Mulberry leaves are a classic herb commonly used in traditional Chinese medicine, and experience since ancient times has shown that leaves collected after frost have better medicinal properties. However, the characteristics of the changes of critical metabolic components in mulberry leaves, especially Morus nigra L., are still unknown. To further study the influence of harvesting time on the dynamic changes of metabolites, especially DNJ compounds and flavonoids, in mulberry leaves after frost. We used metabolomics technology to select 100+ metabolites as indexes to reflect the dynamic changes of metabolites in mulberry leaves comprehensively. The results showed significant differences in the effects of defrosting on the accumulation of metabolites in the leaves of Morus nigra L. and Morus alba L. The content of DNJ in the leaves of Morus nigra L. showed a decreasing trend after the frost, while flavonoids reached the peak of the second frost. For Morus alba L, DNJ showed an increasing trend after frost, especially reaching its peak one day after the second frost. Flavonoids mainly peak in the week before the frost. In addition, by analyzing the influence of picking time on metabolite accumulation in two mulberry leaves, it was concluded that higher DNJ alkaloids and flavonoids would be obtained in mulberry leaves collected in the morning. This study also provides scientific guidance for the optimum harvesting time of mulberry leaves.

Nowadays, the Internet of Things (IoT) concept plays a pivotal role in society and brings new capabilities to different industries. The number IoT solutions in areas such as transportation and healthcare is increasing and new services are under development. In the last decade, society has experienced a drastic increase in IoT connections. In fact, IoT connections will increase in the next few years across different areas. Conversely, despite these benefits, several challenges still need to be faced to enable efficient and secure operations (e.g., interoperability, security, standards, and server technologies). Furthermore, although efforts have been made to produce datasets composed of attacks against IoT devices, several possible attacks are not considered. Most existing efforts do not consider an extensive network topology with real IoT devices. The main goal of this research is to propose a novel and extensive IoT attack dataset to foster the development of security analytics applications in real IoT operations. To accomplish this, 33 attacks are executed in an IoT topology composed of 105 devices. These attacks are classified into seven categories, namely DDoS, DoS, Recon, Web-based, Brute Force, Spoofing, and Mirai. Finally, all attacks are executed by malicious IoT devices targeting other IoT devices.

The CdS nanoparticles were constructed on one-dimensional (1D) CeO2 nanorods by two-step hydrothermal method. The X-ray diffraction (XRD), transmission election microscopy (TEM), Raman spectra, X-ray photoelectron spectra (XPS) and VU-vis diffuse reflection spectroscopy (DRS) techniques were used to characterize these CdS/CeO2 nanocomposites. It is concluded that when the molar ratio of CdS and CeO2 was 1:1, the nanocomposites exhibited the best photo-catalytic desulfurization activity, reaching 92 % in 3 hours. Meanwhile, transient photocurrent (PT) measurement, photoluminescence (PL) spectra and electrochemical impedance spectroscopy（EIS）measurement indicated that the modification of CeO2 nanorods by CdS nanoparticles could sig-nificantly inhibit the recombination of photogenerated electrons and holes. In addition, the pos-sible mechanism of photocatalytic oxidation desulfurization of the nanocomposites was proposed. This study may provide an effective CeO2-based photocatalysts for photocatalytic desulfurization applications.

Thunderstorm electrification has been studied for hundreds of years. Several mechanisms have been proposed to elucidate the electrification, including convective charging, inductive precipitation charging, and ice crystal-graupel collision charging. Field observations and model studies have demonstrated the vital roles that graupel and ice crystals play in the electrification, but the mechanism of the collision charging is still unclear. The fundamental essence of relative growth rate theory used for explaining the tripole charge structure in thunderclouds also needs a further exploration. We analyze the processes of ice crystal-graupel collision charging from charge migration inside hydrometeors to charge separation between two hydrometeors. The driving effects of temperature gradient and chemical potential gradient in charge migration are clarified, as well as the applicability of the relative growth rate theory, thermoelectric effect and surface tension gradient in different humidities. Based on the understanding from these electrification mechanisms, we propose that the essence of charge separation is driven by non-thermal equilibrium, and future studies on thunderstorm electrification should focus on the dynamical non-thermal equilibrium of cloud particles.

Perceived peer support is a critical factor in the academic adjustment of higher vocational college students. While previous studies have explored this relationship, few studies have delved into the underlying mechanisms. This study surveyed 9782 students from 35 higher vocational colleges in 13 provinces and cities in China to explore the relationship and mechanisms between perceived peer support and academic adjustment. Drawing on Conservation of Resources theory and Social Support Resource theory, the findings revealed that perceived peer support not only directly predicted the academic adjustment of higher vocational college students, but also indirectly through the independent mediating effect of academic hope and professional identity, as well as the chain-mediating effect of academic hope to professional identity. Additionally, students from vocational high schools showed a more significant increase in academic hope due to perceived peer support compared to those from general high schools, highlighting the moderating effect of educational background. The study provided a new theoretical perspective for understanding the complex mechanisms of academic adjustment in students and offers valuable guidance for educational practice, emphasizing the importance of fostering perceived peer support, academic hope, and professional identity in higher vocational education.

The goal was to assess dental students' perception of digital technologies after participating in a CAD/CAM exercise for scanning, designing, and manufacturing computer-aided provisional fixed dental restorations. A survey was conducted among second-year dental students (pre-D2 and post-D2), first- (D1, negative control), third-, and fourth-year dental students (D3 and D4, positive controls). Only OSU College of Dentistry students who completed the activity and completed the surveys were included. Seven questions were rated, which evaluated changes in knowledge, skill, interest, the importance of technology availability in an office, patients' perception of technology, the importance of having the technology, and the expected frequency of clinics utilizing the technology. Statistical analysis was performed with a significance level of 0.05. A total of 74 pre-D2 and 77 post-D2 questionnaires were completed. Additionally, 63 D1, 43 D3, and 39 D4 responded to the survey. Significant differences were found for "knowledge" and "skill" between pre-D2 and post-D2, and pre-D2 and control groups (p<0.001). There was a significant difference between post-D2 and all controls for “interest” (p=0.0127) and on practice preference for technology availability (p<0.05). There were significant results between post-D2 and all controls regarding the importance of technology availability in an office (p<0.001) and the expected frequency of clinics utilizing the technology (p=0.01). No significance was found for "patient's value of technology" and "the importance of having the technology". The presence of technology in the practice and educational academic environments significantly improved students’ interest and perception of knowledge and skill.

Soil organic matter is an important component that reflects soil fertility and promotes plant growth. The soil of typical Chinese tea plantations was used as the research object in this work, and by combining soil hyperspectral data and image texture characteristics, a quantitative prediction model of soil organic matter based on machine vision and hyperspectral imaging technology was built. Three methods, standard normalized variate (SNV), multisource scattering correction (MSC) and smoothing, were first used to preprocess the spectra. After that, random frog (RF), variable combination population analysis (VCPA) and variable combination population analysis and iterative retained information variable algorithm (VCPA-IRIV) algorithms were used to extract the characteristic bands. Finally, the quantitative prediction model of nonlinear support vector regression (SVR) and linear partial least squares regression (PLSR) for soil organic matter was established by combining nine color features and five texture features of hyperspectral images. The outcomes demonstrate that, in comparison to single spectral data, fusion data may greatly increase the performance of the prediction model, with MSC+VCPA-IRIV+SVR (R2C=0.995, R2P=0.986, RPD=8.155) being the optimal approach combination. This work offers excellent justification for more investigation into nondestructive methods for determining the amount of organic matter in soil.

The present study was to investigate effects of total flavonoids from Taraxacum mongolicum Hand.-Mazz. (FT) on fermentation quality, antioxidant status and microbial community of Caragana korshinskii Kom. (CK) silage. CK was ensiled with no additive (CON), 1% FT and 2% FT on a fresh weight (FW) basis for 60 days. The results showed that 1% FT and 2% FT groups displayed higher DM content than CON group, and 2% FT group had the best effect on nutrient preservation. Compared with CON and 1% FT groups, 2% FT group exhibited the best silage fermentation quality and the highest antioxidant activity, including increased lactic acid, acetic acid concentrations and the activities of antioxidant enzymes, as well as decreased pH and the ammonia nitrogen (NH₃-N) concentration. Moreover, 2% FT addition significantly affected the microbial community, such as increased abundance of Lactobacillus and decreased abundances of Pseudomonas and unidentified Cyanobacteria. The abundances of Lactobacillus parafarraginis and Lactobacillus brevis were negatively correlated to pH, while they were positively correlated with T-AOC, GSH-Px and CAT activities. In conclusion, 2% FT may be used as additives to inhibit the growth of undesirable microorganisms and promote fermentation quality and antioxidant activity of CK silage.

In this paper, we design two inertial-type subgradient extragradient algorithms with line-search process for solving the pseudomonotone variational inequality problems (VIPs) and common fixed-point problem (CFPP) of finite Bregman relatively nonexpansive mapping and a Bregman relatively demicontractive mapping in p-uniformly convex and uniformly smooth Banach spaces, which are more general than Hilbert spaces. Under mild conditions, we derive weak and strong convergence of the suggested algorithms to a common solution of the VIPs and CFPP, respectively. Additionally, an illustrated example is furnished to back up the feasibility and implementability of our proposed methods.

Abstract:This study aimed to explore the effects of supplementary feeding on milk yield, blood biochemical indexes, milk components, and fecal microflora diversity of Yili horses under grazing condition.18 grazing Yili mare horses with physiological condition consistent were randomly assigned to three groups with six mare horses each. The control group normal grazing, whereas the test group I and II were provided with supplemented with 1 kg/d of concentrate and 1 kg/d of concentrate + 0.4 kg/d coated fatty acids, respectively. After 3 days of pre-feeding, begin the experiment.Horse milk was collected every 7 days, and 10% of the milk yield of each horse was mixed in 100 mL milk sample bottles and stored in -20℃ refrigerator.Which blood samples were collected from the jugular vein before morning feeding (0 h) and at 1,2,3,4,6,9 and 12 h after morning feeding on day 40, and the plasma were centrifuged at 4000 rpm for 15 min and conservation at-20℃. Excrement was collected within 8 h on days 45 and 46 of the test, mixed with 5g of fresh fecal samples in a 5 mL frozen storage tubes and stored in liquid nitrogen. Compared with the control group, the lactation volume of Yili horses in test groups I and II was significantly higher throughout the trial period (P <0.05), and the late test group II was significantly higher than test group I (P <0.05). The yield of milk fat, lactose, and milk protein in test group II was significantly higher than that in test group I and control group (P <0.05); the urea nitrogen content in test group I was significantly lower than the control group (P <0.01). The lauric acid, tetradecanoic acid, cis-11,14,17-eicosotrienic acid, total saturated fatty acid, and total saturated fatty acid/total unsaturated fatty acid in test group II were significantly higher than those in the control group and test group I (P <0.05); The plasma glucose concentration of mares in test group II was significantly higher than that of control group and test group I at 1, 2 and 9 h after feeding (P <0.05), and significantly higher at 4 h after feeding (P <0.05); At 3 h and 6 h after feeding, test group II mares had significantly higher plasma free fatty acids and triglycerides concentrations than the control and test group I (P <0.05), at 4 h after feeding, the plasma triglyceride concentrations were significantly higher than the control and test I groups (P <0.05). Plasma low density lipoprotein and very low density lipoprotein concentrations were significantly higher in mares at 3 h and 9 h after feeding than in control and group I (P <0.05). The total number of OTUs was 3483, and the number of OTUs was 4984,5487, and 5158 in the control and test I and II, respectively. At the phylum level, the total abundance of Bacteroidetes and Firmicutes was more than 75%, and the test group Verrucomicrobia was significantly higher than the control group (P <0.05), and the test group II was significantly higher than the test group I (P <0.05). The Treponema_saccharophilum was significant difference in the feces of the control group (P <0.05); WCHB 1_41, kiritimatiellae, and Verrucomicrobia were significant difference of the test group II (P <0.05) and the fecal flora was mainly related to lipid synthesis, metabolism, and energy metabolism (P <0.05). Supplemental feeding can improve lactation volume of grazing Yili horses, improve the absorption and utilization of fatty acids, and improve the composition and diversity of horse milk and fecal flora to a certain extent.

The constant increase in current density in electrical wires leads to increasingly significant heat losses due to Joule effect. Therefore, reducing the electrical resistivity of copper wires becomes necessary. To achieve this goal, the development of a composite material incorporating a more conductive reinforcement, the graphene, is a promising way. The design of a copper/graphene composite using a powder metallurgy-based method is presented. This synthesis method allows for interface control through the growth of CuO(Cu) nanoparticles tightly bonded to the reinforcement. It also involves the dispersion of graphene through ultrasonic treatment and its alignment within the matrix using a uniaxial pressing densification method. The increase in the hardness (+12 HV) demonstrates the effective dispersion and separation of graphene layers. The impact on the electrical properties of dendritic copper (ρe = 2.30 µΩ.cm) remains limited, with a decrease in electrical resistance of approximately 1.4%. However, for copper with higher electrical resistivity, flake copper (at 2.71 µΩ.cm) and brass at (7.66 µΩ.cm), reductions of 2.7% and 10% have been achieved, respectively. With the improvement of graphene quality, there is more room to improve the electrical properties. This work paves the way for the development of composites with improved electrical resistivity.

In order to improve the adaptability of broilers to low-temperature environments and their ability to resist acute cold stress (ACS), 240 one-day-old broilers were selected and randomly divided into three groups. The control treatment (CC) was raised at the conventional feeding temperature from 1-43 days (d), the cold stimulation treatments (CS) were kept at 3 °C below the temperature of CC at 1-d intervals for 3 and 6 hours from 15 to 35 d, namely CS3 and CS6, respectively. Then all broilers were kept at 20 °C from 36 to 43 d. ACS was then carried out at 44 d, and the ambient temperature was dropped to 10 °C for 6 hours. The study investigated the production perfor-mance, as well as levels of intestinal barrier genes (including Claudin-1, E-cadherin, Occludin, ZO-1, ZO-2 and Mucin2), secretory IgA in duodenum and jejunum, and immunoglobulins (IgA and IgG) in serum. The results showed that IMCS could increase the daily weight gain and decrease the feed conversion ratio. During the IMCS, the expression levels of intestinal barrier genes were up-regulated and the content of secretory IgA was increased. When IMCS ceased for one week, the level of immunoglobulins in serum stabilized, and the expression levels of Occludin, ZO-2 and Mucin2 still maintained high levels. After ACS, broilers that received IMCS training maintained the high levels of intestinal barrier genes and secretory IgA.

