Peptidoglycan hydrolases are enzymes that cleave the peptidoglycan of the bacterial cell wall, facilitating cell growth, cell division, and peptidoglycan turnover. Xanthomonas citri subsp. citri (X. citri), the causal agent of citrus canker, encodes an Escherichia coli M23 peptidase EnvC homolog. EnvC is a LytM factor required for septal peptidoglycan splitting and daughter cell separation. In this study we investigate how EnvC contributes to the virulence and cell separation of X. citri. We observed that disruption of the X. citri envC gene (ΔenvC) led to a reduction in virulence. Upon inoculation into leaves of Rangpur lime (Citrus limonia Osbeck), the X. citri ΔenvC mutant showed a delay in causing citrus canker symptoms compared with the wild-type X. citri strain. Mutant complementation restored the X. citri wild type phenotype. Subcellular localization confirmed that X. citri EnvC is a periplasmic protein. Moreover, the X. citri ΔenvC mutant exhibited elongated cells, indicative of a cell division defect. These findings support the role of EnvC in regulating virulence, cell wall organization, and cell division in X. citri.

Cathepsins (Caths) are lysosomal proteases that participate in various physiological and pathological processes. Accumulating evidence suggests that cathepsins play a multifaceted role in radiotherapy response. Firstly, cathepsins contribute to the remodelling of the tumor microenvironment by degrading extracellular matrix components, promoting angiogenesis, and facilitating tumor invasion and metastasis. Their proteolytic activity influences the tumor's response to radiation by affecting oxygenation, nutrient availability, and immune cell infiltration within the tumor microenvironment. Furthermore, cathepsins have been implicated in DNA damage repair processes, including non-homologous end joining and homologous recombination. Cathepsin-mediated DNA repair mechanisms can promote radioresistance in cancer cells, limiting the efficacy of radiotherapy. Additionally, cathepsins have been associated with the activation of prosurvival signalling pathways, such as PI3K/Akt and NF-κB, which can confer resistance to radiation-induced cell death. Radiotherapy plays a crucial role in the treatment of various malignancies. However, the effectiveness of radiotherapy can be limited by intrinsic or acquired resistance mechanisms in cancer cells. In recent years, there has been growing interest in understanding the role of cathepsins, a family of proteases, in modulating the response of tumor cells to radiotherapy. In this study, we shed light on the regulation and expression of cathepsin B in colon carcinoma cell line (Caco-2) before and after exposure to radiation were investigated. Radiation-induced upregulation of cathepsin B in dose-independent manner. Proteolytic inhibition of cathepsin B by cathepsin B specific inhibitor CA074 has increased the cytotoxic effect of ionizing irradiation in caco-2 cells. Similar results were also obtained after cathepsin B knockout by CRISPR CAS9. These results showed that cathepsin B could contribute to ionizing radiation resistance and abolishing of cathepsin B either by inhibition its proteolytic activity or expression has increased in caco-2 cells susceptibility to ionizing irradiation.

Keap1 is associated with cytoprotective signaling. These roles of Keap1 typically focus on its role as a degrader of the antioxidant response (AR) transcription factor, Nrf2, and the inhibition of this process upon Keap1 labeling by electrophiles. However, work from several laboratories has reemphasized both the important role of Nrf2 binding in negatively regulating AR, and the fact that electrophile Keap1 modification dissociates Nrf2 from Keap1. This model appears to be applicable to other signaling modes regulated by Keap1. Here we use recent data we have derived using experiments in zebrafish and cultured cells to discuss different models of Keap1 regulation.

Articular cartilage lacks intrinsic regenerative capabilities, and the current treatments fail to regenerate damaged tissue and lead only to temporary pain relief. These limitations have prompted the development of tissue engineering approaches, including 3D culture systems. Thanks to their regenerative properties and capacity to recapitulate embryonic processes, spheroids obtained from mesenchymal stromal cells are increasingly studied as building blocks to obtain functional tissues. The aim of this study was to investigate the capacity of adipose stromal cells to assemble in spheroids and differentiate toward chondrogenic lineage from the perspective of cartilage repair. Spheroids were generated by two different methods (3D chips vs Ultra-Low Attachment plates), differentiated toward chondrogenic lineage, and their properties were investigated by: molecular biology analyses, biophysical measurement of mass density, weight, and size of spheroids, and confocal imaging. Overall, spheroids showed the ability to differentiate by expressing specific cartilaginous markers that correlate with their mass density, defining a critical point at which they start to mature. Considering the spheroid generation method, this pilot study suggested that spheroids obtained with chips are a promising tool for the generation of cartilage organoids that could be used for preclinical/clinical approaches, including the realization of personalized therapy.

To the best of the author’s knowledge, studies of mature plasmacytoid dendritic cell proliferation associated with T lymphoblastic lymphoma were extremely rare in the literature. Here, we report a patient who underwent both mature plasmacytoid dendritic cell proliferation and T lymphoblastic lymphoma. With the findings of lymph node biopsy taken from the right cervical and inguinal regions, we identified eye-catching mature plasmacytoid dendritic cells that were considered to be responsible for this lesion at the beginning, until the immunostaining of Ki67 and TDT showed a small group of positive cells hiding in these plasmacytoid dendritic cells. Bone marrow biopsy was also performed in this patient. Microscopically, the hematopoietic tissue was almost completely replaced by lymphoblastoid cells with condensed chromatin, inconspicuous nucleoli and scanty cytoplasm, which were basically the same as those seen in the lymph nodes in morphology. However, there was no sign of plasmacytoid dendritic cells or Langerhans cells in the bone marrow biopsy. With the help of bone marrow biopsy, our final diagnosis of the lymph node was T lymphoblastic lymphoma coexisting with mature plasmacytoid dendritic cell proliferation . Although accumulations of plasmacytoid dendritic cells may occur in some infections or reactive lymphadenopathy, the presence of extensive nodules or infiltration of plasmacytoid dendritic cells strongly reminds the pathologist to carefully evaluate the bone marrow or peripheral blood status of the patient to exclude a hidden myeloid or other neoplasm.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

African swine fever (ASF) is a lethal and highly contagious transboundary animal disease with the potential for rapid international spread. Currently, there is no ASF vaccine commercially available. All infected animals must be isolated and culled immediately upon confirmation of the presence of the virus. Works leading to the rational development of protective ASF vaccines are urgently needed. Here, we generated a safe and efficacious live-attenuated vaccine (LAV) VNUA-ASFV-LAVL2 by serial passaging of a field isolate (VNUA-ASFV-05L1, genotype II) in porcine alveolar macrophage (PAMs, 65 passages) and an immortalized porcine alveolar macrophage cell line (3D4/21, 55 passages). VNUA-ASFV-LAVL2 can efficiently replicate in both PAMs and 3D4/21 cells. It provides 100% protection, even with the low dose of 10^2 HAD50, for the vaccinated pigs against the challenge of contemporary pandemic ASFV field isolate. Pigs vaccinated with this LAV at a dose range of 10^2 to 10^5 HAD50 remained clinically healthy during both the 28-day observation period of immunization and the 28-day observation period of challenge. VNUA-ASFV-LAVL2 was completely eliminated from blood by 28 days post inoculation (DPI), and from feces or oral fluids by 17 DPI. It remained a safe, stable, and attenuated phenotype after five passages in pigs. Consistently high levels of ASFV-specific IgG antibodies and significant cellular immunity were detected in vaccinated pigs before the ASFV challenge. These results indicate that the VNUA-ASFV-LAVL2 strain is a safe and efficacious LAV against the genotype II ASFV strain responsible for current ASF outbreaks in Asia.

Primary lymphoma of the middle ear is rare in cats, and little information has been accumulated on the treatment and course. An 11-year-old spayed female mixed-breed cat was brought to our hospital with facial nerve paralysis, which had been stable using prednisolone for 3 months. She was diagnosed with B-cell lymphoma of the right middle ear after otoscopic sampling, which showed evidence of filling of bilateral tympanic bullae on computed tomography. Hepatic metastasis was suspected and she was treated with multidrug chemotherapy, resulting in clinical remission. On day 176, magnetic resonance imaging and computed tomography was performed as a checkup, revealing tumor invasion into the nasopharyngeal region and recurrence of hepatic lesions without any brain abnormality. Nasal congestion then worsened and the patient died on day 228 after presenting with generalized seizures. Clinicians should be aware of the possibility of invasion to surrounding tissues and hepatic metastasis in cases of feline primary middle ear lymphoma.

Ubiquitin-Specific-peptidase 22 (Usp22) cleaves ubiquitin moieties from numerous proteins, in particular transcription factors. Recently, it was reported that Usp22 acts as negative regulator of interferon-dependent responses. In the current study, we investigated the role of Usp22 deficiency upon acute viral infection with lymphocytic choriomeningitis (LCMV) virus. We found that lack of Usp22 on bone marrow derived cells (Usp22 fl/fl Vav1-Cre mice) reduced induction of type I and II interferons. Limited type I interferon response did not influence virus replication. However, restricted expression of PD-L1 led to increased frequencies of functional virus-specific CD8+ T cells and rapid death of Usp22 deficient mice. CD8+ T cell depletion experiments revealed that accelerated CD8+ T cells were responsible for enhanced lethality in Usp22 deficient mice. In conclusion, we found that the lack of Usp22 generated a pathological CD8+ T cell response, which gave rise to severe disease in mice.

A comprehensive lipid profile was analyzed in patients with non-small cell lung cancer (NSCLC) using nanoflow ultrahigh-performance liquid chromatography-electrospray ionization-tandem mass spectrometry. The study investigated 297, 202, and 166 lipids in saliva, plasma, and fecal samples, respectively, comparing NSCLC patients to healthy controls. Lipids with significant changes (>2-fold, p<0.05) were further analyzed in each sample type. Both saliva and plasma exhibited similar lipid alteration patterns in NSCLC, but saliva showed more pronounced changes and fecal lipids had weak correlation with those of saliva and plasma. Total triglycerides (TGs) increased (>2–3 folds) in plasma and saliva but decreased in fecal samples. Three specific TGs (50:2, 52:5, and 54:6) were significantly increased in NSCLC across all sample types. A common ceramide species (d18:1/24:0) decreased in both plasma and saliva but increased in fecal samples. Additionally, phosphatidylinositol 38:4 decreased by approximately 2-fold in plasma and saliva. Phosphatidylserine 36:1 was selectively detected in saliva and showed a subsequent decrease, making it a potential biomarker for predicting lung cancer. The study identifies 27 salivary, 10 plasma, and 16 fecal lipids as candidate markers for NSCLC by statistical evaluations. Moreover, it highlights the potential of saliva in understanding changes in lipid metabolism associated with NSCLC.

BMAP-27 peptide known to exert cytotoxic effects against cancer cells by membrane integrity disruption. In the current investigation, we aimed to study the role of the BMAP-27 peptide in reducing colon cancer cell proliferation and inducing apoptosis. This study utilized both primary and metastatic colon cancer cell lines (SW480 and SW620). Proliferation was measured using CCK-8, and cellular damage was analyzed by lactate dehydrogenase assay. The study assessed apoptosis, cell cycle, and proliferation by measuring the expression of CASPASE3, BAX, BCL-2, TP53, CDK-6, PCNA, Wnt11, AXIN1, and CTNNB1. Additionally, in-silico studies were conducted to determine the binding affinities of BMAP-27 with APC and β-catenin proteins. BMAP-27 peptide reduced colon cancer cell proliferation, upregulated CASPASE3, BAX, TP53, AXIN1 expression, and downregulated BCL-2, CDK-6, PCNA, WNT11, CTNNB1 in both colon cancer cell lines, however, demonstrated higher activity in primary than metastatic colon cancer cells. The molecular dynamic simulation revealed substantial binding affinity of the peptide to adenomatous polyposis coli and β-catenin proteins.BMAP-27 peptide effectively inhibited the proliferation and enhanced apoptosis in the primary than in metastatic colon cancer cells. In-silico findings suggest that BMAP-27 exhibits a strong binding affinity with APC and β-catenin, highlighting its potential role as an anti-colon cancer agent.

Oral squamous cell carcinoma (OSCC) is one of the most prevalent human malignancies and a global health concern with a poor prognosis despite therapeutic advances, highlighting the need for a better understanding of its molecular background. The genomic landscape of OSCC is well-established and recent research has focused on miRNAs, which regulate gene expression and may be useful as non-invasive biomarkers. A plethora of findings regarding miRNA expression have been generated, posing challenges for their interpretation and identification of disease-specific molecules. Hence, we opted to identify the most important miRNA molecules by bridging genetics and epigenetics, focusing on the key genes implicated in OSCC development. Based on published reports, we have developed a custom panel of 15 major oncogenes and a second panel of 5 major tumor suppressor genes. Following a miRNA/target interaction analysis and a comprehensive study of the literature, we selected the miRNA molecules, which target the majority of each gene panel and are reported to be downregulated or upregulated in OSCC, respectively. As a result, miR-34a-5p, miR-155-5p, miR-124-3p, miR-1-3p and miR-16-5p appeared to be the most OSCC-specific. Their expressional patterns, their verified targets and the signaling pathways affected by their dysregulation in OSCC, are thoroughly discussed in this review.

Recently, federated learning (FL) has been receiving great attention as an effective machine learning method to avoid the security issue in raw data collection as well as to distribute the computing load to edge devices. However, even though wireless communications is a essential part for implementing FL in edge networks, there have been a few works that analyze the effect of wireless networks on FL. In this paper, we investigate FL in small-cell networks where multiple base stations (BSs) and users are located according to homogeneous Poisson point process (PPP) with different densities. We comprehensively analyze the effects of geographic node deployment on the model aggregation in FL on the basis of stochastic geometry-based analysis. We derive the closed-form expressions of coverage probability with tractable approximations and discuss the minimum required BS density for achieving a target model aggregation rate in small-cell networks. Our analysis and simulation results provide insightful information for understanding the behaviors of FL in small-cell networks, and it can be exploited as a guideline for designing the network facilitating the wireless FL.

Production of biofuel from lignocellulosic biomass is relatively low due to the limited knowledge about natural cell wall loosening and cellulolytic processes in plants. Industrial separation of cellulose fiber mass from lignin, its saccharification and alcoholic fermentation is still cost-ineffective and environmental unfriendly. Assuming that the green transformation is inevitable and that the new sources of raw materials for biofuels are needed, we decided to study cell death - a natural process occurring in plants in a context of reducing the recalcitrance of lignocellulose for production of second generation bioethanol. “members of the enzyme families responsible for lysigenous aerenchyma formation were identified during the root hypoxia stress in Arabidopsis thaliana cell death mutants. The cell death regulatory genes, LESION SIMULATING DISEASE 1 (LSD1), PHYTOALEXIN DEFICIENT 4 (PAD4) and ENHANCED DISEASE SUSCEPTIBILITY 1 (EDS1) conditionally regulate the cell wall when suppressed in transgenic aspen. During four years of growth in the field the following effects were observed: lignin content was reduced, the cellulose fiber polymerization degree increased and the growth itself was unaffected. The wood of transgenic trees was more efficient as a substrate for saccharification, alcoholic fermentation and bioethanol production. The presented results may trigger the development of novel biotechnologies in the biofuel industry.

