling of wastes to retailers was more comparing wholesaler and exporter. Retailers and wholesalers gaining from recycling in domestic FTSCs was more comparing to overseas one. Close cooperation between producers, wholesalers, exporters, retailers, and recycling facilities is essential for the effective implementation of waste recycling initiatives. Organizing the training and education programs focused on waste management can increase the extra income of producers and active intermediaries in FTSC from composting and recycling tomato wastes. Offering financial incentives, grants, or subsidies can encourage producers and other actors within the supply chain to adopt waste recycling practices. Continuous research and innovation are crucial in identifying and developing new technologies, processes, and strategies to minimize food loss and waste. Dominating fair-trade practices to ensure that all FTSC actors may balance the income distribution among FTSC actors.

As the demands in reliability and high-degree of automation in industrial applications are increasing exponentially, the current Industry 4.0 trend lies in migrating towards smarter technologies that increase flexibility and provide autonomous operation. To tackle this, manufacturers shifted towards Real-Time Ethernet communication which supports autonomous operation, faster sensor/actuator configuration and high degree of determinism. Nevertheless, the uninterrupted operating principle of legacy industrial systems as well as the system complexity and heterogeneity constitutes the transition to Real-Time Ethernet very challenging. This article proposes a novel method allowing to automate the generation of executable code for Real-Time Ethernet architectures based on high-level programming models. The method is based on a programming model and modular code artifacts for the hardware architecture, employing Real-Time Ethernet communication. Through an tool-supported algorithm the high-level model is linked to the architecture's communication primitives and interfaces. The tool-support reduces significantly the development and debugging effort for Real-Time Ethernet applications and increases the application reliability, since the generated code is based on verified programming models. Additionally, the tool creates dedicated files, which allow automated industrial network configuration without any human intervention. Finally, by embedding firewall policies into the code generation process, the method guarantees cyber-resilience for the Real-Time Ethernet architecture. We demonstrate the proposed method in Programmable Logic Controllers (PLCs) of a Public Power Corporation's Hydroelectric Power Plant, which control the temperature and rotor speed of a power generator. The results demonstrate the method's ability to generate rapidly trustworthy and fault-tolerant code for the autonomous plant operation. The hurdles in time and effort for developing, configuring and debugging Real-Time Ethernet applications can be minimized through a high-level programming model that allows automated generation of executable code that is reusable for similar applications. Such time and effort reduction may pave the way towards the Industry 4.0 area.

Durum wheat is an economically and nutritionally important cereal. The increase in durum wheat yield is mostly associated with improving grain traits. The grain size and shape-related traits are directly related to wheat yield. In addition, grain size influences the seed germination rate and seedling vigour, which play key roles in stand establishment and yield. Thus, it is important to investigate grain traits both agro-morphologically and genetically. In this study, a panel of durum wheat, consisted of 146 genotypes, was evaluated for grain traits agro-morphologically, and a genome-wide association study (GWAS) was conducted to dissect the genomic regions associated with these traits. As a result of GWAS, a total of 41 marker-trait associations (MTAs) were identified on different chromosomes of durum wheat. Of these MTAs, only 11 were stable across environments. A BLAST search for flanking sequences of every stable MTAs in the Svevo genome identified 18 putative candidate genes directly associated with seed traits of different plants, particularly wheat seeds. In conclusion, the annotation results and literature information provide strong evidence that identified stable MTAs and their candidate genes may have important functions in the formation of wheat grain traits. After the validation of these MTAs with different fine-mapping and functional characterization studies, these loci may provide valuable information for geneticists and breeders to improve wheat yield.

Hydrogels can be considered as mimics of extracellular matrix (ECM).Cytoskeleton through integrins is connected with ECM and cytoskeleton tension depends on ECM stiffness.A number of age-related diseases depend on cellular processes related with cytoskeleton function.Some examples of cancer initiation and progression and heart disease in relationship with ECM stiffness has been analysed.Incorporation of rigid particles in ECM can increase ECM stifness and to promote formation of internal residual stresses. Water migration, changes of water binding energy to biomactomolecules, changes of the state of water from tightly bound water to free and loosely bound water changes stiffness of ECM. Risks related with rigid particles incorporation into ECM have been also iscussed.

Strandings are one of the most worrying issues in relation to the conservation of cetacean species, and in the case of Chile, due to its geography and large extension of the coastline, monitoring and access to these events is difficult, making their study more complex. Chile has a shortage of specialized scientific forensic research facilities for cetacean; however, for this study it was able to collect data recorded from official institutions and sporadic scientific biological sampling oriented to investigate the causes of death or stranding. According to the Chilean government official database, we described that the main causes of unusual mortality events (UME) and mass strandings from year 2015 and 2016 were acute poisoning by biotoxin and trauma to the auditory complex, respectively, while individual strandings would have their causes in anthropogenic activities such as entanglements in fishing an aquaculture gear and collisions with vessels. The predominant species in mass strandings was the sei whale (Balaenoptera borealis). The geographical area of greatest prominence in mass strandings was the Aysén Region in the Central Patagonia of Chile, while the species mostly involved in individual strandings along the south-central, central, and northern coast of Chile was the small porpoise (Phocoena spinipinnis). The most common gross pathological findings were advance decay of the carcasses and nonspecific wounds of different nature, difficult to associate with possible causes of death without further histopathological studies.

Stem cells can be used in cellular therapy. This happended in order to replace damaged cells or having aim to regenerate organs. The definition of stem cells can be extended. From this point of view, we can mention taking in consideration the idea in which it is known that these cells form the base of the building body. More than, we can mention that stem cells are characterized by two knowing properties namely differentiation and self renewal. Based on the observation that differentiation of adult stem cells into specific derivative scan be controlled by laboratory techniques, it is anticipated that adult stem cells may become the basis of therapies for many, and various types of medical conditions. Taking on stem cells, regenerative medicine (RM) it is known as being one of the hottest topics in biotechnology nowadays. From this purpose, stem cells can be used in regenerative medicine (RM). The principles of regeneration are found in different types of cultures, from long time ago. As an interdisciplinary field of research, regenerative medicine, play a great role in tissues and organs damaged reparation with a higher potential in transplantation if necessary.

In the landscape of network management, software-defined networking (SDN) technology emerges as a dynamic approach, facilitating efficient network configuration for improved performance and monitoring, akin to the agility of cloud computing rather than traditional methods. However, its centralized structure exposes SDN to various attack vectors. Distributed Denial of Service (DDoS) attacks, particularly, pose a significant threat to SDN. This study employs machine learning algorithms and Network Traffic Classification Analysis (NCA) to classify SDN traffic as potential attacks. Notably, Decision Trees (DT) out shine other algorithms with a flawless 100% classification success, spotlighting their supremacy. Through this research, a robust path toward fortified SDN security takes form, where technological prowess and strategic intelligence unite for enhanced defense.

It is crucial to select the right machine learning classifier for image classification and face recog-nition. This study examines the effectiveness of four different face recognition classifiers - Support Vector Machines (SVM), Random Forest, K-Nearest Neighbors (KNN), and Neural Networks. An analysis of the Large Faces in the Wild (LFW) dataset was carried out using Principal Component Analysis (PCA). Classifiers are rigorously trained and evaluated based on the extracted features. Comparison of classifier performance is an insightful way to figure out their strengths and weaknesses. Having a visual representation of the classifier's performance gives a complete understanding of its capabilities. Through the selection of the most appropriate classifier, study results contribute to advancements in image classification, recognition, and biometric identification. The comparison study demonstrated that the Neural Network classifier was exceptionally accurate and proficient in recognizing faces from the LFW dataset when used in conjunction with PCA for feature extraction. According to the comparative analysis, the Neural Network classifier proved exceptionally accurate and proficient at identifying faces from the LFW dataset when combined with PCA for feature extraction.

In this article, we have tried to extend the Neumann–Kopp law concerning the heat capacity of solid compounds to other physical observables for materials represented as mixtures of chemical compounds, alloys, and ceramics. The main goal of this study is to find the intervals of external or internal parameters for a solid compound, within which its physical observable - the magnetic transition temperature for this work, can be expressed in terms of the atomic or molar weighted sum of the magnetic transition temperatures of the constituent elements of a compound. Outside these intervals, we tried to figure out the structure of the variable by which the weighted sum should be multiplied. Thus, for USb–x(ThSb) mixtures with a mole fraction x from 0.36 to 0.55, the magnetic transition temperature of this mixture is expressed in term of the molar weighted sum of the temperature of uranium structural transition associated with a change in the magnetic properties of uranium and of the temperature at which the nature of the magnetic susceptibility of antimony changes. For the magnetic Laves phase compounds Er(Fe_0.8–xMn_0.2–yCo_x+y)₂, the Curie temperature of the compound is equal to the weighted sum of the Curie temperatures of all elements of the compound, except for Mn, at x = 0.1, y = 0 and y = 0.1. For the paramagnetic Curie temperature of intercalated dichalcogenides Cr_xМоSe₂, it can be expressed in terms of the weighted Neel temperature of chromium multiplied by a variable depending on x, on the atomic numbers of all elements of the compound, and on a parameter proportional to the derivatives with respect to x of the dichalcogenide’s crystal lattice parameters.

Many studies discuss carbon-based materials because of the versatility of its element. They include different opinions for scientific problems and discuss fairly at convincing and compelling levels within the scope and application. A gas-state carbon atom converts into various states depending on its conditions of processing. The electron transfer mechanism in the gas-state carbon atom is responsible to convert it into various states, namely, graphite, nanotube, fullerene, diamond, lonsdaleite and graphene. The shape of ‘energy trajectory’ enables transferring electrons from the left- and right-sides of an atom is like a parabola. That ‘energy trajectory’ is linked to states (filled state and suitable nearby unfilled state) where force-exertion along the poles of transferring electrons is remained balance. So, the mechanism of originating different states of a gas-state carbon atom is under the involvement of energy first. This is not the case for atoms executing confined inter-state electron-dynamics as the force is involved first. Graphite-, nanotube- and fullerene-state atoms ‘partially evolve partially develop’ (form) their structures. These possess one-dimensional, two-dimensional and four-dimensional ordering of atoms, respectively. Their structural formation also comprises ‘energy curve’ having a shape-like parabola. Transferring suitable filled state electron to suitable nearby unfilled state is under a balance force exerting along the poles. The graphite structure under only attained-dynamics of atoms can also be formed but in two-dimension. Here, binding energy between graphite-state carbon atoms is for a small difference of exerting forces along their opposite poles. Structural formation in diamond, lonsdaleite and graphene atoms involve energy to gain required infinitesimal displacements of electrons through which they maintain orientationally-controlled exerting forces along dedicated poles. In this study, the growth of diamond is found to be south to east-west (ground) where atoms bound ground to south. Thus, diamond atoms merge for a tetra-electron ground to south topological structure. Lonsdaleite atoms merge for a bi-electron ground to just-south topological structure. The growth of graphene is found to be north to ground where atoms bound ground to north. Thus, graphene atoms merge for a tetra-electron ground to north topological structure. Glassy carbon exhibits layered-topological structure where, tri-layers of gas-, graphite- and lonsdaleite-state atoms successively bind in repetitive order. Nanoscale hardness is also sketched based on different force-energy behaviors of different state carbon atoms. Here, structure evolution in each carbon state atom explores its own science.