Waterlogging induced by rain in urban areas has a potential risk impact on property and safety. This paper focuses on the impact of rain on waterlogging and evaluates the waterlogging risk in the central city of Shanghai. A simplified waterlogging depth model is developed in different areas with different drainage capacity and rainfall in consumption of simplifying the effect of complex terrain characteristics and hydrological situation. Based on urban waterlogging depth and its classification collection, a Rain-induced Urban Waterlogging Risk Model(RUWRM) is further established to evaluate waterlogging risk in the central city. The results show that waterlogging depth is closely linked with rainfall and drainage, with a linear relationship between them. More rainfall leads to higher waterlogging risk, especially in the central city with imperfect drainage facilities. Rain-induced urban waterlogging risk model can rapidly gives the waterlogging rank caused by rainfall with a clear classification collection. The results of waterlogging risk prediction indicate that it is confident to get the urban waterlogging risk rank well and truly in advance with more accurate rainfall prediction. This general study is a contribution that allows the public, policy makers and relevant departments of urban operation to assess the appropriate management to reduce traffic intensity and personal safety or strategy to lead to less waterlogging risk.

Enterovirus 71 (EV71) is an etiological agent of hand foot and mouth disease and can also cause neurological complications in young children. However, there are no approved drugs to treat EV71 infections. In this study, we conducted an antiviral drug screening by using a Food and Drug Administration (FDA)-approved drug library. We identified five drugs that showed dose-dependent inhibition of viral replication. Sertraline was further characterized because it exhibited the most potent antiviral activity with the highest selectivity index among the five hits. The antiviral activity of sertraline was noted for other EV serotypes. The drug’s antiviral effect is not likely associated with its approved indications as an antidepressant and its mode-of-action as a selective serotonin reuptake inhibitor. The time-of-addition assay revealed that sertraline inhibited an EV71 infection at the entry stage. We also showed that sertraline partitioned into acidic compartments, such as endolysosomes, to neutralize the low pH levels. In agreement with the findings, the antiviral effect of sertraline could be relieved greatly by exposing virus-infected cells to extracellular low-pH culture media. Together, we have identified an FDA-approved antidepressant with the new indication for the broad-spectrum EV inhibition by blocking viral entry through the alkalization of the endolysosomal route.

To compare The effects of organic and inorganic impregnation on the properties of unmodified, phenol formaldehyde oligomer-modified (PFOMCF), and sodium silicate-modified Chinese fir wood (SSMCF) were compared using samples prepared using the respiratory impregnation method. Impregnation and reinforcement effects and water resistance of PFOMCF and SSMCF were compared and the results was showed that the weight percentage gain, density increase rate, bending strength, and compressive strength of SSMCF were clearly higher than those of PFOMCF and had a lower water absorption rate within 60 h. The impregnation and reinforcement effects and dimensional stability of SSMCF were better than those of PFOMCF. FT-IR, XRD, CONE, and TGA examinations were used to test and analyze the chemical structure, crystalline structure, flame retardancy, and heat resistance of these modified woods. The results indicated that SSMCF possessed more hydrogen bonds than PFOMCF and that Si–O–Si chemical bonding with high bond energy was formed. Meanwhile, the weakened degree of the diffraction peak of SSMCF was much less than that of PFOMCF. These results explained that the mechanical properties and water resistance of SSMCF were better than PFOMCF. Compared with PFOMCF, SSMCF had a lower heat release rate (HRR), peak-HRR, mean-HRR, total heat release, smoke production rate, and total smoke production as well as higher thermal decomposition temperature and residual rate. Inorganic sodium silicate was shown to be a better flame retardant, while SSMCF had good smoke suppression effects, thermal stability, and safety performance in the case of fire.

High dimensional statistical analysis for the yield of large-scale circuits is quite difficult due to expensive simulations, especially for the memory circuits with high sigma requirement (e.g., SRAM). In this paper, we developed an efficient sparse additive model to substitute simulations. To fit high sigma region accurately, the modeling center is moved to near failure boundary searched by scaling the shape of sampling function. To solve the model efficiently, the process variables are grouped by standard cells so that the model can be solved by our developed blockwise greedy algorithm. The experiments on the 28nm memory circuits validate that our method achieves high accuracy and efficiency compared with other state-of-art works.

Trimeresurus albolabris, also known as the white-lipped pit viper or white-lipped tree viper, is a highly venomous snake distributed across Southeast Asia and the cause of many snakebite cases. In this study, we report the first whole genome assembly of T. albolabris obtained with next-generation sequencing from a specimen collected in Mengzi, Yunnan, China. After genome sequencing and assembly, the genome of this male T. albolabris individual was 1.51 Gb in length and included 38.42% repeat-element content. Using this genome, 21,695 genes were identified, and 99.17% of genes could be annotated using gene functional databases. Our genome assembly and annotation process was validated using a phylogenetic tree, which included six species and focused on single-copy genes of nuclear genomes. This research will contribute to future studies on Trimeresurus biology and the genetic basis of snake venom.

Rapidly and accurately extracting tobacco plant information can facilitate tobacco planting man-agement, precise fertilization and yield prediction. In karst plateau of southern China, tobacco plant identification is affected by large ground undulations, fragmented planting areas, complex and diverse habitats and uneven plant growth. This study took a tobacco planting area in Gui-zhou Province as the research object and used DJI UAVs to collect UAV visible light images. Considering plot fragmentation, plant size, presence of weeds and shadow masking, this area was classified into eight habitats. The datasets of different habitats were constructed to train the U-Net model. The results show that (1) the overall precision, recall, F1-score and IOU of tobacco plant information extraction were 0.68, 0.85, 0.75 and 0.60, respectively. (2) The precision was the highest for the subsurface-fragmented and weed-free habitat and the lowest for the smooth-tectonics and weed-infested habitat. (3) The weed-infested habitat with smaller tobacco plants can cause blurred images, reducing the plant identification accuracy. This study verified the feasibility of the U-Net model for tobacco single-plant identification in complex habitats. Decomposing complex habitats to establish the sample set method is a new attempt to improve crop identification in complex habitats in karst mountainous areas.

The utilization of smart IoT devices, commonly referred to as digital twins, is aimed at the digitalization of human knowledge within aquaculture processes. This involves the incorporation of cutting-edge technologies, including information-based management with big data and modeling, to automate machinery and gain comprehensive insights into the aquaculture environment and fish farm conditions. The ultimate objective is to empower farmers to make informed decisions, furnishing them with objective data to enhance their capacity in monitoring and controlling the various factors impacting fish production. As a result, farming decisions can be fine-tuned to enhance fish health and optimize farm output. In the context of large and modern aquaculture farms, technological innovation becomes imperative to automate processes, minimize labor requirements, and streamline fish feeding operations. Remarkably, the literature currently offers limited discussions on the digital transformation of aquaculture through the application of digital twin methodologies. A prior study underscores the critical influence of factors such as market prices and fish survival rates on the profitability of offshore caging culture. In this study, we embark on an analysis of the prerequisites for establishing a digital twin infrastructure tailored to intelligent fish feeding management. This infrastructure is designed to facilitate the integration of technology and data-driven decision-making, ultimately enhancing the efficiency of fish feeding processes. The proposed architecture for the fish feeding digital twin encompasses various digital twin components, encompassing water quality forecasting, fish population assessment, fish metrics estimation, fish feed prediction, and evaluation of fish feeding intensity. Furthermore, we optimize the daily fish feeding process through reinforcement learning algorithms. Finally, we implement a cloud-based AIoT system that provides the runtime environment for executing digital twins and controlling our intelligent fish feeding machinery. Experimental findings underscore the efficacy of the proposed digital twin system in significantly improving traditional fish feeding processes, notably in terms of reducing food costs and labor requirements.

East Lake in Wuhan, China, harbors a high number of freshwater fish species of great conservation value, concurrently serving as vital resources for local livelihoods. However, the ecosystem is threatened by an array of anthropogenic activities, thus requiring consistent monitoring of the local fish community to enable more efficacious conservation management. In place of conventional surveying methods, we undertook the first analysis of the fish distribution within East Lake via metabarcoding of environmental DNA (eDNA). The accuracy and efficacy of eDNA metabarcoding relies heavily upon selecting an appropriate primer set for PCR amplification. Given the varying environmental conditions and taxonomic diversity across distinct study systems, it remains a challenge to propose an optimal genetic marker for universal use. Thus, it becomes necessary to select PCR primers suitable for the composition of fish in the East Lake. Here, we evaluated the performance of two primer sets, Mifish-U and Metafish, designed to amplify 12S rRNA barcoding genes in fishes. Our results detected a total of 116 taxonomic units and 51 fish species, with beta diversity analysis indicating significant differences in community structure diversity between the 6 sampling locations encompassing East Lake. While it was difficult to accurately compare the species-level discriminatory power and amplification bias of the two primers, Mifish outperformed Metafish in terms of taxonomic specificity for fish taxa and reproducibility. These findings will assist with primer selection for eDNA-based fish monitoring and biodiversity conservation in the East Lake and other freshwater ecosystems.

Pool boiling is extensively utilized in various fields, such as electronics cooling, battery cooling, nuclear power plants, and chemical processing. In the process of temperature control through boiling, the generation and transportation of bubbles play a crucial role in calculating the heat transfer capacity of the system. Therefore, it holds immense significance to gain a profound understanding of the mechanisms underlying bubble formation, growth, and detachment. Currently, numerous mechanistic explanations and empirical correlations have been proposed to elucidate various parameters of bubbles during the boiling process. These findings were considered valuable references in selecting appropriate boiling media and designing efficient heating surfaces. To comprehensively present the progress of bubble formation and heat transfer during the boiling process, the forces exerted on the bubbles was highlighted in this article. And a meticulous review on bubble force analysis and correlation formulas pertaining to various relevant parameters (e.g. nucleation sites density, bubble growth rate, detachment diameter, detachment frequency) were conducted. This review article also were expected to provide a novel foundation for further exploration of enhanced boiling heat transfer.

Background: The target volume for post-mastectomy radiation therapy (PMRT) in breast cancer patients with reconstruction has been a subject of debate. This study aimed to assess the radiation dose distribution and treatment outcomes associated with different chest wall (CW) delineation according to ESTRO ACROP guideline for patients underwent implant-based reconstruction. Methods: We conducted a retrospective review of breast cancer patients who underwent mastectomy followed by two-stage implant-based breast reconstruction and adjuvant radiation therapy (RT) between 2007 and 2022. The expanders/implants were positioned retropectorally. The chest wall target volumes were categorized into two groups: the prepectoral group, which excluded the deep lymphatic plexus, and the whole expander group. Results: The study included 26 patients, 15 in prepectoral group and 11 in whole expander group. No significant differences were observed in normal organs exposure between the two groups. There was a trend toward a lower ipsilateral lung mean dose in the prepectoral group (10.2 vs. 11.1 Gy, p=0.06). Both groups exhibited limited instances of reconstruction failure and local recurrence. Conclusions: For patients undergoing two-stage expander-implant retropectoral breast reconstruction and PMRT, our data have provided comparable outcomes and normal organs exposure for those omitting the deep lymphatic plexus.

The current deformation and stable state of slopes with historical shatter signs is a concern for engineering construction. Suspected landslide scarps were discovered at the rear edge of the slope of the Genie in the Sichuan-Tibet transportation corridor during a field investigation. In order to qualitatively determine the current status of the surface deformation of this slope, this paper uses high-resolution optical remote sensing, airborne LiDAR and InSAR technologies for comprehensive analysis. The interpretation of high-resolution optical and airborne LiDAR data revealed that the rear edge of the slope exhibits three levels of scarps. However, no deformation was detected with the D-InSAR analysis of ALOS-1 radar images from 2007 to 2008 or with the Stacking-InSAR and SBAS-InSAR processing of Sentinel-1A radar images from 2017 to 2020. A geological model of the slope was established in combination with field investigation stipulating that the slope is composed of steep anti-dip layered dolomite limestone and that the scarps at the rear edge of the slope were caused by historical shallow toppling. Further research is recommended to determine the extent of toppling deformation and evaluate the slope stability under the disturbance of tunnel excavation.