Phototherapy is an efficient strategy to respond to oxidative stress and has been in the spotlight in various therapeutic fields through its biological effect, but the exact molecular mechanism has not yet been established. As a result of irradiating RAW264.7 cells with a 630 nm or 850 nm LED with an energy intensity of 0.01J/cm2, cell viability was increased depend on the irradiation time. After H2O2 was added, 630 nm or 850 nm LEDs were irradiated for 10 min or 40 min to increase cell viability by about 1.7- or 1.6-fold, respectively. In addition, 630nm or 850nm LED irradiation showed a significant ROS scavenging effect and significantly reduced TUNEL-positive cells by 45.7% and 37.8%, respectively, compared to cells treated only with H2O2. In the result of flow cytometry, the number of cells in the late apoptosis stage was about 2.3- and 1.8-fold lower than that of the cells treated with H2O2 only, but there was no significance. The Bax/Bcl-2 ratio of cells irradiated with 630 nm or 850 nm LED was significantly lower than that of cells treated with H2O2 only, and the expression of procaspase-3 and cleaved PARP was also significantly expressed in the direction of suppressing cell death. In conclusion, the ROS scavenging activity by 630 nm or 850 nm LED irradiation, leading the expression of cell death pathway proteins in the direction of inhibiting cell death.

Despite the recent advances in melanoma therapy, the need for new targets and novel approaches to therapy is urgent. We previously reported melanoma actives that work via binding and downregulating spliceosomal proteins hnRNPH1 and H2. In a separate study, we reported that these compounds were non-toxic to Balb/C mice at 50 mg/kg suggesting their utility in in vivo studies. In the present study, we aimed to determine the therapeutic potential of these compounds by testing them in A375 cell-line derived xenograft in nu/nu mice. Animals were randomized into four groups (n=12/group) to receive subcutaneous administration of vehicle, 10 mg/kg vemurafenib, and 25 mg/kg 2155-14 and 2155-18 three times per week for 15 days along with a control group. The results revealed that both 2155-14 and 2155-18 significantly decreased the growth of A375 tumors, which was comparable to vemurafenib. These results were confirmed by tumor volume, weight, and histopathological examination. In conclusion, these results suggest a therapeutic potential of targeting spliceosomal proteins hnRNPH1 and H2.

Recent data suggest that K-Ras4B (hereafter K-Ras) can drive cancer cell stemness via calmodulin (CaM)-dependent, non-canonical Wnt-signalling. Here we examined whether another Ca2+-binding protein, the CaM-related centrin1, binds to K-Ras and could mediate some K-Ras functions that were previously ascribed to CaM. While CaM and centrin1 appear to distinguish between peptides that were derived from their classical targets, they both bind to K-Ras in cells. Cellular BRET-data suggest that CaM engages more with K-Ras than centrin1 and that the interaction with the C-terminal membrane anchor of K-Ras is sufficient for this. Surprisingly, binding of neither K-Ras nor its membrane anchor alone to CaM or centrin1 is sensitive to inhibition of prenylation. In support of an involvement of the G-domain of K-Ras in cellular complexes with these Ca2+-binding proteins, we find that oncogenic K-RasG12V displays increased engagement with both CaM and centrin1. This is abrogated by addition of the D38A effector-site mutation, suggesting that K-RasG12V is held together with CaM or centrin1 in complexes with effectors. When treated with CaM-inhibitors the BRET-interaction of K-RasG12V with centrin1 was also disrupted in the low micromolar range, comparable to that with CaM. While CaM predominates in regulating functional membrane anchorage of K-Ras, it has a very similar co-distribution with centrin1 on mitotic organelles. Given these results, a significant overlap of the CaM- and centrin1-dependent functions of K-Ras is suggested.

Renal cell carcinoma (RCC) is the second most common cancer of the urinary system. The current therapeutic strategies are based on partial or total nephrectomy and/or targeted therapies based on immune checkpoint inhibitors to which patients are often refractory. Preventive and screening strategies are not existing and the few available biomarkers for RCC are characterized by the lack of sensitivity, outlining the need of novel noninvasive and sensitive biomarkers for an early diag-nosis and a better disease monitoring. Blood liquid biopsy (LB) is a non- or minimally invasive procedure for a more representative view of tumor heterogeneity than the tissue biopsy, poten-tially allowing real-time monitoring of cancer evolution. Growing interest is focused on the extra-cellular vesicles (EVs) secreted by either healthy or tumoral cells and recovered in a variety of bio-logical matrices, blood included. EVs are involved in cell-to-cell crosstalk transferring their mRNAs, miRNAs, and proteins content. In particular, transferred miRNAs may regulate the tu-morigenesis and proliferation also impacting on resistance to apoptosis, thus representing poten-tial useful biomarkers. Here we present the latest efforts in the identification of circulating miR-NAs in blood samples, focusing on the potential use of EV derived miRNAs as RCC diagnostic, prognostic markers.

In the last two decades many detailed full transcriptomic studies on complex biological samples have been published and included in large gene expression repositories. These studies primarily provide bulk expression signal for each sample, including multiple cell-types mixed within the global signal. The cellular heterogeneity in these mixtures does not allow the activity of specific genes in specific cell types to be identified. Therefore, inferring relative cellular composition is a very powerful tool to achieve a more accurate molecular profiling of complex biological samples. In recent decades, computational techniques have been developed to solve this problem by applying cell deconvolution methods, designed to decompose cell mixtures into their cellular components and calculate the relative proportions of these elements. Some of them, only calculate the cell proportions (supervised methods), while other deconvolution algorithms can also identify the gene signatures specific for each cell type (unsupervised methods). In these work, five deconvolution methods (CIBERSORT, FARDEEP, DECONICA, LINSEED and ABIS) were implemented and used to analyze blood and immune cells, and also cancer cells, in complex mixture samples (using three bulk expression datasets). Our study provides three analytical tools (corrplots, cell-signature plots and bar-mixture plots) that allow a thorough comparative analysis of the cell mixture data. The work indicates that CIBERSORT is a robust method optimized for the identification of immune cell-types, but not as efficient in the identification of cancer cells. We also observed that LINSEED is a very powerful unsupervised method that provides precise and specific gene signatures for each of the five main immune cell-types analyzed: neutrophils and monocytes (in the myeloid lineage), B-cells, NK cells and T-cells (in the lymphoid lineage).

Breast and Cervical cancer are significant causes of morbidity and mortality among women worldwide. Usually, conventional therapies and early detection has shown success in metastasis and relapse rates and improved overall survival of the patients. The elimination of the efficacy of chemotherapies and target therapies because cancer stem cells create resistance against chemotherapy, metastasis, and relapse. Studies reveal that cancer stem cell markers are important for improving efficiencies of targeted therapies. Our study aims to analyze the stem cell markers and target the most significant stem cell marker by phytochemicals and their derivates. Through the analysis, it was observed that CXCR4 and SOX-2, mir-1, mir-125, and mir-429 may have a crucial role in stemness of breast and cervical cancer respectively, while BPMD & MD simulations revealed Di-valinoyl curcumin as a potential compound for CXCR4 targeting.

Solid oxide cells are capable of efficiently converting various chemical energy carriers to electricity and vice versa. The urgent challenge nowadays is the faster degradation rate compared with other fuel cell/electrolyzer technologies. To understand the degradation mechanisms, simulation of a solid oxide cell is helpful. Since most previous research developed models using commercial software, such as COMSOL and ANSYS Fluent, a gap for knowledge transfer is being gradually formed between academia and industry due to licensing issues. This paper introduces a multiphysics model, developed by a computational code, openFuelCell2. The code is implemented with an open-source library, OpenFOAM. It accounts for momentum transfer, mass transfer, electrochemical reactions and metal interconnect oxidation. The model can precisely predict I-V curves under different temperatures, fuel humidity and operation modes. Comparison between OpenFOAM and COMSOL simulations shows good agreement. The metal interconnect oxidation is modelled, which can predict the thickness of the oxide scale under different protective coatings. Simulations are conducted by assuming an ultra-thin film resistance on the rib surface. It is revealed that coatings fabricated by atmospheric plasma spraying can efficiently prevent metal interconnect oxidation, with a contribution of only 0.53 \% to the total degradation rate.

HAX1 is a multifunctional protein involved in the antagonism of apoptosis in cellular response to oxidative stress. In the present study we identified HAX1 as novel binding partner for Che-1/AATF, a pro-survival factor which plays a crucial role in fundamental processes, including response to multiple stresses and apoptosis. HAX1 and Che-1 proteins show extensive colocalization in mitochondria and we demonstrated that their association is strengthened after oxidative stress stimuli. Interestingly, in MCF-7 cells, resembling luminal estrogen receptor (ER) positive breast cancer, we found that Che-1 depletion correlates with decreased HAX1 mRNA and protein levels, and this event is not significantly affected by oxidative stress induction. Furthermore, we observed an enhancement of the previously reported interaction between HAX1 and estrogen receptor alpha (ERα) upon H2O2 treatment. These results indicate the two anti-apoptotic proteins HAX1 and Che-1 as coordinated players in cellular response to oxidative stress with a potential role in estrogen sensitive breast cancer cells.

Gossypol is a complex plant polyphenol reported to be cytotoxic and anti-inflammatory, but little was known about its effect on gene expression in macrophages. The objective was to explore gossypol’s toxicity and its effect on gene expression involved in inflammatory responses, glucose transport and insulin signaling pathway in mouse macrophages. Mouse RAW264.7 macrophages were treated with multiple concentrations of gossypol for 2-24 h. Gossypol toxicity was estimated by MTT assay and soluble protein content. qPCR analyzed the expression of anti-inflammatory tristetraprolin family (TTP/ZFP36), proinflammatory cytokine, glucose transporter (GLUT) and insulin signaling genes. Cell viability was greatly reduced by gossypol, accompanied with dra-matic reduction of soluble protein content in the cells. Gossypol treatment resulted in an increase of TTP mRNA level 6-20 fold and increased ZFP36L1, ZFP36L2 and ZFP36L3 mRNA levels by 26-69 fold. Gossypol increased proinflammatory cytokine TNF, COX2, GM-CSF, INFγ and IL12b mRNA levels up to 39-458 fold. Gossypol treatment upregulated mRNA levels of GLUT1, GLUT3 and GLUT4 genes as well as INSR, AKT1, PIK3R1 and LEPR but not APP genes. This study demonstrated that gossypol induced macrophage death and reduced soluble protein content that was accom-panied with massive stimulation of anti-inflammatory TTP family and proinflammatory cytokine gene expression as well as elevation of gene expression involved in glucose transport and insulin signaling pathway in mouse macrophages.

Imidazo[1,2-a]pyridines have been studied regarding drug development. The objective of this work was to evaluate the antileukemic capacity of imidazo[1,2-a]pyridine derivatives by screening its ability as a pro-oxidant. Imidazo[1,2-a]pyridine derivatives were synthesized and oral bioavailability and toxicity were analyzed in silico. Redox screening was performed on human Kasumi, KG-1, K562 and Jurkat leukemia cells. The imidazo[1,2-a]pyridine derivative and the most responsive leukemic cell were selected for cytotoxicity, cell proliferation, cell senescence and oxidative stress assays. The predictive toxicity analysis showed a possible effect on the reproductive system, but without mutagenic, carcinogenic or irritability effects. MRK-107 against K562 cells was the compound that showed the best redox profile. MRK-107 did not induce cell death in K562 and monocyte cells. However, this compound was able to decrease cell proliferation and increase cell senescence after 48 and 72 hours. Furthermore, MRK-107 induced oxidative stress in K562 cells after 72h, increasing lipid peroxidation and decreasing reduced glutathione (GSH) contents. This study demonstrated that MRK-107-induced senescence with the involvement of oxidative stress as a possible mechanism of action, addressing this compound as a potential antitumor drug against chronic myeloid leukemia.

The modulation of Nrf2 activity has been reported to be implicated in the pathology of various neurological disorders, including epilepsy. Previous studies have demonstrated that Nrf2 is activated in the post-status epilepticus rat model, however, the spatio-temporal, as well as cell type-specific expression of Nrf2 following brief epileptic seizures remains unclear. Here, we evaluated how an acute epileptic seizure affected the expression of Nrf2 and its downstream genes in the cortex and the hippocampus up to 1-week following the induced seizure. We found that after a pentylenetetrazol-induced seizure, Nrf2 significantly increased at 24 h at the mRNA level and 3 to 6 h at the protein level in the cortex. In the hippocampus, the Nrf2 mRNA level peaked at 3 h after the seizure, and no significant changes were observed in the protein level. Interestingly, the mRNA level of Nrf2 downstream genes peaked at 3-6 h after seizure in both the cortex and the hippocampus. A significant increase in the expression of Nrf2 was observed in the neuronal population of CA1 and CA3 regions of the hippocampus, as well as in the cortex. Moreover, we observed no change in the co-localization of Nrf2 with astrocytes neither in the cortex nor in CA1 and CA3. Our results revealed that following a brief acute epileptic seizure, the expression of Nrf2 and its downstream genes is transiently increased and peaked at early timepoints after seizure predominantly in the hippocampus, and this expression is restricted to the neuronal population.

In this paper, a study of modeling PV cell (solar cell), PV module (solar modules) and PV array solar array) using Matlab/Simulink software is presented. This study is focused on the study to design photovoltaic cell, photovoltaic modules, photovoltaic panels and PV array (solar array) and to analyze the change in PV performance according to changes in different parameters such temperature, solar irradiation, reverse saturation current, series resistance and shunt resistance. This study shows the PV and IV characteristics curve for each model from which MPP (maximum power point) is determined. In this study, different PV and IV characteristic curves are gained for varying temperatures with specified solar irradiation conditions,s and then the MPP is tracked. The highest power output is also compared between the designed PV module and the selected PV module (MX Solar USA MX60-245)

The load cell is an indispensable component of many engineering machinery and industrial automation for measuring and sensing force and torque. This paper describes the design and analysis of the strain gauge load cell, from the conceptional design stage to shape optimization (based on the finite element method (FEM) technique) and calibration, providing ample load capacity with low-cost material (aluminum 6061) and highly accurate force measurement. The amplifier circuit of the half Wheatstone bridge configuration with two strain gauges has been implemented experimentally with an actual load cell prototype. The calibration test was conducted to evaluate the load cell characteristics and derive the governing equation for sensing the unknown load depending on the measured output voltage. The measured sensitivity of the load cell is approximately 15 mV/N and 446.8 µV/V at a maximum applied load of 30 kg. The findings are supported by FEM results and experiments with an acceptable percentage of errors, which revealed an overall error of 6% in the worst situation. Therefore, the proposed load cell meets the design considerations for axial force measurement for the laboratory test bench, which has a light weight of 20 g and a maximum axial force capacity of 300 N with good sensor characteristics.