Knowledge of permafrost’s ice and unfrozen water content is critical for predicting the permafrost behavior during ice–water–ice transition. This is especially relevant when ice and permafrost are melting in many regions under the influence of global warming. It is well-known that only a part of the formation's pore water turns into ice at 0 ^oC. After the further lowering the temperature, the water phase transition continues, but at gradually decreasing rates. Thus, the porous space is filled with ice and unfrozen water. The laboratory data show that frozen formations' mechanical, thermal, and rheological properties strongly depend on the moisture content. Hence, porosity and temperature are essential parameters of permafrost. In this paper, it is shown how, and by combining research in three fields: (1) geophysical exploration, (2) numerical modeling, and (3) temperature logging, it is possible to estimate in-situ the porosity of permafrost. To demonstrate the procedure, five examples of numerical modeling (where all input parameters are specified) are given. This investigation is the first attempt to analyze the permafrost’s porosity in situ quantitively.

In hydraulic systems, energy dissipation can be significant. The pressure drops that can occur in the hydraulic circuit, influenced by the adopted drive architecture, result in an absorbed power often significantly greater than that required by the mechanical system. In this paper, a comparative study of energy efficiency among five drive common architectures in industrial hydraulic axes is carried out. The analysis is applied to a hydraulic blanking press with variable speed and force, a fairly frequent industrial system, e.g. in the production of semi-finished brass products. Standard, regenerative, high-low, variable displacement pump and variable speed drive for a fixed displacement pump configurations have been analysed and compared. An adequate and optimized sizing of the various components of the system has been carried out in each case and subsequently the energy consumption has been estimated for a load cycle common to all the considered cases. The results show that the choice of power generation architecture of the hydraulic system has a very significant impact on energy efficiency and consequently operating costs and carbon footprint. The performed quantification of the potential energy efficiency of the considered drive architectures can be very useful in guiding energy-conscious choices.

Incarceration negatively affects well-being and can shift an individual’s identity through labeling theory and prisonization. Seven incarcerated girls at a juvenile residential facility were administered self-esteem and life satisfaction questionnaires, and interviews were conducted to assess the impacts of incarceration on happiness and well-being. Afterwards, an eight-week music program was implemented. Results indicated that life satisfaction was significantly lower than self-esteem (p = .037), yet all participants expressed an optimistic outlook on their future in their interviews, sharing a desire to pursue further education. Participant feedback following the music program suggests positive impacts on their emotional state and well-being.

Cotton (Gossypium L.) is a major source of natural fibre for the world's textile industry and is also an important oil plant. Cotton fibre is the main source of textiles, the seeds are used for oil and the rest of the bagasse is a high-protein animal feed. In addition, more than 50 industries use cotton's so-called short fibre. Breeding studies in cotton are generally based on crosses between the best genotypes in terms of yield and fibre quality. However, the narrow genetic diversity of cultivars has a negative impact on cotton breeding programmes. For this reason, the identification of genetic resources and the disclosure of genetic diversity are important. Herein, high-resolution capillary gel electrophoresis was used to determine the genetic diversity of G. hirsutum and G. barbadense genotypes. Using 19 EST-SSR markers, a total of 47 genotypes were screened. The PIC values of the markers used ranged from 0.268 to 0.889. The mean PIC value was calculated to be 0.603. Concerning the clustering, PCoA and population structure analyses gave similar results, and the genotypes could be divided into 3 main groups. Genetic admixture with G. hirsutum was found in some genotypes of G. barbadense species. We can conclude that i) the EST-SSR markers used in this study are effective in the determination of genetic diversity, ii) The genetic diversity should be increased through the collection of genetic resources iii) genic EST-SSR markers in this study should be considered in breeding programmes by using them in QTL studies.

Background: Coexisting monozygotic twin molar pregnancies with a living second fetus are known in the literature, with various outcomes and treatment options. Methods: Clinical praesentation of two separate throphoblastic diseases that became directly conditioned. Results: A 33-year-old nuliparous woman, after autolog insemination one blastocysts with extremely high MoM free BHCG, and in the 17th week of pregnancy, bled profusely where ultrasound found a dilated cervix filled with a mass similar to molar tissue with intact second gestational sac. The gynecologists decided on a laparotomy, so they performed a corporeal hysterotomy at the 19th week of pregnancy. A year later, the patient became pregnant spontaneously with an orderly course of pregnancy until the 30th week. Due to the acute abdomen, an emergency caesarean section is indicated, and after the laparotomy, 1000 mL of fresh blood and clots are found with a 5 cm zone of cicatricial percretism. A freshly dead male newborn 1530 g/ 44 cm, without the effect of the resuscitation procedure. With regard to cicatricial percretism, the gynecologist on duty decides on a supracervical hysterectomy.; Conclusions: The treatment approach to molar pregnancy that influenced the outcome of the second pregnancy and the overall poor reproductive outcome is discussed.

We present a near real-time solution for 3D reconstruction from aerial images captured by consumer UAVs. Our core idea is to simplify the multi-view stereo problem into a series of two-view stereo matching problems. Our method applies to UAVs equipped with only one camera and does not require special stereo-capturing setups. We found that the neighboring two video frames taken by UAVs flying at a mid-to-high cruising altitude can be approximated as left and right views from a virtual stereo camera. Leveraging GPU-accelerated real-time stereo estimation, efficient PnP correspondence solving algorithms and extended Kalman filter, our system simultaneously predicts scene geometry and camera position/orientation from the virtual stereo cameras. Also, this method allows user selection of varying baseline lengths, which provides more flexibility given the trade-off between camera resolution, effective measuring distance, flight altitude, and mapping accuracy. Our method outputs dense point clouds at a constant speed of 25 frames per second and is validated on a variety of real-world datasets with satisfactory results.

In this paper, we consider the behavior of the local energy flow velocity of the fundamental air – core mode at the core – cladding boundary in two types of hollow – core fibers: hollow – core fibers with a negative curvature of the core boundary and single – capillary fibers with similar geometrical parameters. It is demonstrated that the behavior of both axial and radial components of the local energy velocity of the fundamental air – core mode is completely different for these two types of hollow – core fibers. The negative curvature of the core boundary leads to an alternating behavior of the radial projection of the local energy velocity and a decrease by two orders of magnitude compared to the values of this projection for a single capillary. In our opinion, this behavior of the local energy velocity of the fundamental air – core mode is caused by a periodic set of Poynting vector vortices that appear in the cladding capillary walls.

The issue of suitability of industrial hemp (IH) for large-scale European pulp mills, referred to in this study as EKPM mills, was discussed, taking into account the causal, cultivation, technological, and application aspects of this issue. The work showed that there are premises for the use of non-wood fibrous raw materials (NFRM) in these mills. As for the IH, it was found that IH stalks are the best IH FRM for EKMP. There are few cultivation factors (CF) favouring the use of IH stalks in them and few, though important (e.g., small cultivation areas), factors not conducive to this use. Most of the technological factors (TF) favour the use of IH in EKPM, apart from the large differences in the length of the IH bast and woody-core fibres. The analysis of application factors (AF) indicates lower usefulness of IH than wheat/rye/triticale straws, Miscanthus giganteus, Virginia mallow, and kenaf due to the much greater availability of these cereal straws than IH and less variation in fibre length of cereal straw, Miscanthus giganteus, Virginia mallow, and kenaf than in IH stalks. The presence of IH variety/ies with fibre lengths more similar to wood would reduce the number of TF and AF factors unfavourable to their use in EKPM.

The discovery of interesting inter-relationships between the different malaria epidemiological parameters is essential towards the disease control. However, existing associative rule-based machine learning algorithms for pattern discovery are slow while working on high-dimensional Malaria Indicator Survey (MIS) data, with the further challenge of data under fitting and inadequate result visualization. Hence, this work proposed a novel and efficient associative rule-based machine-learning algorithm with enhanced graphical visualization capacity for rigorous and confident biological result interpretation for malaria control. Through empirical and asymptotic comparative time-complexity performance evaluations, the proposed algorithm scaled better than other existing associative rule-based machine learning algorithms while maintaining its accuracy. The algorithm was applied to two real MIS data sets obtained from the Demographic and Health Survey repository and other supplementary literature source using Nigeria as a case study. The resulting interesting malaria epidemiological discovered novel trends were: a) the malaria disease might not be associated with the anemia symptom; b) there was no significant association between the anemia symptom and the wealth indices of individuals; c) there were other parameters associated with the insecticide resistance capacity of the malaria vector asides the knock down resistance alleles; d) the population dynamics of the malaria vector was not associated with the malaria disease endemicity. In conclusion, this work developed a computationally efficient and user-friendly associative rule-based machine-learning algorithm called E_Apriori for the control of the malaria disease.

The impacts of COVID-19 (Novel Coronavirus) epidemic cannot have been more severe, with the globe experiencing both economic and health crises. This study examines the trends and correlations in number of COVID-19-related deaths and number of COVID-19-infected patients in all 37 regions of Tamil Nadu state, India, in the month of August 2020 on the basis of panel regression model,

Plums are widely distributed in Türkiye and around the world. Different wild grown plum spe-cies such as Prunus spinosa, Prunus cerasifera and Prunus domestica shows abundance of different climatic zones in Türkiye. Seed propagated diverse plum trees has been growing Anatolia for centuries and fruits of wild plants has economic value. In this study a total of 8 wild grown blackthorn (Prunus spinosa) sampled from Ispir district of Erzurum province and subjected to morphological, biochemical and antioxidant characterization. Taste, aroma, and juiciness were used as the criteria for sensory analysis, and a trained panel of five experts established and evaluated the sensory characteristics of the fruits of the blackthorn. Fruit weight, fruit skin and flesh color as L*, a* and b* values were the main morphological parameters. For biochemical analysis, organic acids, SSC (Soluble Solid Content), vitamin C, total anthocyanins, total phenol-ic content and total antioxidant capacity were determined. Antioxidant capacity was determined by FRAP (ferric reducing antioxidant power) assay. Results indicated significant differences among genotypes. Fruit weight were found between 2.78-3.67 g. Skin L∗, a∗ and b∗ values were 13.11-16.12, 2.56-3.85 and 2.01-3.44, respectively. Flesh L∗, a∗ and b∗ values were in range of 17.45-20.37, 4.88-6.73 and 4.12-5.66, respectively. SSC content was ranged from 18.66% to 21.07%. The total phenolic content (TPC), total anthocyanin content (TAC) and ferric reducing antioxi-dant power (FRAP) were between 372-504 mg GAE/100 g; 53-72 mg cy-3-g eq./100 g and 107-134 mmol Fe (II) eq./g, respectively. The dominant organic acid was malic acid for all genotypes and varied from 1.04 g/100 g to 1.52 g/100 g fresh weight base. Results indicated the importance wild blackthorn fruits for human health.

