Human coronaviruses cause both upper and lower respiratory tract infections in humans. In 2012 a sixth human coronavirus (hCoV) was isolated from a patient presenting with severe respiratory illness. The 60-year-old man died as a result of renal and respiratory failure after admission to a hospital in Jeddah, Saudi Arabia. The aetiological agent was eventually identified as a coronavirus and designated Middle East respiratory syndrome coronavirus (MERS-CoV). MERS-CoV has now been reported in more than 27 countries across the Middle East, Europe, North Africa and Asia. As of July 2017, 2040 MERS-CoV laboratory confirmed cases, resulting in 712 deaths, were reported globally, with a majority of these cases from the Arabian Peninsula. This review summarises the current understanding of MERS-CoV, with special reference to the (i) genome structure, (ii) clinical features, (iii) diagnosis of infection and (iv) treatment and vaccine development.

The viticulture sector, spanning over 7.3 million hectares worldwide, plays a crucial economic role but faces challenges such as labor shortages, rising production costs, market competition, and climate change stresses. Addressing these issues requires monitoring the spatial and temporal variability in vineyard productivity. Traditional ground-based observations, though accurate, are time-consuming and limited in scope. Precision viticulture, leveraging technologies like GPS, remote sensing, and artificial intelligence, offers efficient, non-destructive monitoring tools. This study aims to develop and test a technological workflow using the mobile app Digivit, integrated with the AgroSat platform, to estimate yield variability in vineyards. The workflow was performed during the 2023 growing season in a series of vineyards near Siena (Italy) and involved two main steps: spatial variability characterization using AgroSat and yield estimation using the mobile Digivit app. AgroSat processed Sentinel-2 NDVI data to identify homogeneous zones, while Digivit used smartphone images of grape clusters to estimate yields. The field campaign, performed three weeks before harvest, involved monitoring representative vines within identified zones and uploading georeferenced images for cluster segmentation analysis. Yield estimates were validated against measured weights, showing a strong linear correlation (R²=0.85, RMSE=43.74g). Excluding one outlier improved correlation to R²=0.95, RMSE=14.58g. Vineyard-level yield predictions were compared with harvest data, achieving an overall error of approximately 7%, in agreement with other methods in the literature. The study demonstrates that the Digivit app provides accurate, timely yield prediction, supporting farmers in harvest planning and winemaking management. The user-friendly mobile app approach facilitates a broader adoption of precision viticulture technologies among farmers, overcoming barriers related to technical expertise.

Background: Monogenic Alzheimer's disease (AD) has severe health and socioeconomic repercussions. Its rarest cause are presenilin 2 (PSEN2) gene mutations. We present two new cases with presumed PSEN2-AD, with unusual clinical and neuroimaging findings in order to provide more information on the pathophysiology and semiology of these patients. Methods: Women aged 69 and 62 years at clinical onset, marked by prominent behavioral and language dysfunction, progressing to severe dementia within three years. Neuroimaging, laboratory study, genetic testing. In addition, a systematic review of the PSEN2-AD were performed. Results: Neuroimaging revealed pronounced frontal white matter hyperintensities (WMH) and frontotemporal atrophy/hypometabolism. The genetic study unveiled PSEN2 variants: c.772G>A (p.Ala258Thr) and c.1073-2_1073-1del. Both cerebrospinal fluid (CSF) and experimental blood biomarkers shouldered AD etiology. Conclusions: Prominent behavioral and language dysfunction suggesting frontotemporal dementia (FTD) may be underestimated in the literature as a clinical picture in PSEN2 mutations. Thus, it may be reasonable to include PSEN2 in genetic panels when suspecting FTDL. PSEN2 mutations may cause striking WMH, arguably related with myelin disruption induced by amyloid accumulation.

Objective: Subclinical left ventricular disfunction (LVD) is common in asymptomatic patients with type 2 diabetes (T2D). Many patients with diabetes have an impaired diastolic and systolic function. With preserved ejection fraction LV (EFLV), the latter is defined as reduced global longitudinal strain (GLS), detected using the speckle-tracking echocardiography. This study is aimed to define the long-term structural and functional disorders of the LV myocardium in patients with T2D without CVD. Methods: Of the 120 patients with and without T2D of both sexes aged from 45 to 75 years (57.11±7.9 years), included in the study in 2012-2013, only 57 responded to the follow-up study. The patients were divided into two groups: one with T2D (n=29), the other without it, control (n=28). All patients underwent transthoracic two-dimensional echocardiography with assessment of standard indicators of systolic and diastolic cardiac function, as well as GLS. In addition, all participants underwent laboratory diagnostics of carbohydrate metabolism disorders markers, NT-proBNP and CRP. The median follow-up duration was 7.2 [7.0-7.8] years. Results: During the follow-up, a statistically significant increase in the incidence of diastolic dysfunction (DD) in the type 2 diabetes group was found from 53% to 61% (p = 0.004); no significant dynamics were noted in the control group (p = 0.48). The presence of T2D significantly increases the risk of developing DD (p=0.04). The presence of T2D, increased fasting glucose levels, and an increased HOMA index were independent predictors of the development of DD. Impairment of LVEF was not observed in both groups. At the same time, the proportion of patients with reduced GLS (< -18%) increased in the T2D group (p = 0.036). A significant difference in the frequency of decreased GLS depending on T2D was demonstrated. The presence of obesity, an increase in the HOMA index and an increase in CRP levels are independent predictors of impaired GLS. Conclusions: T2D is an independent risk factor for the worsening of subclinical left ventricular dysfunction in asymptomatic patients with T2D without CVD over 7-year follow-up. Diastolic dysfunction is represented by delayed relaxation of the LV myocardium; with preserved LVEF, reduced 2D GLS identifies systolic dysfunction. The tight control of glycemia, lipidemia, blood pressure and body weight is associated with the absence of poor clinical outcomes.

Caudal type homeobox transcription factor 2 (CDX2) is a gastrointestinal cancer biomarker that regulates epithelial development and differentiation. Absence or low levels of CDX2 have been associated with poor prognosis and proposed as a chemotherapy response predictor. Tumour tissue of 668 patients with stage I-IV colorectal cancer were stained for CDX2 and stratified into two subgroups according to expression levels. Statistical tests evaluated CDX2 relationship with survival and chemotherapy response. Of 646 samples successfully stained, 51 (7.9%) had low and 595 (92.1%) had high CDX2 levels. Low CDX2 staining was associated with poor differentiation, presence of lymphovascular or perineural invasion, and more common in colon and right sided tumours. Overall survival (p&lt;0.001) and disease-free survival (p=0.009) was lower in low CDX2 expressing patients. Multivariable analysis validated CDX2 as an independent poor prognostic factor after excluding confounding variables. There was no statistically significant improvement in survival with adjuvant chemotherapy in stage II colon cancer (p=0.11). In the rectal cohort, there was no relationship between CDX2 levels and therapy response. While confirming the prognostic utility of CDX2 in colorectal cancer, our study highlights larger studies are required to confirm utility as a predictive chemotherapy biomarker, especially in left sided and rectal cancers.

Metabolic dysfunction-associated steatotic liver disease (MASLD) is a serious health problem, and recent evidence indicates that gut microbiota plays a key role in its development. It is known that 2-oleoyl glycerol (2-OG) produced by the gut microbiota is associated with hepatic fibrosis, but it is not known whether this metabolite is involved in the development of hepatic steatosis. The aim of this study was to evaluate how a high-fat sucrose diet (HFS) increases 2-OG production through gut microbiota dysbiosis and to identify whether this metabolite modifies hepatic lipogenesis and mitochondrial activity for the development of hepatic steatosis as well as whether a combination of functional foods can reverse this process. Wistar rats were fed HFS diet for 7 mo. At the end of the study, body composition, biochemical parameters, gut microbiota, protein abundance of lipogenic and antioxidant enzymes, measurement of liver 2-OG, and mitochondrial function were assessed in rats and we studied the effect of HFS with functional foods. In humans with MASLD, we analyzed gut microbiota and serum 2-OG. Consumption of HFS diet in Wistar rats caused oxidative stress, hepatic steatosis and gut microbiota dysbiosis, decreasing α-diversity and increased Blautia producta abundance, which increased 2-OG. This metabolite increased de novo lipogenesis through ChREBP and SREBP-1. 2-OG significantly increased mitochondrial dysfunction. Addition of functional foods to the diet modified the gut microbiota, reducing B. producta and 2-OG levels, leading to a decrease in body weight gain, body fat mass, serum glucose, insulin, cholesterol, triglycerides, fatty liver formation, and increased mitochondrial function. In order to use 2-OG as biomarker, this metabolite was measured in healthy subjects or with MASLD and it was observed that subjects with hepatic steatosis II and III had significantly higher 2-OG than healthy subjects, suggesting that the abundance of this circulating metabolite could be a predictor marker of hepatic steatosis.

Appropriate animal models of human diseases are a cornerstone in the advancement of science and medicine. To create animal models of neuropsychiatric and neurobehavioral diseases such as ASD necessitates the development of sufficient neurobehavioral measuring tools to translate human behavior to expected measurable behavioral features in animals. Indeed, at least in rodents, adequate neurobehavioral and neurological tests have been developed. Since ASD is characterized by a number of specific behavioral trends with significant severity, animal models of autistic-like behavior have to demonstrate the specific characteristic features, namely impaired social interactions, and communication, restricted, repetitive behavioral patterns with association to several additional impairments such as somatosensory, motor and memory impairments. Thus, an appropriate model must show behavioral impairment of a minimal number of neurobehavioral characteristics using an adequate number of behavioral tests. The proper animal models enable the study of ASD like-behavior from the etiologic, pathogenetic and therapeutic aspects. From the etiologic aspects, models have been developed by the use of immunogenic substances like polyinosinic-polycytidylic acid (PolyIC), Lipopolysaccharide (LPS) and propionic acid or other well-documented immunogens or pathogens, like mycobacterium tuberculosis. Another approach is the use of chemicals like valproic acid, Polychlorinated biphenyls (PCBs), organophosphate pesticides - chlorpyrifos (CPF) and others. These substances were administered either prenatally, generally after the period of major organogenesis, or, especially in rodents, during the early postnatal life. In addition, using modern genetic manipulation methods, genetic models have been created of almost all human genetic diseases that are manifested by autistic like behavior (i.e. fragile X, Rett syndrome, SHANK gene mutation Neuroligin genes and others). Ideally, we should not only evaluate the different behavioral modes affected by the ASD-like behavior but also assess the severity of the behavioral deviations by an appropriate scoring system, as applied to humans.

The increasing concern regarding climate change continues to motivate research in the Arctic. Within the delicate cycle of the cryosphere, leads are an important kinematic feature that regulate heat balances in the Arctic. Therefore, it is necessary to quantify the genesis of leads over time to identify when and where changes are occurring. The use of a principal component analysis (PCA) is one such tool that is used to identify the characteristics of seasonal ice variability. The PCA not only identifies “normal” or “dominant” conditions or features, but also extract anomalous spatial features from an archive of long-term sequence of images.