No-till and cereal-legume intercropping have been recognized as favorable cropping practices to increase crop yields while maintaining soil quality in arid and semiarid environment, but the bio-logical mechanisms are poorly understood. The present study was to determine the response of soil properties, enzyme activities, and microbial community diversity and composition in mono- and inter-cropping under conventional and no-tillage conditions. We initiated a field experiment in Wuwei, a typical arid area of China, in 2014. Soil was sampled in August 2022 and, yields, soil properties, enzyme activities, and the microbial community diversity and composition were de-termined in the maize and pea strips in inter- and mono-cropping systems. Results revealed that the maize and pea strips in the no-till intercropping significantly increased yields, total and or-ganic carbon stocks, decreased NO3--N, and obtained the highest total and organic P in the soil. The α- and β-diversity of archaea and eukaryotes were significantly affected by planting patterns, while α- and β-diversity of the bacterial community were significantly affected by tillage practices. Both no-tillage and intercropped maize significantly increased the abundance of archaea phylum Thaumarchaeota and bacterial phylum Nitrospirae, benefiting nitrogen fixation of intercropped pea from the atmosphere under the no-tillage cereal/legume intercropping. No-till intercropping was conducive to the accumulation of organic carbon, while decreasing the abundance of Prote-obacteria, Acidobacteria, and Verrucomicrobia. Limited soil enzyme activities (ACP, ALP, DP, NAG, BG, AG, CB) led to decreases in organic carbon turnover and utilization. Intercropping al-tered soil microbial community diversity and composition due to changes in soil properties and enzyme activities. These findings suggest that no-tilled cereal-legume intercropping is a sustaina-ble cropping practice for improving soil properties and enhancing microbial (archaea, bacterial, Eukaryota) diversity, but the long-term persistence is not conducive to rapid turnover of soil nu-trients due to limited enzyme activities.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The utilization of tempered blast furnace (BF) slag through the direct fiber forming process to create high-value thermal insulation materials offers a dual benefit: it efficiently harnesses the latent heat within unused slag and substantially enhances the value of blast-furnace slag utilization. However, gauging the melting properties of iron slag under high temperatures is a challenge. In this study, we explore the melting behavior of SiO2 within a high-temperature molten pool. We employ dynamic visual data (video stream) captured via a non-contact charge coupled device (CCD) video recording system to extract SiO2 contours through image processing. The change in image centroid characteristics is used to establish a convolution function relationship, and MATLAB's traversal search algorithm determines SiO2's centroid position. Given that SiO2 is proportionate to crucible pixels, the area of SiO2 is calculated through pixel statistics within these contours. Subsequently, we propose a new indirect method to process image information, yielding SiO2 volume and mass at different time points. An exponential fitting yields the melting rate function of SiO2. Finally, we compare this indirect method with shape from shading (SFS), quantitative characterization, and dimensional analysis techniques. We also discuss the strengths and limitations of each method. Our findings reveal that the indirect solution method presented here boasts straightforward calculation steps and imposes minimal image format requirements. This research provides theoretical and technical support for blast-furnace slag's direct fiber forming process.

In a p-uniformly convex and uniformly smooth Banach space, let the pair of variational inequality and fixed point problems (VIFPPs) consist of two variational inequality problems (VIPs) involving two uniformly continuous and pseudomonotone mappings and two fixed point problems implicating two uniformly continuous and Bregman relatively asymptotically nonexpansive mappings. This article designs two parallel subgradient-like extragradient algorithms with inertial effect for solving this pair of VIFPPs, where each algorithm consists of two parts which are of symmetric structure mutually. Under mild registrations, we prove weak and strong convergence of the suggested algorithms to a common solution of this pair of VIFPPs, respectively. Lastly, an illustrative example is furnished to verify the applicability and implementability of our proposed approaches.

GNSS time series prediction plays a significant role in monitoring crustal plate motion, landslide detection, and maintenance of the global coordinate framework. Long Short-Term Memory (LSTM), a deep learning model has been widely applied in the field of high-precision time series prediction especially when combined with Variational Mode Decomposition (VMD) to form the VMD-LSTM hybrid model. To further improve the prediction accuracy of the VMD-LSTM model, this paper proposes a dual variational modal decomposition long short-term memory (DVMD-LSTM) model to effectively handle the noise in GNSS time series prediction. This model extracts fluctuation features from the residual terms obtained after VMD decomposition to reduce the prediction errors associated with residual terms in the VMD-LSTM model. Daily E, N, and U coordinate data recorded at multiple GNSS stations between 2000 and 2022 are used to validate the performance of the proposed DVMD-LSTM model. The experimental results demonstrate that compared to the VMD-LSTM model, the DVMD-LSTM model achieves significant improvements in prediction performance across all measurement stations. The average RMSE is reduced by 9.86%, and the average MAE is reduced by 9.44%. Furthermore, the average accuracy of the optimal noise model for the predicted results is improved by 36.50%, and the average speed accuracy of the predicted results is enhanced by 33.02%. These findings collectively attest to the superior predictive capabilities of the DVMD-LSTM model, thereby enhancing the reliability of the predicted results.

Soluble noble metal salts are widely used for loading noble metals as nano-catalysts in many applications. In this paper, Pt-SnO2 composite nanoceramics were prepared from SnO2 nanoparticles and H2PtCl6 using two Pt-loading methods separately: For the solution reduction method, the H2PtCl6 solution was added to a suspension of SnO2 and zinc powder to form Pt on SnO2 nanoparticles; and for the impregnation method, Pt was formed from H2PtCl6 in the course of sintering. Although a series of samples prepared using both Pt loading methods showed a strong response to H2 at room temperature, the ones prepared using the solution reduction method exhibited much better room temperature hydrogen sensing characteristics. For two samples of 0.5 wt% Pt and sintered at 825°C, the response value for the sample prepared using the solution reduction method was 5300 to 1% H2-20% O2-N2, which was much larger than that of 150 for the sample prepared using the impregnation method. Samples prepared using the two Pt loading methods have similar microstructures as characterized by XRD, FESEM, EDS, TEM, and HRTEM. However, the residual chlorine content in those using the impregnation method was found to be higher than that using the solution reduction method through analysis. It is proposed that the striking difference in the room temperature hydrogen sensing characteristics among samples prepared using these two different Pt loading methods separately resulted from their different chlorine removal process. This study demonstrates the importance of a proper method in loading noble metals from their soluble salts as nano-catalysts in many applications.

(1) Background: Proximal humerus fractures can be a debilitating condition if not properly treated. These fracture patterns are varied and differ in every patient. Functional outcomes may be determined by the integrity of the shoulder girdle involving the rotator cuff insertion. The post-operative resorption or malreduction of the greater tuberosity is an important factor contributing to the poor functional outcome of a patient. (2) Methods: A single-center retrospective comparative study was performed to evaluate the functional outcomes of patients undergoing operative fixation for this injury. A total of 387 consecutive cases treated operatively from 2019-2021 were included for analysis. (3) Results: 94 cases fulfilled our criteria for analysis. A matched-group comparison of 19 patients each was performed to compare demographics, post-operative fracture characteristics and functional outcomes. (4) Conclusions: The resorption or malreduction of the greater tuberosity contributes greatly to the prognostic outcome in patients treated with ORIF surgery. In our demographic study, obesity is another contributing factor affecting the parameters of post-operative reduction in proximal humerus fractures. Appropriate surgical planning and post-operative multidisciplinary care must be taken into consideration to attain a satisfactory prognostic outcome.

(1) Background: Breast cancer is the second leading cause of cancer death among women. The accurate prediction of survival intervals will help physicians make informed decisions on treatment strategies or the use of palliative care for patients; (2) Methods: The gene expression is predictive and correlates to patient prognosis. To establish a reliable prediction tool, we collected the RNA-seq data of breast cancer patients, a total of 1187 RNA-seq data (median age 58 years), in FPKM format from the TCGA database. Among them, 144 RNA-seq data with date of death information was selected to establish the SaBrcada-AD dataset. We first normalized the SaBrcada-AD dataset to transcripts per million (TPM) to build survival prediction model SaBrcada. After normalization and dimension raising, the differential gene expression data were used for testing eight different deep learning architectures. Among them, GoogLeNet performed the best. Considering the effect of age on prognosis, we examined all ages between the lower and upper quartiles of patient age for a stratified random sampling test; (3) Results: Stratifying by age based on a cut-off of 61 years of age improved the accuracy of SaBrcada compared to previous findings, resulting in an accuracy of 0.798. We also built a free website tool to provide 5 kinds of predicted survival period information for clinician reference; (4) Conclusions: We established a breast cancer survival analysis prediction model, SaBrcada, and a website tool with the same name. Through this highly reliable survival analysis model and website tool, information on survival intervals will be provided for clinicians as part of precision medicine.

Steam Generator Level Control System (SGLCS) is one of the key instrumentations and control subsystems to ensure the safe operation of nuclear power plants. It is highly recommended to perform reliability analysis for SGLCS for making better maintenance strategy. SGLCS is a digital control system with complex redundant configuration and failure\self-diagnosis\repair action, traditional fault tree is not applicable due to its static property, Markov model is not a good choice too because of heavy burden of creating state transition graph for even medium-size system. Boolean Logic Driven Markov Process (BDMP) can describe complex failure-repair state transition via ‘trigger link’ and three kinds of leaf nodes, as well as keep compact and easy-read struct like fault tree. So BDMP is adopted to analysis reliability of SGLCS. Graphical BDMP modeling environment KB3 and Monte Carlo simulator YAMS is used for BDMP modeling and quantitative analysis respectively, and unavailability of SGLCS is obtained. The contribution of three parts of SGLCS to the unavailability of the system is also evaluated, and it is found that the water supply flow control part contributes the most to the failure of SGLCS.

Patients with lean NAFLD make up an increasing subset of liver diseases. The association between lean NAFLD and feutin-A, which serves as a hepatokine and adipokine, has never been examined. Our study aimed to explore the association of serum fetuin-A among lean and nonlean patients. The study comprised 606 adults from the community, stratified into lean or nonlean (BMI </≥ 24 kg/m2) and NAFLD or non-NAFLD (scoring of ultrasonographic fatty liver indicator, US-FLI ≥ 2/<2). Multivariate logistic regression analyses were performed to estimate the odds ratio of having NAFLD among the tertiles of fetuin-A after adjustment. The least square means were computed by general linear models to estimate marginal means of the serum fetuin-A concentrations in relation to the NAFLD groups. The OR of having NAFLD for the highest versus the lowest tertile of fetuin-A was 2.62 (95% CI: 1.72-3.98; P for trend<0.001). Stratifying by BMI, the OR of having lean NAFLD for the highest versus the lowest tertile of fetuin-A was 2.09 (95% CI: 1.09-3.98; P for trend 0.026), while nonlean NAFLD had no significant association with the fetuin-A gradient after adjustments. Fetuin-A was positively associated with lean NAFLD after adjusting for central obesity and insulin resistance.

Recently, ice with the stacking disorder structure, consisting of random sequences of cubic ice (Ic) and hexagonal ice (Ih) layers, is reported to be more stable than pure Ih/Ic. While, due to a much lower free energy barrier of heterogeneous nucleation, in practice, the freezing process of water is usually controlled by heterogeneous nucleation which is triggered by an external medium. Herein, molecular dynamic simulations were carried out to explore the polymorph dependence of ice on the lattice structure of substrates. It turns out that, during the nucleation stage, the polymorph of ice nuclei can be severely altered by the graphene substrate, on which the Ih was found to occupy an absolute majority in new-formed ice. This can be attributed to the structure similarity between graphene and basal face of Ih. Besides the nucleation stage, our results suggest that the substrate can not affect the polymorph of ice which is far from the graphene surface. The polymorph selectivity of graphene to Ih will diminish with the growth of ice layer.

The purpose of this study was to arrange a green roof on a sheet metal house to achieve winter heat preservation and summer thermal insulation using different plants and soil media, and to maintain the advantage of cost-saving and quick installation of sheet metal houses. In terms of the research method, the roof insulation, heat preservation and plant growth index were tested. Plants were grown in 10 container-type green roofs on the sheet metal house roof, and the physical environment of the building was monitored for one year. Five containers of commercially-available culture soil and five containers of sustainable composite were used as the media for growing five kinds of plants, respectively. The control group only had a sheet metal house roof. There were 11 experimental modules for testing whether the green roofs had thermal insulation, heat preservation and plant growth effects on a general sheet metal house. The results showed that, regarding the thermal insulation benefit assessment, the Sedum acre cv. robustum of green roof Groups B to D caused the temperature to be 38.29°C lower than the surface of the simple sheet metal house roof in August, showing a temperature difference of 54%.

Electrical remodelling as a result of the homeodomain transcription factor 2 (Pitx2)‐dependent gene regulation was linked to atrial fibrillation (AF) and AF patients with single nucleotide polymorphisms at chromosome 4q25 responded favorably to Class I antiarrhythmic drugs (AADs). The possible reasons behind this remain elusive. The purpose of this study was to assess the efficacy of AADs disopyramide, quinidine, and propafenone on human atrial arrhythmias mediated by Pitx2-induced remodelling, from a single cell to the tissue level, using drug binding models with multi-channel pharmacology. Experimentally calibrated populations of human atrial action potential (AP) models in both sinus rhythm (SR) and Pitx2-induced AF conditions were constructed by using two distinct models to represent morphological subtypes of AP. Multi-channel pharmacological effects of disopyramide, quinidine, and propafenone on ionic currents were considered. Simulated results showed that Pitx2-induced remodelling increased maximum upstroke velocity (dVdtmax) and conduction velocity (CV), and decreased AP duration (APD) and wavelength (WL). At the concentrations tested in this study, these AADs decreased dVdtmax and CV and prolonged APD in the setting of Pitx2-induced AF. Our findings of alterations in WL indicated that quinidine and disopyramide may be more effective against Pitx2-induced AF than propafenone by prolonging WL.

Traditional discrimination techniques for Euler deconvolution use only the color spectrums of structural indexes, without considering the spatial distribution characteristics and inherent relationships among the Euler solutions to separate adjacent causative sources. In the present study, a new approach was developed for discriminating uncorrelated Euler solutions from coherent solutions based on the focusing levels indicated by the probability density distributions generated using multivariate kernel density estimations (KDE). A novel multiple coverage technique was proposed by using a series of different sized moving windows over gridded gravity data, which formed tight clusters of Euler solutions for different sized causative sources. The results of the probability density distributions were obtained using a 3-D KDE method for the Euler solution subsets {x, y, z} of synthetical models, and real data from a survey conducted in British Columbia (Canada) which had successfully established more credible and meaningful geological models when compared with three other subsets.

The formation of rock fractures in nature has a certain relationship with water seepage. In order to analyze the shape of rock fracture, we propose a rock deformation theoretical model in three-dimensional space considering with the condition of seepage water pressure, and establish the mass conservation equation, seepage equation, surrounding rock displacement equation, so as to deduce the rock deformation control equation under seepage pressure action. The numerical analysis of the nonlinear quadratic partial differential equation obtains the fracture deformation distribution in the example, and verifies with the calculated fracture morphology. And we further use this principle to analyze the fracture morphology in nature and prove the rationality of the theory.