Lipid peroxidation (LP) is the most important type of oxidative-radical damage in biological systems, owing to its interplay with ferroptosis and to its role in secondary damage to other biomolecules, such as proteins. The chemistry of LP and its biological consequences are reviewed with focus on the kinetics of the various processes, which helps understand the mechanisms and efficacy of antioxidant strategies. The main types of antioxidants are discussed in terms of structure-activity rationalization, with focus on mechanism and kinetics, as well as on their potential role in modulating ferroptosis. Phenols, pyri(mi)dinols, antioxidants based on heavy chalcogens (Se and Te), diarylamines, ascorbate and others are addressed, along with the latest unconventional antioxidant strategies based on the double-sided role of the superoxide/hydroperoxyl radical system.

The famous Wigner’s friend experiment considers an observer – the friend– and a superobserver – Wigner– who treats the friend as a quantum system and her interaction with other quantum systems as unitary dynamics. This is at odds with the friend describing this interaction via collapse dynamics, if she interacts with the quantum system in a way that she would consider a measurement. These different descriptions constitute the Wigner’s friend paradox. Extended Wigner’s friend experiments combine the original thought experiment with non-locality setups. This allows for deriving local friendliness inequalities, similar to Bell’s theorem, which can be violated for certain extended Wigner’s friend scenarios. A Wigner’s friend paradox and the violation of local friendliness inequalities require that no classical record exists, which reveals the result the friend observed during her measurement. Otherwise Wigner agrees with his friend’s description and no local friendliness inequality can be violated. In this article, I introduce classical communication between Wigner and his friend and discuss its effects on the simple as well as extended Wigner’s friend experiments. By controlling the properties of a (quasi) classical communication channel between Wigner and the friend one can regulate how much outcome information about the friend’s measurement is revealed. This gives a smooth transition between the paradoxical description and the possibility of violating local friendliness inequalities, on the one hand, and the effectively collapsed case, on the other hand.

In this article, we consider the relationship between the brain and the immune system in the context of the Orch OR (Orchestrated Objective Reduction) theory of consciousness. Orch OR is a theory that postulates that consciousness arises from quantum computations occurring inside microtubules. The immune system is capable of acquiring, learning, and remembering information, thus showing all the attributes of natural intelligence. We argue that the immune system also has the attribute of consciousness and can gain access to an amount of information greater than what is accessible to the brain since it is not constrained by brain's reducing valve that is responsible for cognitive bottlenecks. We also describe the role of meditation and religious chanting in affecting the brain and immune system. We speculate that some effects of religious chanting on the immune system may not be mediated by the brain. Finally, we examine the role of the immune system in connecting with the consciousness embedded in the universe.

Food and drinks can be contaminated with pollutants such as lead and strontium and this poses a serious danger to human health. For this reason, a number of effective sensors have been developed for the rapid and highly selective detection of such contaminants. TBA, a well-known aptamer developed to selectively target and thereby inhibit the protein of clinical interest -thrombin, is receiving increasing attention for sensing applications, particularly for the sensing of different cations. Indeed, TBA, in the presence of these cations, folds into the stable G-quadruplex structure. Furthermore, different cations produce small but significant changes in this structure that result in changes in the electrical responses that TBA can produce. In this article we produce an overview of the expected data regarding the use of TBA in the detection of lead and strontium, calculating the expected electrical response using different measurement techniques. Finally, we conclude that the TBA should perform better as a detector of strontium rather than lead.

The paper examines rational Darboux-Crum transforms (RDCTs) of the Jacobi-reference (JRef) potential on the line, with an emphasis on the transformations using only normalizable seed solutions. The Cooper-Ginocchio-Khare (CGK) potential constitutes the simplest example of this rich family of exactly solvable one-dimensional (1D) potentials. It was explicitly confirmed that that an arbitrary Darboux-Crum transformation (DCT) of the given Sturm-Liouville equation (SLE) can be represented as a chain of sequential Darboux deformations of the associated Liouville potentials. If the rational SLE (RSLE) under consideration is exactly solvable and the transformation function (TF) used at each step is nodeless then each RSLE constructed in such a way was proven being exactly solvable itself. The exact solvability of RDCTs of the JRef canonical SLE (CSLE) was also confirmed for the DCTs using pairs of juxtaposed eigenfunctions (an extension of the renowned Adler theorem to the RCSLEs of our interest). By re-expressing the reference polynomial fraction (RefPF) of the transformed CSLE in terms of the Krein determinant (KD), instead of Crum Wronskian (CW), it was shown that the eigenfunctions under consideration are expressible in terms of polynomial solutions of a generalized Heun equation with positions of the most poles dependent on the exponent parameters. The outlined technique was extended to two isospectral SUSY partners of the JRef potential (as well as to its third sibling with the inserted new lowest-energy level) which, by analogy with the CGK potential, are quantized by polynomial solutions of the 2-Heun equation with all four poles at some fixed positions on the real axis.

A method for studying properties of the earth's surface tremor, measured by means of GPS, is proposed. Four characteristics of tremor are considered: the entropy of the distribution of wavelet coefficients, the Donoho-Johnston wavelet index, and two estimates of the spectral slope. The anomalous areas of tremor are determined by estimating the probability densities of extreme values of the studied properties. The criteria for abnormal tremor behavior are based on the proximity to, or the difference between, tremor properties and white noise. The greatest deviation from the properties of white noise is characterized by entropy minima and spectral slope and DJ index maxima. This behavior of the tremor is called "active". The "passive" tremor behavior is characterized by the maximum proximity to the properties of white noise. The principal components approach provides weighted averaged density maps of these 2 variants of extreme distributions of parameters in a sliding time window of 3 years are considered. Singular points are the points of maximum average densities. The method is applied to the analysis of daily time series from a GPS network in the West USA in 2009-2022. It turned out that singular points of tremor form well-defined clusters.

The Harmonic Graphs Conjecture states that there exists an asymptotic relation involving the Harmonic Index and the natural logarithm as the order of the graph increases. This conjecture, grounded in the novel context of Prime Graphs, draws upon the Prime Number Theorem and the sum of divisors function to unveil a compelling asymptotic connection. By carefully expanding the definitions of the harmonic index and the sum of divisors function, and leveraging the prime number theorem's approximations, we establish a formula that captures this intricate relationship. This work is an effort to contribute to the advancement of graph theory, introducing a fresh lens through which graph connectivity can be explored. The synthesis of prime numbers and graph properties not only deepens our understanding of structural complexity but also paves the way for innovative research directions.

This article explores the transformative role of neural networks in the realm of biology, particularly within microscopy image processing and illustrations. Neural networks have revolutionized cell segmentation and analysis, enabling precise delineation of cell boundaries and tracking of cellular behaviours. They excel in detecting subcellular structures, unravelling intricate organelle interactions. In 3D image reconstruction, neural networks navigate volumetric datasets, enhancing our understanding of spatial cellular architecture. These networks enhance disease diagnosis by identifying anomalies and irregularities, potentially revolutionizing early detection and classification. Moreover, neural networks restore and enhance microscopy images, unveiling hidden details. Lastly, they bridge art and science, fostering captivating biological art and enriching science communication. As neural networks evolve, they promise a future of limitless possibilities, weaving together technology, science, and art to illuminate the microscopic realm in unprecedented ways.

We propose a description of the electromagnetic field in the form of a four-component complex spinor, from which a vector of electromagnetic potential with two degrees of freedom, calibrated by two conditions - zero length and zero component along the y-axis - is obtained by using Pauli matrices. A similar approach is applied to the field of a fermion, in particular, the electron. It is known that the quantum field of the electron and the electron itself is a four-component complex spinor, so, existing in the Minkowski vector space, we cannot observe it directly. But with the help of Pauli matrices a vector is formed from the electron spinor, which is known to us as an electric current vector, and this current vector describes exactly a single particle. As a vector, it is available to us for observation in our vector space. Similarly, the electromagnetic field and its photon particle is also a four-component spinor, from which the universal formula using Pauli matrices produces a vector, it is known to us as the electromagnetic potential vector, and it too describes even a single photon. All the differences in the properties of the current vector and the electromagnetic potential vector, and hence the electron and the electromagnetic field, are due only to a slight difference in the structures of their four-component spinors and inextricable linked to them momentum spinors and coordinate spinors. Expressions for the electric and magnetic fields of a photon during its interaction with an electron.Thus, a unified way to describe bosons and fermions in spinor space is proposed. Each spinor using the same formula corresponds to a vector, in the case of a fermion it is a current vector, in the case of a boson it is a vector, for example, of the electromagnetic potential. Each spinor of a field is matched with a spinor of coordinates and a spinor of momentum, which are transformed by the same Lorentz transformations and which have the same structure as their corresponding field spinor, that is, the momentum and coordinates of boson have a bosonic spinor structure, while momentum and coordinates of fermion are a spinor with a fermionic structure. Field, coordinates and momentum vectors of boson automatically have a zero length, while in the case of fermion they all have a nonzero length, so the fermion, in contrast to the boson, has a nonzero mass, nonzero charge and moves with a sub light speed.While quantum mechanics treats probability as a real number, quantum field theory deals with probability as a four-dimensional real vector. The place of the probability amplitude, which in quantum mechanics is a complex number, in quantum field theory is taken by a complex spinor.In the same way as in quantum mechanics the processes of propagation and interaction are described at the level of complex probability amplitudes, and the final result is translated into a real probability value, so in quantum field theory all processes should be described in terms of complex spinor space, and the result is translated into the form of a real vector in Minkowski space.The presented approach, at its proper development, makes it possible to carry out calculations of the interaction of particles in two-dimensional spinor space, and to interpret in terms of the Minkowski vector space only the final results.

Vertical III-V semiconductor nanowires have shown promising absorption of light for solar cell and photodetector applications. The absorption properties can be tuned through the choice of III-V materials and geometry of the nanowires. Here, we review recent progress in the design of the absorption properties of both individual nanowires and nanowire arrays. Future directions for the research field are proposed.

This paper introduces a novel algorithm for solving the point-to-point shortest path problem in a static regular 8-neighbor connectivity (G8) grid. This algorithm can be seen as a generalization of Hadlock algorithm to G8 grids, and is shown to be theoretically equivalent to the relaxed A* (RA*) algorithm in terms of the provided solution's path length, but with substantial time and memory savings, due to a completely different computation strategy, based on defining a set of lookup matrices. Through an experimental study on grid maps of various types and sizes (1290 runs on 43 maps), it is proven to be 2.25 times faster than RA* and 17 times faster than the original A*, in average. Moreover, it is more memory-efficient, since it does not need to store a G score matrix.