Pathologies of the blood brain barrier (BBB) have been linked to a multitude of CNS disorders whose pathology is poorly understood. Cortical spreading depression (CSD) has long been postulated to be involved in the underlying mechanisms of these disease states, yet full understanding remains elusive. This study utilized an in vitro model of the BBB with b.End3 murine endothelial cells to investigate the role of CSD in BBB pathology by characterizing effects of the release of major pronociceptive substances on BBB functional integrity using TEER screening, transcellular uptake, and immunoreactive methods in concert with global proteome and phospho-proteomic approaches. Findings demonstrated relocalization and functional alteration to proteins associated with the cytoskeleton and endothelial tight junctions. Pathologic mechanisms induced by individual substances released during CSD were found to have unique phosphorylation signatures in phospho-proteome analysis, identifying Zona Occludens 1 as a possible pathologic “checkpoint” of the BBB. Utilizing these phosphorylation signatures, possible novel diagnostic methods may be developed for neurological diseases and warrants further investigation.

Cell secretome has been explored as a cell-free technique with high scientific and medical interest for Regenerative Medicine. In this work, the secretome produced and collected from Olfactory Mucosa Mesenchymal Stem Cells and Olfactory Ensheating Cells was analyzed and therapeutically applied to promote peripheral nerve regeneration. The analysis of the conditioned medium revealed the production and secretion of several factors with immunomodulatory functions, capable of intervening beneficially in the phases of nerve regeneration. Subsequently, the conditioned medium was applied to sciatic nerves of rats after neurotmesis, using Reaxon^® as tube-guides. Over 20 weeks, the animals were subjected to periodic functional assessments, and after this period, the sciatic nerves and cranial tibial muscles were evaluated stereologically and histomorphometrically, respectively. The results obtained allowed to confirm the beneficial effects resulting from the application of this therapeutic combination. The administration of conditioned medium from Olfactory Mucosal Mesenchymal Stem Cells led to the best results in motor performance, sensory recovery, and gait patterns. Stereological and histomorphometric evaluation also revealed the ability of this therapeutic combination to promote nervous and muscular histologic reorganization during the regenerative process. The therapeutic combination discussed in this work shows promising results and should be further explored to clarify irregularities found in the outcomes and to allow establishing the use of cell secretome as a new therapeutic field applied in the treatment of peripheral nerves after injury.

Background: Sinonasal squamous cell carcinoma (SNSCC) is rare in the general population. No clear and consistent etiologic correlation between human papillomavirus and SNSCC has yet been delineated in literature. p16 is a tumour suppressor protein used as a surrogate marker for HPV. This study aims to evaluate the relationship between p16 overexpression in SNSCC and its role in prognosis and survival. Methods: A population-based retrospective analysis was performed using prospectively collected data from the Northern Alberta Head and Neck Tumour Board, Alberta Cancer Registry, and Alberta Cancer Research Biobank. p16 overexpression was analyzed from pathologic sample of patients meeting study criteria, and participants were dichotomized by status. Subsequently, nonparametric analysis of demographics, initial staging, and initial treatment were performed, and a Kapan-Meier curve was developed to assess differences in survival. Results: 16 patients were included in analysis. p16 overexpression was seen in 68.8% of patients. p16 positive and negative groups were comparable for age, gender, smoking status, stage, and treatment. A statistically significant five-year survival advantage was observed in patients with p16 positive SNSCC (p = 0.013). Conclusions: This is the first Canadian study to demonstrate a high prevalence of p16 positivity in SNSCC and its presence denoting a statistically significant survival advantage. Results demonstrate a previously unconfirmed role of oncogenic HPV in SNSCC.

Hematological and biochemical reference values in sickle cell disease (SCD) are crucial for patient management and evaluation of interventions. This study was conducted at Muhimbili National Hospital (MNH) in Dar es Salaam, to establish laboratory reference ranges in SCD at steady-state. Patients were grouped into five age groups with respects to their sex. Aggregate functions were used to handle repeated measures within the indi-vidual level in each age group. A nonparametric approach was used to smooth the curves and a parametric approach was used to determine SCD normal ranges. Comparison between males and females and against the general population was documented. Data from 4,422 patients collected from 2004-2015 were analyzed. The majority of the patients (35.41%) were children aged between 5-11 years. There were no significant differences (p≥0.05) in mean corpuscular hemoglobin concentration (MCHC), lymphocytes, basophils and bilirubin direct observed between males and females. Significant differences (p<0.05) were observed in all selected parameters across age groups except neutrophils and MCHC in adults, as well as platelets and alkaline phosphatase in infants when SCD estimates were compared to the general population. Laboratory reference ranges in SCD at steady-state were different from those of the general population and varied with sex and age. The established reference ranges for SCD at steady-state will be a helpful in the management and monitoring of the progress of SCD.

UPF3B is a constituent of the classical nonsense-mediated mRNA decay (NMD) pathway that degrades both the aberrant transcripts and a set of physiological transcripts. In higher eukaryotes, UPF3B have significant biochemical functions in diverse cellular processes including NMD and translation. UPF3B plays a crucial role in neuronal development and differentiation. Next-generation sequencing technologies identified several loss-of-function mutations in the UPF3B gene that results in neuro-developmental disorders in humans. To uncover the mechanistic role of UPF3B in neuronal functions, we have generated the UPF3B-knockout mammalian cell line model system using CRISPR-Cas9 gene editing method. RNA-Sequencing Analysis of cellular transcriptome from UPF3B-KO cells identified specific genes involved in cell growth and neuronal functions. Altered expression of genes related to the axon guidance pathway delineated the UPF3B function to regulate the neuron-specific genes. Functional enrichment analysis identified the genes involved in the disorders related to mental health and intellectual disability. Our study has the potential to identify the direct players of intellectual disability and will have broader implications.

More than 800 million tons of fish are utilizing in a year and 25-30% become waste. The waste amount is beneficial source for extraction of collagen. But procedure of extraction is still to be optimized. The current study was designed to extract collagen from fish through fish waste fermentation under various conditions. For collagen extraction we did lactic acid fermentation in which yogurt and Dough bacteria was added with fish sample and placed it in incubator at 30ºC for one month. In yogurt and dough culture have at least 10 type of lactic acid bacterial species. After every week we check PH of each sample and take soup of that sample. After centrifugation of that sample’s TCA (Trichloroacetic acid) precipitation was done of yogurt and dough sample and kept at -20ºC. then did SDS-PAGE) using 6% resolving and 5% stacking gel of already stored sample. Then HaCaT cells (1 × 10⁴ cells/well) were cultured in 96-well flat-bottom culture plates and treated with appropriate doses of FFCP (fermented fish collagen peptide) for 24 and 48 hours.The SDS-PAGE revealed that the collagen protein of fish had doublet pattern for α1 and α2 chains at corresponding to 145 kDa and 132 kDa respectively. The density for α1 twice as compared to α2. Our result agrees that The fish collagen consists mostly of α-chain as well as little amount of inter and intra molecular cross-linked components of α-chains; b (dimmer) and c (trimer). Different biochemical tests were done for identification of lactic acid bacteria catalase positive, citrate positive, urease negative. Our fermented fish collagen and peptides mixture were test for cellular cytotoxicity and proliferative effect on HaCaT cells. Current result shows that fermented extracted collagen are nontoxic and induce the proliferation of HaCaT cells. Current study is supported by various studies that revealed the medical application of fish extracted collagen as underline.

Objective: Surgical eradication of malignant glioma cells is theoretically impossible. Therefore, reducing the number of remaining tumor cells around the brain-tumor interface (BTI) is crucial for achieving satisfactory clinical results. The usefulness of fluorescence-guided resection for the treatment of malignant glioma was recently reported, but the detection of infiltrating tumor cells in the BTI using a surgical microscope is not realistic. Therefore, we developed an intraoperative rapid fluorescence cytology system, and evaluated its clinical feasibility for the management of malignant glioma. Materials and methods: Twenty-five selected patients with malignant glioma (newly diagnosed: 17; recurrent: 8) underwent surgical resection under photodiagnosis using photosensitizer Talaporfin sodium and a semiconductor laser. Intraoperatively, a crush smear preparation was made from a tiny amount of tumor tissue, and the fluorescence emitted upon 620/660 nm excitation was evaluated rapidly using a compact fluorescence microscope in the operating theater. Results: Fluorescence intensities of tumor tissues measured using a surgical microscope correlated with the tumor cell densities of tissues evaluated by measuring the red fluorescence emitted from the cytoplasm of tumor cells using a fluorescence microscope. A “weak fluorescence” indicated a reduction in the tumor cell density, whereas “no fluorescence” did not indicate the complete eradication of the tumor cells, but indicated that few tumor cells were emitting fluorescence.Conclusion: The rapid intraoperative detection of fluorescence from glioma cells using a compact fluorescence microscope was a useful to evaluate the presence of tumor cells in the resection cavity walls, and provides surgical implications for the more complete resection of malignant gliomas.

Diffuse large B cell lymphoma (DLBCL), the most frequent type of non-Hodgkin lymphoma in adulthood, remains challenging clinical issues. Despite enhanced remission rates can be achieved, there are one-third of patients who will not respond to current treatment or will relapse with resistant disease, necessitating ongoing efforts on effective treatment strategies and agents. The vacuole H+-ATPase inhibitor bafilomycin A1 is broadly used to block late stage of autophagy flux at high concentration. In this study, we show that, to our surprise, bafilomycin A1 effectively inhibited and killed DLBCL cells at nanomolar concentrations (5nM). Bafilomycin A1 targeted cell cycle regulators cyclin D1 and cyclin E2 to induce cell cycle arrest in G0/G1 phase. Meanwhile, it induced caspase-dependent apoptosis with concomitant cleaved caspase-3 and Parp. Furthermore, we found that bafilomycin A1 inhibited autophagy flux at both early and late stages of the autophagy flux through activating ERK and mammalian target of rapamycin signaling, as well as by inhibiting the degradation of autolysosomes. We speculated that bafilomycin A1 as autophagy inhibitor might enhance the effect of DLBCL chemotherapeutic drug rituximab. Accordingly, our results provided evidence that the combination of bafilomycin A1 with rituximab enhanced the inhibition of DLBCL cells notably. Taken together, our data suggest that bafilomycin A1 may be a promising candidate drug in the therapy of diffuse large B cell lymphoma.

Background: Every year, millions of people are hospitalized, and thousands die from influenza A virus (FLUAV) infection. Most cases of hospitalizations and death occur among elderly. Many of these elderly patients are reliant on medical treatment of underlying chronic diseases, such as arthritis, diabetes, and hypertension. We hypothesized that the commonly prescribed medicines for treatment of underlying chronic diseases can affect host responses to FLUAV infection, and thus contribute to morbidity and mortality associated with influenza. Therefore, the aim of this study was to examine whether commonly prescribed medicines could affect host responses to virus infection in vitro. Methods: We first identified 45 active compounds of medicines commonly prescribed in Central Norway. Then we constructed a drug-target interaction network and identified potential implication of these interactions for FLUAV-host cell interplay. Finally, we tested the effect of 45 drugs on viability, transcription and metabolism of mock- and A/WSN/33(H1N1)-infected human retinal pigment epithelial (RPE) cells. Results: In silico drug-target interaction analysis revealed that many drugs, such as acetylsalicylic acid, atorvastatin, candesartan, and hydroxocobalam, could target and modulate FLUAV-host cell interaction. In vitro experiments showed that these and other compounds at non-cytotoxic concentrations differently affected transcription and metabolism of mock- and FLUAV-infected cells. Conclusion: Many commonly prescribed drugs modulate FLUAV-host cell interactions in vitro and therefore could affect their interplay in vivo, thus, contributing to morbidity and mortality of patients with influenza virus infections.

A technique for fabrication of bacterial cellulose-based films with CeO₂ nanofiller has been developed. The structural and morphological characteristics of the materials have been studied, their thermal and mechanical properties in dry and swollen states having been determined. The preparation methodology makes it possible to obtain composites with a uniform distribution of nanoparticles. The catalytic effect of ceria regarding the thermal oxidative destruction of cellulose has been confirmed by TGA and DTA methods. An increase in CeO₂ content led to an increase in the elastic modulus (a 1.27-fold increase caused by the introduction of 5 wt.% of the nanofiller into the polymer) and strength of the films. This effect is explained by the formation of additional links between polymer macro-chains via the nanoparticles’ surface. The materials fabricated were characterised by a limited ability to swell in water. Swelling caused a 20- to 30-fold reduction in the stiffness of the material, the mechanical properties of the films in a swollen state remaining germane to their practical use. The application of the composite films in cell engineering as substrates for the stem cells’ proliferation has been studied. The increase in CeO₂ content in the films enhanced the proliferative activity of embryonic mouse stem cells. The cells cultured on the scaffold containing 5 wt.% of ceria demonstrated increased cell survival and migration activity. An analysis of gene expression confirmed improved cultivation conditions on CeO₂-containing scaffolds.

The mammalian/mechanistic target of rapamycin complex 1 (mTORC1) is activated by the small G-protein, RHEB-GTPase. On lysosome, RHEB activates mTORC1 by binding the domains of N-heat, M-heat, and FAT, which allosterically regulates ATP binding in the active site for further phosphorylation. The crucial role of RHEB in regulating growth and survival through mTORC1, makes it a targetable site for anti-cancer therapeutics. However, the binding kinetics of RHEB to mTORC1 is still unknown at the molecular level. Therefore, we studied the kinetics by in vitro and in-cell protein-protein interaction (PPI) assays. For this, we used the split-luciferase system (NanoBiT®) for in-cell studies, and prepared proteins for the in vitro measurements. Consequently, it was shown that RHEB binds to the whole mTOR both in the presence or absence of GTPɣS, with five-fold weaker affinity in the presence of GTPɣS. Also, RHEB bound to the truncated mTOR fragments of N-heat domain (60-167) and M-heat domain (967-1023) in a GTP independent manner. Furthermore, RHEB bound to the truncated kinase domain (2148-2300) with higher affinity also in GTP independently. In conclusion, RHEB binds two different binding sites of mTOR, which probably regulates the kinase activity of mTOR through multiple different molecular mechanisms.