Two low-C steels microalloyed with Nb were fabricated by simulated strip casting, one with Mo and the other without Mo. Both alloys were coiled at 900 °C to investigate the effect of Mo on the precipitation behaviour in austenite in low-C strip-cast Nb steels. The mechanical properties results show that during the coiling at 900 °C the hardness of both alloys increases and reaches a peak after 3000 s and then decreased after 10,000 s. Additionally, the hardness of the Mo-containing alloy is higher than that of the Mo-free alloy in all coiling conditions. Thermo-Calc predictions suggest that MC-type carbides exist in equilibrium at 900 °C, which are confirmed by transmission electron microscopy (TEM). TEM examination shows that precipitates are formed after 1000 s of coiling in both alloys and the size of the particles is refined by the addition of Mo. Energy dispersive spectroscopy (EDS) and electron energy loss spectroscopy (EELS) reveal that the carbides are enriched in Nb and N. The presence of Mo is also observed in the particles in the Nb-Mo steel during coiling. The concentration of Mo in the precipitates decreases with increasing particle size and coiling time. The precipitates in the Nb-Mo steel provide significant strengthening increments of up to 140 MPa, much higher than that in the Nb steel, ~ 96 MPa. A thermodynamic rationale is given, which explains that the enrichment of Mo in the precipitates reduces the interfacial energy between precipitates and matrix. This is likely to lower the energy barrier for their nucleation and also reduce the coarsening rate, thus leading to finer precipitates during coiling at 900 °C.

Exercise training influences the risk of vascular thrombosis in patients with peripheral arterial disease (PAD). Mitochondrial functionalities in platelets involve the cellular bioenergetics and thrombogenesis. This study aimed to elucidate the effect of cycling exercise training (CET) on platelet mitochondrial bioenergetics in PAD patients. Forty randomly selected patients with PAD engaged in general rehabilitation (GR) with CET (i.e., cycling exercise at ventilation threshold for 30 min/day, 3 days/week) (GR+CET, n=20) or to a control group that only received GR course (n=20) for 12 weeks. Systemic aerobic capacity and platelet mitochondrial bioenergetics that included oxidative phosphorylation (OXPHOS) and electron transport system (ETS) were measured using automatic gas analysis and high-resolution respirometry, respectively. The experimental results demonstrated that GR+CET for 12 weeks significantly (i) elevated VO2peak and lowered VE-VCO2 slope, (ii) raised resting ankle-brachial index and enhanced cardiac output response to exercise, (iii) increased the distance in 6-minute walk test and raised the Short Form-36 physical/mental component scores, and (iv) enhanced capacities of mitochondrial OXPHOS and ETS in platelets by activating FADH2 (Complex II)-dependent pathway. Moreover, changes in VO2peak levels were positively associated with changes in platelet OXPHOS and ETS capacities. However, no significant changes in systemic aerobic capacity, platelet mitochondrial bioenergetics, and health-related quality of life (HRQoL) occurred following GR alone. Hence, we conclude that CET effectively increases the capacities of platelet mitochondrial bioenergetics by enhancing Complex II activity in patients with PAD. Moreover, the exercise regimen also enhanced functional exercise capacity, consequently improving HRQoL in PAD patients.

Currently, there is no specific treatment for COVID-19 proven by clinical trials. WHO and CDC guidelines therefore endorse supportive care only. However, frontline clinicians have been applying several virus-based and host-based therapeutics in order to combat SARS-CoV-2. Medications from COVID-19 case reports, observational studies and the COVID-19 Treatment Guideline issued by the China's National Health Commission (7^th edition published March 3^rd, 2020. Edited translation attached) are evaluated in this review. Key evidence from relevant in vitro researches, animal models and clinical studies in SARS-CoV-2, SARS-CoV and MERS-CoV are examined. Antiviral therapies remdesivir, lopinavir/ritonavir and umifenovir, if considered, could be initiated before the peak of viral replication for optimal outcomes. Ribavirin may be beneficial as an add-on therapy and is ineffective as a monotherapy. Corticosteroids use should be limited without indicating comorbidities. IVIG is not recommended due to lack of data in COVID-19. Xuebijing may benefit patients with complications of bacterial pneumonia or sepsis. The efficacy of interferon is unclear due to conflicting outcomes in SARS and MERS studies. Chloroquine and hydroxychloroquine have shown in vitro inhibition of SARS-CoV-2 and may be beneficial as both prophylactic and treatment therapy. For patients who developed cytokine release syndrome, interleukin-6 inhibitors may be beneficial. Given the rapid disease spread and increasing mortality, active treatment with readily available medications may be considered timely prior to disease progression.

The manuscript reported the synthesis of Al2O3 nano-coating onto quartz fiber by plasma electrolysis spray for enhanced thermal conductivity and stability. The nano- and micro-sized clusters were partially observed on the coating, while most coating was relatively smooth. It was suggested that the formation of a ceramic coating was followed as the nucleation-growth raw, that is, the formation of the coating clusters was dependent on the fast grow-up partially, implying the inhomogeneous energy distribution in the electrolysis plasma. The deposition of the Al2O3 coating increased the annealing tensile strength from 19.2 MPa to 58.1 MPa. The thermal conductivity of the coated quartz fiber was measured to be 1.17 W m-1 K-1, increased by ~45% compared to the bare fiber. The formation mechanism of the Al2O3 coating was preliminarily discussed. We believe that the thermally conductive quartz fiber with high thermal stability by plasma electrolysis spray will find a wide range of applications in industries.

An improved anti-noise morphology vision navigation algorithm is proposed for intelligent tractor tillage in a complex agricultural field environment. At first the two key steps, Guided Filtering and improved anti-noise morphology navigation line extraction were addressed in detail. Then the experiments were carried out in order to verify the effectiveness and advancement of the presented algorithm. Finally, the optimal template and it’s application condition were studied for improving the image processing speed. The comparison experiment results show that the YCbCr color space has minimum time consumption of 0.094 s in comparison with HSV, HIS and 2R-G-B color spaces. The Guided Filtering method can effectively distinguish the boundary between the new and old soil than other competing vanilla methods such as Tarel, Multi-scale Retinex, Wavelet-based Retinex and Homomorphic Filtering inspite of having the fastest processing speed of 0.113 s. The extracted soil boundary line of the improved anti-noise morphology algorithm has best precision and speed compared with other operators such as Sobel, Roberts, Prewitt and Log. After comparing different size of image template, the optimal template with the size of 140×260 pixels can meet high precision vision navigation while the course deviation angle is not more than 7.5°. The maximum tractor speed of the optimal template and global template are 51.41 km/h and 27.47 km/h respectively which can meet real-time vision navigation requirement of the smart tractor tillage operation in the field. The experimental vision navigation results demonstrated the feasibility of the autonomous vision navigation for tractor tillage operation in the field using the new and old soil boundary line extracted by the proposed improved anti-noise morphology algorithm which has broad application prospect.

Ice covering on overhead transmission lines would cause damage to transmission system and long-term power outage. Among various de-icing devices, modular multilevel converter (MMC) based DC de-icer (MMC-DDI) is recognized as a promising solution due to its excellent technical performance. Its principle feasibility has been well studied, but few literature discuss its economy or hardware optimization, thus the designed MMC-DDI for high voltage transmission lines is usually too large and too expensive for engineering applications. To fill this gap, this paper presents a quantitative analysis on the converter characteristics of MMC-DDI, and calculates the minimal converter rating and its influencing factors. It reals that, for a given de-icing requirement, the converter rating varies greatly with its AC-side voltage. Then an optimization configuration is proposed to reduce the converter rating and improve its economy. The proposed configuration is verified in a MMC-DDI for a 500kV transmission line as a case study. The result shows, in the case of outputting same de-icing characteristics, the optimized converter rating is reduced from 151 MVA to 68 MVA, and total cost of MMC-DDI is reduced by 48%. This analysis and conclusion are conductive to the optimized design of multilevel DC de-icer, then to its engineering application.

A simple and effective surface modification of polyester fabrics with sulfuric acid to improve the interfacial deposition of polypyrrole was presented in our work. A range of sulfuric acid concentrations were analyzed by studying water contact angle. Effect of sulfuric acid modification on the deposition of polypyrrole was investigated by sheet resistance and color depth of fabric samples. Polyester fabrics coated with polypyrrole layer were confirmed by scanning electron microscopy (SEM), X-ray photoelectron spectroscopy (XPS), X-Ray diffraction spectra (XRD), Fourier transform infrared spectroscopy (FTIR). XPS showed that sulphur containing functional groups were obviously appeared on the polyester fiber surface after modification, which were advantageous to promote the deposition of polypyrrole onto polyester fabrics. The improved deposition increased electrical conductivity of fabric samples.

Over the past decades, overweight and obesity has become a global epidemic and the leading threat for death. To prevent the serious risk, an overweight or obese individual must apply a long-term weight-management strategy to control food intake and physical activities, which is however, not easy. Recently, with the advances of information technology, more and more people can use wearable devices and smartphones to obtain physical activity information, while they can also access various health-related information from Internet online social networks (OSNs). Nevertheless, there is a lack of an integrated approach that can combine these two methods in an efficient way. In this paper, we address this issue and propose a novel mobile-social framework for health recognition and recommendation, namely, H-Rec². The main ideas of H-Rec² include (1) to recognize the individual's health status using smartphone as a general platform, and (2) to recommend physical activity and food intake based on personal health information, life science principles, and health-related information obtained from OSNs. To demonstrate the potentials of the H-Rec² framework, we develop a prototype that consists of four important components: (1) an activity recognition module that senses physical activity using accelerometer, (2) a health status modeling module that applies a novel algorithm to generate personalized health status index, (3) a restaurant information collection module that collects relevant information from OSN, and (4) a restaurant recommendation module that provides personalized and context-aware recommendation. To evaluate the prototype, we conduct both objective and subjective experiments, which confirm the performance and effectiveness of the proposed system.

Quantum nonlocality represents correlation properties between subsystems of a composite quantum system, usually including the four types: Bell nonlocality, steerability, entanglement, and quantum correlation (quantum discord). Given a basis $e_{AB}=\{|e_{ij}\>\}_{i\in[d_A],j\in[d_B]}$ for the Hilbert space $\H_A\otimes \H_B$ of a bipartite system $AB$, a density operator $\rho^{AB}$ (quantum state) of $AB$ can be represented as a $d_Ad_B\times d_Ad_B$ matrix $\hat{\rho}_{e_{AB}}=[\]$, called the density matrix of a density operator $\rho^{AB}$. A natural question is what is the relationship between the quantum nonlocality of a density operator $\rho^{AB}$ and its corresponding density matrix $\hat{\rho}_{e_{AB}}$? In this work, we discuss the relationships between quantum locality and basis, and prove that one type of quantum locality of density operators and that of their density matrices under a basis are the same if and only if the chosen basis is the tensor product of the bases of subsystems. Consequently, different bases define different quantum nonlocality density operators.

With the rapid development of intelligent transportation, Vehicle Ad hoc Networks (VANETs) is becoming increasingly important.As a critical component of intelligent transportation systems, the Conditional Privacy-Preserving Authentication (CPPA) scheme plays a significant role in ensuring drivers' privacy and security.However, current CPPA schemes still face limitations in terms of security and efficiency, with these schemes either imposing higher computational overhead for enhanced security or compromising some level of security to reduce overhead. Motivated by this challenge, we propose a CPPA scheme that strikes a better balance between efficiency and security.By leveraging the token mechanism to achieve multiple authentication and minimizing information leakage. Furthermore, our performance analysis demonstrates that our ECC-based algorithm can significantly reduce overhead, with pseudonymous generation requiring only 0.0039ms.

The aim of this pilot study is to evaluate and compare the quality of the genomics and proteomics data obtained from paired formalin fixed paraffin embedded (FFPE) and frozen (FF) tissue percutaneous core biopsies of LIRADS 5 hepatocellular carcinoma (HCC) of varying histological grade. The preliminary data identified differentially expressed proteins and genes in poor, moderate and well differentiated HCC biopsies, with a greater efficacy in fresh frozen samples.

Defect detection plays a pivotal role in quality control for fabrics. In order to enhance the accuracy and efficiency of fabric defect detection, we have proposed the PRC-Light YOLO model for fabric defect detection and have established a detection system. Firstly, we add new convolution operators in Backbone for the YOLOv7 and integrate them with Extended-Efficient Layer Aggregation Network. This combination constructs a new feature extraction module that not only reduces the computational effort of the network model, but also extracts spatial features effectively. Secondly, we employ multi-branch dilated convolutions feature pyramid, and introduce lightweight upsampling operators to improve performance of the feature fusion network. This module achieves an expanded receptive field by generating real-time adaptive convolution kernels, allowing for the collection of crucial information from regions with a richer contextual context. To further minimize the computation during network model training, we adopt the HardSwish activation function. Finally, we apply the Wise-IOU v3 bounding box loss function as a dynamic non-monotonic focusing mechanism, which decreases adverse gradients from low-quality instances. We conduct data augmentation on real fabric dataset to raise the generalization capability of the PRC-Light YOLO model. Compared with the YOLOv7 model, numerous simulation experiments show that our proposed methods reduce the model’s parameters and computation by 18.03% and 20.53%, respectively. Simultaneously, there has been a 7.6% improvement in mAP.

MicroRNAs (miRNAs) play a pivotal role in important biological processes by regulating posttranscriptional gene expression and exhibit differential expression patterns during development, immune responses, and stress challenges. The diamondback moth causes significant economic damage to crops worldwide. Despite substantial advancements in understanding the molecular biology of this pest, our knowledge regarding the role of miRNAs in regulating key immunity-related genes remains limited. In this study, we leveraged whole transcriptome resequencing data from P. xylostella infected with Metarhizium anisopliae to identify specific miRNAs targeting the prophenoloxidase-activating protease1 (PAP1) gene through bioinformatic analysis. Seven miRNAs (pxy-miR-375-5p, pxy-miR-4448-3p, pxy-miR-279a-3p, pxy-miR-3286-3p, pxy-miR-965-5p, pxy-miR-8799-3p and pxy-miR-14b-5p) were identified and validated. Luciferase reporter assays confirmed that pxy-miR-279a-3p binds to the open reading frame (ORF) and pxy-miR-965-5p to the 3’ untranslated region (3’ UTR) of PAP1. Our experiments demonstrated that injecting a pxy-miR-965-5p mimic significantly reduced PAP1 expression in P. xylostella larvae, suppressing PO activity and increasing larval mortality rate. Conversely, the injection of inhibitors obtained opposite results. Furthermore, we identified four LncRNAs (MSTRG.32910.1, MSTRG.7100.1, MSTRG.6802.1, and MSTRG.22113.1) that potentially interact with pxy-miR-965-5p. Interference assays using antisense oligonucleotides (ASO) revealed that silencing MSTRG.7100.1 and MSTRG.22113.1 increased the expression of pxy-miR-965-5p. These findings shed light on the potential role of pxy-miR-965-5p in the immune response of P. xylostella to M. anisopliae infection and provide a theoretical basis for biological control strategies targeting the immune system of this pest.