This study describes the synthesis and characterization of mixed hydrotalcite–organosilica membrane for gas separation. Hydrotalcite exhibits the capability to adsorb carbon dioxide at elevated temperatures. High surface area and favorable coating properties are essential to harness its potential for practical applications. Stable alcohol-based dispersions are needed for thin film applications of mixed membranes containing hydrotalcite. Currently, producing such dispersions without the need for delamination and dispersion agents is a challenging task. This work introduces for the first time a manufacturing approach to overcoming the drawbacks mentioned above. It includes a synthesis of hydrotalcite nanoparticles, followed by agent-free delamination of their layers and final dispersion into alcohol without dispersion agents. Further, the hydrotalcite-derived sorption agent is dispersed in a matrix based on organo-silica gels derived from 1,2-bis(triethoxysilyl)ethane (BTESE). The analytical results indicate that the interconnection between hydrotalcite and BTESE-derived gel occurs via forming a strong hydrogen bonding system between the interlayer species (OH groups, CO32-) of hydrotalcite and oxygen and silanol active gel centers. These findings lay the foundation for applications involving incorporating hydrotalcite-like compounds into silica matrices, ultimately enabling the development of materials with exceptional mass transfer properties. In part 2 of this study, gas separation performance of the organo-silica and the hydrotalcite-like materials and their combined form will be investigated

In late December 2019 a novel RNA beta-coronavirus was recognized as the causative agent of previously pneumonia cases of unknown origin. The virus was successively named Severe Acute Respiratory Syndrome CoronaVirus 2 (SARS-CoV-2) as well as the respiratory illness that it causes Coronavirus disease 19 (COVID-19) (1, 2). The global spread of SARS-CoV-2 and the thousands of deaths caused by COVID-19 led the World Health Organization (WHO) to declare a pandemic on 11 March 2020. To date, the world has paid a high toll in this pandemic in terms of human lives lost, economic repercussions and increased poverty. Indeed, even if most patients with COVID-19 are asymptomatic or experience mild self-limiting disease, 14% of them progress to severe disease and 5% to critical illness with complications, such as interstitial pneumonia, respiratory failure with acute respiratory distress syndrome (ARDS) and multiple organ dysfunction syndromes (MODS) (3). It is accepted that SARS-CoV-2 primarily affects the respiratory system, although other organs are also involved (4). The virus enters host cells by attaching its Spike like surface projections to the angiotensin-converting enzyme-2 (ACE2) receptor which is mainly expressed on alveolar epithelial cells and in nearly all human organs in varying degrees. Thus, although the central target of SARS-CoV-2 infection is the lung, the wide distribution of ACE2 receptors in other organs may lead to cardiovascular, gastrointestinal, kidney, liver, central nervous system and ocular damages that have to be closely monitored during the disease (5, 6). The virus then activates the innate and adaptive immune system resulting in a large number of cytokines release, known as “cytokine storm”, that is directly correlated with tissue injury and unfavourable prognosis of severe lung disease (7). In particular, interleukin (IL)-6 seems to plays an important role in driving this cytokine release so that its increased levels have been recognized as a hallmark inflammatory signature in sera of COVID-19 patients (8). IL-6 is a polyfunctional cytokine with both anti-inflammatory and pro-inflammatory properties which exerts its several functions through two main signal transduction pathways (9). In the classical signal transduction pathway, IL-6 binds to IL-6-trans membrane receptor (IL-6R) to form a complex that, then, binds to the trans membrane glycoprotein gp130, inducing its homo-dimerization and initiating intracellular signal transduction. This kind of signaling is limited to cells (hepatocytes, macrophages, neutrophils, T cells, etc.) that express IL-6R on their cell surface (10). Nevertheless, cells do not express IL- 6R, as stromal and epithelial cells, are able to still respond to IL-6 because the soluble form of the receptor (sIL-6R) binds to IL-6 in circle and then anchors to membrane gp130 receptor, initiating the trans-signaling pathway. For this reason, sIL-6R is able to increase the function of IL-6 and is considered the agonist form of its receptor. When the level of IL-6 increases, its effects are widely expressed because gp130 molecules are ubiquitous and, therefore, also present in cells without IL-6R in the membrane form. On the contrary, a soluble form of the glycoprotein 130 (sgp130) can complex with sIL-6R to prevent the sIL-6R from binding to the membrane-bound gp130. In this case sgp130 is able to decrease the function of IL-6 and is considered the antagonist form of IL-6 receptor system (11). Based on the central role of IL-6 in the inflammatory pathology of COVID-19 and the consistent association between elevated levels of the cytokine and severe disease outcomes found in the first phase of infection, we sought to analysis IL-6 and its soluble receptor complex behavior during the different waves of COVID-19 pandemic, in order to evaluate the possible differences which occur among them and to hypothesize if they might be used as prognostic markers of disease severity.

Formaldehyde (HCHO), an indoor volatile organic compound, is seriously harmful to human health. Therefore, green and effective decomposition of HCHO is essential. TiO₂ has been employed for the degradation of HCHO via photocatalytic generation of reactive oxygen species (ROS) (O^2-, ·OH), yet the low specific surface area of crystalline TiO₂ depressed the catalytic performance. Herein, we prepared TiO₂ aerogels with high specific surface area and high porosity by sol-gel method, and added PVA to introduce flexible molecular chains for pore size regulation. The photocatalytic performance test verifies that the pore size of TiO₂ aerogel is one of the important factors for HCHO decomposition. Notably, through the establishment of theoretical model and calculation, we validated that the efficiency of HCHO decomposition is related to the oxygen pressure in the pores of TiO₂ aerogel, and the oxygen pressure is inversely proportional to the pore size. Accordingly, the optimal pore size of TiO₂ aerogel for the photocatalytic HCHO decomposition is 2 nm~10 nm. This study provides a theoretical idea for TiO₂ aerogels in the decomposition reaction of HCHO, which is expected to inspire more breakthroughs in the study of TiO₂ aerogels for green chemistry.

We produced a recombinant eel luteinizing hormone (rec-eel LH) analog with high potency in Chinese hamster ovary DG44 (CHO DG44) cells. The eel LH mutant (LH-M), which had a linker comprising the equine chorionic gonadotropin (eCG) β-subunit carboxyl-terminal peptide (CTP) region (amino acids 115 to149), was inserted between the β-subunit and α-subunit of wild-type tethered eel LH (LH-wt). Monoclonal cells transfected with the eel LH-wt and eel LH-M plasmids were isolated from five and nine clones of CHO DG44 cells, respectively. The secreted quantities abruptly increased on day 3, with peak levels of 5,000–7,500 ng/mL on day 9. The molecular weight of eel LH-wt was 32–36 kDa while that of eel LH-M increased to approximately 38–44 kDa, indicating the detection of two bands. Treatment with peptide N-glycanase F decreased the molecular weight by approximately 8 kDa. The oligosaccharides at the eCG β-subunit O-linked glycosylation sites were appropriately modified post-translation. The EC50 value and maximal responsiveness of eel LH-M increased by approximately 2.90- and 1.29-fold, respectively, indicating that the mutant exhibited more potent biological activity than eel LH-wt. Phosphorylated extracellular regulated kinase (pERK1/2) activation resulted in a sharp peak 5 min after agonist treatment, with a rapid decrease thereafter. These results indicate that the new rec-eel LH analog which contains the eCG β-subunit CTP linker comprising O-linked glycosylation sites, had more potent activity than the wild-type in vitro. Taken together, this new eel LH analog can be produced in large quantities using a stable CHO DG44 cell system.

In this research, the primary goal was to investigate the relationship between strategic planning and organizational performance in Iraq's manufacturing context. The study's primary data sources were 360 manager respondents. The structured questionnaire was used to collect primary data from manufacturing firms located throughout Iraq. To analyze the result, the researcher used descriptive statistics, correlation, and multiple regression analysis. SPSS version 16 software was used to conduct data analysis. The result reveals that the process of strategic planning has a beneficial effect on financial performance. Environmental scanning has a statistically significant positive effect on a company's non-financial performance. Management participation and planning formality positively and statistically significantly affect a business's non-financial performance at the 10 percent level. The domain of strategy and technique has not impacted the company's non-financial performance.

This study aimed to produce single-chain recombinant eel follicle-stimulating hormone (rec-eel FSH) analogs with high activity in Chinese hamster ovary DG44 (CHO DG44) cells. We recently reported that an O-linked glycosylated carboxyl-terminal peptide (CTP) of the equine chorionic gonadotropin (eCG) β-subunit plays contributes on high activity and time-dependent secretion in mammalian cells. We constructed a mutant (FSH-M) in which a linker including the eCG β-subunit CTP region (amino acids 115 to149) was inserted between the β-subunit and α-subunit of wild-type single chain eel FSH (FSH-wt). Plasmids containing eel FSH-wt and eel FSH-M were transfected into CHO DG44 cells. Single cells expressing each protein were isolated from 10 and 7 clones, respectively. Secretion increased gradually during the cultivation period and peaked at 4,000–5,000 ng/mL on day 9. The molecular weight of eel FSH-wt was 34–40 kDa, while that of eel FSH-M increased substantially, with two bands at 39–46 kDa. Treatment with PNGase F to remove the N glycosylation sites decreased the molecular weight remarkably to approximately 8 kDa. The EC50 value and maximal responsiveness of eel FSH-M were approximately 1.23- and 1.06-fold higher than those of eel FSH-wt, indicating that the mutant showed slightly higher biological activity. Phosphorylated extracellular regulated kinase (pERK1/2) activation exhibited a sharp peak at 5 min, followed by a rapid decline. These findings indicate that the new rec-eel FSH molecule with the eCG β-subunit CTP linker showed potent activity and could be produced in massive quantities using the stable CHO DG44 cell system.

A two-year experiment was conducted with a local maize hybrid under full irrigation (F), deficit irrigation (D) and rainfed conditions (R) to estimate maize evapotranspiration in Bosnia and Herzegovina. Three approaches (Allen & Pereira (A&P), SIMDualKc (SD), and Vegetation Index (VI)) were used to estimate the actual crop coefficient (Kc act), actual basal crop coefficient (Kcb act), and actual crop evapotranspiration (ETc act) were applied with the dual crop coefficient method and remote sensing (RS) data. While Kcb act from all approaches matched FAO56 tabulated values, SD showed differences, in comparison to A&P, of up to 0.24 in D and R conditions, especially in initial and mid-season stages. VI demonstrated very good performance in all treatments. In F, the obtained Kc act for all approaches during the initial and end stages were higher than the tabulated values, ranging from 0.71-0.87 for Kc ini act and from 0.80-1.06 for Kc end act, while the mid-season period showed very good agreement with the literature. Maize crop evapotranspiration range is 769-813 mm, 480-752 mm, and 332-618 mm for F, D and R, respectively. The results confirmed the suitability of both approaches (SD and VI) to estimate maize crop evapotranspiration under F, with the VI approach demonstrating an advantage in calculating Kcb act, Kc act, and ETc act values under water stress conditions. The 67.6% increase in grain yields with irrigation emphasizes the need to transition from rainfed to irrigation-dependent agriculture, even for drought-resistant crops like maize.

: Climate change necessitates urgent actions to mitigate carbon dioxide (CO2) emissions from fossil fuel-based energy generation. Among various strategies, the deployment of carbon capture and storage (CCS) solutions are critical for reducing emissions from point sources such as power plants and heavy industries. In this context, cryogenic carbon capture (CCC) via desublimation has emerged as a promising technology. While CCC offers high separation efficiency, minimal downstream compression work, and integration potential with existing industrial processes, challenges such as low operating temperatures and equipment costs persist. Ongoing research aims to address these hurdles in order to optimize the desublimation processes for widespread implementation. This review consolidates diverse literature works, providing insights into the strengths and limitations of CCC technology, including the latest pilot plant scale demonstrations. The transformative potential of CCC is first assessed on a theoretical basis, such as thermodynamic aspects and mass transfer phenomena. Then, recent advancements in the proposed process configurations are critically assessed and compared through key performance indicators. Furthermore, future research directions for this technology are clearly highlighted.