Necroptosis is an inflammatory form of lytic programmed cell death that is thought to have evolved to defend against pathogens. Genetic deletion of the terminal effector protein – MLKL – shows no overt phenotype in the C57BL/6 mouse strain under conventional laboratory housing conditions. Small molecules that inhibit necroptosis by targeting the kinase activity of RIPK1, one of the main upstream conduits to MLKL activation, have shown promise in several murine models of non-infectious disease and in phase II human clinical trials. This has triggered multi-billion-dollar investments into the emerging class of necroptosis blocking drugs, and the potential utility of targeting the terminal effector is being closely scrutinised. Here we review murine models of disease, both genetic deletion and mutation, that investigate the role of MLKL. We summarize a series of examples from several broad disease categories including ischemia reperfusion injury, sterile inflammation, pathogen infection and haematological stress. Elucidating MLKL’s contribution to mouse models of disease is an important first step to identify human indications that stand to benefit most from MLKL-targeted drug therapies.

Heart regeneration after myocardial infarction remains challenging in reconstruction of blood resupply system. Here, we find that in zebrafish heart after resection of the ventricular apex, the local myocardial cells and the clotted blood cells undergo cell remodeling process via cytoplasmic exocytosis and nuclear reorganization within revascularization-based blastema. The regenerative processes are visualized by spatiotemporal expression of three blastema representative factors (alpha-SMA- which marks for fibrogenesis, Flk1for angiogenesis/hematopoiesis, and Pax3a for remusculogensis)，and two histone modifications (H3K9Ac and H3K9Me3 mark for chromatin remodeling). Using the cultured zebrafish embryonic fibroblasts we identify blastema fraction components and show that Krt5 peptide could link cytoskeleton network and BMP4 signaling pathway to regulate the transcription and chromatin accessibility at the blastema representative genes and bmp4 genes. Our study provides new mechanistic insights into the epithelial-dependent and revascularization-based blastema regeneration for potential myocardial infarction therapy.

Cancer immunotherapy reaches a remarkable achievement in various cancer types and brings new possibilities to improve cancer patients’ long-term survival. However, outcomes vary from case to case, and the present protocol benefits a small fraction of patients. One notable factor is the tumor microenvironment, especially the immune cell components, that may reflect the immune response's status quo on site. Thus, understanding the content of infiltrating immune cells in tumors is not only for research interesting but also a crucial subject toward precision medicine. We implement an algorithm for resolving relative proportions of twenty-one immune cell subclasses from a human tissue profiled transcriptome by microarray technology to reach the goal above. By selecting gene features and then adopting ?-Support Vector Regression, we can construct a deconvolution model and resolve the immune cell context. The excellent consistency between the estimated values and the correct immune-cell composition further demonstrates this approach provides a more natural alternative to revealing samples' immune cell content and reliable results like recent single-cell technologies. Based on this algorithm, the web-based deconvolution tool implemented named mySORT provides a user-friendly interface for estimating the immune cell content by uploading gene expression profiling. We also present comprehensive visualization 2D/3D plots in mySORT so that users can easily make a comparison between different samples. Finally, we synthesized pseudo-bulk expression data from single-cell transcriptomic datasets of 17 melanoma and 16 head and neck cancer patients. The deconvolution results of microarray-based data in the previous study and synthetic pseudo-bulk data all proved the excellent performance of mySORT. We believe that mySORT can help researchers in all fields easily understand complex immune microenvironment. The website of mySORT is freely accessible on https://symbiosis.iis.sinica.edu.tw/mySORT/.

Artificial intelligence methods may help in unveliling information hidden in high-dimensional oncological data. Flow cytometry studies of haematological malignancies provide quantitative data with the potential to be used for the construction of response biomarkers. Many computational methods from the bioinformatics toolbox can be applied to these data but have not been exploited in their full potential in leukaemias, specifically for the case of childhood B-cell acute lymphoblastic leukemia. In this paper we analysed flow cytometry data obtained on diagnosis from 54 paediatric B-cell acute lymphoblastic leukemia patients from two local institutions. We constructed classifiers based on the Fisher’s Ratio to quantify differences in expression levels of immunophenotypical markers between patients with relapsing and non-relapsing disease. The distribution of the marker CD38 was found and validated to have a strong discriminating power between both patient cohorts, thus providing a classifier.

Unanticipated errors in scientific research data can be attributed to the unwarranted assumption of uniformity in the polystyrene surface that is ubiquitously used in tissue culture flasks and dishes. We have shown that when adherent cells are subjected to fluid shear force, equivalent to rinsing the culture with a balanced salt solution, cells on some areas of the polystyrene surface will immediately rupture while still adherent on the surface. This heterogeneity on the polystyrene surface can cause unexpected variability in experimental results and in replicating experiments among labs. In this paper a novel quantitative method is described to measure the degree of heterogeneity on the polystyrene surface of tissue culture flasks. The results show significant variation among several brands of tissue culture flasks as well as large variability within the production lot of a manufacturer. The assay method involves loading the cells with a fluorescent marker that is released upon membrane rupture. Cell membrane rupture also causes the loss of marker proteins used in Westernblots. This novel assay method can be used to monitor the batch consistency and the manufacturing process of flasks and dishes. It may also be used to test new biomaterials.

Cyclodextrin polymers have high applicability in pharmaceutical formulations due to better biocompatibility, solubility enhancement, loading capacity and controlled drug release than parent the cyclodextrins. The cytotoxicity and cell uptake of new cationic beta-cyclodextrin monomers and polymers were evaluated as suitable material for nasal formulations and their protective effects on cells exposed to hydrogen peroxide were studied. PC12 and CACO-2 cells were selected as the neuronal and epithelial type cells, respectively, to mimic the structure of respiratory and olfactory epithelia of the nasal cavity. All cationic beta-cyclodextrin polymers tested showed dose- and time-dependent toxicity; nevertheless, at 5 µM concentration and 60 min of exposure, the quaternary-ammonium-beta-cyclodextrin soluble polymer could be recognized as non-toxic. Based on these results, fluorescently labelled quaternary-ammonium-beta-cyclodextrin monomer and polymer were selected for uptake studies in CACO-2 cells. The monomeric and polymeric beta-cyclodextrins were internalized in the cytoplasm of CACO-2 cells; the cationic monomer showed higher permeability than the hydroxypropyl-beta-cyclodextrin, employed as comparison. Therefore, these cationic beta-cyclodextrins showed potential as excipients able to improve the nasal absorption of drugs. Furthermore, amino-beta-cyclodextrin and beta-cyclodextrin soluble polymers were able to reduce oxidative damage in PC12 and CACO-2 cells and thus could be studied as bioactive carriers or potential drugs for cells protection against oxidative stress.

Prostate cancer (PCa) has become the most common tumor among males in Europe and the USA. Adoptive immunotherapy appears as a promising strategy to control the advanced stages of the disease by specific targeting the tumor, in particular through chimeric antigen receptor T (CAR-T) cell therapy. Despite the advancements of CAR-T technology in the treatment of hematological malignancies, solid tumors still represent a challenge. To overcome current limits, other cellular effectors than T lymphocytes are under study as possible candidates for CAR-engineered cancer immunotherapy. A novel approach involves the NK-92 cell line, which mediates strong cytotoxic responses against a variety of tumor cells but has no effect on non-malignant healthy counterparts. Here, we report a therapeutic approach against PCa based on engineering of NK-92 cells with a CAR recognizing the human prostate-specific membrane antigen (PSMA), which is overexpressed in prostatic neoplastic cells. Upon CAR transduction, NK-92/CAR cells acquired high and specific lytic activity against PSMA-expressing prostate cancer cells in vitro, and also underwent degranulation and produced high levels of IFN-γ in response to antigen recognition. Lethal irradiation of the effectors, a safety measure requested for the clinical application of retargeted NK-92 cells, fully abrogated replication but did not impact on phenotype and short-term functionality. PSMA-specific recognition and antitumor activity were retained in vivo, as adoptive transfer of irradiated NK-92/CAR cells in prostate cancer-bearing mice restrained tumor growth and improved survival. Anti-PSMA CAR-modified NK-92 cells represent a universal, off-the-shelf, renewable and cost-effective product endowed with relevant potentialities as a therapeutic approach for PCa immunotherapy.

Geranylgeranyl acetone (GGA) protects against various types of cell damages by upregulating heat shock proteins. We investigated whether GGA protect neuronal cells from cell death induced by oxidative stress. Glutamate exposure was lethal to HT-22 cells which comprise a neuronal line derived from mouse hippocampus. This configuration is often used as a model for hippocampus neurodegeneration in vitro. In the present study, GGA protected HT-22 cells from glutamate-induced oxidative stress. GGA pretreatment did not induce Hsps. Moreover, reactive oxygen species increased to the same extent in both GGA-pretreated and untreated cells exposed to glutamate. In contrast, glutamate exposure and GGA pretreatment increased mitochondrial membrane potential. However, increases in intracellular Ca2+ concentration were inhibited by GGA pretreatment. In addition, the increase of phosphorylated ERKs by the glutamate exposure was inhibited by GGA pretreatment. These findings suggest that GGA protects HT-22 cells from glutamate-provoked cell death without Hsp induction and that the mitochondrial calcium buffering capacity plays an important role in this protective effect.

Organoid engineering promises to revolutionize medicine with wide ranging applications of scientific, engineering, and clinical interest, including precision and personalized medicine, gene editing, drug development, disease modeling, cellular therapy, and a basic understanding of human development. Organoids are a three-dimensional (3D), miniature, caricature of a target organ, are initiated with stem/progenitor cells, and are extremely promising tools to model organ function. The biological basis for organoids is that they foster stem cell-self renewal, differentiation, and self-organization, recapitulating tissue structure or function better than 2D systems. In this review, we first discuss the importance of epithelial organs and the general properties of epithelial cells to provide context for the liver, pancreas, and gall bladder and rationale for organoid cultures. Next, we develop a general framework to understand self-organization, tissue hierarchy, and organoid cultivation. For each of these areas, we provide historical context, and review both a wide range of biological and/or biophysical/mathematic perspectives that enhances understanding of organoids. Next, we review existing techniques and progress in hepatobiliary and pancreatic organoid engineering. To do this, we review organoids from both primary tissues, cell lines, and stem cells, and introduce engineering studies when applicable. Noninvasive assessment of 1 organoids can reveal underlying biology and enable improved assays for growth, metabolism, and function. Applications of organoid for cell therapy are also discussed. Taken together, we establish a broad strong scientific foundation for organoids and provide an in-depth review of hepatic, biliary and pancreatic organoids.

PcALCL mainly concerns elderly patients. It is a large CD30+ T-cell neoplasm composed of large cells with anaplastic, pleomorphic or immunoblastic morphology, with exclusively cutaneous onset and localization. The clinical course of pcALCL is predominantly indolent. Most elderly patients with lymphoma tend to have a sedentary lifestyle, which has a negative effect on their quality of life (QoL) and on their survival. Several studies indicate that exercise has a positive impact on QoL because it reduces peak oxygen consumption, improves physical capacity, increases self-esteem, reduces accumulated stress and promotes relaxation. Therefore, particularly in indolent lymphomas, it is necessary to indicate a program of physical activity to be practiced systematically. The complete surgical excision and local radiotherapy are the first line gold standard in pcALCL with solitary lesion.

The incidence of human papillomavirus-related head and neck squamous cell carcinoma (HPV+HNSCC) has reached epidemic levels in the last decade. While prophylactic vaccines will prevent future HPV infections, there are currently no HPV-specific antiviral drugs to treat current HPV infections or HPV+HNSCC. HPV replication and transcription are promising targets for anti-HPV therapeutics, as modulation of these processes can alter expression levels of HPV E6 and E7, which are required for maintenance of the transformed phenotype. This is a particularly attractive target in in HPV+HNSCC where the majority of tumors have episomal genomes replicating in an E1-E2 dependent manner. Here, we describe a model system to study HPV16 E1-E2 mediated DNA replication and HPV16 E2-mediated transcriptional activation and repression in multiple HNSCC cell lines. Our results demonstrate that low levels of IFIT1 are required for HPV16 replication in HNSCC cell lines and HPV16 E1 interacts with IFIT1. Restoration of IFIT1 expression in HNSCC cell lines partially inhibits HPV16 E1-E2 mediated replication. This system can be used to study replication and transcription by HPV16 E1 and E2 in HNSCC as well as be utilized to screen potential anti-HPV therapeutics that target HPV16 replication and transcription.

Pyruvate kinase M2 (PKM2) is essential for aerobic glycolysis and is highly expressed in various cancer tissues. Although high PKM2 expression is observed in prostate cancer tissues, its functional role in cancer metabolism is unclear. Here, we investigated the role of PKM2 in regulating autophagy and its associated pathways in prostate cancer cells. PKM2 expression was silenced using various PKM2 small interfering RNAs (siRNAs) and then we measured PKM2-related cellular pathways associated with autophagy. PKM2 siRNA-transfected prostate cancer cells showed significantly reduced viability. Acridine orange staining and immunoblotting analysis showed that PKM2 downregulation markedly increased autophagic cell death. Results of western blotting analysis showed that PKM2 knockdown affected protein kinase B/mechanistic target of rapamycin 1 pathway, which consequently downregulated the expression of glycolytic enzymes lactate dehydrogenase A and glucose transporter 1. To the best of our knowledge, this is the first study to show that PKM2 inhibition alters cancer cell metabolism and induces autophagy. Thus, the present study provides a strategy for the development of PKM2-targeted novel anticancer drugs for the treatment of prostate cancer.

T-cell mediated immune responses should be regulated to avoid the development of autoimmune or chronic inflammation diseases. Several mechanisms have been described to regulate this process, namely death of overactivated T cells by cytokine deprivation, suppression by T regulatory cells (Treg), induction of expression of immune checkpoint molecules such as CTLA-4 and PD-1, or activation-induced cell death (AICD). In addition, activated T cells release membrane microvesicles called exosomes during these regulatory processes. In this review, we revise the role of exosome secretion in the different pathways of immune regulation described to date and its importance in the prevention of autoinmune disease. Expression of membrane-bound death ligands on the surface of exosomes during AICD, or the more recently described transfer of miRNA or even DNA inside T-cell exosomes are molecular mechanisms that will be analyzed.