Scaffolds used for tissue/ bone defect repair must possess versatile properties suitable for each specific application. The issue of antibiotic resistance poses a significant challenge in bone tissue engineering especially when dealing with microbial infections. The most effective approach to address this challenge is to promote the integration of tissue before bacteria can adhere to it, hence preventing the proliferation of certain bacterial strains on the implant. The utilization of 3D printing and or the use of various composite polymers in scaffolds to create antibacterial scaffolds that possess both adequate mechanical strength and exceptional biocompatibility is an attractive approach for addressing the challenges associated with microbial infections in tissue. Herein, a new phage functionalized scaffold was created through surface charge modification of the composite scaffold with polyethyleimine (PEI). Afterwards, the PEI polymerized Scaffolds were incubated with phage lysate for approximately 2h prior to rinsing with ethanol. The morphological and physiochemical properties of formed scaffold were assessed through Raman spectrophotometry while the antibacterial assays were done through growth inhibition zones/ cell viability assays. The polymerized phage composite SF20_PEI.AR9 possessed the highest antimicrobial effect with clear inhibition zones of about 78.30 mm. This could be attributed to the lytic effect of phages on the bacterial cells. Moreover, the enhanced phage effect on the scaffolds was also associated to the improved surface charge on the scaffold, 78,3±7,6 mm which ultimately promoted phage scaffold interface integration hence the high antibacterial activity. The PEI polymerization approach could serve as a model for future development of phage scaffolds.

Natural montane peatlands generally are not a significant source of nitrous oxide (N₂O) due to environment limitation including phosphorus (P) scarcity and temperature lowness. Phosphorus enrichment and warming caused by global change are altering this limitation, likely to increase the source function of N₂O. However, the combined effects of P addition and warming on N₂O fluxes and biotic/abiotic factor in peatlands are still uncertain. To address this, we investigated the long-term (12 yrs) effects of P addition (5 and 10 kg ha^-1 yr^-1) and its interaction with warming on N₂O fluxes in a peatland. The results showed that although long-term P addition did not significantly affect the source/sink function of N₂O in the peatland, it stimulated enzyme activities, promoted peat decomposition. However, warming amplified the effect of P addition to increase N₂O emissions by stimulating enzyme activities and changing soil stoichiometry, even turned the peatland into a significant source of N₂O with an emission of approximate 100 g m^-2 during the growing season. Our study suggests that P enrichment under the current background of global warming will enhance the possibility of strong N₂O emissions in montane peatlands, which may increase the risk to further aggravate global warming.

Crossostephium chinense is a wild species with strong salt tolerance, which has great potential to improve the salt tolerance of cultivated chrysanthemums. Conversely, the unique salt-tolerant molecular mechanisms of Cr. chinense are still unclear. This study performed a comparative physiological and transcriptome analysis of Cr. chinense, Chrysanthemum lavandulifolium and their hybrids. The physiological results showed that Cr. chinense maintained a higher superoxide dismutase (SOD) activity, to alleviate the oxidative damage to membrane. KEGG enrichment analysis showed that the plant hormone signaling transduction and the MAPK signaling pathway were mostly enriched in Cr. chinense and hybrids under salt stress. Further weighted gene co-expression network analysis (WGCNA) of DEGs suggested that the abscisic acid (ABA) signaling transduction may play a significant role in the salt-tolerant mechanisms of Cr. chinense and hybrids. The tissue-specific expression patterns of the candidate genes related to ABA signaling transduction and MAPK signaling pathway indicated that genes related to ABA signaling transduction performed significant expression levels under salt stress. This study provides a theoretical foundation for future research into the molecular mechanism of salt tolerance in chrysanthemums under salt stress.

This paper explores the use of different deep learning models for predicting precipitation in 56 meteorological stations in Jilin Province, China. The models used include Stacked-LSTM, Transformer, and SVR, and Gaussian noise is added to the data to improve their robustness. Results show that the Stacked-LSTM model performs the best, achieving high prediction accuracy and stability. The study also conducts variable attribution analysis using LightGBM and finds that temperature, dew point, precipitation in previous days, and air pressure are the most important factors affecting precipitation prediction, which is consistent with traditional meteorological theory. The paper provides detailed information on the data processing, model training, and parameter settings, which can serve as a reference for future precipitation prediction tasks. The findings suggest that adding Gaussian noise to the dataset can improve the model's generalization ability, especially for predicting days with zero precipitation. Overall, this study provides useful insights into the application of deep learning models in precipitation prediction and can contribute to the development of meteorological forecasting and applications.

In order to study the acoustic emission characteristics of sandstone under the action of the high temperature-water cooling cycle, the RMT-150B electro-hydraulic servo rock test system and the DS-5 acoustic emission detection and analysis system were used to conduct a single analysis of the sandstone after the high temperature-water cooling cycle. Experimental study on acoustic emission characteristics under axial compression, analyzing the deformation, strength and acoustic emission characteristics of sandstone under different temperatures and cycles. The results of the study show that the high temperature-water cooling action causes changes in the physical properties of the sandstone. The expansion rate of the rock sample decreases first and then increases when the temperature rises, and the strength first increases and then decreases. The number of cycles has little effect on the physical properties of the rock sample; sandstone acoustic emission ringing count increases with the increase of temperature and cycle times, acoustic emission activities become more frequent with the loading process; with the increase of cycle times and temperature, acoustic emission ringing counts and accumulative acoustic emission energy appear earlier The rock sample enters the elastic deformation stage ahead of schedule, the yielding period increases, and the rock sample presents a trend of transition from brittle failure to ductile failure; the ringing count and cumulative energy increase with the increase in temperature and cycle times, and the high-energy ringing count and cumulative energy increase. The simultaneous sharp increase of the rock sample is the harbinger of the failure and instability of the rock sample.

Selenium (Se) is an essential trace element for human beings and Se supplementation is of great significance. In this paper, high selenized Gastrodia elata Blume Polysaccharides (SeGEP) were obtained through pre-sulfation before conducting the selenylation modification process, which owned a maximum Se content reach to 2.29%. UV, FT-IR, NMR, SEM, EDX, HPLC, size-exclusion chromatography and periodate oxidation analysis showed that the seleninic group had been successfully introduced into GEP with the substitution position at C-6 of glucose. Immunostimulating assays were conducted in vitro and in vivo on RAW 264.7 cells and cyclophosphamide (CTX)-induced mice model, respectively. The results showed that Se-GEP enhanced RAW264.7 cells proliferation, cell phagocytosis, and secretion of nitric oxide (NO) and interleukin (IL)-1β factors. In addition, Se-GEP enhanced the immunologic activity of CTX-treated mice by increasing the spleen and thymus indices, enhancing the phagocytic function, and activating both Th1 and Th2 lymphocytes. The current outcome also suggested that Se-GEP with covalently bonding Se group possessing increased safety and has a potential dietary selenium nutrient for improving human immunity.

Prostate-specific membrane antigen (PSMA) is a well validated prostate cancer marker, but reported PSMA-targeted tracers derived from the Lys-urea-Glu pharmacophore including the clinically validated [99mTc]Tc-EDDA/HYNIC-iPSMA have high off-target uptake in kidneys, spleen and salivary glands. In this study, we synthesized and evaluated three novel 99mTc-labeled PSMA-targeted tracers and investigated if the tracers derived from the Lys-urea-Aad pharmacophore could have minimized uptake in off-target organs/tissues. In vitro competition binding assays showed that compared with HYNIC-iPSMA, the three novel ligands had slightly weaker PSMA binding affinity (average Ki = 3.11 vs 8.96 - 11.6 nM). Imaging and ex vivo biodistribution studies in LNCaP tumor-bearing mice showed that [99mTc]Tc-EDDA/HYNIC-iPSMA and the three novel tracers successfully visualized LNCaP tumor xenografts in SPECT images and were excreted mainly via the renal pathway. The average tumor uptake at 1 h post-injection varied from 5.40 to 18.8 %ID/g, and the tracers derived from the Lys-urea-Aad pharmacophore had much lower uptake in spleen and salivary glands. Compared with the clinical tracer [99mTc]Tc-EDDA/HYNIC-iPSMA, the Lys-urea-Aad derived [99mTc]Tc-EDDA-KL01127 had lower background uptake and superior tumor-to-background contrast ratios, and is therefore promising for clinical translation to detect prostate cancer lesions with SPECT.

Metal plasmonic nanostructures have promising applications in biosensing due to their ability to facilitate light-matter interaction. However, the damping of the metal leads to a wide full width at half maximum (FWHM) spectrum and results which restricts its sensing capabilities. In this research, we present a novel non-full-metal nanostructure, namely indium-tin oxide (ITO)-Au nanodisk arrays consisting of top ITO nanodisk arrays and a bottom gold layer, and compare the coupling mode with the full-metal nanodisk arrays. The FWHM of proposed ITO-Au nanodisk array reduces to one fifth of that all metal nanodisk arrays, which is generated mode-coupling by surface plasmon modes at metal interfaces with magnetic resonance mode. Furthermore, the thickness variation of nanodisks has no impact on the sensing performance of this ITO-based nanostructure, ensuring excellent tolerance during preparation. We fabricated both structures by using template transfer and vacuum deposition techniques and calibrated their sensing performances by detect Immunoglobulin G (IgG) protein molecules. Both theoretical and experimental results demonstrate that ITO-Au nanodisk arrays provide an effective solution for biosensing applications.

Lithium-sulfur (Li-S) battery has been regarded as an important candidate for the next-generation energy storage system due to its high theoretical capacity (1675 mAh g-1) and high energy density (2600 Wh kg-1). However, the shuttle effect of polysulfide seriously affects the cycling stability of the Li-S battery. Here, a novel Fe3C decorated folic acid-derived graphene-like N-doped carbon sheet (Fe3C@N-CS) was successfully prepared as the polysulfide catalyst to modify the separator of Li-S battery. The porous layered structures can successfully capture polysulfide as a physical barrier, and the encapsulated Fe3C catalyst can effectively trap and catalyze the conversion of polysulfide, thus accelerating the redox reaction kinetics. Together with the highly conductive networks, the cell with Fe3C@N-CS modified separator evinces superior cycling stability with 0.06% capacity decay per cycle at 1 C rate over 500 cycles and excellent specific capacity with an initial capacity of 1260 mAh g-1 at 0.2 C. Besides, at a high sulfur loading of 4.0 mg cm-2, the batteries also express superb cycle stability and rate performance.

In past years, lithium-ion batteries (LIBs) can be found in every aspect of life, and batteries, as energy storage systems (ESSs), need to offer electric vehicles (EVs) more competition to be accepted in markets for automobiles. Thick electrode design could reduce the use of non-active materials in batteries that its energy density would be improved and its cost would be cut. However, thick electrodes are limited by their weak mechanical stability and poor electrochemical performance, these limitations could be classified as the critical cracking thickness (CCT) and the limited penetration depth (LPD). The understanding of the CCT and the LPD have been proposed and the recent works on breaking the CCT and improving the LPD are listed in this article. By comprising these attempts, some thick electrodes could not offer higher mass loading or higher accessible areal capacity that would defeat the purpose.

Carrot juice and its associated beverage products are well-known healthy drinks all over the world. However, what effect carrot juice has on the human gut microbiota and how it is fermented by the intestinal microbes have not been studied. Here, using an in vitro model of anaerobic fermentation, we demonstrated that carrot juice could be fermented into lactate and acetate by the human gut microbiota. 16S high-throughput sequencing and bioinformatic analyses indicated that fermentation of carrot juice could significantly change the composition of the human gut microbiome. Interestingly, carrot juice remarkably increased the abundances of beneficial bacteria, including Lactobacillus fermentum, Lactobacillus salivarius, Lactobacillus mucosae and Bacteroides uniformis and decreased the population of opportunistic pathogenic bacteria, such as Enterococcus faecium in the gut. Collectively, our study illustrates a favorable effect of carrot juice on the human gut microbiota and lays a foundation for the development of carrot juice as a novel prebiotic agent.

Ovarian cancer is the most frequent cause of deaths in gynecologic malignancies. Many possible mechanisms have been proposed via RNAseq and DNAseq technique recently. However, the driving factors are still obscure. The possible reasons are attributed to the incomplete human reference. This study integrated the canonical mapping-based and mapping-free protocols to extract reliable variations and novel events. We eventually obtained 450 reliable SNVs from the WES data and novel events from the RNAseq data, including 154 SNVs, 462 intron events, two repeats and six splice events. We identified six differentially expressed genes and six contigs that are significantly related to survival prognosis. The recurrent SNVs in significantly differentially expressed genes can be validated in an independent cohort of 20 Chinese ovarian cancer patients.