Despite Low Power Wide Area Networks’ ability to offer an extended range, it might still encounter challenges with coverage blind spots in the network. This article proposes an innovative energy-efficient nature-inspired relay selection algorithm for LoRa-based LPWAN networks, serving as a solution for challenges related to poor signal range in areas with limited coverage. A behavior swarm-inspired approach has been utilized to select the relays’ localization in the network, providing network energy efficiency and radio signal extension. These relays help bridge communication gaps, significantly reducing the impact of coverage blind spots by forwarding signals from devices with poor direct connectivity with the gateway. The proposed algorithm considers critical factors for the LoRa standard, such as the Spreading Factor or device energy budget analysis. The simulation experiments validate the proposed scheme’s effectiveness in terms of energy efficiency under diverse multi-gateway topology scenarios involving thousands of devices. Specifically, it has been verified that the proposed approach outperforms the reference method in preventing the battery depletion of relays, which is vital for battery-powered IoT devices. Furthermore, for some large-scale problems, the proposed heuristic method achieves over twice the speed of the exact method with a negligible accuracy loss of less than 2%.

Gastric inflammation-related disorders are commonly observed digestive system illnesses char-acterized by the activation of proinflammatory cytokines, particularly tumor necrosis factor-α (TNF-α). This results in the induction of cyclooxygenase-2 (COX-2)/prostaglandin E2 (PEG2) and matrix metallopeptidase-9 (MMP-9). These factors contribute to the pathogenesis of gastric in-flammation disorders. We examined the preventive effects of Lonicera japonica Thunb. ethanol ex-tract (Lj-EtOH) on gastric inflammation induced by TNF-α in normal GES-1 cells. The GES-1 cell line was used to establish a model that simulated the overexpression of COX-2/PGE2 and MMP-9 proteins induced by TNF-α, to examine the anti-inflammatory properties of Lj extracts. The re-sults indicated that Lj-EtOH exhibits significant inhibitory effects on COX-2/PEG2 and MMP-9 ac-tivity, attenuates cell migration, and provides protection against TNF-α-induced gastric inflam-mation. The protective effects of Lj-EtOH are associated with the modulation of COX-2/PEG2 and MMP-9 through activation of TNFR–ERK 1/2 signaling pathways as well as the involvement of c-Fos and nuclear factor kappa B (NF-κB) signaling pathways. Based on our findings, Lj-EtOH ex-hibits a preventive effect on human gastric epithelial cells. Consequently, it may represent a novel treatment for the management of gastric inflammation.

Hepatocellular carcinoma (HCC) is a heterogeneous malignancy with complex carcinogenesis. Although there has been significant progress in the treatment of HCC over the past decades, drug resistance to chemotherapy remains a major obstacle in its successful management. In this study we were able to reduce chemoresistance in cisplatin-resistant HepG2 cells by either silencing the expression of transglutaminase type 2 (TG2) using siRNA or by pre-treatment of cells with the TG2 enzyme inhibitor cystamine. Further analysis revealed that, whereas the full-length TG2 isoform (TG2-L) was almost completely cytoplasmic in its distribution, the majority of the short TG2 isoform (TG2-S) was membrane-associated in both parental and chemoresistant HepG2 cells. Following induction of cisplatin toxicity in non-chemoresistant parental cells, TG2-S together with cisplatin quickly relocated to the cytosolic fraction. Conversely, no cytosolic relocalisation of TG2-S or nuclear accumulation cisplatin was observed following identical treatment of chemoresistant cells, where TG2-S remained predominantly membrane-associated. This suggests that deficient subcellular relocalisation of TG2-S from membranous structures into the cytoplasm may limit the apoptic response to cisplatin toxicity in chemoresistant cells. Structural analysis of TG2 revealed the presence of binding motifs for interaction of TG-S with the membrane scaffold protein LC3/LC3 homologue that could contribute to a novel mechanism of chemotherapeutic resistance in HepG2 cells.

During the last two decades several cases of venous thrombosis (VTE) after a prolonged period at a computer has been described, denominated “eThrombosis”. Video gaming on a computer has become very popular and can be a social activity where several players are gathered to play against each other or in a virtual environment for several days (“LAN (i.e., Local Area Network) parties”) where the participants are sedentary and consuming calorie-rich food items. The aim of this study was to investigate a potential coagulation activation during a 42 hour LAN party. Nine male gamers volunteered for the LAN party. Citrated blood was sampled before and every 6 hours, and plasma was analyzed for thrombin generation, and Thrombin-antithrombin-complexes (TAT), prothrombin Fragment 1+2 (F1+2), and D-dimer. Thrombin generation increased slightly but not significantly during the LAN party, whereas the coagulation activation markers were unchanged. These results do not indicate that the coagulation system is activated significantly during 42 h gaming with minimal physical activity. Although an increased activity cannot be excluded, it does not directly indicate a risk of VTE in general. It may be specific and particularly susceptible in-dividuals who are prone to thrombosis and, therefore, are at risk of developing e-thrombosis.

Nucleoside analogs are commonly used drugs for the treatment of cancer and viral infections. Nucleoside deoxyribosyltransferase (NDT) is one of the key enzymes required for the biosynthesis of deoxynucleotides. The feasibility of biochemical transformation processes is usually greatly dependent on the cost of biocatalysts. Therefore, immobilizing and reusing biocatalysts is an approach to be considered to bring biotransformations closer to industrial feasibility, since it not only allows enzymes to be reused but can also improve their stability under several reaction conditions. In this work, histidine tags have been successfully fused to a Nucleoside deoxyribosyltransferase from Lactobacillus reuteri (LrDNT), which has been produced in a bench-scale reactor using a facile araBAD promoter-based protein expression system in an industrial microorganism, the E. coli BL21(DE3) strain. The overexpressed LrNDT was bound to a nickel-chelating agarose affinity chromatography medium via a one-step purification and immobilization process with a 99% yield, retaining about 97% of its initial activity. The optimal conditions for the immobilized LrNDT maintain high enzyme activity within the range of 20-45°C and pH 6.0-7.5. Finally, the immobilized enzyme reactor (IMER) of LrNDT was applied for the continuous-flow biosynthesis of 2'-deoxyadenosine and retained 90% of its activity after 16 hours, providing a theoretical basis for the industrial production of nucleoside analogs.

The late diagnosis of Type 2 Diabetes Mellitus can occur due to lack of access to the primary health care system and the non-manifestation of symptoms. Faced with this problem, this work presents the creation of a mobile application, called DiabetesCheck, for predicting the risk of Type 2 Diabetes Mellitus. A mathematical model is used, which classifies the risk of Type 2 Diabetes Mellitus for a group of patients with intervention and for a comparative group, using Fuzzy Classification and Decision Trees. The proposed application allows the health professional to monitor patients through the history stored in a database, allowing a representation of the evolution of patients and indication of medications. Therefore, this proposal aims to carry out the diagnosis in the initial phase of the disease and help in the prescription of more effective treatments and in the proposition of public policy strategies in epidemiology and screening.

Nanocomposites of TiO₂ Degussa P25 nanoparticles/activated carbon (TiO₂/AC ) were prepared at various mass ratios of (4:1), (3:2), (2:3), and (1:4) by a facile process. The effects of TiO₂/AC mass ratios on the structural, morphological, and photocatalytic properties were systematically studied in comparison with bare TiO₂ and bare AC. TiO₂ nanoparticles exhibited dominant anatase and minor rutile phases, and a crystallite size of approximately 21 nm; while AC had XRD peaks of graphite and carbon, and a crystallite size of 49 nm. The composites exhibited tight decoration of TiO₂ nanoparticles on micron-/submicron AC particles, and uniform TiO₂/AC composites were obtained as evidenced by the uniform distribution of Ti, O, and C in an EDS mapping. Moreover, Raman spectra show the typical vibration modes of anatase TiO₂ (e.g., E_1g⁽¹⁾, B_1g⁽¹⁾, E_g⁽³⁾) and carbon materials with D and G bands. The TiO₂/AC with (4:1), (3:2), and (2:3) possessed higher reaction rate constants (k) in photocatalytic degradation of methylene blue (MB) than that of either TiO₂ or AC. Among the investigated materials, TiO₂/AC = 4:1 achieved the highest photocatalytic activity with a high k of 55.2×10^-3 min^-1 and an MB removal efficiency of 96.6% after 30 min treatment under UV-Vis irradiation (120 mW/cm²). The enhanced photocatalytic activity for TiO₂/AC is due to the synergistic effect of the high adsorption capability of AC and the high photocatalytic activity of TiO₂. Furthermore, TiO₂/AC promotes the separation of photoexcited electron/hole (e^-/h⁺) pairs to reduce their recombination rate and thus enhance photocatalytic activity. The optimal TiO₂/AC composite in this study can be used for treating industrial or household wastewater with organic pollutants.

This report provides a comprehensive overview of occupational asthma and respiratory hypersensitivity, focusing on some chemicals used in the workplace Includes numerous case studies and research papers related to occupational exposure methacrylates, such as HEMA-HPMA, and respiratory hypersensitivity are discussed And the relationship is explored The book also examines asthma pathophysiology, emerging drug delivery systems used to treat asthma, and the potential of nanoparticles , dendrimers and micellar systems have to improve pulmonary drug delivery in detail The worldwide prevalence of asthma is highlighted, with higher rates in high-GDP countries. The book highlights the need to improve asthma diagnosis, treatment and biomarkers, particularly in rural and low-income countries where the disease is often underdiagnosed and inadequately treated, and discusses the role of inflammation in asthma, in particular secondary inflammation characterized by specific cytokines and inflammation cells In addition, the paper explores various drug delivery methods, such as parenteral and parenteral drugs, pressurized inhalers (pMDIs), dry powder inhalers ( DPIs), nebulizers, nanoparticles, liposomes, micellar systems, microparticles , dendrimers, and gene therapy . These systems aim to increase pulmonary delivery of drugs and improve clinical outcomes. The potential of dendrimer bilirubin-based nanoparticles and micellar systems in the treatment of asthma and lung inflammatory diseases, including asthma, has been discussed in summary, this paper provides an overview of occupational asthma and respiratory hypersensitivity, and this discussion highlights the association between methacrylate exposure and respiratory hypersensitivity.

To accurately and non-destructively monitor the growth of spring wheat in the Hetao Irrigation Area, UAV remote sensing was employed during various fertility stages. Digital image indices from diverse fertilization treatments were calculated and compared with physiological indices to identify the most sensitive digital image indices corresponding to these indices. The study underscored the critical importance of the flowering stage in the growth of spring wheat, thus highlighting the necessity of focusing on this stage. This finding reiterated that the flowering stage was pivotal for spring wheat development in the Hetao Irrigation Area. Several digital image indices, such as GLA, R, G, INT, g, GRVI, MGRVI, RGBVI, EXG, and GRRI, exhibited a high frequency of significant correlations with physiological indices during the four primary reproductive stages of wheat. Consequently, these sensitive digital image indices during the flowering stage can more effectively characterize the physiological indices of spring wheat.