Reversible protonic ceramic cells (rPCCs) combine two different operation regimes, fuel cell and electrolysis cell modes, which allow reversible chemical-to-electrical energy conversion at reduced temperatures with high efficiency and performance. Here we present novel technological and materials science approaches, enabling a rPCC with symmetrical functional electrodes to be prepared using a single sintering step. The response of the cell fabricated on the basis of P–N–BCZD|BCZD|PBN–BCZD (where BCZD = BaCe_0.5Zr_0.3Dy_0.2O_3–δ, PBN = Pr_1.9Ba_0.1NiO_4+δ, P = Pr₂O₃, N = Ni) is studied at different temperatures and water vapor partial pressures (pH₂O) by means of volt-ampere measurements, electrochemical impedance spectroscopy and distribution of relaxation times analyses. The obtained results demonstrate that symmetrical electrodes exhibit classical mixed-ionic/electronic conducting behavior with no hydration capability at 750 °C; therefore, increasing the pH₂O values in both reducing and oxidizing atmospheres leads to some deterioration of their electrochemical activity. At the same time, the electrolytic properties of the BCZD membrane are improved, positively affecting the rPCC’s efficiency. The electrolysis cell mode of the rPCC is found to be more appropriate than the fuel cell mode under highly humidified atmospheres, since its improved performance is determined by the ohmic resistance, which decreases with pH₂O increasing.

In this paper, an analytical investigation of the combined effect of through flow and magnetic field on the convective instability in an electrically conducting fluid layer, bounded in a Hele-Shaw cell is presented within the context of linear stability theory. The Galarkin method is utilized to solve the eigenvalue problem. The outcome of the important parameters on the stability of the system is examined analytically as well as graphically. It is observed that the through flow and magnetic field have both stabilizing effects, while the Hele-Shaw number has destabilizing effect on the stability of system. It is also found that the oscillatory mode of convection possible only when the magnetic Prandtl number takes the values less than unity.

We describe how clinical researchers can exploit the Android cell phone as an economic platform for the gathering of data from clinical trial participants. The aim was to provide a solution with the shortest possible learning curve for researchers who are comfortable with setting up web pages. The additional requirement is that they extend their skills to the installation of a local webserver on the cell phone and then use four simple PHP templates to construct the clinical research data collection and processing forms. Data so collected is automatically written to local csv files on the cell phone. These csv phones can be retrieved from the device by the researcher simply by plugging the cell phone into their desktop PC and accessing the cell phone memory in just the same way as they would a USB memory stick. The results are presented as a list of recommended Android Apps along with settings that have proved to provide a stable combination likely to be easily used by clinical research participants. We have made a limited ‘user trial’ of this approach with satisfactory feedback received. We have concluded that this approach will reward researchers with a solution that is user friendly, will provide transcription free data and that is more than cost competitive with the conventional error prone/poor compliance ‘paper based participant form – researcher transcription’ cycle.

Direct reprogramming of fibroblasts into induced cardiomyocytes (iCMs) holds a great promise for regenerative medicine and has been studied in several major directions. However, cell-cycle regulation, a fundamental biological process, has not been investigated during iCM-reprogramming. Here, our time-lapse imaging on iCMs, reprogrammed by Gata4, Mef2c, and Tbx5 (GMT) monocistronic retroviruses, revealed that iCM-reprogramming was majorly initiated at late-G1- or S-phase and nearly half of GMT-reprogrammed iCMs divided soon after reprogramming. iCMs exited cell cycle along the process of reprogramming with decreased percentage of EdU⁺/αMHC-GFP⁺ cells. S-phase synchronization post-GMT-infection could enhance cell-cycle exit of reprogrammed iCMs and yield more GFP^high iCMs, which achieved an advanced reprogramming with more expression of cardiac genes than GFP^low cells; however, S-phase synchronization didn’t enhance the polycistronic-MGT reprogramming, in which cell-cycle exit had been accelerated. In conclusion, post-infection synchronization of S-phase facilitated the early progression of GMT-reprogramming through a mechanism of enhanced cell-cycle exit.

We propose a wave-like design on the surface of cathode channels (wave form cathode channels) to improve oxidant delivery to gas diffusion layers (GDLs) [1-2]. We performed experiments using PEMFCs combined with wave form surface design on cathodes. We varied the factors of the distance between wave-bumps (the Adhesive distance, AD), and the size of the wave-bumps (the Expansion ratio, ER). The ADs are 3, 4, and 5 times the size of the half-circle bump’s radius, and the ERs are 1/1.5, 1/2, and 1/3 times the channel’s height. We evaluated the performances of the fuel cells, and compared the current-voltage (I-V) relations. For comparison, we prepared PEMFCs with conventional flat-surfaced oxygen channels. Our aim in this work is to identify fuel cell operation by modifying the surface design of channels, and ultimately to find the optimal design of cathode channels that will maximize fuel cell performance.

We evaluated oleanolic acid (OA)-induced anti-cancer activity, apoptotic mechanism, cell cycle status, and MAPK kinase signaling in DU145 (prostate cancer), MCF-7 (breast cancer), and U87 (human glioblastoma) cells. The IC50 values for OA-induced cytotoxicity were 112.57 in DU145, 132.29 in MCF-7, and 163.60 in U87 cells, respectively. OA (at 100 µg/mL) increased the number of apoptotic cells to 27.0% in DU145, 27.0% in MCF-7, and 15.7% in U87 cells, when compared to control cells. This enhanced apoptosis was due to increases in p53, cytochrome c, and Bax expression. OA-treated DU145 cells were arrested in G2 because of the activation of p-ERK and p21, and the decrease in cyclin B1 and cyclin E expression. Furthermore, OA-treated MCF-7 cells were arrested in G1 owing to the activation of p-JNK, p-ERK, p21, and p27, and the decrease in p-AKT, cyclin E, and CDK2. U87 cells also exhibited G1 phase arrest caused by the increase in p-ERK, p-JNK, p21, and p27, and the decrease in CDK2. Thus, OA arrests the cell cycle in different phases, and increases apoptosis in cancer cells. These results suggest that OA may alter the expression of cell cycle regulatory proteins in a cancer type-dependent manner.

Studies on the possible association between bacteria and oral squamous cell carcinoma (OSCC) remain inconclusive, largely due to methodological variations/limitations. The objective of this study was to characterize the species composition as well as functional attributes of the bacteriome associated with OSCC. DNA obtained from 20 fresh OSCC biopsies (cases) and 20 deep-epithelium swabs (matched control subjects) were sequenced for the V1-V3 region using Illumina’s 2x300 bp chemistry. High quality, non-chimeric merged reads were classified to species level using a prioritized BLASTN-algorithm. Downstream analyses were performed using QIIME, PICRUSt, and LEfSe. Fusobacterium nucleatum subsp. polymorphum was the most significantly overrepresented species in the tumors followed by Pseudomonas aeruginosa and Campylobacter sp. Oral taxon 44, while Streptococcus mitis, Rothia mucilaginosa and Haemophilus parainfluenzae were the most significantly abundant in the controls. Functionally, genes involved in bacterial mobility, flagellar assembly, bacterial chemotaxis and LPS synthesis were enriched in the tumors while those responsible for DNA repair and combination, purine metabolism, phenylalanine, tyrosine and tryptophan biosynthesis, ribosome biogenesis and glycolysis/gluconeogenesis were significantly associated with the controls. This is the first epidemiological evidence for association of F. nucleatum and P. aeruginosa with OSCC. Functionally, an “inflammatory bacteriome” is enriched in OSSC.

Background: Nodal peripheral T-cell lymphomas (nPTCLs) encompass a heterogeneous group of mature and aggressive lymphoid malignancies, including peripheral T-cell lymphoma, not otherwise specified (PTCL/NOS), angioimmunoblastic T-cell lymphoma (AITL) and anaplastic large cell lymphoma (ALCL) ALK-positive and ALK-negative. Their differential diagnosis and prognosis are an issue in the clinical practice. Accurate biomarkers to refine the different subtypes of nPTCLs and to stratify their prognosis are essential to improve their treatment approach. The aim of this study was to test the prognostic impact of GATA3 gene expression, and its capability to discriminate the different subtypes of nPTCLs. Patients and Methods: From 2000 to 2017, 80 patients with nPTCLs were eligible for GATA3 gene expression analysis that was assessed retrospectively by quantitative real time PCR (qRT-PCR) of neoplastic biopsies in Formalin-Fixed Paraffin-Embedded samples (FFPE). Results: Median age was 49 years old (IqR 34-59), 43/80 (53.7%) were male. Median follow-up was 1.72 years. Of them, 36.3% were classified as PTCL/NOS, 31.2% ALK-negative ALCL, 21.2% ALK-positive ALCL and 11.3% AITL. The majority of cases had advanced stage (III/IV). Two-year estimated overall survival (OS) and progression-free survival (PFS) were 52.2% and 39.5%, respectively. The median GATA3 gene expression level was 0.49% (range 0 – 7.07) in all cohort, it was 0.11% for ALK-positive ALCL, 0.46% for ALK-negative ALCL, 0.86% for PTCL/NOS and 0.67% for AITL. The difference of GATA3 gene expression among distinct variants of nPTCLs was statistically significant (p < 0.001). GATA3 gene expression levels ≥ 0.71% discriminate PTCL/NOS from ALK-negative ALCL and AITL with sensitivity of 62% and specificity of 80.3%. GATA3 gene expression levels ≥ median was associated with poor 2-year OS for PTCL/NOS (46.7% x 21.4%, p=0.04) and for ALK-negative ALCL (85.7% x 54.5%, p=0.04). Conclusion: Despite the relative small and heterogeneous group of patients with nPTCLs, GATA3 gene overexpression may be an important biomarker associated with poor prognosis in PTCL/NOS and ALK-negative ALCL. Moreover it may also discriminate different subtypes of nPTCLs. Further studies with larger series of patients should confirm our findings.

As non-operative management (NOM) of esophageal and rectal cancer is becoming more prevalent, blood-biomarkers such as circulating tumor DNA (ctDNA) may provide clinical information in addition to endoscopy and imaging to aid in treatment decisions following chemotherapy and radiation therapy. In this feasibility study, we prospectively collected plasma samples from locally advanced esophageal (n=3) and rectal cancer (n=2) patients undergoing multimodal neoadjuvant therapy to assess the feasibility of serial ctDNA monitoring throughout neoadjuvant therapy. Using the DIDA-Seq error-correction method, we serially interrogated plasma cell-free DNA at 28-41 tumor-specific genomic loci throughout therapy and in surveillance with an average limit of detection of 0.016% mutant allele frequency. In both rectal cancer patients, ctDNA levels were persistently elevated following total neoadjuvant therapy with eventual detection of clinical recurrence prior to salvage surgery. Among the esophageal cancer patients, ctDNA levels closely correlated with tumor burden throughout and following neoadjuvant therapy, which was associated with a pathologic complete response in one patient. In this feasibility study, patient and tumor-specific ctDNA levels correlated with clinical outcomes throughout multi-modality therapy suggesting that serial monitoring of patient ctDNA has the potential to serve as a highly sensitive and specific biomarker to risk-stratify esophageal and rectal cancer patients eligible for NOM. Further prospective investigation is warranted.

In the face of rising global demand and unsustainable production methods, cultivated crustacean meat (CCM) is proposed as an alternative means to produce delicious lobster, shrimp and crab products. Cultivated meat requires starting stem cells that may vary in terms of potency, and propensity to proliferate or differentiate into myogenic (muscle-related) tissues. We suggest that regenerating crustacean limbs harbor a range of stem cells suitable for cultivated meat production and present a humane tissue source because they can be accessed non-lethally. To investigate stem cell activity in this model, we have conducted RNA-Seq analysis across six stages of claw regeneration in the crayfish Cherax quadricarinatus (four pre-molt and two post-molt stages), along with histology and real time quantitative PCR (qPCR). Differential expression analysis revealed expression patterns of significantly up- or down-regulated genes in 14 functional categories. Relative expression of select stem cell target genes (including endocrine, myogenic, cell cycle and pluripotency factors) highlighted two growth peaks during pre-molt regeneration and limited stem cell activity after the molt. Histology and qPCR results support the overall finding that pre-molt limb regeneration stages harbor more stem cell activity, likely making them a more prolific cell source for CCM development.

Immunity against respiratory pathogens is often short-term, and consequently there is an unmet need for effective prevention of such infections. One such infectious disease is COVID-19, which is caused by the novel Beta coronavirus SARS-CoV-2 that emerged around the end of 2019. The World Health Organization declared the illness a pandemic on March 11, 2020, and since then it has killed or sickened millions of people globally. The development of COVID-19 systemic vaccines, which impressively led to a significant reduction in disease severity, hospitalization, and mortality, con-tained the pandemic's expansion. However, these vaccines have not been able to stop the virus from spreading because of the restricted development of mucosal immunity. As a result, breakthrough infections have frequently occurred and new strains of the virus have been emerging. Furthermore, SARS-CoV-2 will likely continue to circulate and, like the influenza virus, co-exist with humans. The upper respiratory tract and nasal cavity are the primary sites of SARS-CoV-2 infection and thus, a mucosal/nasal vaccination to induce a mucosal response and stop the virus transmission is warrant-ed. In this review, we present the status of the systemic vaccines, of the approved mucosal vaccines and those under evaluation in clinical trials. Furthermore, we present our approach of a B-cell pep-tide-based vaccination applied by prime-boost schedule for eliciting both systemic and mucosal immunity.

Despite chronic fibrosis and associated excess extracellular matrix (ECM) deposition and crosslinking occurring in many pathological conditions, few in vitro studies examine how fibrosis-induced ECM stiffening impacts lymphatic endothelial cells (LEC) behavior and subsequent new lymphatic vessel growth and function. This study examined the stiffening profile of PhotoCol®—commercially available methacrylated type I collagen—photo-crosslinked with photoinitiators Lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP), Irgacure 2959 (IRG), and Ruthenium/Sodium Persulfate (Ru/SPS) prior to evaluating PhotoCol® permeability and LEC response to PhotoCol® at low and high stiffness levels representing normal and fibrotic ECM stiffness. Ru/SPS produced the highest maximum stiffness for photo-crosslinked PhotoCol® hydrogels. While Ru/SPS stiffness values did not differ significantly with increased light exposure, permeability decreased significantly with increasing light exposure for 40 kDa dextran. Finally, LECs on softer PhotoCol® appeared smaller with less prominent VE-Cadherin (cell-cell junction) and F-actin expression compared to cells on stiffer PhotoCol®. Overall, PhotoCol® with Ru/SPS photoinitiator provides the fibrillar microstructure and dynamic stiffness range that enables systematic study of LEC stiffness responses relevant to the stiffened ECM observed in pathologies with significant fibrotic activity. Therefore, this study demonstrates the utility of PhotoCol® with Ru/SPS for disease modeling applications, particularly modeling lymphatic vascular growth and function during fibrosis.

The observation that certain therapeutic strategies for targeting inflammation benefit patients with distinct immune-mediated inflammatory diseases (IMIDs) is exemplified by the success of TNF blockade in conditions including rheumatoid arthritis, ulcerative colitis and skin psoriasis, albeit only for subsets of individuals with each condition. This suggests intersecting "nodes" in inflammatory networks at a molecular and cellular level may drive and/or maintain IMIDs, being “shared” between traditionally distinct diagnoses without mapping neatly to a single clinical phenotype. In line with this proposition, integrative tumour tissue analyses in oncology have highlighted novel cell states acting across diverse cancers, with important implications for precision medicine. Drawing upon advances in the oncology field, this narrative review will first summarise learnings from the Human Cell Atlas in health as a platform for interrogating IMID tissues. It will then review cross-disease studies to date that inform this endeavour, before considering future directions in the field.