Emerging pollutants as pharmaceuticals have been focusing international attention for few decades. Ciprofloxacin (CIP) is a common drug widely found in effluents from hospitals, industrial and different wastewater treatment plants, as well as rivers. In this work, the lab-scale 3D-BER system was established, and more than 90% of the antibiotic CIP removal from the Low C/N wastewater. Best results were obtained with current intensity, and different C/N ratio significantly improve the removal of CIP and nitrates, when the ideal conditions were; C/N = 1.5-3.5, pH =7.0-7.5, and I = 60 mA. The highest removal efficiency of CIP = 94.20 %, NO3--N= 95.53 % and total nitrogen (TN) = 84.27 %, respectively. In this novel system, the autotrophic-heterotrophic denitrifying bacteria played vital role for the removal of CIP and enhanced denitrification process. Thus, autotrophic denitrifying bacteria uses CO2 and H2 as carbon sources to reduce nitrates to N2. This system has the assortment and prosperous community revealed at the current intensity of 60 mA, and the analysis of bacterial community structure in effluent samples fluctuates under different condition of C/N ratios. According to the results of LC-MS/MS analysis, the intermediate products were proposed after efficient biodegradation of CIP. Microbial community on biodegrading was mostly found at phylum, and class level was dominantly responsible for the NO3--N and biodegradation of CIP. This work can provide some new insights towards the biodegradation of CIP and the efficient removal of nitrates from low C/N wastewater treatment by the novel 3D-BER system.

Product innovation is a crucial factor in enterprise survival. Even though there are sources from strategic theory that guides the clear comprehension towards appreciating the nexus between these two variables (product innovation and enterprise survival), there are still many lacunas that should be addressed and filled. Consequently, the need for additional empirical corroboration or support is pertinent. This study aimed at verifying the nexus between product innovation and enterprise survival, and how they are affected by the existence of antecedent variables such as competitive intensity and competitive advantage. In the methodology, this study adopts the conduct of explanatory and cross-sectional investigations through the use of structural equation modelling (SEM) to a sample of selected food and beverages enterprises in Lagos, Nigeria. Regarding the food and beverage enterprises in Lagos, Nigeria, this study discovered that competitive intensity has huge positive implication on product innovation at (0.39; t = 5.69, p < 0.05). This gives numerical evidence that, in the face of more market competition, enterprises will be pressured to adopt the model of costs reduction on products which will enhance the reduction of product prices, and will have significant impact on profit. However, the findings reveal that there is no significance between competitive advantage and product innovation at (0.002; t = 0.203, p > 0.05), and there is no significance between product innovation and enterprise survival at (-0.035; t = -1.583, p > .05). As a result, the food and beverage enterprises should concentrate more on product innovation so that they will be able to stand the intensity of competition. The results emanated from the study is germane as it make significant contribution to literature and the body of knowledge and on strategic management by enlightening that competitive intensity is a necessary inducement for product innovation.

Carboxylic acids such as acetic acid and propionic acid have been investigated as representative components for fast pyrolysis (FP) bio-oil upgrading. Selective catalytic conversion of carboxylic acids can enhance bio-refinery processing economics through catalyst preservation and process intensification. Various metal-doped molybdenum carbide bead catalysts have been synthesized and developed in this work. Our aim is to enable selective conversion of carboxylic acids. In the case of acetic acid conversion, calcium doped Mo₂C beads offer the highest yield of acetone ~96% at 450 °C among undoped and Ca or Ni doped catalysts. By comparing hot gas filter with and without Ca-Mo₂C catalyst tested with real FP vapors, the former showed a 36.7% reduction of acetic acid, a 37.5% reduction of small ketones in aqueous phase, and a ~50% reduction of methoxies (methoxy phenols and methoxy aromatics) in organic phase. The conversion resulted in the formation of more long chain chemicals in the organic phase, which are more amendable for downstream upgrading.

Small peptides (SPs), ranging from 5 to 100 amino acids, play integral roles in plants due to their diverse functions. Despite their low abundance and small molecular weight, SPs intricately regulate critical aspects of plant life, including cell division, growth, differentiation, flowering, fruiting, maturation, and stress responses. As vital mediators of intercellular signaling, SPs have garnered significant attention in plant biology research. This comprehensive review delves into SPs' structure, classification, and identification, providing a detailed understanding of their significance. Additionally, we summarize recent findings on the biological functions and signaling pathways of prominent SPs that regulate plant growth and development. The review also offers a forward-looking perspective on future research directions in peptide signaling pathways.

(1) Background: Alzheimer’s disease (AD) presents a significant challenge in terms of discovering novel diagnostic methods and therapies. Previous research has shed light on the neuroprotective properties of Apelin-13 in neurodegenerative disorders. However, elucidating the mechanism underlying its efficacy in combating AD-related nerve injury is imperative. In this study, we aimed to investigate the mechanism of action of Apelin-13 in an in vivo model of AD induced by streptozocin (STZ); (2) Methods: We utilized an STZ-induced nerve injury model of AD in mice to investigate the effects of Apelin-13 administration. The Apelin-13 was administered intranasally, and cognitive impairment was assessed using standardized behavioral tests. The main methods included behavioral assessment, histological analysis, and biochemical assays to evaluate synaptic plasticity and oxidative stress signaling pathways; (3) Results: Our findings indicate that intranasal administration of Apelin-13 ameliorated cognitive impairment in the STZ-induced AD model. Furthermore, we observed that this effect was potentially mediated through the enhancement of synaptic plasticity and attenuation of oxidative stress signaling pathways; (4) Conclusions: The results of this study suggest that intranasal administration of Apelin-13 holds promise as a therapeutic strategy for preventing neurodegenerative diseases such as AD. By improving synaptic plasticity and mitigating oxidative stress, Apelin-13 may offer a novel approach to neuroprotection in AD and related conditions.

In China's mountainous coastal terrain, the storm badly damaged low-rise buildings. At present, it is not clear how the relative position of buildings and mountains affects the surface of a low-rise building’s fluctuating coefficient. The study compared these results with the wind pressure distribution without the surrounding environment. The primary objective of this study is to examine the fluctuating coefficient variation rule based on the spacing between hillsides and buildings under 0° wind angle. Additionally, the study analyzes the fluctuating wind pressure coefficient across wind angles between 0°~90°. The distribution of wind pressure in different common hillside landforms was examined through a wind tunnel experiment, which also compared with the distribution in an open environment. The study examined the fluctuating coefficient as the distance between the building and the hillside changed, specifically for wind blowing at a 0° angle. Next, an analysis is conducted on the changing pattern of the fluctuating coefficient for low-rise buildings ranging from a wind angle of 0° to 90°. Simultaneously, the investigation examined the power spectrum and wind pressure’s probability distribution, while considering the proximity of the building to an adjacent hill. The findings indicated that the changing wind pressure factor on the surface of the structure differed based on the relative location of the hillside and the building. The roof's wind pressure coefficient fluctuated and gradually increased until it reached its peak, unaffected by the surroundings. The low-frequency energy decreased in windward eaves, while the high-frequency energy progressively rose as the distance between the hillside and the building increased. The wind pressure on the leeward side exhibited Gaussian characteristics in its probability distribution.

Selenium nanoparticles (SeNPs) has higher bioavailability and safety than inorganic selenium, and was widely used in medical, agricultural, nutritional supplements, and antibacterial fields. The present study screened a strain L11 producing SeNPs from a selenium rich dairy cow breeding base in Hubei Province, China. The strain was identified as Bacillus subtilis through physiological, biochemical, and molecular biology analysis. Through optimization of cultivation conditions, the optimal cultivation parameters for L11 to produce SeNPs were pH=6, cultivation temperature of 37 °C, 4 mmol/L Na2SeO3, and cultivation for 48 hours. XPS, SEM-EDS, and TEM were used to verify that the Se particles produced by L11 are SeNPs with diameters ranging from 50 to 200 nm. The combination of protein analysis of different cell components and TEM analysis showed that L11 mainly produces SeNPs through the transformation of the cell's periplasmic space, cell membrane, and cell wall. Adding L11 SeNPs complex to sheep feed can significantly enhance the antioxidant activity and immunity of sheep, and increase the Se content in the neck muscles, liver, and spleen tissues.

In order to the effect of hydrated phase change materials on suppressing coal spontaneous combustion, the thermogravimetric experiment and reaction activation energy analysis experiment were used to explore the changes of combustion characteristic, parameters characteristic temperature and activating energy of gas coal, long flame coal, meagre coal, and lean coal before and after adding hydrated phase change materials. The research results showed that hydrated phase change materials increased the coal samples’characteristic temperature point and have effective inhibitory effects on different stages of oxidation process.However, the effect was best at low temperatures, as hydrated phase change materials undergo phase change and absorb heat when heated at low temperatures, isolating coal from contact with oxygen. The activating energy increased by 1.138 KJmol-1～23.048 KJmol-1 and the mass loss reduced by 1.6%～9.3% after the inhibition of the coal sample,indicating that the oxidation rate of various coal samples can be slowed down and the spontaneous combustion can be suppressed by using hydrated phase change materials.At the same time, this material can also reduce the combustibility index of meagre coal and lean coal, as well as the comprehensive combustion index and maximum loss rate of long flame coal and gas coal.

To achieve a micro-destructive and rapid measurement of the wood density of standing trees, this study investigated the feasibility of using the micro-drilling resistance method, formulated a mathematical model, explored the potential for a unified model across multiple tree species, and analyzed the influence of moisture content on measurement accuracy. First, 231 tree cores and drill resistance data were sampled from Pinus massoniana, Cunninghamia lanceolate, and Cryptomeria fortunei. The basic density and moisture content of each core were measured, and the average value of each resistance data record was calculated. Second, the average drill resistance, the natural logarithm of average drill resistance, and absolute moisture content were used as independent variables, while the wood basic density was used as the dependent variable. Third, the total model of the three tree species and sub-model for each tree species were established through a stepwise regression method. Finally, the accuracy of each model was compared and analyzed with that of using the average basic density of each tree species as an estimated density. The results revealed that the estimation accuracy of the sub-model for each tree species was 1.670 percentage points higher than the average value of each tree species used as the density estimation value for these tree species. Additionally, except for Cryptomeria fortunei, the natural logarithm of drill resistance significantly influenced the wood density model at a significance level of 0.05. Moreover, moisture content significantly affected the total model and sub-models of Pinus massoniana at a significance level of 0.05. The estimation accuracy of the total mathematical model was 2.125 percentage points lower than that achieved using the average basic density of each tree species to predict their density. The results indicated the feasibility of using the micro-drilling resistance method to measure the wood density of standing trees. Moreover, the relationship between wood density and drill resistance did not follow a linear pattern, and moisture content slightly influenced the drill needle resistance. Furthermore, the establishment of a mathematical model for each tree species was deemed essential. This study provides valuable guidance for measuring the wood density of standing trees through the micro-drilling resistance method.

The use of ARPIs has led to an increase in the proportion of AR-null prostate cancer, including NEPC and DNPC, but the mechanism underlying this lineage transition has not been elucidated. We found that ID2 expression was increased in AR-null prostate cancer. In vitro and in vivo studies confirmed that ID2 promotes PCa malignancy and can confer resistance to enzalutamide in PCa cells. We generated a ID2 UP50 signature, which is capable to determine resistance to enzalutamide and also valuable for predicting patient prognosis. Functional experiments showed that ID2 could activate the stemness-associated JAK/STAT and FGFR signaling while inhibiting the AR signaling pathway. Our study indicates that ID2 promotes the acquisition of a stem-like phenotype in adenocarcinoma cells, leading to resistance to ADT and next-generation ARPIs in prostate cancer.

It is always a difficult task to assign the peaks recorded from vibrational spectrum. Herein we explored a new pathway of density functional theory (DFT) simulation to present three kinds of spectra of ice XIV and can be referenced as inelastic neutron scattering (INS), IR, and Raman experimental spectrum. The INS spectrum is proportional to phonon density of states (PDOS) while the photon scattering signals reflect the normal vibration frequencies near the Brillouin zone (BZ) center. Based on good agreements with experimental data, we identified the relative frequency and made scientific assignments by normal vibration modes analysis. The debating two hydrogen bond (H-bond) peaks among ice phases from INS have been discussed and the dynamic process of H-bond vibrations were found to be classified into two basic modes. we deduce that two H-bond modes are a general rule among ice family and more works are ongoing to investigate this subject.

Artificial intelligence technologies based on deep convolutional neural networks and large lan-guage models have made significant breakthroughs in many tasks such as image recognition, target detection, semantic segmentation and natural language processing, but also face the problem of contradiction between the high computational capacity of the algorithms and the limited deployment resources. Quantization, which converts floating-point neural networks into low-bit-width integer networks, is an important and essential technique for efficient deploy-ment and cost reduction in edge computing. This paper analyze various existing quantization methods, showcase the deployment accuracy of advanced techniques, and discuss the future challenges and trends in this domain.

The rapid urbanization in China has significantly contributed to the vast expansion of urban built-up areas. Precisely extracting and monitoring these areas is crucial for understanding and optimizing the developmental process and spatial attributes of smart, compact cities. However, most existing studies tend to focus narrowly on a single city or global scale with a single dimension, often ignoring mesoscale analysis across multiple urban agglomerations. In contrast, our study employs GIS and image processing techniques to integrate multi-source data for the identification of built-up areas. We specifically compare and analyze two representative urban agglomerations in China: the Yangtze River Delta (YRD) in the east and the Chengdu-Chongqing (CC) region in the west. We use different methods to extract built-up areas from socio-economic factors, natural surfaces, and traffic network dimensions. Additionally, we utilize a high-precision built-up area dataset of China as a reference for verification and comparison. Our findings reveal several significant insights: (1) The multi-source data fusion approach effectively enhances the extraction of built-up areas within urban agglomerations, achieving higher accuracy than previously employed methods. (2) Our research methodology performs particularly well in the CC urban agglomeration. The average precision rate in CC is 96.03%, while the average precision rate in YRD is lower at 80.33%. This study provides an objective and accurate assessment of distribution characteristics and internal spatial structure of built-up areas within urban agglomerations. This method offers a new perspective for identifying and monitoring built-up areas in Chinese urban agglomerations.