Background: The aim was to diagnose Candida in the oral cavity of subjects with type 2 diabetes mellitus (T2DM) using a genotyping technique and to compare the results with those from con-ventional diagnosis by Papanicolau (Pap) staining. Methods: Palatal mucosa smears were per-formed in 18 dental care patients diagnosed with T2DM and grade I, II, and III prosthetic stomatitis who met the inclusion criteria; 18 healthy control subjects were also included in the study. He-moglobin A1c (HbA1c) levels were determined from total blood. Using exfoliative cytology, the Pap staining technique was used to diagnose candidiasis. Exfoliative cytology was also used for molecular diagnosis; DNA was obtained for Candida genotyping and RNA was used for gene ex-pression studies. Results: Clinical patterns indicated that all subjects were positive for Candida; however, Pap analysis revealed only three positive subjects, whereas end-point polymerase chain reaction (PCR) analysis revealed fifteen subjects with some type of Candida. The most common Candida species found were Candida guilliermondii (38.8%), Candida krusei (33.3%), Candida tropicalis, and Candida lusitaniae (22.2%). Interestingly, the coexpression of different species of Candida was found in various patients. In all patients, HbA1c levels were increased. Gene expression analysis showed a significant decrease (p ≤ 0.05) in TLR2 expression in positive subjects, whereas TLR4 expression did not differ significantly among patients. Conclusions: The end-point PCR technique showed better sensitivity for diagnosis of Candida when compared with diagnosis by Pap staining. T2DM subjects showed an increased presence of C. guilliermondii that was correlated with decreased TLR2 expression

Nowadays, it is highly desired to develop highly active and humidity resistive ozone decomposition catalyst to eliminate the ozone contaminant, one of the primary pollutants in air. In this work, a series of Cu2S hollow structured materials are rapidly synthesized using different structured Cu2O templates. The Cu2S from porous Cu2O shows the highest ozone catalytic decomposition efficiency of >95% to 400 ppm ozone with a weight hourly space velocity of 480,000 cm3g-1h-1 in dry air. Importantly, the conversion still keeps >85% in a high relative humidity of 90%. The mechanism is explored by diffusive reflectance infrared spectroscopy which shows the decomposition intermediate of O22-, and the X-ray photoelectron spectroscopy reveals the dual active site of both Cu and S. All these results show the effective decomposition of ozone by Cu2S especially in harsh environments, promising for active ozone elimination.

As humans age, aberrancies in several signaling pathways occur. In the aging population, some patients display abnormal bone morphogenetic protein (BMP) signaling. This can lead to osteoporosis (OP), a debilitating bone disorder caused by an imbalance between osteoblasts and osteoclasts. In 2002, the Food and Drug Administration (FDA) approved usage of recombinant human BMP-2 (rhBMP-2) during spinal fusion surgery as it is crucial for bone formation. However, complications have been reported with rhBMP-2 and primary osteoblasts isolated from OP patients are unresponsive to BMP-2. While patient samples are available, previous medical history may alter results. Therefore, C57BL/6 mice, an aging model that displays aberrant BMP-signaling, can be utilized to investigate OP and aging. We show that BMP receptor type Ia (BMPRIa) is upregulated in the bone marrow stromal cells (BMSCs) of 15-month mice similar to previous data. We show that a conjugation between BMP-2 and Quantum Dots (QDot®s) effectively binds to BMPRIa and can investigate BMP-2 activity. After incubating BMSCs with methyl-β-cyclodextrin (MβCD), BMP-signaling is restored in 15-month mice as shown by western blotting and the von Kossa assay. MβCD may be used to rescue BMPRIa and the BMP-signaling pathway can be utilized by future therapeutics to treat OP.

Background. Type 2 diabetes mellitus (T2DM) is becoming a major global health concern, especially in poorer nations. The high prevalence of obesity and the ensuing diabetes is attributed to rapid economic progress, physical inactivity, consumption of high-calorie foods, and changing lifestyles. Objectives. We investigated the role of pro-inflammatory chemokines; CCL1, 2, 4 and 5 with varying levels of obesity in T2DM in the Asir region of Saudi Arabia. Materials and methods. 170 confirmed T2DM patients and a normal control group were enrolled. The demographic data, serum levels CCL-1, 2, 4 and 5 and the biochemical indices were assessed in patients and control groups by standard procedures. Results. T2DM patients were divided into four groups: A (normal body weight), B (Overweight), C (obese), and D (highly obese). n controls. We observed that male and female control patients had similar mean serum concentrations of pro-inflammatory chemokines CCL 1, 2, 4, and 5. Chemokines CCL1, CCL2, and CCL4 in the serum of Type 2 Diabetes Mellitus patients with normal or overweight body weights were significantly higher than the control group, regardless of gender. In T2DM individuals with obesity and severe obesity, the rise was most significant. There was a progressive rise in the concentrations of CCL1, 2, and 4 in T2DM) patients with increasing BMI. Serum CCL5 levels increased significantly in all T2DM patient groups. The increase in CCL5 was more predominant in normal-weight people as compared to overweight and obese T2DM patients. Conclusions. Male and female control patients had similar serum levels of pro-inflammatory chemokines CCL 1, 2, 4, and 5. The progressive rise in blood concentrations of three Pro-inflammatory chemokines; CCL1, 2, and 4 in T2DM patients with increasing BMI supports the idea that dyslipidemia and obesity contribute to chronic inflammation and insulin resistance. Serum CCL5 levels increased significantly in all T2DM patient groups. The selective and more pronounced increase of CCL5 in the T2DM group with normal BMI as compared to patients with varying degrees of obesity, was rather surprising. Further research is needed to determine if CCL5 under-expression in overweight and obese T2DM patients is due to some unexplained counterbalancing processes.

Cognitive reserve is the adaptability of cognitive processes in the face of brain aging and pathology. This study aimed to validate the Arabic version of the Cognitive Reserve Index Questionnaire (CRIq) in a healthy Lebanese sample. CRIq assesses cognitive reserve through three domains: education, working activity, and leisure time. Statistical measures, including descriptive and regression analysis along with structural equation modeling, were utilized to investigate the convergent and discriminant validity of CRIq, incorporating fluid intelligence (Gf) and measures of cognitive function, long-term memory encoding and retrieval (Glr), and processing speed (Gs). Results from 174 participants revealed that the activities assessed by CRIq-Arabic were comparable to the original CRIq study, with slight cultural differences. The internal consistency of CRIq-Arabic was good (Cronbach's α = 0.88), indicating reliability. Convergent validity was confirmed, with moderate to high loadings on the cognitive reserve latent construct. Discriminant validity was supported as correlations between cognitive reserve variables and non-target constructs (Gf, Glr, Gs) were less than 1. The findings provide an initial psychometric validation of the CRIq-Arabic. Further research in clinical samples is needed to enhance its utility in neuropsychological practice.

Type 2 diabetes mellitus (T2DM) is a common metabolic disease characterised by insulin resistance and elevated blood glucose levels, affecting millions of people worldwide. T2DM patients with dyslipidaemia have an increased risk of cardiovascular disease (CVD). A complex interplay of risk factors such as hyperglycaemia, dyslipidaemia, hypertension, obesity, inflammation and oxidative stress favour the development of atherosclerosis, a central mechanism in the pathogenesis of cardiovascular disease. Dyslipidaemia, a hallmark of T2DM, is characterised by elevated triglycerides, decreased high-density lipoprotein (HDL) cholesterol and the presence of small, dense low-density lipoprotein (LDL) particles, all of which promote atherosclerosis. In this article, we have attempted to present various treatment strategies that include pharmacological interventions such as statins, ezetimibe, PCSK9 inhibitors, fibrates and omega-3 fatty acids. We have also tried to highlight the pivotal role of lifestyle modifications, including physical activity and dietary changes, in improving lipid profiles and overall cardiovascular health in T2DM patients. We have also tried to present the latest clinical guidelines for the management of dyslipidaemia in T2DM patients. In conclusion, the treatment of dyslipidaemia in T2DM patients is of great importance as it lowers lipid particle levels, slows the progression of atherosclerosis and ultimately reduces susceptibility to cardiovascular disease.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

D-Glucaric acid is an important bio-based building block of polymers and is a high value-added chemical that can be used in a variety of applications. In the present study, the Udh target genes from Pseudomonas putida and Pseudomonas syringae were used together to construct the expression vector pETDuet-2×Udh. The transformants of BL21(DE3) with vector pETDuet-2×Udh was applied to produce glucaric acid from glucuronic acid. After optimization of induction conditions, the highest Udh expression were achieved when 0.4 mmol L-1 isopropyl-β-d–thiogalactoside (IPTG) was added to cell cultures at an OD600 value of 0.6 followed by culture at 26℃ for 6 hours. The production of glucaric acid substantially reached 5.24 ± 0.015 g L-1 in fed-batch cultures in a 30 L tank. In the present study, a new system for glucaric acid production was established, which was more economic and friendly to environment.

One of the hallmarks of microgravity-induced effects in several cellular models is represented by the alteration of oxidative balance with the consequent accumulation of Reactive Oxygen Species (ROS). It is well known that male germ cells are sensitive to oxidative stress and to changes of gravitational force even if published data on germ cell models are scarce. To gain more insights into the mechanisms of male germ cell response to altered gravity, a 3D cell culture model has been established from TCam-2 cells, a seminoma-derived cell line considered the only human cell line available to study in vitro mitotically active human male germ cells. TCam-2 cell spheroids were cultured for 24 hours under unitary gravity (Ctr) or simulated microgravity (s-microgravity) conditions, these last ones were obtained using the Random Positioning Machine (RPM). A significant increase in intracellular ROS and mitochondria superoxide anion levels has been observed after RPM exposure. In line with these results a trend of protein and lipid oxidation increase, and increased pCAMKII expression levels were observed after RPM exposure. The ultrastructural analysis by Transmission Electron Microscopy revealed that RPM-exposed mitochondria appeared enlarged and, even if seldom, disrupted. Notably, even the expression of the main enzymes involved in the redox homeostasis appears modulated by RPM exposure in a compensatory way, being GPX1, NCF1, and CYBB downregulated, whereas NOX4 and HMOX1 upregulated. Interestingly, HMOX1 is involved in the heme catabolism of mitochondria cytochromes, and therefore the positive modulation of this marker can be associated to the observed mitochondria alteration. All together, these data demonstrate TCam-2 spheroid sensitivity to acute SM exposure and indicate the capability of these cells to trigger compensatory mechanisms that allow to overcome the exposure to altered gravitational force.

Systemic sclerosis (SSc) is a multisystem connective tissue disease characterized by pathological processes involving autoimmunity, vasculopathy, and resultant extensive skin and organ fibrosis. Recent studies have demonstrated activation and aberrant wound healing responses in the epithelial layer of the skin in this disease, implicating the epithelial keratinocytes as a source of pro-fibrotic and inflammatory mediators. In this paper we investigated the role of Immunoglobulin G (IgG) autoantibodies directed against epithelial cells, as potential initiators and propagators of pathological keratocyte activation and the ensuing SSc fibrotic cascade. A keratinocyte cell-based ELISA is used to evaluation binding of SSc IgG. SSc skin biopsies were stained by immunofluorescence for the presence of IgG in the keratinocyte layer. Moreover, IgG purified from SSc sera is evaluated for the potential to activate keratinocytes in tissue culture and to induce signaling in TLR2 &amp; 3 reporter cell lines. We demonstrate enhanced binding of SSc IgG to keratinocytes, and activation of these cells leading to release of IL-1α, representing a potential initiating pathway in this disease.

N'-(5-bromofuran-2-carbonyl)isonicotinohydrazide (1) was obtained as a white solid in 83% yield by 2-methyl-6-nitrobenzoic anhydride (MNBA)/4-dimethylaminopyridine (DMAP)-catalyzed reaction of 5-bromofuran-2-carboxylic acid and isoniazid in dichloromethane at room temperature. The structure of N'-(5-bromofuran-2-carbonyl)isonicotinohydrazide (1) was elucidated by 1H NMR, 13C NMR, FTIR, and the high resolution mass spectrometers. Molecular docking screening of the title compound (1) on the cyclooxygenase-2 (COX-2) protein (PDB ID: 5IKR) exhibited that compound (1) has a good binding affinity, suggesting that it is very interesting for further structure optimization and in-depth research as a potential COX-2 inhibitor.