The design and integration of intelligent energy management systems in hybrid Electric Vehicle (EV) charging stations, leveraging Industry 4.0 and renewable energy sources, is crucial for advancing sustainability, efficiency, and technological development. This paper introduces a pioneering hybrid EV charging station that employs hybrid power sources, combining photovoltaic panels, a battery, and a fuel cell, each operating at 240V and 14A. Utilizing wireless power transfer technology, the system comprises five integral blocks: a power source, a boost converter, a High-Frequency (HF) inverter, transfer coils, and EV batteries. The optimization process involves two key stages: i) maximum power point tracking optimization of the boost converter, ensuring maximum power generation by varying the duty cycle between 10% and 90%, and ii) the HF phase employing a class-ϕ2 inverter at 30 MHz, synchronized with the resonant frequency of wireless power transfer coils. Control is executed through a digital signal processor card utilizing zero-voltage switching for efficient operations. This design enhances sustainability in EV charging solutions by optimizing power transfer through the use of hybrid sources.

Introduction: Lung cancer remains a global health concern, with non-small cell lung cancer (NSCLC) comprising the majority of cases. Early detection of lung cancer has led to an increased number of cases identified in the earlier stages of NSCLC. This required the revaluation of the NSCLC treatment approaches for early-stage NSCLC. Methods: We conducted a comprehensive search using multiple databases to identify relevant studies on treatment modalities for early-stage NSCLC. Inclusion criteria prioritized but were not limited to, clinical trials and meta-analyses on surgical approaches to early-stage NSCLC conducted from 2021 onwards. Discussion: Minimally invasive approaches, such as VATS and RATS, along with lung resection techniques, including sublobar resection have emerged as treatments for early-stage NSCLC. Ground-glass opacities (GGOs) hve shown prognostic significance, especially when analyzing the consolidation-tumor ratio (CTR). There have also been updates on managing GGOs, including the non-surgical approaches, the extent of lung resection indicated, and the level of lymphadenectomy required. Conclusion: The management of early-stage NSCLC requires further assessment of treatment strategies. This includes understanding the required extent of surgical resection, interpreting the significance of GGOs (specifically GGOs with a high CTR), and evaluating the efficacy of alternative therapies. Customized treatment involving surgical and non-surgical interventions is essential for advancing patient care.

The risk of malignant transformation of induced pluripotent stem cells (iPSC)-derived cells in response to DNA damage is a potential concern as the tumor suppressor genes TP53 and CDKN2A are transiently inactivated during reprogramming. Here, we evaluated the integrity of cellular senescence pathways and DNA double-strand break (DSB) repair in iPSC-derived human fibroblasts (i-HF) compared to their parental skin fibroblasts (HF). Using a variety of functional assays, we show that the capacity of i-HF to enter senescence and repair DSB is not compromised after damage induced by ionizing radiation (IR) or overexpression of H-RASV12. Still, i-HF lines are transcriptionally different from their parental lines, showing enhanced metabolic activity and higher expression of p53-related effector genes. As a result, i-HF lines generally exhibit increased sensitivity to various stresses, have an elevated senescence-associated secretory phenotype (SASP) and cannot be immortalized unless p53 expression is knocked down. In conclusion, while our results suggest that i-HF are not at a greater risk of transformation, their overall hyperactivation of senescence pathways may impede their function as a cell therapy product.

Background: The accurate diagnosis of regional lymph node metastasis is critical for guiding treatment decisions in head and neck cancer patients. Despite advances in imaging techniques, detecting nodal metastasis remains challenging, leading to potential undertreatment or overtreatment. This systematic review aims to identify molecular markers associated with occult metastasis in Head and Neck Squamous Cell Carcinoma (HNSCC) patients. Methods: The present research was conducted following PRISMA guidelines. Prospero registration nr. CRD42024522985. Results: Through a comprehensive literature search and review process, 634 articles were considered, 103 of them were finally included. Conclusions: Several promising markers were identified, including miR-205, DSG3, pan-CK AE1/AE3, HPV-16, Activin-A, Cyclin D1, and NPL that demonstrated effectiveness across multiple studies. Future research should focus on exploring combination scoring systems to improve diagnostic precision and optimize treatment selection in HNSCC patients.

Background and Objectives: Age-related macular degeneration (AMD) is one of the major causes of central vision loss in the older age group and its dry form accounts for the majority of cases. Although several causes and mechanisms for the development and progression of AMD have previously been identified, the pathogenesis of this complex disease is still not entirely understood. As the inflammation and involvement of the immune system are strongly suggested to have a central role to promote the degenerative process and to stimulate the onset of complications, we aimed to analyze the prevalence of serum anti-retinal (ARA) and anti-endothelial cell antibodies (AECA) in patients with dry AMD and to determine their relationship with the clinical features of the disease, notably area of geographic atrophy (GA). Materials and Methods: We enrolled 41 patients with dry AMD and 50 sex- and age-matched healthy controls without AMD. The presence of ARA was determined by indirect immunofluorescence using monkey retina as an antigen substrate, while the presence of AECA was determined using cultivated human umbilical vein endothelial cells and primate skeletal muscle. Results: ARA were detected 36 (87.8%) AMD patients (titers range from 1:20 to 1:320) and in 16 (39.0%) (titers range from 1:10 to 1:40) of controls (p=0.0000). Twenty of the 41 patients (48.8%) were positive for AECA, while in a control group AECA were present only in 5 sera (10.0%). The titers of AECA in AMD patients ranged from 1:100 to 1:1000 and in the control group the AECA titers were 1:100 (p=0.0001). There were no significant correlations between the presence of AECA and disease activity. Conclusions: This study provides evidence for the possible involvement of an autoimmune process against retina and retinal vessel antigens in the pathogenesis of geographic atrophy associated with dry AMD.

In spite of prevalence gaps in several micronutrients supporting immune function, significance of their deficits/supplementation for efficacy of vaccines is underinvestigated. Thus, influence of supplementation combining vitamins C and D, zinc, selenium and manganese, and N-acetyl-cysteine on mouse IgG responses and underlying mechanisms to seasonal quadrivalent influenza vaccine (QIV) was investigated. QIV was given in two doses (28 days apart). The supplementation starting 5 days before the first injection increased the total serum IgG titre, through stimulation of germinal centre (GC) reaction in secondary lymphoid organs (SLOs), as indicated by increase in the frequency of GC B cells and follicular CD4+ T helper (Th) cells, and IL-21-producing Th cells. Additionally, the supplementation “optimized” IgG response following the second QIV injection by supporting more favorable (in respect to virus clearance) IgG2a response through favoring Th1 differentiation as indicating by Th1 (INF-γ) /Th2 (IL-4) signature cytokine level ratio upon QIV restimulation in SLO cell cultures. This most likely reflected partly their antioxidant action (as indicated by redox status analyses) on Th cell differentiation. Thus, the study forms solid base for further research aimed at repurposing use this safe and inexpensive micronutrient combination as an adjuvant for virus influenza vaccine.

Lung adenocarcinoma is the most prevalent form of lung cancer, and drug resistance is a significant obstacle in its treatment. This study aimed to investigate the overexpression of long non-coding RNAs (lncRNAs) as a mechanism that promotes intrinsic resistance in tumor cells from the onset of treatment. Drug-tolerant persister cells (DTP) are a subset of cancer cells that survive and proliferate after exposure to therapeutic drugs, making them an essential object of study for cancer treatment. The molecular mechanisms underlying DTP cell survival are not fully understood; however, long non-coding RNAs (lncRNAs) have been proposed to play a crucial role. DTP cells from lung adenocarcinoma cell lines were obtained after a single exposure to tyrosine kinase inhibitor TKIs (erlotinib or osimertinib). After establishing DTPs, RNA sequencing was performed to investigate the differential expression of the lncRNAs. Some lncRNAs and one mRNA were found to be overexpressed in DTP cells. The clinical relevance of lncRNAs was evaluated in a cohort of patients with lung adenocarcinoma from The Cancer Genome Atlas (TCGA). RT-qPCR validated the overexpression of lncRNAs and mRNA in residual DTP cells and LUAD biopsies. Knockdown of these lncRNAs increases the sensitivity of DTP cells to therapeutic drugs. This study provides an opportunity to investigate the involvement of lncRNAs in the genetic and epigenetic mechanisms underlying intrinsic resistance. The identified lncRNAs and CD74 mRNA may serve as potential prognostic markers or therapeutic targets to improve the overall survival of patients with lung cancer.

Circulating cell-free DNA (cfDNA) refers to small fragments of DNA molecules released after programmed cell death and necrosis in several body fluids such as blood, saliva, urine, and cerebrospinal fluid. The discovery of cfDNA has revolutionized the field of non-invasive diagnostics in the oncologic field, in prenatal testing, and in organ transplantation. Despite the potential of cfDNA and the solid results published in recent literature, several challenges remain, represented by low abundance, need for highly sensitive assays and analytical issues. In this review, the main technical advances in cfDNA analysis are presented and discussed, with a comprehensive examination of the current available methodologies applied in each field. Considering the potential advantages of cfDNA, this biomarker is increasing its consensus among clinicians, as it consents to monitor patients’ conditions in an easy and non-invasive way, offering a more personalized care. Nevertheless, cfDNA analysis is still considered a research marker to be further validated, and very few centers are implementing its analysis in the real-life assistance. As technical improvements are enhancing the performances of cfDNA analysis, its application will transversally improve patients’ quality of life.

Infectivity assays are the key analytical technology for development of manufacturing processes for virus-based therapeutics. Here, we introduce a novel assay format that utilizes label-free bright field images to determine the kinetics of infection-dependent changes in cell morphology. In particular, cell rounding is directly proportional to the amount of infectious virus applied, enabling rapid determination of viral titers in relation to a standard curve. Our kinetic infectious virus titer (KIT) assay is stability-indicating and, due to its sensitive readout method, provides results within 24 hours post-infection. Compared to traditional infectivity assays, which depend on a single readout of an infection endpoint, cumulated analysis of kinetic data by a fit model results in precise results (CV &lt; 20%) based on only three wells per sample. This approach allows for a high throughput with ~400 samples processed by a single operator per week. We demonstrate the applicability of the KIT assay for VSV-GP and NDV, but it can potentially be extended to a wide range of viruses that induce morphological changes upon infection. The versatility of this assay, combined with its independence from specific instruments or software, makes it a promising solution to overcome the analytical bottleneck in infectivity assays within the pharmaceutical industry and as a routine method in academic research.

Nanoencapsulation has emerged as a recent improvement in the delivery of drugs, offering and improving stability and bioavailability, and allowing for the controlled and targeted delivery of substances to specific cells or tissues. However, traditional nanoparticle delivery faces challenges such as short circulation time and immune recognition. To address these issues, cell membrane-coated nanoparticles have been proposed as a promising alternative. The production of cell membrane-coated nanoparticles involves three key stages: cell lysis and membrane fragmentation, membrane isolation, and nanoparticle coating. Typically, cell membranes are fragmented using hypotonic lysis in combination with homogenization or sonication. Subsequent membrane fragments are isolated through multiple centrifugation steps. The coating of nanoparticles can be achieved through extrusion, sonication, or a combination of both methods. This analysis shows the absence of a universally applicable method for nanoparticle coating, as the three stages exhibit notable differences in their procedures. Here we review ongoing developments and approaches to cell membrane-coated nanoparticles that position this technology as a promising alternative for effective targeted drug delivery and many other therapeutic applications.

Cryptococcus neoformans is a fungus that mainly affects the respiratory system and the central nervous system. One of the main virulence factors is the capsule, constituted by the polysaccharides glucuronoxylomannan (GXM) and glucuronoxylomanogalactan (GXMGal). Polysaccharides are immunomodulators. One of the target cell populations for modulation are macrophages, part of the first line of defense, important for innate and adaptive immunity. It has been reported that macrophages can be modulated to act as a "Trojan horse" taking phagocytosed yeasts to strategic sites or having their machinery activation compromised. The scarcity of information on canine cryptococcosis led us to assess whether the purified capsular polysaccharides from C. neoformans would be able to modulate the microbicidal action of macrophages. In the present study, we observed that the capsular polysaccharides, GXM, GXMGal or capsule total did not present toxic effects for the DH82 macrophage cell line. However, it was possible to demonstrate that phagocytic activity was decreased after treatment with polysaccharides. In addition, yeasts recovered from macrophages treated with the polysaccharides, after phagocytosis, could be cultured, showing that their viability was not altered. The polysaccharides led to a reduction in ROS production and the expression of IL-12 and IL-6. We observed that GXMGal inhibits MHC class II expression and GXM reduces ERK phosphorylation. In contrast, GXMGal and GXM were able to increase the PPAR- expression. Furthermore, our data suggests that capsular polysaccharides can reduce the microbicidal activity of canine macrophages DH82.

Background: One of the most astounding discoveries of recent times is the recognition that cancer embodies a transition from a higher level of metazoan cell organization to a more foundational pre-metazoic state. This shift is steered by genes housed within the ancestral genome compartment, pervasive across all metazoan genomes, encompassing humans, and governed by a pre-metazoic gene regulatory mechanism (aGRN). This work aims to highlight the emerging field of evolutionary cancer cell biology (ECCB), which points to the deep homology between cancer and protist life cycles tracing back to the common ancestor of amoebozoans, metazoans, and fungi (AMF). The ECCB analysis reveals the essence of the non-gametogenic germline of the AMF ancestor, which serves as a blueprint for all metazoan germlines and stem cell lineages and controls the life cycle of cancer. Every germ and stem cell lineage of humans and metazoans traces its lineage back to this Urgermline, transmitting crucial processes such as asymmetric cell cycling, differentiation, stemness, and phenomena like GST and SGT (aka EMT and MET) to their subsequent evolutionary descendants. Oxygen-sensitive germline and stem cells suffer DNA-DSB due to stress and oxygen ranges reminiscent of ancestral hyperoxia, leading to cell senescence. Cells that can overcome senescence can proliferate as DSCD cells with defective symmetric cell division, paving the way for malignancy and PGCC cancers. Conclusions: Understanding cancer from its evolutionary origins may help break some of the logjams in cancer prevention and open up new therapeutic pathways.