This paper explores the challenges of providing services of general interest in rural areas of Germany and proposes co-created mobility software solutions to address the specific needs of these regions. The research is part of the Smarte.Land.Regionen project, which aims to improve digital public services at the district level. Focusing on rural mobility, the paper introduces the concept of ride-sharing benches as a potential solution. Through workshops, surveys and market research, the study identifies barriers to the adoption of ride-sharing benches and investigates factors contributing to their success. The proposed software solution emphasizes user-centered development, geographic location of benches and prioritized matching of passengers. Findings highlight safety concerns, lack of reliability, and the importance of getting people who are theoretically interested in solutions to actively participate in them. The paper emphasizes the importance of collaborative development with county stakeholders. Future research should focus on sustaining and scaling digital solutions, measuring their impact on rural mobility, and ensuring their transferability to other regions. The ultimate goal is to contribute to inclusive and sustainable rural development by improving access to digital public services and promoting the adoption of tailored mobility solutions.

We present an analysis of recent experiments in femtoscopy by the STAR collaboration in terms of the protocol of entanglement witnessing involving purity measurements. The entanglement is between the charge and momentum degrees of freedom of pions and the state purity measurements ultimately rely on the bosonic nature of the detected pions. The pion experiment is intended to measure the size of nuclei and the distance between the nuclei involved, however it indirectly confirms that the states of dfferently charged pions are entangled through an entanglement witness based on the purity of various pionic states. The entangled state of pions can be modelled straightforwardly dynamically using a simple Hamiltonian. Quantum indistinguishability plays a key role in this analysis and we make comparison with the equivalent photonic experiments.

Amidst the transformative backdrop of the post-Covid-19 context, the researcher embarks on a qualitative exploratory study to investigate the intricate interplay of religiosity, educational engagement, and campus life among college students at St. Michael's College, Iligan City. Guided by a theoretical framework integrating Vygotsky's sociocultural theory, Fredricks et al.'s engagement theory, and Pascarella & Terenzini's educational impact theory, this study delves into the dynamic fruition of religiosity in response to the pandemic's impact. Employing purposeful and maximum variation sampling, the investigation unravels narratives from interviews, focus group discussions, and observations. Through thematic analysis, themes of "Adaptive Integration," "Religious Resilience," "Community Nexus," "Challenges of Synchronization," and "Identity Negotiation" emerge. In the discourse of these themes, strategies students employ to navigate challenges arising from this confluence are unearthed. Rooted in a deep understanding of the context, this study presents implications for fostering holistic growth within an inclusive educational environment. As the findings and insights are presented, stakeholders are invited to reimagine the role of religiosity, educational engagement, and campus life in shaping the holistic student experience in a world forever changed.

In the present work, the main methodologies used to reconstruct wind fields in the U-SPACE have been analyzed. The SESAR U-SPACE program aims to develop an Unmanned Traffic Management system with a progressive introduction of procedures and services designed to support a secure access to the air space for a large number of drones. The Italian Aerospace Research Center (CIRA) is carrying out the EDUS project focused on the development and validation of operating platform demonstrators serving the micro-scale weather forecasts and the collection of information necessary for the definition of the flight plan of the drones in urban contexts. For this reason, the state of art methodologies that can be used to estimate winds at low altitudes in urban areas starting from available observational data have been reviewed in the present paper. Some of these techniques were originally developed for reconstruction at high altitudes, but successively adapted to treat different heights. A common approach to all techniques is to approximate the probabilistic distribution of wind speed over time with some parametric models, apply spatial interpolation to the parameters and then read the predicted value.

This scoping review examines global strategies and enterprises for sustainable solid waste management, with a focus on alternative landfilling approaches. The study collected and analyzed a significant number of documents from different regions, revealing Asia as the major contributor (for the collected documents) (48.7%), followed by North America (24.3%) and Europe (15.8%). Recycling emerged as the most effective alternative waste treatment method, representing 52.3% of the documented approaches, with industrial recycling (22.6%) and residential/non-residential recycling (20.2%) as prominent categories. Food waste was a significant concern across regions, constituting 21.4% of the collected documents. Composting was widely adopted (15.4%) due to its simplicity and benefits for gardening and soil improvement. Other methods like biogas extraction, reusing, raising awareness, incinerating, redistributing, reducing, and fermentation accounted for 13.1% cumulatively. The study highlights the need for tailored waste management solutions based on regional challenges and successful practices. Promoting recycling infrastructure, composting, and waste reduction approaches are crucial to achieving sustainable waste management aligned with SDGs. Collaboration and knowledge-sharing between regions are essential to improve inefficient waste management mechanisms. Integrating the findings into policymaking and industry practices can lead to a more sustainable future with reduced environmental impact.

How to disentangle the possible genuine quenching of gA caused by scale anomaly of QCD parameterized by the scale-symmetry-breaking quenching factor qssb from nuclear correlation effects is described. This is done by matching the Fermi-liquid xed (FLFP) point theory to the "Extreme Single Particle (shell) Model" (acronym ESPM) in superallowed Gamow-Teller transitions in heavy doubly-magic shell nuclei. The recently experimentally observed indication for (1-qssb) ≠0 - that one might identify as "fundamental quenching (FQ)" - in certain experiments seems to be alarmingly signicant. I present arguments how symmetries hidden in the matter-free vacuum can emerge and suppress such FQ in strong nuclear correlations. How to conrm or refute this observation is discussed in terms of the superallowed Gamow-Teller transition in the doubly-magic nucleus 100Sn and in the spectral shape in the multifold forbidden β decay of 115In.

Self-efficacy and perfectionism play an important role in high-performance activities. This cross-sectional study analyses the relationship between these constructs and resilience in a sample of 145 music students (57.9% female) with a mean age of 27.77 years. Perfectionism was assessed using the Multidimensional Inventory of Perfectionism in Sport, resilience using the Resilience Scale, and self-efficacy using the General Self-Efficacy Scale. Compared to those with low resilience, students with high resilience score higher on self-efficacy and lower on dysfunctional perfectionism. No differences were observed in the total perfectionism score or adaptive perfectionism. Self-efficacy shows significant predictive power for resilience (β = .525, p < .001). Although functional perfectionism did not significantly predict resilience, a marginal negative relationship was found between dysfunctional perfectionism and resilience (β = - .156, p = .063). The results are discussed concerning their implications for music pedagogy and teacher intervention.

RF photonic transversal signal processors, which combine reconfigurable electrical digital signal processing and high-bandwidth photonic processing, provide a powerful solution for achieving adaptive high-speed information processing. Recent progress in optical microcomb technology provides compelling multi-wavelength sources with compact footprint, yielding a variety of microcomb-based RF photonic transversal signal processors implemented by either discrete or integrated components. Although operating based on the same principle, processors in these two forms exhibit distinct performance. This letter presents a comparative investigation into their performance. First, we compare the performance of state-of-the-art processors, focusing on the processing accuracy. Next, we analyze various factors that contribute to the performance differences, including tap number and imperfect response of experimental components. Finally, we discuss the potential for future improvement. These results provide a comprehensive comparison of microcomb-based RF photonic transversal signal processors implemented using discrete and integrated components and provide insights for their future development.

As a rapidly expanding family of two-dimensional (2D) materials, MXenes have recently gained considerable attention due to their appealing properties. Here, by developing a solution-based coating method that enables transfer-free and layer-by-layer film coating, we investigate the layer-dependent nonlinear optical absorption of Ti₃C₂T_x films ‒ an important member of the MXene family. By using the Z-scan technique, we characterize the nonlinear absorption of the prepared MXene films consisting of different numbers of monolayers. The results show that there is a strong and layer-dependent nonlinear absorption behavior, transitioning from revisable saturable absorption (RSA) to saturable absorption (SA) as the layer number increases from 5 to 30. Notably, the nonlinear absorption coefficient β varies significantly within this range, changing from ~7.13 × 10² cm/GW to ~-2.69 × 10² cm/GW. We also characterize the power-dependent nonlinear absorption of the MXene films at various incident laser intensities, and a decreasing trend in β is observed for increasing laser intensity. These results reveal the intriguing layer-dependent nonlinear optical properties of 2D MXene films, highlighting their versatility and potential for implementing high-performance nonlinear photonic devices.

Long Covid is a heterogeneous clinical condition in which Myalgic Encephalomyelitis/Chronic Fatigue Syndrome (ME/CFS) and brain fog stand out among the different clinical symptoms and syndromes. The cerebral metabolic alterations and neuroendocrine disorders seem to constitute an important part of Long Covid. Given the substantial lack of drugs and effective therapeutic strategies, hypothalamic phospholipid liposomes which have been on the market for several years as adjuvant therapy of cerebral metabolic alterations resulting from neuroendocrine disorders, can be taken into consideration in an overall therapeutic strategy that aims to control the Long Covid associated symptoms and syndromes. Their pharmacological mechanisms and clinical effects strongly support their usefulness in Long Covid. Our initial clinical experience corroborates this rationale. Further research is imperative in order to obtain robust clinical evidence.

The invariant mass of free particles is used to derive a bound-state equation for several particle atomic systems at rest. This relativistic-kinematic bound-state equation is applied to the hydrogen and helium atoms. The derived equation has the well-known solutions for the single-electron bound states of the hydrogen atom, and the two-electron states of the helium atom. For the hydrogen atom, existence of the two-particle bound states, for which the electron and the proton kinetic energies are of the same order of magnitude, is predicted. The three-particle bound states with the same feature of the kinetic energies can exist in the helium atom. Radiative operators for processes involving the hydrogen two-particle bound states, are obtained. It is discussed that these new two- and three-particle bound states should be optically inactive.

This review describes and discusses unusual axonal structural details and evidence for unmasking of sulfhydryl groups (-SH) in axoplasmic membranes resulting from electrical stimulation or asphyxia. Crayfish axons contain fenestrated septa (FS) that in phase contrast micrographs appear as repeated striations. In the electron microscope each septum is made of two cross-sectioned membranes containing ~550 Å pores, each occupied by a microtubule. Thin filaments, likely to be made of kinesin, bridge the microtubule to the edge of the pore. FS are believed to play a role in axoplasmic flow. The axons also display areas in which axon and sheath-glial cell plasma membranes are sharply curved and project into the axoplasm. In freeze-fractures, the protoplasmic leaflet (P-face) of the projections appears as elongated indentations containing parallel chains of particles. The sheath-glial cell plasma membrane also contains particles, but they are irregularly aggregated. The axons also display areas where axonal and glial plasma membranes fuse, creating intercellular pores. In axons fixed during electrical stimulation the plasma membrane, the outer membrane of mitochondria, membranes of other cytoplasmic organelles and gap junctions increase in electron opacity and thickness, resulting from unmasking of sulfhydryl groups (-SH). Similar changes occur in asphyxiated nerve cords.

Preferentially expressed Antigen in Melanoma (PRAME) is a cancer testis antigen (CTA) that is selectively expressed in certain somatic tissues, predominantly in the testis and is overexpressed in various cancers. PRAME family proteins are leucine rich repeat proteins, that are localized in the nucleus and cytoplasm, with multifaceted roles in immunity, during gametogenesis and in the overall reproduction process. It is a widely studied CTA and has been associated with the prognosis and therapeutic outcome in patients with epithelial and non-epithelial tumors. PRAME has also been studied extensively as a therapeutic target. Moreover, it has been found to play a role in most of the well-known cancer hallmarks. Interestingly, the role of PRAME in tumorigenesis is paradoxical. Over the last decade, PRAME has garnered substantial interest as a target for immunotherapy. There are multiple clinical trials and pre-clinical studies targeting PRAME alone or in combination with other tumor antigens. This review article is an attempt to update our knowledge and understanding of the context-dependent oncogenic functions of PRAME in various carcinomas, and the current immunotherapeutic strategies, challenges, and perspectives on developing newer strategies to target PRAME for a better outcome.