Adipose tissue is a crucial organ in energy metabolism and thermoregulation. Adipose tissue phenotype is controlled by various signaling mechanisms under pathophysiological conditions. Type II transmembrane serine proteases (TTSPs) are a group of trypsin-like enzymes anchoring on the cell surface. These proteases act in diverse tissues to regulate physiological processes, such as food digestion, salt-water balance, iron metabolism, epithelial integrity, and auditory nerve development. More recently, several members of the TTSP family, namely, hepsin, matriptase-2, and corin, have been shown to play a role in regulating lipid metabolism, adipose tissue phenotype, and thermogenesis, via direct growth factor activation or indirect hormonal mechanisms. In mice, hepsin deficiency increases adipose browning and protects from high-fat diet-induced hyperglycemia, hyperlipidemia, and obesity. Similarly, matriptase-2 deficiency increases fat lipolysis and reduces obesity and hepatic steatosis in high-fat diet-fed mice. In contrast, corin deficiency increases white adipose weights and cell sizes, suppresses adipocyte browning and thermogenic responses, and causes cold intolerance in mice. These findings highlight an important role of TTSPs in modifying cellular phenotype and function in adipose tissue. In this review, we provide a brief description about TTSPs and discuss recent findings regarding the role of hepsin, matriptase-2, and corin in regulating adipose tissue phenotype, energy metabolism, and thermogenic responses.

Preterm delivery can be precipitated by infection, and preterm infants are at heightened risk of postnatal infection. Little is known about the ontogeny of inflammatory biomarkers in extremely preterm infants. We hypothesized that suspected prenatal infection (chorioamnionitis or spontaneous preterm labor) and clinically diagnosed postnatal infection would be associated with unique biomarker signatures, and those patterns would be influenced by the degree of prematurity. Venous blood was collected daily for the first week and weekly for up to 14 additional weeks from 142 neonates born at 22-32 weeks gestation. A custom array was utilized to measure monocyte chemoattractant protein-1 (MCP-1) and interleukin-6 (IL-6). C-reactive protein (CRP) levels were obtained from the electronic medical record. 90 infants had suspected prenatal infection and 63 were diagnosed with postnatal infection. Independent of gestational age at delivery, MCP-1 was significantly increased (P &lt; 0.001) in association with maternal preeclampsia, but MCP-1 was decreased (P&lt;0.01) and CRP was increased (P&lt;0.05) in the presence of chorioamnionitis. IL-6 and CRP were both increased in infants diagnosed with postnatal infection with peak levels observed on days 2 and 3, respectively. In conclusion, suspected prenatal and postnatal infections and non-infectious complications of pregnancy are associated with unique biomarker profiles, independent of gestational age. In those clinically diagnosed with a postnatal infection in the absence of antenatal infection concerns, IL-6 increases before CRP, emphasizing a potential role for expanded biomarker screening if antibiotics are initially avoided in infants born exclusively for maternal indications.

Erectile dysfunction (ED) is a common and feared complication of radical prostatectomy (RP) for prostate cancer. Recently, tissue engineering is being attempted for post-prostatectomy ED, with controlled interactions between cells, growth factors, and extracellular matrix (ECM) being important for nerve regeneration's structural integrity. In this study, we evaluated the effects of biomechanical ECM patch on human bone marrow-derived mesenchymal stem cells (hBMSCs) morphology and behavior in bilateral cavernous nerve injury (BCNI) rat model. The ECM patch, made of decellularized human fibroblast-derived ECM (hFDM) and a biocompatible polyvinyl alcohol (PVA) hydrogel, was tested with human bone marrow-derived mesenchymal stem cells (hBMSCs) on a bilateral cavernous nerve injury (BCNI) rat model. In vitro analysis showed that the hFDM/PVA + hBMSCs patches significantly increased neural development markers. In vivo experiments demonstrated that the rats treated with the hFDM/PVA patch had higher ICP/MAP ratio, a higher ratio of smooth muscle to collagen, increased content of nNOS, higher levels of eNOS protein expression, and a higher cGMP level compared to the BCNI group. These results indicate that the hFDM/PVA patch is effective in promoting angiogenesis, smooth muscle regeneration, and nitrergic nerve regeneration, which could contribute to improved erectile function in post-prostatectomy ED.

Beyond plasma glucose-lowering in patients with type 2 diabetes, sodium- glucose cotransporter 2 inhibitors (SGLT2i) significantly reduced the hospitalization for heart failure (HF) and retarded the progression of chronic kidney disease (CKD). Endothelial dysfunction is not only involved in the development and progression of cardiovascular disease (CVD), and is also associated with the progression of CKD. In patients with type 2 diabetes, hyperglycemia, insulin resistance, hyperinsulinemia and dyslipidemia induce the development of endothelial dysfunction. SGLT2i have shown an improvement in endothelial dysfunction, as assessed by flow-mediated vasodila-tion, in individuals at high risk for CVD. Along with an improvement of endothelial dysfunction, SGLT2i showed improvements in oxidative stress, inflammation, mitochondrial dysfunction, glucotoxicity such as advanced glycation end products signaling and nitric oxide bioavailability. The improvements in endothelial dysfunc-tion and such endothelium-derived factors may play an important role in preventing the development of coronary artery disease, coronary microvascular dysfunction and diabetic cardiomyopathy which cause HF and in retarding CKD. The suppression of the development of HF and the progression of CKD achieved by SGLT2i might have been largely induced by the improvement of vascular endothelial function by SGLT2i.

This research intended to report amine-functionalized multiwall carbon nanotubes (MWCNTs) prepared by a simple method for efficient and rapid removal of Reactive Yellow 2 (RY2) from water. EDS analysis showed that the N content increased from 0 to 2.42% and from 2.42 to 8.66% after modification by APTES and PEI, respectively. BET analysis displayed that the specific surface area, average pore size, and total pore volume were reduced from 405.22 to 176.16 m2/g, 39.67 to 6.30 nm, and 4.02 to 0.28 cm3/g, respectively. These results proved that the PEI/APTES-MWCNTs were successfully prepared. pH edge experiment indicated that pH 2 was optimal for RY2 removal. At pH 2 and 25 °C, the time required for adsorption equilibrium was 10, 15, and 180 min at initial concentrations of 50, 100, and 200 mg/L, respectively; and the maximum RY2 uptake calculated by the Langmuir model was 714.29 mg/g. Thermodynamic studies revealed that the adsorption process was spontaneous and endothermic. 0-0.1 mol/L of NaCl showed negligible effect on RY2 removal by PEI/APTES-MWCNTs. Five adsorption/desorption cycles confirmed the good reusability of PEI/APTES-MWCNTs in RY2 removal. Overall, the PEI/APTES-MWCNTs are a potential and efficient adsorbent for reactive dye wastewater treatment.

In an historic perspective on the development of the Standard Model of particle physics it is shown how mathematically driven axioms have masked the merits of a physically comprehensible structural view. It is concluded that the difference between the two approaches can be traced back to two major issues. Whereas in the Standard Model the quark is a Dirac particle with a single real dipole moment, the quark in the structural model, in confinement with other quarks, is a Dirac particle with two real dipole moments. The second issue is the view that empty space does not exist, but that space is filled with a polarisable energetic fluid. It is shown how recognition of these two issues pave a road to reconcile particle physics with gravity, in which the quark can be seen as a magnetic electron and in which the gluon, as the strong force carrier, can be seen as a massive photon.

Low back pain is a clinically highly relevant musculoskeletal burden and is associated with inflammatory as well as degenerative processes of the intervertebral disc. However, the pathophysiology and cellular pathways contributing to this devastating condition are still poorly understood. Based on previous evidence, we hypothesize that tissue renin-angiotensin system (tRAS) components, including the SARS-CoV-2 entry receptor angiotensin-converting enzyme 2 (ACE2), are present in human nucleus pulposus (NP) cells and associated with inflammatory and degenerative processes. Experiments were performed with NP cells from 4 human donors. The existence of angiotensin II, angiotensin II type 1 receptor (AGTR1), AGTR2, MAS-receptor (MasR), and ACE2 in human NP cells was validated with immunofluorescent staining and gene expression analysis. Hereafter the cell viability was assessed after adding agonists and antagonists of the target receptors as well as angiotensin II in different concentrations for up to 48 hours of exposure. A TNF-α-induced inflammatory in vitro model was employed to assess the impact of angiotensin II addition and the stimulation or inhibition of the tRAS receptors on inflammation, tissue remodeling, expression of tRAS markers, and the release of nitric oxide (NO) into the medium. Further, protein levels of IL-6, IL-8, IL-10, and intracellular as well as secreted angiotensin II were assessed after exposing the cells to the substances, and inducible nitric oxide synthase (iNOS) levels were evaluated utilizing Western Blot. The existence of tRAS receptors and angiotensin II were validated in human NP cells. Cell viability analysis revealed no cytotoxic effects of angiotensin II. The AGTR1 inhibitor Candesartan and the MAS receptors AVE0991 showed cytotoxic effects at high concentrations (100 µM). The addition of angiotensin II only showed a mild impact on gene expression markers. However, there was a significant increase in NO secreted by the cells. The gene expression ratios of pro-inflammatory/anti-inflammatory cytokines IL-6/IL--10, IL-8/IL-10, and TNF-α /IL-10 were positively correlated with the AGTR1/AGTR2 and AGTR1/MAS1 ratios, respectively. The stimulation of the AGTR2 MAS-receptor and the inhibition of the AGTR1 receptor revealed beneficial effects on the gene expression of inflammatory and tissue remodeling markers. This finding was also present at the protein level. We did not find alterations in iNOS protein concentrations after adding the drugs. The current data showed that tRAS components are expressed in human NP cells and are associated with inflammatory and degenerative processes. Further characterization of the associated pathways is warranted. The findings indicate that tRAS modulation might be a novel therapeutic approach to intervertebral disc disease.

Fusarium culmorum is a major pathogen of grain crops. Infected plants accumulate deoxynivalenol (DON), 3-acetyl-deoxynivalenol (3-ADON), or nivalenol (NIV), which are mycotoxins of the trichothecene B group. These toxins are also produced by F. graminearum species complex. New trichothecenes structurally similar to trichothecenes B but lacking the carbonyl group on C-8, designated NX toxins, were recently discovered in atypical isolates of F. graminearum from North America. Only these isolates and a few strains of a yet to be characterized Fusarium species from South Africa are known to produce NX-2 and other NX toxins. Here we report that among 20 F. culmorum strains isolated from maize, wheat, and oat in Europe and Asia over a period of 70 years, 18 strains produced NX-2 simultaneously with 3-ADON and DON or NIV. Rice cultures of strains producing 3-ADON accumulated NX-2 in amounts corresponding to 2-8% of 3-ADON (1.2 - 36 mg/kg). A strain producing NIV accumulated NX-2 and NIV at comparable amounts (13.6 and 10.3 mg/kg, respectively). In F. graminearum, producers of NX-2 possess a special variant of cytochrome P450 monooxygenase encoded by TRI1 that is unable to oxidize C-8. In F. culmorum, producers and nonproducers of NX-2 possess identical TRI1; the reason for the production of NX-2 is unknown. Our results indicate that production of NX-2 simultaneously with trichothecenes B is a common feature of F. culmorum.