The Shule River Basin (SRB) is a typical arid area in northwest China with a fragile ecology. Un-derstanding vegetation dynamics and its response to climate change and human activities provides essential information for ecological and environmental resource management. This study extracted fractional vegetation coverage (FVC) data from 2000 to 2019 using the Google Earth Engine plat-form and Landsat satellite images, employing trend analysis and other methods to examine spati-otemporal changes in vegetation in the SRB. Additionally, partial correlation and residual analysis were utilized to explore the response of FVC to climate change and human activities. The main results were as follows: (1) The regional average FVC in the SRB showed a significant upward trend from 2000 to 2019, increasing by 1.3 × 10−3 y–1. The area within 1 km of roads experienced a higher increase of 3 × 10−3 y–1, while the roadless areas experienced a lower increase of 1.1 × 10−3 y–1. Road construction from 2004 to 2006 significantly reduced the FVC within 200 meters of the roads. FVC spatial heterogeneity in the SRB is significant. (2) Partial correlation analysis shows that FVC has a strong positive correlation with precipitation and surface water area, with correlation coefficients of 0.575 and 0.744, respectively. There is a weak negative correlation between FVC and land surface temperature (LST). FVC changes are more influenced by precipitation than by LST. (3) Compared to climate factors, human activities have a greater impact on vegetation dynamics in the SRB. The contributions of climate change to vegetation recovery are increasing. (4) The area changes of dif-ferent land types are closely related to climate factors and human activities, reflecting their impact on vegetation. These results provide valuable information for ecosystem restoration and environ-mental protection in the SRB.

This research focuses on the Hopf bifurcation occurring at a singular point with high-order degeneracy in a class of three-dimensional systems. Based on center manifold theorem, by expanding the technique for determining singular point values of degenerate singularities in two-dimensional systems, the formal series method to determine the singular point values at the high-order degenerate critical point is discussed. Furthermore, a class of specific three-dimensional differential systems with high-order degenerate singularities is explored. By computing the singular point values and determining center conditions, we proved that a minimum of 5 small-amplitude limit cycles in the vicinity of the origin. This research provides new perspectives on the center problem and limit cycle bifurcation in high-dimensional systems with high-order degenerate singular points.

: AliCPT-1 is the first Cosmic Microwave Background (CMB) experiment in China, dedicated to achieve accurate measurements of B-mode polarization. Situated in Ali of Tibet, China, this telescope is currently undergoing deployment and will operate in two frequency bands centered at 90 and 150 GHz. The Far-Field Flat Mirror（FFF）is a calibration device of AliCPT-1 telescope for far-field beam mapping. The design of FFF is optimized for easy assembly and adjustment. Meteorological station data reveals that the maximum wind speed near FFF is 17.5 m/s, while the maximum wind speed on the windward side is 8 m/s. The wind pressure on FFF was analysed using a maximum wind speed of 17.5m/s as the input condition, based on the fluid-structure coupling method in ANSYS. The results demonstrate that it is safe and reliable when withstanding combined gravity and wind pressure loads. The torque on the mount is within the motor rated torque. The flatness of the FFF reflective surface can be adjusted to an RMS value of 0.05 mm when taken into account the effect of gravity and assembly accuracy. The deformation caused by the maximum wind loads is approximately 0.0587 mm under the protection of wind-proof wall. The combined deformation is 0.077 mm in RMS value combining the two influences, which is less than 1/20 of wavelength. The FFF mirror assembly is stable and precisely for telescope calibration.

Heat dissipation from Li-ion batteries is a potential safety issue for large-scale energy storage applications. Maintaining low and uniform temperature distribution, and low energy consumption of the battery storage is very important. We studied the fluid dynamics and heat transfer phenomena of a single cell, 16-cell modules, battery packs, and cabinet through computer simulations and experimental measurements. The results show that the temperature distribution of single cell is relatively uniform when the cell is facing the air flow. In a module, very high air flow rate and large gap between the cells can reduce the cell temperature. A pack with a good thermally conductive case is very important to ensure good heat dissipation of the battery module. Due to limited space in the cabinet, additional air inlets and outlets can be opened outside of the cabinet to slightly lower the pack temperature. Installing fins outside the cabinet can also slightly reduce the temperature inside the cabinet. Liquid cooling medium, such as water, is much better than the air-cooling medium.

Globally, the use of whole-cell matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) in clinical microbiology laboratories has increased considerably. With the rapid growth of artificial intelligence technology, there is an increasing number of areas devoted to solving problems by implementing machine learning-based methods. Applying the use of artificial intelligence to the analysis of the massive amount of information obtained in the mass spectrum derived from MALDI-TOF MS should be a breakthrough in clinical microbiology. Specifically, it would facilitate a more rapid and accurate strain typing or antibiotic susceptibility test (AST) based on whole-cell MALDI-TOF MS spectra, and hence, it is a promising solution. Even though the reproducibility of peaks could result in some critical problems, computational methods have been developed to address this issue. Therefore, clinical microbiologists are able to perform strain typing or an AST as smoothly and easily as identifying species by using MALDI-TOF MS and artificial intelligence.

Aging and obesity make humans more prone to cardiovascular and metabolic syndrome diseases, leading to several serious health conditions, including dyslipidemia, high blood pressure, and sleep disturbance. Hyperlipidemia means elevated blood lipid levels, including cholesterol and triglycerides. This study aimed to explore the hypolipidemic effect of fermented citrus lemon juice using a hyperlipidemic hamster model. Sugar-free lemon juice’s fermentation was optimized, and the characteristics of fresh and fermented lemon juice (FLJ) were evaluated and compared. In addition, tests were conducted to determine the appropriate hamster feed for the functional animal tests. Then, experiments were conducted to evaluate the hypolipidemic effect of the FLJ, which contained polyphenols and superoxide dismutase-like activity, on a hyperlipidemic hamster model. This study’s pre-fermentation efficiency evaluation found that 21–30 days of bacterial DMS32004 and DMS32005 fermentation of fresh lemon juice provided the best fermentation benefits. In addition, the fermentation evaluation showed that a sugar-free fermentation method provided FLJ with the best benefits. Results showed that the absorption and utilization efficiency of FLJ was higher compared with the unfermented lemon juice. After six weeks of feeding, the total cholesterol and triglyceride values in the blood and liver of the FLJ treatment groups were de-creased compared with the high-fat diet (HFD) group. In addition, the blood low-density lipoprotein cholesterol levels were significantly reduced in the FLJ treatment groups compared with the HFD group. In contrast, the blood high-density lipoprotein to low-density lipoprotein cholesterol ratio increased considerably in the FLJ treatment groups, and the total to high-density lipoprotein ratio was significantly lower than in the HFD group. Compared with the HFD group, the total cholesterol content in the FLJ treatment groups’ feces increased significantly. This study demonstrated that the sugar-free fermentation method and fermentation cycle management provided FLJ with the potential to regulate blood lipids. Further research and verification will be carried out to isolate specific substances from the FLJ and identify their mechanisms of action.

The study of the currently known >3,000 species of snakes can provide valuable insights into the evolution of their genomes. Deinagkistrodon acutus, also known as Sharp-nosed Pit Viper, one hundred-pacer viper or five-pacer viper, is a venomous snake with significant economic, medicinal and scientific importance. Widely distributed in southeastern China and South-East Asia, D. acutus has been primarily studied for its venom. Here, we employed next-generation sequencing to assemble and annotate a highly continuous genome of D. acutus. The genome size is 1.46 Gb; its scaffold N50 length is 6.21 Mb, the repeat content is 42.81%, and 24,402 functional genes were annotated. This study helps to further understand and utilize D. acutus and its venom at the genetic level.

In this paper, the performance of Cu-(In,Ga)-S2 (CIGS2) solar cells with adjusting composite CGI-ratio absorber is explored and compared through an improved three-stage co-evaporation technique. For co-evaporating CIGS2 absorber as a less toxic alternative to Cd-containing film, we analyse the effect of the CGI-ratio stoichiometry and crystallinity, and explore its opto-electric sensing characteristic of individual solar cell. The results of this research signify the potential of high-performance CIGS2-absorption solar cells for photovoltaic (PV)-module industrial applications. For the optimal CIGS2-absorption film (CGI=0.95), the Raman main-phase signal (A1) falls at 291 cm-1, which is excited by the 532-nm line of Ar+-laser. Using photo-luminescence (PL) spectroscopy, the corresponding main-peak bandgaps measured is 1.59 eV at the same CGI-ratio film. Meanwhile, the best conversion efficiency (=3.212%) and the average external quantum efficiency (EQE=51.1% in the visible-wavelength region) of photo-electric properties were achieved for the developed CIGS2-solar cells (CGI=0.95). The discoveries of this CIGS2-absorption PV research provide a new scientific understanding of solar cells. Moreover, this research undeniably contributes to a major advancement towards practical PV-module applications and can help more to build an eco-friendly community.

Recent researches indicated that metal nanoparticles which have the unique optical properties can be used to enhance the spectral response of the photovoltaic modules. Since most of the nanoparticles have enhancement effects in a specific wavelength range, improving the spectral response of the photovoltaic modules in a broadband range is crucial for their applications in imaging, energy harvesting, and optical communication. In this study, flower-like silver particles are applied to achieve the enhancement effects in a broadband range. The optical absorption of photovoltaic modules is improved in a broad wavelength range of 400~2000 nm by immobilizing flower-like silver particles onto an amorphous Si p-i-n structure, and the peak responsivity of the spectral response is enhanced by about 10 times. Theoretical investigation further elaborates that the enhancement originates from the near-field effects of silver particles due to the interaction of different parts of the flower-like silver particles. Through these studies, we demonstrate that, utilizing the subwavelength silver particles with roughness surface can achieve the spectral response of the photovoltaic modules enhanced in broadband range, which can improve the utilization efficiency of optical energy for the applications of sensing, imaging, optical communication, and energy harvesting.

Noise model selection criteria has a significant impact on identifying the stochastic noise proper-ties of any GNSS daily coordinate time series. The low-frequency random walk noise existing in these time series could lead to overestimation of the tectonic rate, so it is of great significance to accurately detect the random walk component. This study focuses on noise model estimation cri-terion (BIC_tp) derived from the AIC and the BIC by introducing 2π factors. It is more sensitive to abnormal steps (random jumps). Using observation data from 72 GNSS stations from 1992 to 2022 and simulated data, four combined noise models are used to explore the impacts of time se-ries lengths (ranging from2 to 24 years) and data loss (between 2% and 30%) on noise models and velocity estimation. The results show that as the time length increased, the selected optimal noise model, and the estimated uncertainty of the tectonic trend with different data gap, gradually con-verge. When the time length is short (less than 8 years), it could lead to the FNRWWN, FNWN, and PLWN models being mistakenly estimated as GGMWN models, thereby affecting the accura-cy of determining the station velocity parameters. When the time length is 12 years, the RW noise component is more probably detected, As the time length increases, the impact of RW on velocity uncertainty is weakened. Finally, we conclude that for a time series with a minimum time length of 12 years, both the selection of the optimal stochastic noise model and the estimation of the ve-locity parameters are reliable.

In response to the structural optimization problem of PCB stator coreless disc motors, the orthogonal response surface method was used to optimize the motor structure, determine the basic parameters of the motor preliminarily, and conduct orthogonal experiments on the motor parameters based on the optimization design objectives, The optimization factors were the quantity of magnetic pole of the motor rotor, the ratio of main/auxiliary pole size, the thicknessof the permanent magnet, and the air gap length.The motor torque，the amplitude of magnetic density of the air gap and waveform distortion rateare used as optimization objectives. The motor parameters that make the motor torque reach the maximum, the air gap magnetic density maximum, and the waveform distortion rate minimum. Due to the use of PCB plates instead of motor stator cores in PCB coreless disc motors,The service life of the PCB board during motor operation will be reduced with the temperature rise generated by the stator winding To solve this problem, the response surface analysis of the motor is carried out to reduce the temperature rise of the stator windings during the operation of the motor. PCB board and stator winding are the main factors affecting the temperature rise of the motor.Taking the thickness of the PCB board, the hole diameter on the board, and the uneven width of the stator winding as optimization factors, the motor parameters with the lowest temperature rise of the motor winding are obtained. Simulation analysis is conducted using Ansys/Maxwell software, and the results prove the feasibility of optimization.

In recent years, laser engraving has received widespread attention as a convenient, efficient, and programmable method, which has enabled the obtaining of high-quality porous graphene from various precursors. Laser engraving is often used to fabricate the dielectric layer with micro-structure for capacitive pressure sensors, however, the usual choice of electrodes remains poorly flexible metal electrodes, which greatly limits the overall flexibility of the sensors. In this work, we propose a flexible capacitive pressure sensor made entirely of thermoplastic polyurethane (TPU) and laser-induced graphene (LIG) derived from wood. The capacitive pressure sensor consisted of a flexible LIG/TPU electrode (LTE), a LIG/TPU electrode with micro hole array, and dielectric layer of TPU with micro-cone array molded from laser-engraved hole array on wood, which provided high sensitivity (0.11 kPa-1), ultra-wide pressure detection range (100Pa to 1.4MPa), fast response (~300 ms) and good stability (&gt;4000 cycles, at 0-35 kPa). We believe that our research makes a significant contribution to the literature because the easily available materials derived from wood and overall consistent flexibility meet the requirements of flexible electronic devices.

Soil is an extremely significant resource for human survival, and agglomerates, as the basic unit of soil structure, not only enhance soil fertility and control the biological validity of nutrients, but also strengthen the soil's erosion resistance. The mass application of fertilizers may have a significant impact on crop growth and soil structure, and the rational application and dispensing of fertilizers will be an urgent issue to be addressed. Therefore, the effect of fertilizer application on the stability of water-stable soil aggregates needs to be studied under different meteorological and soil conditions to draw more general and feasible conclusions. Our Meta-analysis of data from 220 of 56 published studies found that fertilizer application increased mean weight diameter (MWD) by an average of 18% compared to the no-fertilizer treatment. Among the nitrogen (N), phosphate (P), and organic (OM) fertilizer treatments, the organic fertilizer treatment had a greater stimulatory effect on MWD (26%). Among the different fertilizer levels, low level of phosphorus (<40kg·hm-2·yr-1), high level of N (>120kg·hm-2·yr-1), and low level of organic fertilizer (<5000kg·hm-2·yr-1) increased MWD by 19%, 14%, and 41% respectively. Across soil types and land use types, the response to MWD was positive for red soils and paddy fields, and the stimulatory effect of organic fertilizer was more significant compared to chemical fertilizer. The regression model showed that the response ratio of MWD was negatively correlated with the response ratio of soil pH and bulk density (BD), and positively correlated with the response ratio of soil organic carbon (SOC) and microbial mass carbon (MBC). Meanwhile, the PLS-SEM model showed that average annual temperature was the main factor affecting the stability of soil aggregates, and the average annual rainfall is the secondary factor. Therefore, this study found that the long-term use of organic fertilizers in place of some chemical fertilizers was more effective than chemical fertilizer alone. Temperature and rainfall have greater effects on the response of fertilizer to soil aggregate stability.