The center of mass dynamics of human seated posture in a work environment under hypogravity (0<g<1) have rarely been investigated and it remains to be accomplished. The present study determined the difference in the body system of 32 participants working under simulated 1/6g (Moon) and 1g (Earth) for comparison reason using static and dynamic action measurements. This was based on analyzing the participant's center of mass before, during, and after the task when they started to get fatigued. According to this analysis, there is a positive relation (p<0.01) with a positive coefficient of correlation between CoM body shift down along the Y axis and gravity level for males and females. At the same time, the same positive relationship (p<0.01) between the tilt of the body back along the Z axis and the level of gravity was found only in females. This offers fresh perspectives for comprehending hypogravity. It can also improve workplace ergonomics, body stability, equipment design, and biomechanics.

This article presents a study on brain tumor detection using the VGG-16 model, a convolutional neural network known for its performance in computer vision tasks. The aim of the study is to classify magnetic resonance imaging (MRI) images and accurately identify the presence of brain tumors. The dataset used consists of brain tumor MRI images, categorized into two classes: "NO" (no tumor) and "YES" (tumor). The methodology involves setting up the environment, importing and preprocessing the data, building the VGG-16 model, and evaluating its performance using metrics such as accuracy, precision, and recall. The results demonstrate an accuracy of approximately 88% on the validation set and 80% on the test set, indicating the potential of the VGG-16 model in supporting healthcare professionals in diagnosing brain tumors. The study contributes to the field of medical image analysis and offers insights into the application of deep learning for brain tumor detection.

A review is given of the experimental values of the magnetic hyperfine structure and the Bohr-Weisskopf effect in muonic atoms. The need for more measurements and systematic calculations is discussed in the light of distinguishing between different models of the Bohr-Weisskopf effect in nuclei.

TThis paper delves into the extension and characterization of radial positive definite functions into non-integer dimensions. We provide a thorough investigation by employing the Riemann-Liouville fractional integral and fractional Caputo derivatives, enabling a comprehensive understanding of these functions. Additionally, we introduce a secondary characterization based on the Bernstein characterization of completely monotone functions. The practical significance of our study is showcased through an examination of the positivity of the fundamental solution of the space-fractional Bessel diffusion equation, highlighting the real-world applicability of the developed concepts. Through this work, we contribute to the broader understanding of radial positive definite functions and their utility in diverse mathematical and applied contexts.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Today electricity is distributed to the individual users via physical Copper connections. From the power stations, the energy is transported through transmission lines where the electricity, sinusoidally modulated at a fixed frequency of about 50 Hz, is raised up to a voltage in a range approximately variating between 30, and 110 kV. When electrons, aligned at this voltage, pass through the transmission lines, they cause coherent vibrations, sometimes even audible in the acoustic frequencies. In the spectrum of movements to which electric cables are subjected, there are also unexpected and sporadic movements caused by winds and rain. The problem of carrying out persistent, precise and spatially distributed monitoring of transmission line health is to use a large number of sensors physically distributed everywhere and somehow transmit the results to a control station. The use of synthetic aperture radar (SAR) data could be a viable solution of persistent and wide-area high-voltage vibration monitoring. In this paper we produce a comprehensive survey on how to monitor both movements in terms of vibrational displacement, due to weathering, and those due to electricity transmission, normally fixed at about 50 Hz. The results demonstrate the technical feasibility of an operational use of SAR for these purposes in the very short term. This would allow the possibility of monitoring malfunctions such as black-outs or other frequency anomalies.

Scientists are gradually becoming aware of the challenges in the understanding of the very root mechanisms of massively parallel computations that are observed in literally all scientific disciplines ranging from cosmology, physics, across chemistry, biochemistry, and ending in biology. This leads us to the main motivation and simultaneously to the central thesis of this review: “Can we design artificial, massively-parallel, self-organized, emergent, error-resilient, computational environments?” A large number of simulations along with examples and counter-examples, finalized by a list of the future directions, are giving hints and partial answers to the main thesis. This all together is opening the crucial question whether there is existing a deeper, beyond the Turing machine theoretical description of massively-parallel computing. Important information dealing with this topic is reviewed along with highly expressive animations generated by the open-source, Python software GoL-N24. The perspective, future directions including applications in robotics and biology of this research are discussed in the light of known information.

In this paper, we classify the function space of all real-valued functions on R denoted as F(R,R) into 28 distinct blocks. Each block contains elements that share common features in terms of the cardinality of their sets of continuity and differentiability. Alongside this classification, we introduce the concept of the Connection, which reveals a special relationship structure between four well-known real-valued functions in real analysis: the Cantor function, Dirichlet function, the Thomae function, and the Weierstrass function. Despite the significance of this field, several perspectives remain unexplored.

The refractive index of solids guages their transparency to incident light, while the energy gap determines the threshold for light absorption. This paper provides a mathematical formulation for the relationship between refractive index and energy gap. It is also established that this formulation aided in the unification of the Moss, Ravindra, and Herve-Vandamme relationships.

This paper contextualises the common queries of "why is crypto crashing?" and "why is crypto down?", the research transcends beyond the frequent market fluctuations to unravel how cryptocurrencies fundamentally work and the step-by-step process on how to create a cryptocurrency. The study examines blockchain technologies and their pivotal role in the evolving Metaverse, shedding light on topics such as how to invest in cryptocurrency, the mechanics behind crypto mining, and strategies to effectively buy and trade cryptocurrencies. Through an interdisciplinary approach, the research transitions from the fundamental principles of fintech investment strategies to the overarching implications of blockchain within the Metaverse. Alongside exploring machine learning potentials in financial sectors and risk assessment methodologies, the study critically assesses whether developed or developing nations are poised to reap greater benefits from these technologies. Moreover, it probes into both enduring and dubious crypto projects, drawing a distinct line between genuine blockchain applications and Ponzi-like schemes. The conclusion resolutely affirms the continuing dominance of blockchain technologies, underlined by a profound exploration of their intrinsic value and a reflective commentary by the author on the potential risks confronting individual investors.

G-protein-coupled receptors (GPCRs) are ubiquitous sensors and regulators of cellular functions. Each GPCR exists in complex aggregates with multiple resting and active conformations. Designed to detect weak stimuli, GPCRs can also activate spontaneously, resulting in basal ligand-free signaling. Agonists trigger a cascade of events leading to an activate agonist-receptor-G protein complex with high agonist affinity. However, the ensuing signaling process can further remodel the receptor complex to reduce agonist affinity, causing rapid ligand dissociation. The acutely activated ligand-free receptor can continue signaling, as proposed for rhodopsin and  opioid receptors, resulting in robust receptor activation at low agonist occupancy with enhanced agonist potency. Continued receptor stimulation can further modify the receptor complex, regulating sustained ligand-free signaling - proposed to play a role in opioid dependence. Basal, acutely agonist-triggered, and sustained elevated ligand-free signaling could each have distinct functions, reflecting multi-state conformations of GPCRs. This review addresses basal and stimulus-activated ligand-free signaling, its regulation, genetic factors, and pharmacological implications, focusing on opioid and serotonin receptors, and the growth hormone secretagogue receptor (GHSR). Ligand-free signaling of intracellular 5-HT2A receptors could mediate therapeutic effects of psychedelic drugs. Research avenues are suggested to close gaps in our knowledge of ligand-free GPCR signaling.

Innovation and technology are important tools of minerals sector efficiency and productivity im-provement. The uptake of technologies has proven important levelrs to improve the productivity of mining sector. This paper provides a comprehensive analysis of mine-level productivity by using a global data of copper, gold, and platinum from 1991-2020. Various drivers of proioductivity have been analysed to draw policy insights. Empirical findings reveal significant disparities in technical efficiency and productivity across mines and regions. A further decomposition of TFP into its different components suggest that the adoption of innovative practices and investment in technology adoption could improve the overall productivity of these commodities. The findings also suggest that an appropriate input mix and optimal scale of production could boost platinum mining productivity. Regional disparities in productivity in different commodities (e.g., South Africa vs. Zimbabwe) give policymakers with insights into how to support production scale and productivity through appropriate input mixtures.

Exogenous proteases are well established for hydrolysing proteins and improving the digestibility of amino acids, which, in animal production, enhances growth performance and diet formulation flexibility. Attention has now turned to the wider, or ‘extra-proteinaceous’, benefits of proteases. Both host and (gut) microbiome utilise amino acids for diverse functions beyond just cellular growth and proliferation. For example, the host produces a diverse array of proteinaceous secretions that seek to modulate the activity of the intestinal microbiome and opportunities to interact with host (e.g., epithelial) receptors. Reciprocally, the microbiome utilises various protein-based components to perform individual lifestyle traits, such as colonising gut niches, production of virulence traits, etc., which can be influenced by protease activity and amino acid availability. In addition, microbial fermentation of proteins and amino acids produces metabolites that may be considered undesirable (e.g., toxic) for the host’s cells or, for example, can act as signalling molecules, shaping the secretion of gut hormones and function. Parallels may also exist between various antibiotic growth promoters and proteases, in that both can target/impact microbial proteins (synthesis and degradation, respectively). There are many aspects to consider, such as determining optimal intestinal levels and spectra of proteolytic activity under various scenarios, but great potential exists.

Due to the incomplete of China's current social security system, health shocks are one of the main risks faced by rural families. Using data from the 2019 China Household Finance Survey, we examined the impact of borrowing on household welfare when rural households face health shocks. We found that household income and food expenditure both declined significantly when rural households faced health shocks; rural household borrowing was mainly used for the treatment of the diseases, and it had a crowding out effect on tourism and general health care expenditures, but not on education expenditures. We also found that the impact of borrowing on the western region was higher than that on the central and eastern regions from Looking at the impact of borrowing in different regions. Finally, we put forward some suggestions for promoting sustainable rural development from the perspective of medical security, such as accelerating the promotion of new rural medical insurance, helping rural low-income families improve health benefits, establishing diversified financing channels, improving rural financial platforms, and solving the financing difficulties of households to improve the ability of rural households to resist health shocks.