Conventional methods of crop mapping need ground truth information to train the classifier. Thanks to the frequent acquisition allowed by recent satellite missions (Sentinel 2), we can identify temporal patterns that depend on both phenology and crop management. Some of these patterns are specific to a given crop and thus can be used to map it. Thus, we can substitute ground truth information used in conventional methods with agronomic knowledge. This approach was applied to identify irrigated permanent grasslands (IPG) in the Crau area (Southern France) which play a crucial role in groundwater recharge. The grassland is managed by making three mows during the May-October period which leads to a specific temporal pattern of leaf area index (LAI). The mowing detection algorithm was designed using the temporal LAI signal derived from Sentinel 2 observations. The algorithm includes some filtering to remove noise in the signal that might lead to false mowing detection. A pixel is considered a grassland if the number of detected mows is greater than 1. A data set covering five years (2016-2020) was used. The detection mowing number was done at the pixel level and then results are aggregated at the plot level. A validation data set including 780 plots was used to assess the performances of the classification. We obtained a Kappa index ranging between 0.94-0.99 according to the year. These results were better than other supervised classification methods that include training data sets. The analysis of land-use changes shows that misclassified plots concern grasslands managed less intensively with strong intra-parcel heterogeneity due to irrigation defects or year-round grazing. Time series analysis, therefore, allows us to understand different management practices. Real land-use change in use can be observed, but long time series are needed to confirm the change and remove ambiguities with heterogeneous grasslands.

In this paper, the phases in the Mg-Ti-O system using the 1:1 formulation of MgO:TiO2 mixing synthetic brucite of Mexican origin with TiO2 microparticles of high purity and with a heat treatment at 1100°C for 1 h were studied. The raw materials and formulation by XPS and DRX techniques were characterized. The results demonstrate the presence of different oxidation states in titania and the formation of different oxides in the Mg-Ti-O system when mixed and calcined at 1100°C; additionally, the formation of vacancies in the crystal lattice during the transformation from hexagonal brucite to magnesia with a cubic structure centered on the faces is estimated. With the results, its thermal behavior is warned based on the MgO-TiO2 phase diagram.

The purpose of the current study was directed to investigate the effectiveness of docosahexaenoic acid (DHA) as a chemopreventive agent on experimentally induced hamster buccal pouch (HBP) carcinogenesis; Material and methods: 40 Syrian male hamsters, five weeks old, were divided into 4 groups of 10 animals in each as follows, GI: Topical application of liquid paraffin alone (thrice a week for 14 weeks), GII: Topical application of 7, 12 dimethyl benz[a]anthracene (DMBA) alone (0.5 % in liquid paraffin, thrice a week for 14 weeks), GIII: Topical application of DMBA (0.5 % in liquid paraffin, thrice a week for 14 weeks) + Oral administration of DHA (125 mg/kg b.w. in 1 ml distilled water by oral gavage, thrice a week for 14 weeks on alternative days of DMBA application), GIV : Oral administration of DHA alone (125 mg/kg b.w. in 1 ml distilled water by oral gavage, thrice a week for 14 weeks); Results: Gross observations and histopathological findings revealed a-GI: normal stratified squamous epithelium b- GII: well and moderately differentiated squamous cell carcinoma (SCC) c-: GIII: showed variable results ranges from hyperkeratosis, hyperkeratosis and focal hyperplasia, mild dysplasia, and well differentiated SCC with superficial invasion of tumor cells not extended to deeper areas d: GIV: normal similar to GI. Immunohistochemical results revealed that oral DHA treatment to DMBA treated hamsters restored the normal expression of bcl-2; Conclusion: DHA has the potential to be a dietary chemopreventive agent due to its capacity to improve carcinogen detoxification and to block/suppress the initiation and promotion stages of experimentally produced HBP carcinogenesis.

Calcium dihydrogen phosphate monohydrate [Ca(H2PO4)2·H2O] (a fertilizer) was successfully synthesized by the recrystallization process by using a prepared triple superphosphate (TSP) that derived from oyster shell waste as starting material. This bio-green, eco-friendly process to produce an important fertilizer can promote a sustainable society. The shell-waste-derived TSP was dissolved in distilled water and kept at 30, 50, and 80 °C. Non-soluble powder and TSP solution were obtained. The TSP solution fraction were then dried and the recrystallized products (RCP30, RCP50, and RCP80) were obtained and confirmed as Ca(H2PO4)2·H2O. Whereas the non-soluble products (NSP30, NSP50, and NSP80) were observed as calcium hydrogen phosphate dihydrate (CaHPO4·2H2O). The recrystallized yields of RCP30, RCP50, and RCP80 were found to be 51.0%, 49.6%, and 46.3%, whereas the soluble percentages were 98.72%, 99.16%, and 96.63%, respectively. RCP30 shows different morphological plate sizes, while RCP50 and RCP80 present the coagulate crystal plates. X-ray diffractograms confirm the formation of both the NSP and RCP. The infrared adsorption spectra confirmed the vibrational characteristics of HPO42‒, H2PO4‒ and H2O existed in CaHPO4·2H2O and Ca(H2PO4)2·H2O. Three thermal dehydration steps of Ca(H2PO4)2·H2O (physisorbed water, polycondensation, and re-polycondensation) were observed. Ca(H2PO4)2 and CaH2P2O7 are the thermodecomposed products from the first and second steps, whereas the final product is CaP2O6.

Type 2 diabetes (T2D) is associated with increased cardiovascular morbidity, mortality, and hospital admissions. There is variability in clinical practice. The objectives are to analyze the variability in the control of Blood Pressure (BP), HbA1c, and LDL-C in T2D patients and its influence on admissions due to cardiovascular events (CVE) Methods: We analyzed the electronic records in Primary Care Health centers in Navarra (Spain) and hospital admission for CVE. We follow 480637 people from 2012 to 2016. We calculated indicators of control of patients with T2D for each year, percentage with: HbA1c &lt; 7%; HbA1c &gt;= 9%; BP &lt;140/90 mmHg; LDL-C &lt;100 mg/dl. We used logistic and Cox regression. Results: Patients in the best control GP practices cluster are 2.5 times more likely to have HbA1c &lt;7% [OR: 2.46 (95% CI: 2.29-3.64)]. Poor HbA1c control ≥ 9% is more likely in the worst control cluster [OR: 1.73 (95% CI:1.63-1.83)]. The probability of admission for CVE increases with age, being male, low income, obesity, history of CVE, having HbA1c ≥ 9%, and belonging to a GP practice in the cluster of HbA1C ≥ 9% worst control. In contrast, it decreases in patients with HbA1c &lt;7%, BP&lt;140/90 mmHg and LDL &lt;100 mg/dl.

(1) Background: Mouse-mammary tumor virus (MMTV) might play a role in the etiology of some breast cancers in humans. The purpose of our study was to identify MMTV DNA sequences in breast tissue samples from breast cancer patients operated in our regional center from Romania. (2) Methods: We have selected 75 patients with non-metastatic breast cancer treated with curative intent and searched with PCR the MMTV-like DNA sequence in the breast cancer tissue and normal breast tissue obtained from the same patients. (3) Results: None of the examined samples was positive for MMTV-like target sequences on PCR. (4) Conclusions: We could not prove that MMTV plays a role in the etiology of breast cancer in our patient group. This finding is similar to findings of other geographically related research groups and might be due to the fact that only the Mus musculus domesticus mouse species was proven to carry infectious MMTV, but not the Mus musculus musculus species, which is specific to South-Eastern Europe and some parts of Asia.

Water reuse for irrigation is increasingly recognized as an essential and economical strategy in areas with water scarcity. A simple, low-cost, low-maintenance, and highly efficient Pond-In-Pond (PIP) treatment system can be used for wastewater reuse. PIP is a treatment technology in which two types of ponds -- anaerobic and aerobic -- are combined into a single pond and consist of a deeper inner section entirely submerged within the outer pond. Previous studies on PIPs and PIP-like systems have reinforced the potential for reuse through promising performance results with BOD removal over 80% and a reduction in land area requirements by approximately 40%. Yet, no prior efforts have been made to understand the performance mechanism of such systems. This study makes use of two, 2-D modeling tools in developing a fundamental understanding of PIP flow dynamics and the expected performance. The modeling results showed that the PIP configuration offers improved flow diversion along with reduced flow velocity. Additionally, the PIP retained approximately 17% more (p<0.05) particles than the traditional pond with most of the particles concentrated within the inner pond. Lower velocity and the higher solids retention in the PIP thus allowed for better treatment performance compared to traditional ponds. The findings from this study can be used as preliminary data for future in-depth investigations of the PIP system leading toward effective and optimal designs. This will help address the major societal concern of water scarcity with low-cost and effective wastewater treatment.

In this article, the geometry of pseudoparallel, Ricci-generalized pseudoparallel and 2-Ricci-generalized pseudoparallel invariant submanifolds of an almost $\alpha$-cosymplectic $(\kappa,\mu,\nu)$ space has been searched under the some conditions. We also give some characterizations for such submanifolds. I think that obtained new results contribute to differential geometry.

Abstract. The purpose of this review is to investigate the nature of privacy concerns in the context of Smart Local Energy Systems (SLES) to understand how SLES providers can minimize both users’ concern, and cause for concern, around privacy. We conducted a rapid realist review and thematic framework analysis against Bronfrenbrenner’s socio-ecological model to understand privacy concerns in different contexts. A common privacy concern was that sharing detailed energy use data had the potential to reveal information about home life, and to intrude upon people’s sense of autonomy, choice and control. Evidence suggests that people are willing to accept newdata sharing technologies if the benefits of doing so are clear, anticipated, and mutually beneficial. Building trust, through increasing knowledge and understanding was a mechanism for overcoming privacy concerns, but this was mediated by the organization providing the information. Non-profit organizations were more trusted to ensure appropriate safeguards to privacy were in place. One key barrier to participation with good supporting evidence was that people can resist perceived intrusions on their privacy. This could be actively resisted by refusing to install data collection technologies or passively by non-participation in adapting energy use behaviors: both of which are necessary for SLES to achieve their goals of managing energy demand and building resilience in smart grids.

The urgent need to improve performance in the construction industry has led to the adoption of many innovative technologies. 3D laser scanners are amongst the leading technologies being used to capture and process assets or construction project data for use in various applications. Due to its nascent nature, many questions are still unanswered about 3D laser scanning, which in turn contribute to the slow adaptation of the technology. Some of these include the role of 3D laser scanners in capturing and processing raw construction project data. How accurate is the 3D laser scanner or point cloud data? How does laser scanning fit with other wider emerging technologies such as Building Information Modelling (BIM)? This study adopts a proof-of-concept approach, which in addition to answering the afore-mentioned questions, illustrates the application of the technology in practice. The study finds that the quality of the data, commonly referred to as point cloud data is still a major issue as it depends on the distance between the target object and 3D laser scanner’s station. Additionally, the quality of the data is still very dependent on data file sizes and the computational power of the processing machine. Lastly, the connection between laser scanning and BIM approaches is still weak as what can be done with a point cloud data model in a BIM environment is still very limited. The aforementioned findings reinforce existing views on the use of 3D laser scanners in capturing and processing construction project data.