Drug resistance in tumor cells is a significant roadblock in the clinical management of advanced or recurrent diseases in endometrial cancers. As a part of the tumor-stromal ecosystem, tumor cells are ecologically connected to the cancer-associated fibroblasts (CAFs), which form contributory elements of the tumor microenvironment (TME). We recently reported a novel model of patient-derived CAF-based 2-cell Hybrid Co-Culture (HyCC) to evaluate CAFs' role in developing drug resistance and understanding personalized tumor cell-CAF dialogue. Using our 2-cell HyCC model of patient-derived endometrial CAFs, we present data to demonstrate the direct counter-inhibitory effect of CAFs to combinations of cytotoxic and targeted drugs in developing drug resistance. CAFs derived from resected endometrial tumor samples were first passage-wise characterized before and after freeze-thaw for their positive and negative CAF markers expression pattern. Paclitaxel and its combination with copanlisib, TAK228, lenvatinib, and trametinib were used to test the 3D clonogenic growth of endometrial AN3CA cells on endometrial CAFs. We demonstrate that CAF-mediated resistance to antitumor drugs occurs via direct and indirect contact with CAFs in HyCC. Our data established the strength of the 2-cell HyCC model of patient-derived CAFs in solid tumors and provided a model of resistance to antitumor drugs tailored on a patient-to-patient basis.

The incidence of human papillomavirus (HPV)-associated oropharyngeal squamous cell carcinoma (OPSCC) is rising in the West, but little is known in Asia. This study elucidated changes in the incidence and HPV-positive portion of OPSCC in Hong Kong. Data from population-based cancer registry were used to analyze the incidence of OPSCC in associate with other head and neck cancers. Archived tumour tissues were tested for HPV. From 1986 to 2020, there was a marked decrease in the incidence of nasopharyngeal and laryngeal cancers, but a persistent increase in OPSCC from 36 cases in 1986 to 116 cases in 2020. The average positive rate for high-risk HPV was 36.1% (112/310) among OPSCC diagnosed in 2010-2020. The HPV positive rate in recent years was significantly higher than earlier cases (tonsil SCC: 64.7% (55/85) in 2016-2020 vs. 40.4% (19/47) in 2010-2015, P = 0.007). Patients with HPV-positive tonsil cancers were significantly younger than those negative (mean [SD]: 58.9 [9.9] vs. 64.3 [13.3] years, P = 0.006), but no significant difference between genders. A persistent increase in the incidence of oropharyngeal cancer over the last few decades was observed in Hong Kong, which can be explained by the remarkable increase in HPV-positive tonsil cancers.

Docking results suggest that Amentoflavone has a higher affinity for investigated Serine/threonine-protein kinases, indicating potential interactions that may influence the activities of these kinases. The negative values of the binding energies signify strong and stable interactions, suggesting that Amentoflavone could be a key molecule in modulating the functions of these kinases, which play crucial roles in cellular processes such as cell cycle regulation and apoptosis.

Pancreatic ductal adenocarcinoma (PDAC) is mostly diagnosed at advanced or even metastasized stages limiting patient´s prognosis. Metastasis requires high tumor cell plasticity implying phenotypic switching in response to changing environments. Here, Epithelial-Mesenchymal-Transition (EMT), being associated with the gain of cancer stem cell (CSC) properties, and its reversion are important. Since it is poorly understood whether different CSC-phenotypes exist along the EMT-axis and how these impact malignancy-associated properties, we aimed to characterize CSC-populations of epithelial and mesenchymal PDAC cells. Single-cell cloning revealed CSC (Holoclone) and non-CSC (Paraclone) clones from the PDAC cell lines Panc1 and Panc89. Panc1 Holoclone cells showed a mesenchymal phenotype dominated by high expression of the stemness marker Nestin, while Panc89 Holoclone cells exhibited a SOX2-dominated epithelial phenotype. Panc89 Holoclone cells showed enhanced cell growth and self-renewal capacity but slow cluster-like invasion. Contrarily, Panc1 Holoclone cells showed slower cell growth and self-renewal ability but were highly invasive. Moreover, cell variants differentially responded to chemotherapy. In vivo, Panc1 and Panc89 cell variants significantly differed regarding number and size of metastases as well as organ manifestation leading to different survival outcomes. Overall, these data support the existence of different CSC-phenotypes along the EMT-axis in PDAC manifesting in different metastatic propensities.

A study was conducted on the power system of a forklift equipped with PEM fuel cells. A fuel cell assembly relies on several components for proper functioning, and among these, the air compressor holds paramount importance due to its significant energy consumption when compared to other Balance of Plant components. The air supply system, in turn, plays a critical role in ensuring the stable and efficient operation of the entire fuel cell system. To enhance system efficiency, we delved into the impact of varying the stoichiometric ratio of air and air pressure on the validated and optimized power module model. This investigation was carried out under real loading conditions, replicating the conditions experienced by the power module when fuel cells are in use within a forklift. The air compressor, being a pivotal component of a PEM fuel cell system, can be oper-ated at different excess air and pressure ratios, which in turn influence both the fuel cell's performance and the overall efficiency of the power module system. Our research focused on assessing the performance of polymer electrolyte membrane (PEM) fuel cells under different load cycles, adhering to the VDI60 requirements for forklift applications. This comprehensive examination encompassed the system's minimum and maximum load scenarios, with the primary goal of optimizing excess air and pressure ratio parameters, especially under dynamic load conditions. The results revealed that higher air pressures and lower excess air ratios were con-ducive to increasing system efficiency, shedding light on potential avenues for enhancing the performance of PEM fuel cell systems in forklift applications.

Cellular locomotion is required for survival, fertility, proper embryonic development, regeneration, and wound healing. Cell migration is a major component of metastasis, which accounts for two-thirds of all solid tumor deaths. While many studies have demonstrated increased energy requirements, metabolic rates, and migration of cancer cells compared to normal cells, few have systematically compared normal and cancer cell migration as well as energy requirements side by side. Thus, we investigated how non-malignant and malignant cells migrate utilizing several cell lines from the breast and lung. Initial screening was done in an unbiased high-throughput manner for the ability to migrate/invade on collagen and/or Matrigel. We unexpectedly observed that all the non-malignant lung cells moved significantly faster than cells derived from lung tumors regardless of growth media used. Given the paradigm-shifting nature of our discovery, we pursued possible mechanisms responsible. Neither mass, cell doubling, nor volume, accounted for the individual speed and track length of the normal cells. Non-malignant cells had higher levels of ATP at premigratory-wound induction stages. Meanwhile, cancer cells also increased ATP at premigratory-wound induction – but not to the levels of the normal cells, indicating the possibility for further therapeutic investigation.

In this study, we aimed to identify blood lymphocytes as a prognostic factor for survival in patients with locally advanced stage III non-small cell lung cancer (NSCLC) treated with concurrent chemoradiotherapy (CCRT). We conducted a secondary analysis of 196 patients enrolled in the Korean Radiation Oncology Group 0903 phase III clinical trial to evaluate the prognostic significance of circulating blood lymphocyte levels. The median total lymphocyte count (TLC) reduction ratio during CCRT was 0.74 (range: 0.29 – 0.97). In multivariate analysis, patient age (p = 0.014) and gross tumor volume (GTV, p = 0.031) were significant factors associated with overall survival, while TLC reduction (p = 0.018) and pretreatment neutrophil-to-lymphocyte ratio (NLR; p = 0.010) were associated with progression-free survival (PFS). In multivariate logistic regression analysis, pretreatment NLR, GTV, and heart V20 were significantly associated with TLC reduction. TLC reduction during CCRT is a significant prognostic factor for PFS, and heart V20 is significantly associated with TLC reduction. Thus, constraining the volume of the radiation dose to the whole heart must be prioritized to reduce TLC.

Oral Squamous Cell Carcinoma is one among the most common cancer and early detection is the main key to avoid deaths. Automated diagnostic tools that process the histopathological images of a patient to detect abnormal oral lesions will be very much useful for the clinicians. A deep learning framework have been designed with an intermediate layer between feature extraction layers and classification layers for classifying the histopathological images into two categories, namely normal and oral squamous cell carcinoma. The intermediate layer is constructed using the proposed Swarm Intelligence technique called Modified Gorilla Troops Optimizer. Various optimization algorithms are implemented in literature for optimal parameter identification, weights updating and feature selection in deep learning models, but this work focuses on usage of optimization algorithm as intermediate layer that transforms the extracted features into the features that are more suitable for classification. Three datasets totally comprising 2784 normal and 3632 oral squamous cell carcinoma subjects are considered in this work. Three popular CNN architectures namely InceptionV2, MobileNetV3, and EfficientNetB3 are investigated as feature extraction layers. Two fully connected Neural Network layers along with batch normalization and dropout are used as classification layers. Among the investigated feature extraction models, MobileNetV3 performs well in all the three datasets with the highest accuracy of 0.89. Usage of the proposed Modified Gorilla Troops Optimizer as an intermediate layer boosts this accuracy to 0.95.

We have previously developed several successful decellularization strategies yielding porcine cardiac extracellular matrices (pcECMs), which exhibit tissue-specific bioactivity and bioinductive capacity when cultured with various pluri- and multipotent stem cells. Here, we studied the tissue-specific effects of the pcECM on seeded human mesenchymal stem cells (hMSCs) phenotype using reverse transcribed quantitative polymerase chain reaction (RT-qPCR) arrays for cardio-vascular related genes. We further corroborated interesting findings at the protein level (flow cytometry and immunological stains) as well as bioinformatically using several mRNA sequencing and protein databases of normal and pathologic adult tissue expression, as well as during human embryonic organogenesis. We discovered that upon seeding of human mesenchymal stem cells (hMSCs) on the pcECM they displayed partial MET toward endothelial phenotypes (CD31+) and morphologies, which were preceded by an early spike (~day 3 onward after seeding) in HAND2 expression at both the mRNA and protein levels compared to plate controls. CRISPR-Cas9 knockout (KO) of HAND2 and its associated antisense long non-coding RNA (HAND2-AS1) regulatory region resulted in proliferation arrest, hypertrophy, and senescent-like morphology. Bioinformatic analyses revealed that HAND2 and HAND2-AS1 are highly correlated in expression, are expressed in many different tissue types albeit at distinct yet tightly regulated expression levels. Deviation (down or up regulation) from these basal tissue expression levels are associated with a long list of pathologies. We thus suggest that HAND2 expression levels may finetune cell plasticity possibly affecting senescence and mesenchymal-to-epithelial transition states, through yet unknown mechanisms. Targeting this pathway may represent a promising new therapeutic approach for a wide range of diseases, including cancer, degenerative disorders, and aging. Nevertheless, further investigations are required to better understand the molecular players involved, potential inducers and inhibitors of this pathway, and eventually potential therapeutic applications.

Alginate-gelatin hydrogels are extensively used in bioengineering. However, despite different formulations being utilized for growing different cell types in vitro, their pH and its effect, together with the crosslinking ions, of those formulations are still infrequently assessed. In this work we studied how these elements can affect hydrogel stability and printability and influence U2OS and NIH/3T3 cell viability and metabolism on the resulting 3D prints. In this context, 6% alginate + 2% gelatin hydrogels were prepared with 0.1 M MES buffer with pH 5.5, 6.5, 7.0 or 8.0, printed by extrusion-based 3D printing, and crosslinked immediately after printing with either CaCl2 or BaCl2. Our results showed that both the buffer pH and the crosslinking ion (Ca2+ or Ba2+) influence the swelling and degradation rates of the prints. Moreover, the buffer pH influenced the printability of the hydrogel in air, but when printed directly in a fluid-phase CaCl2 or BaCl2 crosslinking bath. In addition, both U2OS and NIH/3T3 cells showed greater cell metabolic activity on one-layer prints crosslinked with Ca2+. Besides, Ba2+ increased cell death of NIH/3T3 cells while had no effect on the U2OS cell viability. The pH of the buffer also caused an important impact on the cell behaviour. U2OS cells showed a 2.25-fold cell metabolism increase on one-layer prints prepared at pH 8.0 in comparison to those prepared at pH 5.5. Whereas, NIH/3T3 cells showed greater metabolism on one-layer prints with pH 7.0. Finally, we observed a difference on cell arrangement of the U2OS cells growing on prints prepared from hydrogels with acidic buffer in comparison to cells growing on those prepared using neutral or basic buffer. These results show that both pH and crosslinking ion influence hydrogel strength and cell behaviour.

Background. Currently, most of the research in breast cancer has been carried out in conventional two-dimensional (2D) cell culture due to its practical benefits, however, the three-dimensional (3D) cell culture is becoming the model of choice in cancer research because it allows cell-cell and cell-extracellular matrix (ECM) interactions, mimicking the native microenvironment of tumors in vivo. Methods. in this work, we evaluated the effect of 3D cell organization on the expression pattern of miRNAs (by Small-RNAseq) and mRNAs (by microarrays) in the breast cancer SKBR3 cell line and analyzed the biological processes and signaling pathways regulated by the differ-entially expressed protein-coding genes (DE-mRNAs) and miRNAs (DE-microRNAs) found in the organoids. Results. We obtained well-defined cell-aggregated organoids with a grape cluster-like morphology with a size up to 9.2×105 μm3. The transcriptomic assays showed that cell growth in organoids significantly affected (all p < 0.01) the gene expression patterns of both, miRNAs and mRNAs, finding 20 upregulated and 19 downregulated DE-microRNAs, as well as 49 upregulated and 123 downregulated DE-mRNAs. In silico analysis showed that a subset of 11 upregulated DE-microRNAs target 70 downregulated DE-mRNAs. These genes are involved in 150 gene on-tology (GO) biological processes such as regulation of cell morphogenesis, regulation of cell shape, regulation of canonical Wnt signaling pathway, morphogenesis of epithelium, regulation of cy-toskeleton organization, as well as in the MAPK and AGE-RAGE signaling KEGG-pathways. In-terestingly, hsa-mir-122-5p (Fold Change (FC)=15.4), hsa-mir-369-3p (FC=11.4), and hsa-mir-10b-5p (FC=20.1) regulated up to the 81 % of the 70 downregulated DE-mRNAs. Conclu-sion, the organotypic 3D cell-organization architecture of breast cancer SKBR3 cells impacts the expression pattern of miRNAs-mRNAs network mainly through overexpression of hsa-mir-122-5p, hsa-mir-369-3p, and hsa-mir-10b-5p. All these findings suggest that the interaction between cell-cell and cell-ECM as well as the change in the culture architecture impacts gene ex-pression, and therefore, support the pertinence of migrating breast cancer research from conven-tional cultures to 3D models.