Interferons were the original prototype cytokine system discovered in 20th-century research. As the name implies, they were originally thought to be synthesised and secreted between cells. Thanks to technological advances, the processes involved in protein secretion can be explained comparatively more clearly at both the genetic and biochemical levels. The discovery of interferon (IFN) occurred when genetic research was still in its infancy. Franklin and Wilkins discovered the structure and function of deoxyribonucleic acid (DNA) at the same time as Crick and Watson; however, Isaacs and Lindemann, two scientists, described the first IFN in 1957. Mutations can be caused by inherent genetic protein synthesis and during infection as well as within IFN regulation pathways affecting cell proliferation. This remains central to host cell IFN synthesis and effects through IFN protein receptor subunits defined by 6 protein domains. Type II IFN is key to immune cell function secreted by a variety of immune cells, mainly natural killer (NK) as well as T cells. Single–stranded and/or double–stranded RNA/DNA viruses, as well as bacterial infections (e.g., Escherichia coli) and fungal infections (e.g., Aspergillus), also affect IFN regulation. Pathogenic proteins utilise intra/extracellular proteins that sense foreign antigens like Toll–like Receptors (TLRs), affected by mutations within the human cellular IFN transduction pathways. Since the discovery of the third IFN type in 2003, when immune cell phenotypes were further characterised, questions remain about the immunological mechanisms contributing to the regulation of the innate and adaptive host immune system. Alterations in the synthesis of type I/II/III host IFNs can differentially and beneficially alter homeostatic cellular pathways in pathological disease, with type I IFN being synthesised in cancer as well as by homeostatic cells. Therefore, considered here are the overall IFN molecular, cell regulatory mechanisms in the context of immune cell research developments.

The COVID-19 virus is spread to the respiratory system by minute airborne particles in contrast to large particle fomite transmission. Yet, an often-repeated health directive during the COVID-19 pandemic was to improve handwashing to limit the spread of the virus. Persistent handwashing can aggravate obsessive-compulsive disorder (OCD), diminishing mental health. Given that handwashing is unlikely to control the spread of COVID-19, it is pertinent to determine if the directive for handwashing to eradicate the COVID-19 virus increased the incidence of OCD and, as such, promoted negative mental health. This scoping review of the parameter, “handwashing, mental health, COVID-19, OCD”, conducted during July 2023, searched six relevant databases. The result was that negative mental health related to increased handwashing was evident both for those already diagnosed with OCD and regarding new cases of OCD throughout the duration of the pandemic. The conclusion is that health officials should update details of their health directives as information becomes available during a pandemic and, concerning COVID-19, the directive to concentrate on handwashing should have been relaxed once it was known that spread of the virus by fomite transmission was improbable. This likely would have reduced the incidence of OCD and improved mental health.

The quest to comprehend the nature of consciousness has spurred the development of many theories that seek to explain its underlying mechanisms and account for its neural correlates. In this paper, I compare my own conscious electromagnetic information field (cemi field) theory with integrated information theory and global workspace theory for their ability to ‘carve nature at its joints’ in the sense of predicting the entities, structures, states and dynamics that are conventionally recognized as being conscious or nonconscious. I demonstrate the cemi field theory shares features with both integrated information theory and global workspace theory but consistently outperforms both by correctly predicting the entities, structures, states and dynamics that support consciousness. I argue that the simplest solution to the question of why cemi field theory consistently outperforms rival theories of consciousness is that the brain’s EM field is consciousness.

This article deals with the governance of common goods within regeneration projects of UNESCO heritage sites. The main objective is to evaluate the existence of conditions that prove the con-temporary function of common goods as drivers of strategic regeneration of complex territories with high cultural value. The research identifies some of the strategic planning policies implemented for the historical centre of Naples and analyses their proactive function in the enhancement, conser-vation and reuse of built commons. The expected result is to contribute to the debate on the cultural planning of the territory, aimed at the diversification of services and the fight against the process of touristisation. Through desk research and consultation of primary sources, a brief outline is given of the historical process that led to the birth of the "Great UNESCO Project" in the historical centre of Naples. The paper then analyses the "Discipline of the common goods - Principles for the govern-ance and management of the commons in the city of Naples", defining its addresses, opportunities and limitations as a contribution to relational, oriented and sustainable strategic territorial planning.

When two black holes form a binary system, each black hole observes an event horizon and a curved distorted space-time region around the other black hole. In this space-time, two such regions are formed, and another black hole forms in the second region from the initial black hole, which may be termed the “image” of the first black hole. The same event occurs for the other black hole also, and an extra image of it is formed. In these conditions, the energy of the system divides between the two black holes and their images. These four new black holes that are formed interact with each other again and produce new horizons and new distorted regions. Each black hole produces an image of all the other black holes and detects the background of six black holes instead of three. Consequently, for four black holes, 24 new black holes arise. The energy of the system will be divided amongst all 24 black holes. This story continues and black holes interact with one another and produce new images. Finally, very light black holes are formed each of which is so weak that it cannot produce strong distortions of space-time. The radiated gravitational waves from these weak black holes could be detected by LIGO as well as the signature of these binary black holes. However, detected waves are only a part of very strong gravitational waves. Each time a part of these waves escapes from the system and reaches the earth, they may be regarded as emitted waves from a new binary black hole. The time between radiated signals decreases, and it may be interpreted that a new supermassive binary black hole is radiating. If radiated signals combine, an explosion of the very strong binary system could be detected.

This paper considers the problem of predicting earthquakes. It uses a small amount of information to create a descriptive key that can be used as a footprint to describe an event. A frequency grid clusters events that occurred at the same time and then the algorithm averages the history of these events over preceding days, in particular the gaps when the events did not occur. The gaps are measured for the clustered events only and can be used to create a description that is quite unique. Results suggest that seismic events can in fact be traced using this key and subsequently recognised again, if the same conditions reoccur. They also suggest that force direction may be more important than magnitude, for this type of earthquake. Greek and USA datasets have been looked at and the prediction accuracy can be 70% or better. The author therefore suggests that this is an interesting method that deserves attention.

The concept of an economy that is circular and without the need for material or energy input has an irresistible appeal to those who have recognized that planetary boundaries exist and that resources are not unlimited. Thus, in the public discourse its narrative outperforms other lines of arguments when it comes to keeping radical critics of destructive extractivism and the growth imperative in check and averting the uptake of diverging opinions by larger segments of the population and government bodies. Moreover, the myth of a circular economy has the additional benefit that it can win over parts of the environmental movement that dread radical and transformative change, particularly in the urban milieus of a middle-class that enjoys the privileges of the current social order. In this paper I argue that the circular economy narrative tends to hinder the necessary systemic transformation while entailing a wide range of specific measures that deserve to be recognized for their merit.

Type 2 diabetes mellitus (T2DM) is a chronic metabolic disorder characterized by elevated blood glucose levels. Despite the availability of pharmacological treatments, dietary plans, and exercise regimens, T2DM remains a significant global cause of mortality. Consequently, there is a growing interest in exploring lifestyle interventions, such as Intermittent Fasting (IF). This study aims to identify underlying patterns and principles for effectively improving T2DM risk parameters through IF. By analyzing data from multiple randomized clinical trials investigating various IF interventions in humans, a machine learning algorithm was employed to develop a personalized recommendation system. This system advises pre-diabetic and diabetic individuals on the most suitable IF interventions to improve T2DM risk parameters. With a success rate of 95%, this recommendation system offers highly tailored guidance, optimizing intermittent fasting's benefits for diverse population subgroups. The results of this study allow us to conclude that weight is the crucial feature for females, while age is the determining factor for males to reduce glucose levels in blood. By revealing patterns in diabetes risk parameters among individuals, this study not only provides practical guidance but also sheds light on the underlying mechanisms of T2DM, contributing to a deeper understanding of this complex metabolic disorder.

A method for studying properties of the earth's surface tremor, measured by means of GPS, is proposed. Four characteristics of tremor are considered: the entropy of the distribution of wavelet coefficients, the Donoho-Johnston wavelet index, and two estimates of the spectral slope. The anomalous areas of tremor are determined by estimating the probability densities of extreme values of the studied properties. The criteria for abnormal tremor behavior are based on the proximity to, or the difference between, tremor properties and white noise. The greatest deviation from the properties of white noise is characterized by entropy minima and spectral slope and DJ index maxima. This behavior of the tremor is called "active". The "passive" tremor behavior is characterized by the maximum proximity to the properties of white noise. The principal components approach provides weighted averaged density maps of these 2 variants of extreme distributions of parameters in a sliding time window of 3 years are considered. Singular points are the points of maximum average densities. The method is applied to the analysis of daily time series from a GPS network in the West USA in 2009-2022. It turned out that singular points of tremor form well-defined clusters.

This article studies electrostatic fields and potentials in the presence of conductors and point charges under the framework of solving Laplace’s equation with specifi ed boundary conditions. The results demonstrate that many problems posed and solved in elementary electrostatics through various heuristics such as the method of images, can be more rigorously treated under the solution framework of Laplace’s equation.

The recently discovered Gaia BH1 binary system, a Sun-like star and a dark object (presumably a black hole), may significantly change our understanding of the population of low-q binaries. The paper presents the components mass ratio distributions of binary systems of different observational classes. They all demonstrate a significant shortage of low-q systems. It is shown that this shortage can be filled with the help of search and study of objects like Gaia BH1.

The question of whether some neutrinos are tachyons remains unresolved although various evidence from cosmic ray and other data exists that the electron neutrino has an effective $m_\nu^2\approx -0.25 eV^2,$ which would require that one or more mass states is also tachyonic. In 2013 the $3+3$ model of the neutrino masses, which includes one tachyonic mass state, was proposed based on supernova SN 1987A neutrino data. Here we update evidence for tachyonic electron neutrinos and the $3+3$ model and discuss one test which could prove conclusive. The update of earlier evidence includes many new elements, including new data which makes the earlier cosmic ray evidence more robust, new results on cosmic ray composition, the ankle of the spectrum, leptonic cosmic ray data, and the statistical significance of finding the three large neutrino masses stipulated in the $3+3$ model. Barring a galactic supernova, which occur only around twice a century, a decisive test of the $3+3$ model could involve observing an extragalactic supernova neutrino burst, that is a cluster of neutrinos in a specific time window well beyond what chance would predict. Even though existing searches for such bursts have yielded only upper limits on the extragalactic supernova frequency within a certain distance, it is shown that the choice of a one-day window for possible neutrino clusters in time might be far more sensitive. A search using a one day time window could be done using existing data, and if a signal is found it would confirm the $3+3$ model. Of course, the absence of any day-long neutrino burst would not disprove the model, since it could mean only that the nearest supernova during the period when detectors were active was simply too far to be detected. Finally, apart from testing the 3 + 3 model, an alternative type of search is suggested using existing hadronic cosmic ray data (from the IceCube Collaboration) that might verify the tachyonic neutrino hypothesis.

Recently, some authors have claimed that we may live in one of a pair of universes in which one is expanding receding from the Big Bang and its partner is contracting and moving towards the Big Bang. We show that near a black hole binary system, this event may be occurring. If we suppose that there is a N dimensional brane which contains many smaller k dimensional branes and black holes, there is a possibility that the curved space times near black holes act like mirrors. This is because these space-times contain two regions such that the branes in the one region have opposite quantum numbers with respect to the branes in the other region. Also, if branes in one region are expanding and go away from a point state and the Big Bang, anti-branes in the other region are contracting and moving towards the point state and the Big Bang. If black holes join and form a binary system, then their states become similar to two mirrors that are facing each other and producing many images themselves of smaller branes and even black holes in the binary system. Summing over all branes and images give the CPT system. Dark energy could be a result of the images of observed matter. Comparing the masses of the observed objects and dark energy, the angle between cosmic mirrors like black hole binary systems could be determined.