Aims: Angiotensin-converting enzyme 2 (ACE2) plays an important role in the entry of coronaviruses into host cells. This paper described how carnosine, a naturally occurring supplement, can be an effective drug candidate for coronavirus disease (COVID-19) on the basis of molecular docking and modeling to host ACE2 co-crystallized with COVID-19 spike protein. Methods: First, the starting point was ACE2 inhibitors and their structure-activity relationship (SAR). Next, chemical similarity (or diversity) and PubMed searches made it possible to repurpose and assess approved or experimental drugs for COVID-19. In parallel, at all stages, authors performed bioactivity scoring to assess potential repurposed inhibitors at ACE2. Finally, investigators performed molecular docking and modeling of the identified drug candidate to host ACE2 co-crystallized with COVID-19 spike protein. Results: Carnosine emerged as the best known drug candidate to match ACE2 inhibitor structure. Preliminary docking was more optimal to ACE2 than the known typical angiotensin-converting enzyme 1 (ACE1) inhibitor (enalapril) and quite comparable to known or presumed ACE2 inhibitors. Viral spike protein elements binding to ACE2 were retained in the best carnosine pose in SwissDock at 1.75 Angstroms. Out of the three main areas of attachment expected to the co-crystallized protein structure, carnosine bind with higher affinity to two compared to the known ACE2 active site. LibDock score was 92.40 for site 3, 90.88 for site 1, and inside the active site 85.49. Conclusion: Carnosine has promising inhibitory interactions with host ACE2 co-crystallized with COVID-19 spike protein and hence could offer potential mitigating effect against current COVID-19 pandemic.

The regioselectivity in non-polar [3+2] cycloaddition (32CA) reactions has been studied within the Molecular Electron Density Theory (MEDT) at the B3LYP/6-311G(d,p) level. To this end, the 32CA reactions of nine simplest three-atom-components (TACs) with 2-methylpropane were selected. The electronic structure of the reagents has been characterised through the Electron Localisation Function (ELF) and the Conceptual DFT. The energy profiles of the two regioisomeric reaction paths and ELF of the transition state structures are studied to understand the origin of the regioselectivity in these 32CA reactions. This MEDT study permits to conclude that the least electronegative ends X1 atom of these TACs controls the asynchronicity in the C-X (X = C,N,O) single bond formation, and consequently, the regioselectivity. This behaviour is a consequence of the fact that the creation of the non-bonding electron density required for the formation of the new CX single bonds has a lesser energetic cost at the least electronegative X1 atom than that at the Z3 one.

Sun-Induced chlorophyll Fluorescence (SIF) relates directly to photosynthesis yield and stress but there are still uncertainties in its interpretation. Most of these uncertainties concern the influences of the emitting vegetation’s structure (e.g., leaf angles, leaf clumping) and biochemistry (e.g., chlorophyll content, other pigments) on the radiative transfer of fluorescent photons. The Caatinga is a large region at northeast Brazil of semiarid climate and heterogeneous vegetation, where such biochemical and structural characteristics can vary greatly even within a single hectare. With this study we aimed to characterize eleven years of SIF seasonal variation from Caatinga vegetation (2007 to 2017) and to study its responses to a major drought in 2012. Orbital SIF data from the instrument GOME-2 was used along with MODIS MAIAC EVI and NDVI. Environmental data included precipitation rate (TRMM), surface temperature (MODIS) and soil moisture (ESA CCI). To support the interpretation of SIF responses we have used red and far-red SIF adjusted by the Sun’s zenith angle (SIF-SZA) and by daily Photosynthetically Active Radiation (dSIF). Furthermore, we have also adjusted SIF through two contrasting formulations using NDVI data as proxy for structure and biochemistry, based on previous leaf-level and landscape level studies: SIF-Yield and SIF-Prod. Data was tested with time-series decomposition, rank correlation, spatial correlation and Linear Mixed Models (LMM). Results show that GOME-2 SIF and adjusted SIF formulations responded consistently to the observed environmental variation and showed a marked decrease in SIF emissions in response to a 2012 drought, that was generally larger than the corresponding NDVI and EVI decreases. Drought sensitivity of SIF, as inferred from LMM slopes, was correlated to land cover at different regions of the Caatinga. This is the first study to show correlation between landscape-level SIF and an emergent property of ecosystems (i.e., resilience), showcasing the value of remotely sensed fluorescence for ecological studies.

Anti-diabetic effects of Glycine soja seed extract (GS) on Type 2 diabetes mellitus mouse model and human hepatocytes induced insulin resistance were investigated. 3 weeks old db/db mice were divided into 5 groups (n = 6) including two control groups and 3 GS treated groups with different doses. Oral administration of GS for 6 weeks to diabetic db/db mice reduced blood glucose level significantly in a dose dependent manner by 44.7% (300 mg/kg/day), 30.9% (150 mg/kg/day) and 21.1% (75 mg/kg/day). GS treatment also lowered significantly plasma level of HbA1c, insulin, IGF-1 and leptin, and increased that of adiponectin. GS treatment activated AMPK, and down-regulated GLUT2 in liver tissues of mice while up-regulated GLUT4 in muscle tissues of mice. In in vitro study with insulin resistance induced human hepatocyte, GS treatment increased glucose uptake and increased the activities of Akt and PPAR-γ in response to insulin. Treatment of GS appears to reduce blood glucose level by regulating energy metabolism positively through various metabolic pathways and reducing insulin resistance in Type 2 diabetes mellitus.

Anti-diabetic effects of Glycine soja seed extract (GS) on Type 2 diabetes mellitus mouse model and human hepatocytes induced insulin resistance were investigated. 3 weeks old db/db mice were divided into 5 groups (n = 6) including two control groups and 3 GS treated groups with different doses. Oral administration of GS for 6 weeks to diabetic db/db mice reduced blood glucose level significantly in a dose dependent manner by 44.7% (300 mg/kg/day), 30.9% (150 mg/kg/day) and 21.1% (75 mg/kg/day). GS treatment also lowered significantly plasma level of HbA1c, insulin, IGF-1 and leptin, and increased that of adiponectin. GS treatment activated AMPK, and down-regulated GLUT2 in liver tissues of mice while up-regulated GLUT4 in muscle tissues of mice. In in vitro study with insulin resistance induced human hepatocyte, GS treatment increased glucose uptake and increased the activities of Akt and PPAR-γ in response to insulin. Treatment of GS appears to reduce blood glucose level by regulating energy metabolism positively through various metabolic pathways and reducing insulin resistance in Type 2 diabetes mellitus.

Western Anatolia comprises a vast amount of various volcanic successions spanning from Eocene to Upper Miocene periods. These units mainly display southward younging in broad sense and display large amounts of chemical variation that spanned from basalt to rhyolite. The southward younging of magmatism and chemical variations have been largely attributed to the retreat and roll-back of the Hellenic slab and the western escape of the Anatolian microplate. However, there is still a lack of high precision data to pinpoint the exact nature of the magmatism and lithospheric tectonics. In this contribution we investigated a poorly known region along the Western Anatolia along Manisa district called Karakılıçlı volcanic field. We investigated two different volcanic sections (Kalpakkaya and Çamlık hill) that display the best volcano-sedimentary features in terms of geochronology and geochemistry. Samples acquired from the bottom, middle and upper portions of these sections display Early-Middle Miocene ages of 17.64±0.20, 17.22±0.15, 16.16±0.17 and 16.36±0.13, 15.79±0.71 and 13.61±0.20 Ma respectively. The results indicate that the volcanism in the region generated by the melting of the mantle and/or lithospheric mantle by slab retreat and roll-back of the Hellenic slab and evolved in the shallow magma chambers/mushes by fractional crystallization, magma mixing and crustal assimilation.

In this paper, a solenoid based linearly movable armature system is designed using robust control theory in order to improve the performance of the system. Reference track method is the best performance analysis for position control systems. Among the robust controllers, H infinity mixed-sensitivity and Mixed H 2 /H∞ with Regional Pole Placement Controllers are used to improve the performance of the system. Comparison of the proposed controllers for tracking a reference displacement signals (step and sine wave) and a promising simulation result have been obtained.

Water quality retrieval for small urban waterbodies by remote sensing get used to be difficult due to coarse spatial resolution of the remote sensing imagery. The recently launched Sentinel-2 produces imagery with a spatial resolution of 10 m. It provides an opportunity to solve the problem of retrieving water quality for small waterbodies. Additionally, many water management issues also require fine resolution of imagery, e.g. illegal discharge to an urban waterbody. Since illegal discharges are an important issue for urban water management, chemical oxygen demand (COD), total phosphorous (TP), and total nitrogen (TN) were chosen as the target parameters for water quality retrieval in this study. COD, TP and TN, however, are non-optically active parameters. There were limited studies in the past to retrieve these parameters in comparison with optically active parameters, e.g. Chlorophyll-A etc. This study compared three machine learning models, namely Random Forest (RF), Support Vector Regression (SVR), and Neural Networks (NN), to investigate the opportunity to retrieve the above non-optically active parameters. Results showed that R² of TP, TN, and COD by NN, RF and SVR were 0.94, 0.88, and 0.86, respectively. The performances of water quality retrieval for these non-optically active parameters were significantly improved by the optimized machine learning models. These models hence solved the problem to use remote sensing data to retrieve these non-optically active water quality parameters and provided a new monitoring strategy for small waterbodies. Water quality mapping obtained by Sentinel-2 imagery provided a full spatial coverage of the water quality characterization for the entire water surface. Compared with water samples collecting and testing, it greatly reduced labor cost, reagents cost, and waste treatment cost. It also may help identify illegal discharges to urban waterbodies. The method developed in this research provides a new practical and efficient water quality monitoring strategy in managing water with consideration of environmental sustainability.

The transnational spread of coronavirus (2019-nCoV) first detected in Wuhan is causing global panic; thus, accelerated research into clinical intervention is of high necessity. The spike glycoprotein structure has been resolved, and its affinity to human angiotensin-converting enzyme 2 (ACE-2) has been experimentally validated. Here, using computational methods, a metastable conformation of 2019-nCoV-RBD/ACE-2 complex has been revealed and FDA-database of approved drugs have been docked into the interface. Darunavir has been discovered as high ligand affinity candidate capable of disrupting communication between 2019-nCoV-RBD and ACE-2. Darunavir, in addition to its previously known anti-HIV protease inhibitor is now repurposeable for the treatment 2019-nCoV disease acting via disruption of cellular recognition, binding and invasion.

A new compound containing a triene, a tetrahydropyran ring and glycine ester functionalities, restricticin B (1), together with four known compounds (2-5) were obtained from the EtOAc extract of the marine fungus Penicillium janthinellum. The planar structure of 1 was determined by detailed analyses of MS, 1D and 2D NMR data. The relative and absolute configurations of 1 were established via analyses of NOESY spectroscopy data, comparison of optical rotation values with those of restricticin derivatives reported and electronic circular dichroism (ECD). All the compounds were screened for their anti-neuroinflammatory effects in lipopolysaccharide (LPS)-induced BV-2 microglia cells. Restricticin B (1) and N-acetyl restricticin (2) exhibited anti-neuroinflammatory effects by suppressing the production of pro-inflammatory mediators in activated microglial cells.

Iron and zinc are essential micronutrients required for growth and health. Deficiencies of these nutrients are highly prevalent among populations, but can be alleviated by supplementation. Cross-sectional studies in humans showed positive association of serum zinc levels with hemoglobin and markers of iron status. Dietary restriction of zinc or intestinal specific conditional knock out of ZIP4 (SLC39A4), an intestinal zinc transporter, in experimental animals demonstrated iron deficiency anemia and tissue iron accumulation. Similarly increased iron accumulation has been observed in cultured cells exposed to zinc deficient media. These results together suggest a potential role of zinc in modulating whole body iron metabolism. Studies in intestinal cell culture models demonstrate that zinc induces iron uptake and transcellular transport via induction of divalent metal iron transporter-1 (DMT1) and ferroportin (FPN) expression, respectively. It is interesting to note that intestinal cells are exposed to very high levels of zinc through pancreatic secretions, which is a major route of zinc excretion from the body. Therefore, zinc appears to be modulating the iron metabolism possibly via regulating the DMT1 and FPN1 levels. Herein we critically reviewed the available evidence to hypothesize novel mechanism of Zinc-DMT1/FPN axis in regulating intestinal iron absorption and tissue iron accumulation to facilitate future research aimed at understanding the yet elusive mechanisms of iron and zinc interactions.