Background: Millions of people worldwide suffer from a genetic hemoglobinopathy known as sickle cell disease (SCD). It is a long-term condition marked by progressive multiorgan failure. Among SCD patients, cardiovascular complications are the main leading cause of death. Cardiovascular complication raises cardiac markers level as well as sickle cell vaso-occlusive crisis (VOC). This makes it challenging to determine the source. Methods: This research aims to identify the association between cardiac markers and myocardial infarction in SCD patients At King Abdulaziz University (KAUH) in Jeddah, Saudi Arabia. This retrospective study was conducted from June 2022 to March 2023. All patients with SCD who were 18 years and above were enrolled. Cardiac markers' associations with age, emergency room visits, ECG, blood transfusion, hydroxyurea, anticoagulants, and mortality were analyzed. Result: 537 patient records were screened during the study period, of which 270 met the inclusion criteria. Among these, 144 (53.3%) were female. The prevalence of elevated LDH, troponin, and CK-MB among the SCD patients who visited ER for the VOC was 78.5%, 9.3%, and 6.3%, respectively. Overall, there was a significant relationship between the cardiac marker level and the number of ER visits, age and mortality (p= 0.01), but there was no significant association between the cardiac marker level and for each of the following: hydroxyurea use, antiplatelet/anticoagulant use, needing of blood transfusion and ECG abnormalities. This retrospective research shed light on the significance of cardiac marker levels in patients with SCD. The level of cardiac markers was remarkably linked with age, frequency of ER visits, and patients' states.

Solar photovoltaic systems are becoming increasingly popular due to their outstanding environmental, economic, and technical characteristics. To simulate, manage, and control photovoltaic (PV) systems, the primary challenge is identifying unknown parameters accurately and reliably as early as possible using a robust optimization algorithm. This paper proposes a newly developed cheetah optimizer (CO) and improved CO (ICO) to extract parameters from various PV models. This algorithm, inspired by cheetah hunting behavior, includes several basic strategies: searching, sitting, waiting, and attacking. Although this algorithm has shown remarkable capabilities in solving large-scale problems, it needs improvement concerning its convergence speed and computing time. Here, an improved CO (ICO) is presented to identify solar power model parameters for this purpose. Single-, double-, and PV module models are investigated to test ICO's parameter estimation performance. Statistical analysis uses minimum, mean, maximum, and standard deviation. Furthermore, to improve confidence in test results, Wilcoxon and Freidman rank nonparametric tests are also performed. Compared to other state-of-the-art optimization algorithms, the ICO algorithm is proven to be highly reliable and accurate when identifying PV parameters.

In 2020, the WHO established a road map for neglected tropical diseases 2021−2030 that aims to control and eradicate 20 diseases, including Leishmaniosis and Chagas disease. In addition, since 2015, the WHO has been developing a Global Action Plan on Antimicrobial Resistance. In this context, the achievement of innovative strategies as an alternative to replace conventional therapies is a first-order socio-sanitary priority, especially regarding endemic zoonoses in poor regions such as those caused by Trypanosoma cruzi and Leishmania spp infections. In this scenario, it is worth highlighting a group of natural peptide molecules (AMPs and CPPs) that are promising strategies for improving therapeutic efficacy against these neglected zoonoses, avoiding the development of toxicity and resistance of conventional treatments. This review presents the novelties of these peptide molecules and their ability to cross a whole system of cell membranes, as well as to stimulate the host immune defenses or even serve as a vector of molecules. The efforts of the biotechnological sector will make it possible to overcome the limitations of antimicrobial peptides through encapsulation and functionalization methods to obtain approval for these treatments to be used in clinical programs for the eradication of Leishmaniosis and Chagas disease.

Acute myeloid leukemia (AML) is the most common and incurable leukemia subtype. Despite extensive research into the disease's intricate molecular mechanisms, AML have not yet identified effective treatments or expanded diagnostic or prognostic markers. The morphological, immunophenotypic, cytogenetic, biomolecular, and clinical characteristics of AML patients are extensive and complex. Leukemia stem cells (LSC) consist of hematopoietic stem cells (HSC) and cancer cells transformed by the complex, finely-tuned interaction that causes the complexity of AML. Microenvironmental regulation of LSC dormancy, its diagnostic and therapeutic implications for identifying and targeting LSCs due to their significance in the pathogenesis of AML were discussed in this review. It is essential to perceive the relationship between the niche for LSCs and HSC, which together cause the progression of AML. Notably, methylation is a well-known epigenetic change that is significant in AML, and our data also reveals that microRNAs are a unique factor for LSC. Furthermore, multiple-targeted approaches to reduce the risk of epigenetic factors, such as the administration of natural compounds for the elimination of local LSC, may prevent potentially fatal relapses. Furthermore, the survival analysis of overlapping genes revealed that specific targets had significant effects on the survival and prognosis of patients. We predicted that the multiple-targeted effects of herbal products on epigenetic modification are governed by different mechanisms in AML and prevent potentially fatal relapses. Thus, these strategies can facilitate the incorporation of herbal medicine and natural compounds into the advanced drug discovery and development processes enabled achievable by Network Pharmacology research.

Djeya1 (RKLAFRYRRIKELYNSYR), is a very effective cell penetrating peptide (CPP) which mimics the α5 helix of the highly conserved Eya domain (ED) of eyes absent (Eya) proteins. The objective of this study was to bioengineer analogues of Djeya1 that, following effective translocation into planarian tissues, would reduce the ability of neoblasts (totipotent stem cells) and their progeny to regenerate the anterior pole in decapitated S. mediterranea. As a strategy to increase the propensity for helix formation, molecular bioengineering of Djeya1 was achieved by the mono-substitution of the helicogenic aminoisobutyric acid (Aib) at three species variable sites: 10,13,16. CD analyses indicted that Djeya1 is highly helical and that Aib-substitution had little influence on secondary structure. Aib-substituted Djeya1 analogues are highly efficient CPPs, devoid of influence upon cell viability or proliferation. All three peptides increase the migration of PC-3 cells which express high concentrations of Eya. Two peptides, [Aib13]Djeya1 and [Aib16]Djeya1, are bioportides which delay planarian head regeneration. As neoblast are the only cell population capable of division in planaria, these data indicate that bioportide technologies could be utilised to directly manipulate other stem cells in situ, thus negating any requirement for genetic manipulation.

When oxidizing reduced sulfur compounds, the phototrophic sulfur bacterium Allochromatium vinosum forms spectacular sulfur globules as obligatory intracellular – but extracytoplasmic – intermediates. The globule envelope consists of three extremely hydrophobic proteins: SgpA and SgpB are very similar and can functionally replace each other. SgpC is involved in the expansion of the sulfur globules. The presence of a fourth protein, SgpD, has been suggested by comparative transcriptomics and proteomics of enriched sulfur globules. Here, we investigated the in vivo function of SgpD by coupling its carboxy-terminus to mCherry. This fluorescent protein requires oxygen for chromophore maturation, but we were able to use it in anaerobically growing A. vinosum provided the cells were exposed to oxygen for one hour prior to imaging. While mCherry lacking a signal peptide resulted in low fluorescence evenly distributed throughout the cell, fusion with SgpD carrying its original Sec-dependent signal peptide targeted mCherry to the periplasm and co-localized it exactly with the highly light-refractive sulfur deposits seen in sulfide-fed A. vinosum cells. Insertional inactivation of the sgpD gene showed that the protein is not essential for the formation and degradation of sulfur globules.

In this study, we propose a radiomics-clinical probability weighted model for the prediction of prognosis for NSCLC. The model combines radiomics features extracted from RT planning images with clinical factors such as age, gender, histology, and tumor stage. CT images with radiotherapy structures of 422 NSCLC patients were retrieved from The Cancer Imaging Archive (TCIA). Radiomic features were extracted from gross tumor volume (GTV). Five machine learning algorithms, namely decision trees (DT), random forests (RF), extreme boost (EB), support vector machine (SVM) and generalized linear model (GLM), were optimized by a voted ensemble machine learning (VEML) model. A probabilistic weighted approach is used to incorporate the uncertainty associated with both radiomic and clinical features and to generate a probabilistic risk score for each patient. The performance of the model is evaluated using a receiver operating characteristic (ROC). Radiomic model, clinical factors model and combined radiomic-clinical probability weighted model demonstrated good performance in predicting NSCLC survival with AUC of 0.941, 0.856 and 0.949 respectively. The combined radiomics-clinical probability weighted enhanced model achieved significantly better performance than radiomic model in 1-year survival prediction (chi-square test, p<0.05). The proposed model has the potential to improve NSCLC prognosis and facilitate personalized treatment decisions.

Human induced pluripotent stem cell (hiPSC)-derived neural cells have been used at the preclinical stage of drug development. As previously reported, hiPSC-derived neurons exhibit greater tolerance to excitotoxicity than that of primary cultures of rodent neurons; however, the underlying mechanisms remain unknown. We therefore investigated the functions of L-glutamate (L-Glu) transporters, the most important machinery used to maintain low extracellular L-Glu concentrations, in hiPSC-derived neural cells. We also clarified the contribution of each L-Glu transporter subtype. At 63 days in vitro (DIV), we detected neuronal circuit functions in hiPSC-derived neural cells by a microelectrode array system (MEA). Exposure to 100 μM L-Glu for 24 hrs did not affect the viability of these 63 DIV neural cells. Pharmacological inhibition of excitatory amino acid transporter 1 (EAAT1) and EAAT2 blocked almost 100% of L-Glu uptake. In this condition, L-Glu exposure dramatically decreased cell viability. These results suggest that in hiPSC-derived neural cells, EAAT1 and EAAT2 are predominant L-Glu transporters, and their uptake potentials are stronger than those of primary cultures of rodent neurons. Furthermore, hiPSC-derived neural cells may be useful for screening drugs that target L-Glu transporters.

Nonalcoholic fatty liver disease (NAFLD) has become a widely studied subject due to its increasing prevalence and links to diseases such as type 2 diabetes and obesity. It has severe complications, including nonalcoholic steatohepatitis, cirrhosis, hepatocellular carcinoma, and portal hypertension that can lead to liver transplantation in some cases. To better prevent and treat this pathology, it is important to understand its underlying physiology. Here, we identify three main factors that play a crucial role in the physiopathology of NAFLD: oxidative stress, insulin resistance, and the key role of carcinoembryonic antigen related cell adhesion molecule 1 (CEACAM1). We discuss the pathophysiology linking these factors to NAFLD pathophysiology.

For the replacement of lost contractile elements in the treatment of coronary heart disease, the most promising approaches to obtain cardiomyocytes by cardiac differentiation of pluripotent cells. The aim of this work is to develop a technology for the formation of a functional layer of cardiomyocytes differentiated from iPSCs, capable of generating rhythmic activity and synchronous contractions. To accelerate cardiomyocyte maturation, the renal subcapsular transplantation model was used in SCID mice. After explantation, the formation of cardiomyocyte contractile apparatus was assessed by fluorescence and electron microscopy, and calcium ion oscillation in the cytoplasm was assessed by visualization of the fluorescent calcium binding dye Fluo-8. It was shown that human iPSC-derived cardiomyocyte cell layers transplanted (for up to 6 weeks) under SCID mouse kidney fibrous capsules begin to form an ordered contractile apparatus and retain functional activity and the ability to oscillate calcium ion fluxes after explantation from the body.

Cardiopulmonary complications remain the major cause of mortality despite newer therapies and improvements in lifespan of patients with sickle cell disease (SCD). Inflammation has been identified as a major risk modifier in the pathogenesis of SCD associated cardiopulmonary complications in recent mechanistic and observational studies. In this review, we discuss recent cellular and molecular mechanisms of cardiopulmonary complications in SCD and summarize the most recent evidence from clinical and laboratory studies. We emphasize the role of inflammation in the onset and progression of these complications to better understand the underlying pathobiological processes. We also discuss future basic and translational research in addressing questions about the complex role of inflammation in the development of SCD cardiopulmonary complications, which may lead to promising therapies and reduce morbidity and mortality in this vulnerable population.

Previous research suggests that the senescence and death of the replaceable bud in chestnut cultivar (cv.) ‘Tima Zhenzhu’ involves programmed cell death (PCD). However, the molecular network responsible for regulating replaceable bud PCD is poorly characterized. Here, we performed transcriptomic profiling of the chestnut cv. ‘Tima Zhenzhu’ replaceable bud before (S20), during (S25), and after PCD (S30) to ascertain the molecular mechanism underlying the PCD process. A total of 5,779, 9,867, and 2,674 differentially expressed genes (DEGs) were discovered upon comparison of S20 vs. S25, S20 vs. S30, and S25 vs. S30, respectively. Approximately 6,137 DEGs common to at least two comparisons were selected for GO and KEGG enrichment analyses to interrogate the main corresponding biological functions and pathways. GO analysis showed that these common DEGs could be divided into three functional categories, including 15 cellular components, 14 molecular functions, and 19 biological processes. KEGG analysis found that “plant hormone signal transduction” included 93 DEGs. Overall, 441 DEGs were identified as related to the process of PCD. Most of these were found to be genes associated with ethylene signaling, as well as initiation and execution of various PCD processes. A hypothetical model, consisting of three overlapping processes, is proposed for the replaceable bud PCD: First, ethylene signaling is activated during preparation for PCD, in order to regulate the activity of downstream targets. Next, during PCD initiation, the up-regulation of several TFs (including MYB, MADS-box, bHLH, and NAC TFs) induces an increase in cytochrome c expression and in the cytosolic Ca2+ content, activating the Ca2+-dependent signaling cascade. Finally, during PCD execution, the process of autophagy and the activity of proteases (i.e., cysteine proteinases RD21A-like, metacaspase-9-like, vacuolar-processing enzyme-like, and senescence-associated proteins for hydrolysis) work synergistically to clear the cell of cellular components. When this process is complete, the replaceable bud senesces and dies.

Liver cancers give rise to a heavy burden of health care worldwide. Understanding the tumour microenvironment (TME) underpins the development of precision therapy. Single-cell RNA sequencing (scRNA-seq) technology has generated high-quality cell atlases of the TME, but its wider application faces enormous costs for various clinical circumstances. Fortunately, a variety of deconvolution algorithms can instead repurpose bulk RNA-seq data, alleviating the need for generating scRNA-seq datasets. In this study, we reviewed major public omics databases for relevance in this study and utilized 8 RNA-seq and 1 microarray datasets from clinical studies. To decipher the TME of liver cancer, we estimated the fractions of liver cell components by deconvoluting the samples with Cibersortx using three reference scRNA-seq atlases. We also confirmed that Cibersortx can accurately deconvolute cell types/subtypes of interest. Compared with non-tumorous liver, liver cancers showed multiple decreased cell types forming normal liver microarchitecture, as well as elevated cell types involved in fibrogenesis, abnormal angiogenesis and disturbed immune responses. Survival analysis shows that the fractions of five cell types/subtypes significantly correlated with patient outcomes, indicating potential therapeutic targets. Therefore, deconvolution of bulk RNA-seq data with scRNA-seq atlas references can be a useful tool to help understand the TME.