The forehead and temporal region are a frequent area of skin cancer development. After tumor removal, reconstruction must be performed maintaining the frontal-temporal line of the scalp and the symmetry of the eyebrows, trying to hide the scars in these marks or in natural folds and wrinkles. Second wound healing and skin grafts generally do not produce an acceptable cosmetic result. When direct closure is not possible, the technique of choice is skin flaps. In the midfrontal line, continuation of the glabella, there is a remnant of skin to be used as a donor area for local flaps; similarly, it occurs in the preauricular cheek, which can move towards the temple. In addition to the classic advancement and rotation flaps, the frontalis myocutaneous transposition flap is an excellent technique for closing defects which are wider than higher on the forehead. Its design is very versatile and can be done between the two pupil lines at different heights depending on the location of the defect. On the other hand, the preauricular skin advancement flap with an infralobular Burow's triangle is also an excellent option for reconstructing tumors in the temporal area.

In this research, the application of the Physics-Informed Neural Network (PINN) model is explored to solve transport equation-based Partial Differential Equations (PDEs). The primary objective is to analyze the impact of different activation functions incorporated within the PINN model on its predictive performance, specifically assessing the Mean Squared Error (MSE) and Mean Absolute Error (MAE). The dataset used in the study consists of a varied set of input parameters related to strut diameter, unit cell size, and the corresponding yield stress values. Through this investigation, the aim is to understand the effectiveness of the PINN model and the significance of choosing appropriate activation functions for solving complex PDEs in real-world applications. The outcomes suggest that the choice of activation function may have minimal influence on the model's predictive accuracy for this particular problem. The PINN model showcases exceptional generalization capabilities, indicating its capacity to avoid overfitting with the provided dataset. The research underscores the importance of striking a balance between performance and computational efficiency while selecting an activation function for specific real-world applications. These valuable findings contribute to advancing the understanding and potential adoption of PINN as an effective tool for solving challenging PDEs in diverse scientific and engineering domains.

G4v is a four-vector theory of gravitation proposed by Mead (2015, 2023a,b) which reinterprets several major results commonly celebrated for the tensor-based approach of General Relativity (GR). Here, we show that G4v obeys the correspondence principle, an important test of any relativistic theory. We derive the non-relativistic Lagrangian and Energy expressions at the limit of low speeds and potentials, complete with the correct terms for potential energy (something traditional Special Relativity is incapable of achieving). G4v could represent a new interpretation of the gravitational field with essentially the same mathematics as electromagnetism (Mead 2023a). It is also possible to interpret G4v as a very interesting (and useful) approximation of the Einstein field equations (Mead 2023b).

Background: Psoriasis is a chronic immune-mediated skin disease in which systemic inflammation plays an important role in the pathogenesis. In recent years, neutrophil-to-lymphocyte ratio (NLR), neutrophil-to-monocyte ratio (NMR), platelet-to-lymphocyte ratio (PLR), and systemic immune-inflammation index (SII) have been shown to be important indicators of inflammation. In this study, our aim is to investigate NLR, NMR, PLR, and SII levels in psoriasis patients treated with biologic agents. Method: Clinical and biochemical data of 209 patients who received systemic therapy for psoriasis were obtained by retrospectively reviewing their medical records. NLR, NMR, PLR, and SII values were calculated from the hemogram values of the patients. Results: In the third month of follow-up, the mean CRP, NLR, NMR, PLR, and SII values were significantly decreased compared to the baseline values. SII values showed strong positive correlations with NLR, NMR and PLR. Adalimumab, etanercept, and infliximab, which are TNF-α blockers, were observed to be more effective on PLR and NLR and especially NMR. Conclusion: NLR, NMR, PLR, and SII, which are data obtained from routine blood tests, can be used in the monitoring of treatment of psoriasis, especially with TNF- α blockers.

In this study, a new approach to pesticide permeation through the apple peel into the pulp is discussed. The tested compounds can be classified, based on mode of action, as systemic (boscalid, cyprodinil, pirimicarb, propiconazole and tebuconazole) or contact (captan, cypermethrin and fludioxonil) pesticides. The barrier effect was assessed using a Franz flow-type vertical diffusion cell system. Residue analysis was performed using a modified quick, easy, cheap, efficient, rugged and safe (QuEChERS) extraction method coupled to gas chromatography with tandem mass spectrometry (GC-MS/MS). The limits of detection (LODs) ranged between 2.6 µg kg-1 (pirimicarb) and 17 µg kg-1 (captan), with the coefficient of variability (CV) lower than 6%, while recoveries ranged from 85% (boscalid) to 112% (captan) at 0.1 and 1 mg kg-1 spiked levels. The highest peel penetration was observed for pirimicarb, captan and cyprodinil, with cumulative permeation of 90, 19 and 17 µg cm-2, respectively. The total absorption was in the range from 0.32% (tebuconazole) to 32% (pirimicarb). Only cypermethrin was not quantitatively detected in the pulp and its use can be recommended in crop protection techniques. The obtained results indicate that molecular weight, octanol-water partition coefficient and water solubility are important parameters determining the process of pesticide absorption.

The quantum Randi challenge is an invitation to violate Bell’s inequality with a programmable (transparent and reproducible) sequence of local events. This is widely perceived as impossible, given Bell’s Theorem. However, mathematical proofs can be correct without universal validity, as seen in the case of Euclidean geometry. Is Bell’s Locality Criterion inclusive enough to account for all the local phenomena? It is well known that Bell-type inequalities apply to jointly distributed variables, meaning that they hold for events that can be recorded at the same time. Yet, some physical qualities are mutually exclusive. They only become observable at different times. Accordingly, pairwise detections in a narrow window of coincidence – but not at the same exact time – allow for maximal Bell violations (S=4 for the CHSH inequality), without room for doubt about the local nature of the process.

The metaphor of being touched by music is widespread and almost universal. The tactile experience, moreover, has received growing interest in recent years. There is, however, a need to go beyond a mere metaphorical use of the term, by positioning the tactile experience within the broader frame of embodied cognition and the experiential turn in cognitive science. This article explores the possible contribution of a science of touch by defining music as a vibrational art that impinges upon the body and the senses. It takes as a starting point the clinical findings on the psychological and physiological value of tender touch with a special focus on the method of kangaroo mother care, which is a method for holding the baby against the chest of the mother, skin-to-skin. It is seen as one of the most basic affiliative bonding with stimuli that elicit reward. Via an extensive review of the research literature, it is questioned to what extent this rationale can be translated to the realm of music. There are, in fact, many analogies, but a comprehensive theoretical framework is still lacking. This article aims at providing at least some preparatory groundwork to fuel more theorizing about listening and its relation to the sense of touch.

Shrubland and forestland covers are highly prone to fire. The Normalized Difference Vegetation Index (NDVI) has been widely used for biomass quantitative assessment. This study aims were the following: (1) to compute the NDVI annual curve for two types of land cover eucalypts and shrubland areas; (2) to collect field data in these two types of land cover to estimate aboveground biomass (AGB); and (3) to produce AGB maps for eucalypts and shrubland areas by modelling AGB with NDVI and validate them with other data sources. A study area in the central inland Portugal was considered. The Sentinel-2 MSI imagery for the year of 2022 and 2023 were used to compute the NDVI. The NDVI annual curve for 2022 showed a minimum observed between July and August, in accordance with the climatological data, and allowed differentiating eucalypts from shrubland areas. Spectral signatures also confirmed this differentiation. The fitted linear models for AGB prediction using the NDVI imagery showed good fitting performances (R2 of 0.76 and 0.69). The AGB maps provide a relevant decision support tool for forest management and for fire hazard and fire severity mitigation. Further research is needed using more robust data sets for models’ independent validation.

In spite of its remarkable characteristics, consciousness cannot be considered in splendid isolation. It is only one of the remarkable phenomena associated with the brain, the brain is just one of the organs in the body, and computers and brains share many characteristics as information-based systems. On the basis of the ubiquitous hierarchical organization of reality into stacked layers, and the particular importance of strong emergence in living systems, this article argues that the brain must also employ such methods to achieve its advanced functions. This is in line with the prop-osition of Integrated Information Theory (IIT) that consciousness requires a high degree of causal integration in its physical substrate. However, such emergence is also shown to underlie infor-mation processing in computers and the non-conscious functions of the brain. It is also demon-strated that both computers and brains exploit a specific type of information that is correlated to but not synonymous with states and mechanisms in the physical substrate. Emergent Information Theory (EIT) therefore presents consciousness as one member of a large and diverse family of non-physical but real forms of emergent information created by specific types of designed and evolved systems.

Starting with a positive odd integer $n$, apply a function $f(n)$ repetitively such that $f(n) = 3n + 1$ if $n \not\equiv 0 (\text{mod}\:2)$ or $f(n) = n/2$ if $n \equiv 0 (\text{mod}\:2)$. Let the sequence of all the odd integers obtained form an orbit $n, f^1(n) , f^2(n), \ldots, f^k(n), f^{k + 1}(n)$. The $k^{th}$ odd integer is written as $f^k(n) = (3^k + \mathbf{B(k)})/2^{\mathbf{z(k)}}$ where $\mathbf{B(k)}$ is the collection of terms without the coefficient $n$. We show that when $1 - \mathbf{B(k)}/(2^{\mathbf{z(k)}} n) \approx 1$, the condition for unbounded orbit is given by OEIS A022921. Further, if there exists at least one orbit for which $f^{k + 1}(n) = n$ when $(k + 1) < 3$, we show that there exists no orbit with $k + 1 > 3$ for which $f^{k + 1}(n) = n$. The final result is that the odd integers that can violate the Collatz conjecture are smaller than 5.

Recent evidence obtained in murine atrial cardiomyocytes suggests that the behavior of tubulin, a constituent of microtubules, is influenced by audible sounds. In the present study, the sequence and the structure of murine and human tubulins were compared with those of human TMC1 (Transmembrane channel-like protein 1), a sound-sensitive protein that is responsible for forming the pore of mechanosensory transduction channels in the hair cells of the inner ear of vertebrates, and with those of bacterial FtsZ (Filamenting temperature-sensitive mutant Z), a bacterial protein homologous to tubulin. The results show that mouse and human alpha-tubulin are 100% identical, whereas sequence homology of human TMC1 and human tubulin alpha 1A chain is scarce, with only 17.31% identity. A higher degree of similarity was observed in the presence of aromatic amino acids as well as in the propensity to form alpha-helices. Based on these results, it is hypothesized that the response of tubulin to audible sounds is mediated by the external alpha-helices as it occurs in TMC1. The sequence homology of human TMC1 and FtsZ from Lactobacillus johnsonii, is moderate with 23.40% identity, however higher than that between TMC1 and tubulin. The overall presence of aromatic amino acids in FtsZ is scarce, but helix propensity is significant. These results are discussed in the context of Orch OR, a theory that postulates that consciousness emerges from quantum computations occurring in microtubules of neurons via information processing mediated by aromatic amino acids of tubulin.