This study examined the relationship among the three domains of executive function (EF; cognitive shifting, inhibitory control, and working memory) to test the applicability of the unity-diversity model in preschoolers using both behavioral and fNIRS approaches. Altogether 58 Chinese preschoolers (34 boys, 24 girls, Mage = 5.86 years, SD = 0.53, Age range = 4.83-6.67 years) were administered the Dimensional Card Change Sort (DCCS), go/no-go, and missing scan task. Their brain activations in the prefrontal cortex during the tasks were examined using fNIRS. First, the behavioral results indicated that the missing scan task scores (working memory) correlated with the DCCS (cognitive shifting) and go/no-go tasks (inhibitory control). But the latter two did not correlate with each other. Second, the fNIRS results demonstrated that the prefrontal activations during the working memory task correlated with those in the same regions during the cognitive shifting and inhibitory control tasks. Still, the latter two did not correlate. The behavioral and neuroimaging evidence jointly indicates that the unity-diversity model of EF does apply to Chinese preschoolers.

Zero-rate output (ZRO) drift induces deteriorated micro-electromechanical system (MEMS) gy-roscope performances, severely limiting its practical applications. Hence, it is vital to explore an effective method toward ZRO drift reduction. In this work, we conduct an elaborate investigation on the impacts of the internal and packaging stresses on the ZRO drift at the thermal start-up stage, and propose a temperature-induced stress release method to reduce the duration and magnitude of ZRO drift. Self-developed high-Q dual mass tuning fork gyroscopes (TFGs) are adopted to study the correlations between temperature, frequency and ZRO drift. Furthermore, a rigorous finite element simulation model is built based on the actual device and packaging structure, revealing the temperature and stresses distribution inside TFGs. Meanwhile, the relationship between temperature and stresses are deeply explored. Moreover, we introduce a temperature-induced stress release process to generate thermal stresses and reduce the temperature-related device sensitivity. By this way, the ZRO drift duration is drastically reduced from ~2000 s to ~890 s, and the drift magnitude decreases from ~0.4 °/s to ~0.23 °/s. This stress release method achieves a small bias instability (BI) of 7.903 °/h and a low angle random walk (ARW) of 0.792 °/√h, and the long-term bias performance is significantly improved.

Tuning fork gyroscopes (TFGs) are promising for potential high-precision applications. This work proposes and experimentally demonstrates a novel high-Q dual mass tuning fork microelectro-mechanical system (MEMS) gyroscope utilizing three-dimensional (3D) packaging techniques. Except for two symmetrically-decoupled proof masses (PM) with synchronization structures, a symmetrically-decoupled lever structure is designed to force the antiparallel, antiphase drive-mode motion and basically eliminate the low-frequency spurious modes. The thermoelastic damping (TED) and anchor loss are greatly reduced by the linearly-coupled, momentum- and torque-balanced antiphase sense mode. Besides, a novel 3D packaging technique is used to realize high Q-factors. A composite substrate encapsulation cap, fabricated by through-silicon-via (TSV) and glass-in-silicon (GIS) reflow processes, is anodically bonded to the sensing structures at wafer scales. A self-developed control circuit is adopted to realize loop control and characterize gyro-scope performances. It is shown that a high-reliability electrical connection together with a high-air-impermeability package can be fulfilled with this 3D packaging technique. Furthermore, the Q-factors of the drive and sense modes reach up to 51947 and 49249, respectively. This TFG realizes a wide measurement range of ±1800° /s and a high resolution of 0.1° /s with a scale-factor nonlinearity 720 ppm after automatic mode-matching. Besides, the long-term zero-rate output (ZRO) drift can be effectively suppressed by temperature compensation, inducing a small angle random walk (ARW) of 0.923°/√h and a low bias instability (BI) of 9.270°/h.

With the development of designing and manufacturing level for micro-electromechanical system (MEMS) gyroscopes, the control circuit system becomes a key point to determine their internal performances. Nevertheless, phase delay of electron components may result in some serious hazards. This paper describes a real-time circuit phase delay correction system for MEMS vibratory gyroscopes. A detailed theoretical analysis is provided to clarify the influences of circuit phase delay on the in-phase and quadrature (IQ) coupling characteristics and zero rate output (ZRO) utilizing force-to-rebalance (FTR) closed-loop detection and quadrature correction system. By deducing the relationship between amplitude-frequency, phase-frequency of MEMS gyroscope and the phase relationship of the whole control loop, a real-time correction system is proposed to automatically adjust the phase reference value of phase-locked loop (PLL) and thus compensate for the real-time circuit phase delay. The experimental results show that the correction system can accurately measure and compensate the circuit phase delay in real time. Furthermore, the unwanted IQ coupling can be eliminated and the ZRO is decreased by 755% to 0.095°/s. This correction system realizes a small angle random walk of 0.978°/√h, and a low bias instability of 9.458°/h together with a scale factor nonlinearity of 255 ppm at room temperature. Besides, the thermal drift of ZRO is reduced to 0.0034°/s/°C at a temperature range from -20°C to 70°C.

Electromagnetic sensors have been used for inspecting small surface defects of metals. Based on the eddy-current thin-skin regime, a revised algorithm is proposed for a triple-coil drive-pickup eddy-current sensor scanning over long surface crack slots (10 mm) with different rotary angles. The method is validated by the voltage measurement of the designed EC sensor scanning over a benchmark (ferromagnetic) steel with surface defects of different depths and rotary angles. With an additional sensing coil for the designed EC sensor, the defect angle (or orientation) can be measured without spatially and coaxially rotating the excitation coil. By referring to the voltage change (due to the defect) diagram (voltage sum versus voltage different) of two sensing pairs, the rotary angle of the surface crack is retrieved with a maximum residual deviation of 3.5 %.

Cancer immunotherapy reaches a remarkable achievement in various cancer types and brings new possibilities to improve cancer patients’ long-term survival. However, outcomes vary from case to case, and the present protocol benefits a small fraction of patients. One notable factor is the tumor microenvironment, especially the immune cell components, that may reflect the immune response's status quo on site. Thus, understanding the content of infiltrating immune cells in tumors is not only for research interesting but also a crucial subject toward precision medicine. We implement an algorithm for resolving relative proportions of twenty-one immune cell subclasses from a human tissue profiled transcriptome by microarray technology to reach the goal above. By selecting gene features and then adopting ?-Support Vector Regression, we can construct a deconvolution model and resolve the immune cell context. The excellent consistency between the estimated values and the correct immune-cell composition further demonstrates this approach provides a more natural alternative to revealing samples' immune cell content and reliable results like recent single-cell technologies. Based on this algorithm, the web-based deconvolution tool implemented named mySORT provides a user-friendly interface for estimating the immune cell content by uploading gene expression profiling. We also present comprehensive visualization 2D/3D plots in mySORT so that users can easily make a comparison between different samples. Finally, we synthesized pseudo-bulk expression data from single-cell transcriptomic datasets of 17 melanoma and 16 head and neck cancer patients. The deconvolution results of microarray-based data in the previous study and synthetic pseudo-bulk data all proved the excellent performance of mySORT. We believe that mySORT can help researchers in all fields easily understand complex immune microenvironment. The website of mySORT is freely accessible on https://symbiosis.iis.sinica.edu.tw/mySORT/.

Laser shock peening as an innovative surface treatment technology can effectively improve the fatigue life, sur-face hardness, corrosion resistance, and residual compressive stress. Compared with the laser shock peening, the warm laser shock peening (WLSP) is a new surface treatment technology to improve materials’ surface performances, which takes advantage of thermal mechanical effects on stress strengthening and micro-structure strengthening, results in more stable distribution of the residual compressive stress under heating and cyclic loading process. In this paper, the microstructure of GH4169 nickel super-alloy processed by WLSP technology with differ-ent laser parameters were investigated. The proliferation and tangling of dislocations in GH4169 were observed and the dislocation density increased after WLSP treatment. The influences of different treatment by LSP and WLSP on the microhardness distribution of the surface and along cross-sectional depth were investi-gated. The microstructure evolution of the GH4169 alloy being shocked with WLSP were studied by TEM. The effect of temperature on the stability of high temperature microstructure and properties of GH4169 alloy WLP was investigated.

Artemia franciscana, native to America, has recently colonized non-indigenous populations in Eurasia, Mediterranean regions and Australia. In present we sought to evaluate the potential effects of colonization of A. franciscana on genetic differentiation in the new environments in UAE. We used the COI marker to determine population genetic structure and identify the origins of exotic populations in UAE. Our findings have confirmed the colonization of both localities by A. franciscana. Genetic variation of invasive A. franciscana were exclusively lower than native population in Great Salt Lake and San Francisco Bay. Results have showed the studied population could not possibly have colonized directly from natural American localities, perhaps resulting from secondary introduction events from other non-indigenous populations. Genetic analysis have yielded different demographic patterns for invasive studied populations. Al Wathba Wetland Reserve (AWWR) population have represented demographic expansion. In contrast, Godolphin Lakes (GL) population was at demographic equilibrium. Neutrality tests have documented the excess of both recent and historical mutations in the COI gene pool of invasive AWWR Artemia throughout establishment in the new environment.

Periostracum cicadae, the cast-off shell of the cicada Cryptotympana pustulata Fabricius, is used in traditional Chinese medicine for its diaphoretic, anticonvulsive, sedative, antipyretic, and antiallergic effects. However, the exact pathogenesis of immunoglobulin A nephropathy (IgAN) remains unclear, thereby hindering investigations to identify novel therapeutic agents. A rat IgAN model was established by administration of bovine serum albumin, lipopolysaccharide, and carbon tetrachloride, which simultaneously established blood stasis and a heat syndrome model. The animals were sacrificed to detect changes in protein levels in urine and blood. Immunofluorescence was performed to assess IgA deposition in the glomeruli. Tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin 6 (IL-6) levels were measured in bronchoalveolar lavage fluid (BALF) by enzyme-linked immunosorbent assay. Hematology and eosin, periodic acid-Schiff, TUNEL, and immunohistochemical staining were performed to evaluate histopathological changes in kidney tissues. Additionally, target-related proteins were measured by western blotting. Periostracum cicadae resulted in a reduction in blood and urine protein levels. Serum TNF-α, IL-1β, and IL-6 levels significantly decreased in the periostracum cicadae-treated groups compared to the IgAN group. Furthermore, a reduction in MCP-1, TLR4, and IgA expression levels and a dose- dependent increase in caspace-3 expression were observed in response to periostracum cicadae treatment. TGF-β1 levels decreased, whereas that of Fas increased in the kidney tissues of the periostracum cicadae-treated groups. The findings of the present study indicate that periostracum cicadae induces apoptosis and improves kidney inflammation and fibrosis in IgA nephropathy rat models.

Dry intrusion is an important mid-latitude atmosphere phenomenon within the upper troposphere and lower stratosphere. It is always found to be related to the cyclogenesis, rainstorm, as well as convection generation and precipitation enhancement. Since the atmosphere environment for any of these above-mentioned weather is terribly complicated, those preexisting popular schemes which takes no account of water vapor may not suitable for detecting the dry intrusion related to these weathers. With regard to the merits and demerits of the current preexisting schemes, a new scheme based on Fengyun-2E geo-stationary satellite data is presented in this study to detect the atmospheric dry intrusion. The scheme is set up based on the statistical relationship between water vapor at high level troposphere, the general moist potential vorticity, ozone concentration and upper-level jet. After using the total amount of ozone and ozone profile operational products retrieved by Fengyun-3 Polar Orbiting Meteorological Satellites and the potential vorticity calculated by ECMWF Interim data for validation, this scheme is applied to analyze two typical middle-latitude weather processes. One is the famous Beijing extreme rainfall of 21 July 2012 and the other is a hailstorm occurred on the eastern China during March 19, 2014. A good application effect in both cases suggests that our new method of detecting dry intrusion is feasible and can be helpful in middle-latitude disastrous weather monitoring and forecasting.

Trichinellosis is a major worldwide health concern caused by T. spiralis infection without highly efficient and safe therapeutic method so far. To solve the problem of uncomplete drug treatment schemes and the rise of anthelmintic resistance, a potential protective effect of probiotic strains against zoonotic T. spiralis infection was investigated in the framework of a new therapeutic strategy aimed at using probiotics to control parasitic zoonoses. The study was focused on L. reuteri protected against T. spiralis infection in intestinal phase throughout the detection of adult worm number, inflammatory factors mRNA expression, antioxidant enzyme expression and Nrf2 signal pathway protein expression. Mice were divided randomly into 3 groups: 1) Control group: no treatment; 2) Ts group: T. spiralis infection; 3）LAB group: T. spiralis infected after orally administered L. reuteri for 7 days. Probiotics bacteria were administered daily in a dose of 109 CFU/mL, and mice were infected with 400 T. spiralis larvae in the experimental groups. The number of adult worms was also significantly increased after administration of probiotics. Meanwhile, L. reuteri alleviate the inflammatory response caused by T. spiralis infection in intestinal has been confirmed. In addition, the promotion of antioxidant enzyme expression can be inferred that L. reuteri regulate Nrf2 signal pathways against T. spiralis infection. Our study demonstrates that L. reuteri provide protection against T. spiralis infection in intestinal. Therapeutic approaches with probiotic strains admission could help to reduce the risks of trichinellosis or complement classical anti-parasite treatments.