Generative artificial intelligence (GenAI) has been developing with many incredible achievements like ChatGPT and Bard. Deep generative model (DGM) is a branch of GenAI, which is preeminent in generating raster data such as image and sound due to strong points of deep neural network (DNN) in inference and recognition. The built-in inference mechanism of DNN, which simulates and aims to synaptic plasticity of human neuron network, fosters generation ability of DGM which produces surprised results with support of statistical flexibility. Two popular approaches in DGM are Variational Autoencoders (VAE) and Generative Adversarial Network (GAN). Both VAE and GAN have their own strong points although they share and imply underline theory of statistics as well as incredible complex via hidden layers of DNN when DNN becomes effective encoding/decoding functions without concrete specifications. In this research, VAE and GAN is unified into a consistent and consolidated model called Adversarial Variational Autoencoders (AVA) in which VAE and GAN complement each other, for instance, VAE is good at generator by encoding data via excellent ideology of Kullback-Leibler divergence and GAN is a significantly important method to assess reliability of data which is realistic or fake. In other words, AVA aims to improve accuracy of generative models, besides AVA extends function of simple generative models. In methodology this research focuses on combination of applied mathematical concepts and skillful techniques of computer programming in order to implement and solve complicated problems as simply as possible.

The goal of this narrative review was to identify, synthesize and summarize research providing both institutional and personal recommendations for female leaders who aspire to hold leadership roles in academia. Existing evidence regarding factors that influence females acquiring leadership positions was first gathered and examined, noting recurring issues that have been identified as inimical to women assuming leadership roles. Recent research studies and statistical trends were then investigated, tracking and reporting on the increase in female leadership in academia that has occurred over recent years. Quantitative and qualitative literature focusing on successful strategies to support females aspiring to academic leadership positions were then elaborated upon, with specific factors identified in order to deepen understanding of shifts that may help to account for the rise of females in academic leadership roles. The recommendations resulting from the findings of this narrative review could be used to scaffold female success in the pursuit of academic leadership roles and offer insights for university executives and administrators on methods of more effectively supporting an increase in female leaders in academia.

Current artificial intelligence (AI) technology is still considered weak AI. However, the progression towards strong AI unavoidably involves grappling with concerns surrounding consciousness, the mind, and creativity. This paper focuses on analyzing consciousness, creativity, and the generation of emotions to explore the possibility of machine-based consciousness, creativity, and emotion. We believe that the emergence of consciousness relies on the complex interplay at different layers within a complex system, rather than wholly relying on the underlying substrates of the system. Thus, it is plausible to consider the existence of machine-based consciousness, creativity, and emotion. Furthermore, swarm intelligence should be recognized as a distinct form of intelligence. Human individuals serve as the foundational substrate enabling the realization of swarm intelligence, with individual intelligence reflecting the projection of swarm intelligence at the individual level. The advanced state of human civilization is primarily attributable to the effect of swarm intelligence. Building upon basic emotions to adapt to environmental conditions, advanced human emotions are a product of the evolutionary process by swarm intelligence. Emotions serve as a pivotal impetus for the formation and development of societies grounded in swarm intelligence. In pursuit of super-AI that surpasses human civilization in the future, nurturing swarm intelligence represents an inevitable trajectory.

The paper deals with the reverse engineering, namely the as built documentation of the actual construction. The input is data measured in field using geodetic methods. In addition to modern methods of surveying 3D objects, such as laser scanning, it is still necessary to use classic surveying using a total station. The bottle neck of the process is the creation of documentation of the construction, which is still created manually in the appropriate CAD/BIM software. The goal of the research was to find a method that would reduce the amount of manual work when drawing documentation in CAD/BIM to a minimum. The core of the solution is the use of a topology that interconnects the points measured in field. The entire procedure has 2 parts: 1. Creating a topo-logical drawing template in a suitable CAD/GIS software (digital sketch), 2. Adding geometry to this sketch and creating a drawing using topological codes. The method was verified in practice by applying it to several specific buildings in the Czech Republic. The practical application of the method demonstrated a 30% time saving, a reduction in work and error rate in the entire process.

In this paper, a short survey of the existed results concerning the Jacobian Conjecture is first given. Then the 3-fold linear type polynomial map will be analyzed in detail. The expansion of the Jacobian condition is deduced to obtain its equivalent algebraic equations, and the Jacobian condition will be analyzed to derive two coordinate transformations that can maintain the invariance of the Jacobian condition. Finally, it is proved by mathematical induction method that one general chain expression presented in this paper is just the inverse polynomial map of 3-fold linear type polynomial map, i.e. LJC(n,[3]) holds such that the Jacobian Conjecture holds.

It is known from ancient Egyptian mathematical papyri that the Egyptians were able to calculate the area of a circle with great accuracy. How they found the formula for this calculation was still unknown. Here it is shown how the unknown ancient Egyptian mathematician found a method for calculating the area of a circle and the ratio of a circle’s circumference to diameter.

This study aimed to explore the experiences of teachers in the recovery of educational skills. Specifically, ten teachers of Andap National High School are selected for the in-depth interview. This study employed a qualitative-phenomenological research design of which in-depth interview (IDI) was used in gathering the data. The study utilized phenomenological approach to study a particular phenomenon concerning the post-pandemic experiences of teachers in the implementation of the face-to-face classes. After gathering sufficient amount of data through the conduct of in-depth interviews, thematic analysis was used to analyse further the results and to check the disparities and similarities of all responses gathered. This was the time wherein responses were categorized and organized into themes. The findings of the study revealed that the challenges encountered of educational skills recovery were sources of learning materials, learning gaps, learners characteristics, difficulty with comprehension and lack of interest. It was also revealed that the most challenging teaching experiences in the recovery of educational skills were catching attention, learning gaps, communicating to students, need for remedial instruction, retroactive interference and difficulty in understanding English Language. They frequently have to quickly convert lesson material they had intended to teach in a classroom setting to any learning modality implemented. Further, adjust and learn new trend, provide opportunities to develop new skills, helps to manage stress, improved educational outcomes, become well-rounded teacher, networking and learning and continue doing responsibilities helped in these insights had in confronting challenges brought by the pandemic.

In the wake of globalization and the revolutionary impact of Artificial Intelligence (AI), literature and language education play a pivotal role in preparing the next generation to navigate an ever-changing world. This reflective concept paper explores the profound insights shared by educators, focusing on literature and language education amidst globalization and AI. Drawing on interviews and observations, teachers' reflections reveal the enduring value of literature in shaping young minds, fostering critical thinking, and promoting empathy. Additionally, they emphasize the importance of embracing multilingualism and cultural diversity to equip students for an interconnected world. In the face of challenges, educators showcase their resilience and adaptability, harnessing technology, particularly AI-driven tools, to foster future-ready learners. Identifying gaps and implications in literature and language education, this paper sets the stage for collective efforts among stakeholders to shape the future of education. Ultimately, teachers hold the key to nurturing a generation capable of embracing the complexities of the AI-driven global landscape with confidence and compassion, empowering students as transformative agents in a rapidly changing world.

This paper presents a numerical method for solving a two-dimensional subdiffusion equation with a Caputo fractional derivative. The problem considered assumes symmetry in both the equation’s solution domain and the boundary conditions, allowing for a reduction of the two-dimensional equation to a one-dimensional one. The proposed method is an extension of the fractional Crank-Nicolson method, based on the discretization of the equivalent integral-differential equation. To validate the method, the obtained results were compared with a solution obtained through Laplace transform. The analytical solution in the image of the Laplace transform was inverted using the Gaver-Wynn-Rho algorithm implemented in the specialized mathematical computing environment, Wolfram Mathematica. The results clearly show the mutual convergence of the solutions obtained by the two methods.

During last decades, production and consumption of small ruminant milk has been increased. As a result of it, sheep and goat farming has been developing and scientists are focused on these animal researches both clinical and feeding strategies. By the evolutionary challenges and adaptations, colostrum has a crucial role of immune complementation for litter. As a result of these challenges and adaptations neonatal life is especially more important in ruminants because of it affects their whole life and future of livestock. Passive immune transfer is the main mechanism that explained by biological evolution between dam and lamb and also it is effected by factors up to dam and up to the litter. Today importance of passive immune transfer is well known for the future of livestock economy and animal welfare. In the literature, researchers are focused on correlation between colostrum quality (especially immunoglobulin amounts) and blood serum levels of newborns. Aims of present review are to discuss datas of recent studies, point out different effecting factors in colostrum quality and passive immune transfer, enlighten and give new ideas to researchers.

Most fungal species are commensals, not pathogenic for plants, humans, or animals. However, several species from genera Alternaria, Aspergillus, Trichophyton and Microsporum are common causes of disease, even for immunocompetent individuals, contributing to skin barrier impairment. A total of 68 allergic dogs were selected from a veterinary dermatology and allergy outpatient consultation, for conditions related to Malassezia overgrowth or other fungal complications. Allergy diagnosis was made through anamnestic and clinical criteria and allergy-implicated species were identified by intradermal testing (IDT) and serum determination of specific immunoglobulin E (sIgE). Dermatophagoides farinae, Dactylis glomerata and Malassezia pachydermatis showed as the higher sensitization species from each group. Significant correlations at p<0.05 were found between Dactylis glomerata and Phleum pratense grass pollens, Dermatophagoides farinae and Dermatophagoides pteronyssinus, Acarus siro, Tyrophagus putrescentiae and Lepidoglyphus destructor dust/storage mites, and between fungi like Aspergillus mix and Penicillium or Alternaria alternata. A significant correlation was also found between sensitization to Aspergillus mix and D. farinae, D. pteronyssinus or A. siro. Rather severe dermatitis was observed where positive IDT to Malassezia pachydermatis was found, regardless of the presence of circulating sIgE, allowing us to perceive the usefulness of both sIgE and IDT for allergy diagnosis to fungi.

A strong correlation between karyotype diversity and species richness in mammals was first reported over forty years ago: in mammalian phylogenetic clades, standard deviation of karyotype diversity (KD) closely corresponds to the standard deviation of species richness (SR). These initial studies, however, did not control for phylogenetic signal, raising the possibility that the correlation was due to phylogenetic relatedness among species in a clade. Accordingly, karyotype diversity trivially reflects species diversity simply as a passive consequence of adaptive radiations. A more recent study in mammals has controlled for phylogenetic signal and established the correlation as phylogenetically independent, suggesting that species diversity cannot, in itself, explain the observed corresponding karyotype diversity. The correlation is therefore remarkable because the mechanisms contributing to karyotype diversity are evolutionarily independent of the mechanisms contributing to species diversity. Recently, it was shown in salamanders that the two processes generating genetic diversity and species diversity are indeed independent and operate in parallel, suggesting a potential non-adaptive and non-causal relationship between the two fundamental variables involved in adaptive radiations. The following will examine the relationship between KD and SR in the context of Motoo Kimura’s theory of non-adaptive radiation.