The NA61/SHINE experiment studies hadron production in hadron-hadron, hadron-nucleus and nucleus-nucleus collisions. The physics programme includes the study of the onset of deconfinement and search for the critical point as well as reference measurements for neutrino and cosmic ray experiments. For strong interactions, future plans are to extend the programme of study of the onset of deconfinement by measurements of open-charm and possibly other short-lived, exotic particle production in nucleus-nucleus collisions. This new programme is planned to start after 2020 and requires upgrades to the present NA61/SHINE detector setup. Besides the construction of a large acceptance silicon detector, a 10-fold increase of the event recording rate is foreseen, which will necessitate a general upgrade of most detectors.

The Biginelli reaction is a highly versatile reaction, which leads to dihydropyrimidinones/thiones. This scaffold is reported as being a privileged structure due to its ability to interact with biological targets. Synthesis of ethyl 4-(2-fluorophenyl)-6-methyl-2-thioxo-1-(p-tolyl)-1,2,3,4-tetrahydropyrimidine-5-carboxylate was achieved through the Biginelli reaction using a functionalized thiourea. In silico studies demonstrated that the compound title showed good potential for interacting with ecto-5’-nucleotidase, which has been considered as a target in designs for anti-cancer drugs.

(RADA)4 nanoscaffolds are excellent candidates for use as peptide delivery vehicles: they are relatively easy to synthesize with custom bio-functionality, and assemble in situ to allow a focal point of release. This enables (RADA)4 to be utilized in multiple release strategies by embedding a variety of bioactive molecules in an all-in-one ‘construct’. One novel strategy focuses on the local, on-demand release of peptides triggered via proteolysis of tethered peptide sequences. However, the spatial-temporal morphology of self-assembling nanoscaffolds may greatly influence the ability for enzymes to both diffuse into as well as actively cleave substrates. Fine structure and its impact on overall affect on peptide release is poorly understood. In addition, fractal networks observed in nanoscaffolds are linked to the fractal nature of diffusion in these systems. Therefore, matrix morphology and fractal dimension of virgin (RADA)4 and mixtures of (RADA)4 and matrix metalloproteinase 2 (MMP-2) cleavable substrate modified (RADA)4 were characterized over time. Sites of high (GPQG+IASQ, CP1) and low (GPQG+PAGQ, CP2) cleavage activity were chosen. Fine structure was visualized using established according to established methods. After 2 hrs of incubation, nanofiber networks showed an established fractal nature, however nanofibers continued to bundle in all cases as incubation times increased. It was observed that despite extensive nanofiber bundling after 24 hrs of incubation time, the CP1 and CP2 nanoscaffolds were susceptible to MMP-2 cleavage. The properties of these engineered nanoscaffolds characterized herein illustrate that they are an excellent candidate as an enzymatically initiated peptide delivery platform.

In the recent past about 40 botulinum neurotoxin (BoNT) subtypes belonging to serotypes A, B, E, and F pathogenic to humans were identified among hundreds of independent isolates. BoNTs are the etiological factors of botulism and represent potential bioweapons, but are also recognized pharmaceuticals for efficient counteraction of hyperactive nerve terminals in a variety of human diseases. The detailed biochemical characterization of subtypes as the basis for development of suitable countermeasures and possible novel therapeutic applications is lagging behind the increase in new subtypes. Here we report the primary structure of a ninth subtype of BoNT/F. Its amino acid sequence diverges by at least 8.4% at the holotoxin and 13.4% on the enzymatic domain level from all other known BoNT/F subtypes. We found that BoNT/F9 shares the scissile Q⁵⁸/K⁵⁹ bond in its substrate vesicle associated membrane protein 2 with the prototype BoNT/F1. Comparative biochemical analyses of four BoNT/F enzymatic domains showed that the catalytic efficiencies decrease in the order F1 > F7 > F9 > F6 and vary by up to factor eight. K_M values increase in the order F1 > F9 > F6 ≈ F7, whereas k_cat decreases in the order F7 > F1 > F9 > F6. Comparative substrate scanning mutagenesis studies revealed a unique pattern of crucial substrate residues for each subtype. Based upon structural coordinates of F1 bound to an inhibitor polypeptide the mutational analyses suggest different substrate interactions in the substrate binding channel of each subtype.

The considerable biological and medicinal activities of pyridazines has stimulated considerable research on efficient syntheses of these derivatives. In the last decade, microwave irradiation has generally been used for the energy source. As demonstrated in recent studies, pressure reactor “Q-tubes” may be used to accelerate several of these reactions in a more optimal and safer manner (compared to microwaves). In these studies there has been postulated a pathway for the formation of pyridazino[5,4,3-de][1,6]naphthyridine derivatives . In this paper we consider this pathway, and an alternate pathway, for several reactions. Contrary to the suggestion in these studies the pathway in which initial dimerization of malononitrile was postulated could be excluded based on chemical evidence. The reactions performed were the reaction of arylhydrazonals 1a,b with benzylidinemalononitrile which afforded in Q-tube the 3-acyl-4-aryl-1-phenyl-6-amino-1,4-dihydropyridazines, and the reaction of arylhydrazonals 1a,b, malononitrile 9 and aromatic aldehydes 10a-g in Q-tubes which afforded the tricyclic systems 12a-n whose structure could be established by X-ray crystal structure determination. In conclusion, we have added to the work of the recent studies by excluding a reaction pathway for one of their reaction products.

Abstract Background: Diabetes mellitus is dramatically increasing in the wide world. The managing of diabetes care emphasized the self-management education and support into patients’ care and family care. Objective: to review and synthesizes the effectiveness of DSME strategies involving family as a key person to provide social support for diabetes mellitus self-management of glycemic uncontrolled patients Method: Three databases through PubMed, CINAHL, and Scopus were reviewed to assess the relevant articles. The following search terms: “type 2 diabetes,” “self-management,” “family support,” and “glycemic uncontrolled.” We summarized details of family support on self-management among glycemic uncontrolled patients for 14 existing studies. Results: A total of 22 intervention studies were identified. Those studies have a heterogeneous of the education strategies, support perceived, follow-ups strategies and outcomes among type 2 DM. Family integration on diabetes self-management education (DSME) has a positive impact on several outcomes including, self-care behaviors, psychological outcomes, self-efficacy and clinical outcomes Conclusions: This systematic review found robust data related to the integration of family support on diabetes self-management among glycemic uncontrolled patients. Consequently, the improvement in outcomes was identified. Implications: The findings suggest model of family engagement is better and needed for sustaining the diabetes care in the long-term care

Glacier dynamics play an important role in the mass balance of many glaciers, ice caps and ice sheets. In this study we exploit Radarsat-2 (RS-2) Wide Fine (WF) data to determine the surface speed of Svalbard glaciers in the winters of 2012/2013 and 2013/2014 using Synthetic Aperture RADAR (SAR) offset and speckle tracking. The RS-2 WF mode combines the advantages of the large spatial coverage of the Wide mode (150 x 150 km) and the high pixel resolution (9m) of the Fine mode and thus has a major potential for glacier velocity monitoring from space through offset and speckle tracking. Faster flowing glaciers (1.95 m d^-1 - 2.55 m d^-1) which are studied in detail are Nathorstbreen, Kronebreen, Kongsbreen and Monacobreen. Using our Radarsat-2 WF dataset, we compare the performance of two SAR tracking algorithms, namely the GAMMA Remote Sensing Software and a custom written MATLAB script (GRAY method) that has primarily been used in the Canadian Arctic. Both algorithms provide comparable results, especially for the faster flowing glaciers and the termini of slower tidewater glaciers. A comparison of the WF data to RS-2 Ultrafine and Wide mode data reveals the superiority of RS-2 WF data over the Wide mode data.

Mitochondrial pyruvate dehydrogenase complex (PDHC) is essential for the brain glucose and neurotransmitter metabolism, dysregulated in many pathologies. Using specific inhibitors of PDHC in vivo, we determine biochemical and physiological responses to PDHC dysfunction. Dose dependence of the responses to membrane-permeable dimethyl acetylphosphonate (Ac-PMe2) is non-monotonous. Primary decreases in glutathione and its redox potential, methionine and ethanolamine are alleviated with increasing PDHC inhibition, the alleviation accompanied by physiological changes. Comparison of 39 brain biochemical parameters after administration of four phosphinate and phosphonate analogs of pyruvate at a fixed dose of 0.1 mmol/kg reveals no primary, but the secondary changes, such as activation of 2-oxoglutarate dehydrogenase complex (OGDHC) and decreased levels of glutamate, isoleucine and leucine. The accompanying decreases in RMSSD of ECG and freezing time are most pronounced after administration of me-thyl acetylphosphinate and dimethyl acetylphosphonate. The levels of PDHA1 expression and phosphorylation, sirtuin 3 and total protein acetylation are not significantly changed by the PDHC inhibitors that affect the brain protein succinylation and glutarylation. Thus, decreased production of the tricarboxylic acid cycle substrate acetyl-CoA by inhibited PDHC is compen-sated by increased degradation of amino acids through the cycle with activated OGDHC, increas-ing total protein succinylation and decreasing anxiety indicators.

In the present work, we investigate the possibility that long-range airborne transport of infectious aerosols could initiate an epidemic outbreak at distances downwind beyond one hundred kilometers. For this, we have developed a simple atmospheric transport box-model which, for a hypothetical case of a COVID-19 outbreak, was compared to a more sophisticated 3-dimensional transport-dispersion model (HYSPLIT) calculation. Coupled with an extended Wells-Riley description of infection airborne spread, it shows that, the very low probability of outdoor transmission can be compensated by high numbers and densities, such as occurs in large cities, of infected and susceptible people in the source upwind and in the target downwind respectively. This may result in the creation of a few primary cases. It is worth pointing out that the probability of being infected remains very small at the individual level. Therefore, this process alone, which depends on population sizes, geography, seasonality and meteorology, can only “trigger” an epidemic which could then spread by the standard infection routes

Epithelial characteristics underlying the differential susceptibility of chronic asthma to SARS-CoV-2 (COVID-19) and other viral infections are currently unclear. By revisiting transcriptomic data from patients with Th2 low versus Th2 high asthma, as well as mild, moderate and severe asthmatics, we characterized the changes in expression of human coronavirus and influenza viral entry genes relative to sex, airway location and disease endotype. We found sexual dimorphism in expression of COVID-19 genes ACE2, TMPRSS2, TMPRSS4, and SLC6A19. ACE2 receptor downregulation occurred specifically in females in Th2 high asthma, while proteases broadly assisting coronavirus and influenza viral entry, TMPRSS2 and TMPRSS4, were highly upregulated in both sexes. Overall, changes in COVID-19 gene expression were specific to Th2 high molecular endotype of asthma, and different by asthma severity and airway location. The downregulation of ACE2 (COVID-19, SARS) and ANPEP (HCoV-229E) viral receptors correlated with loss of club and ciliated cells in Th2 high asthma, while the increase in DPP4 (MERS-CoV), ST3GAL4, and ST6GAL1 (influenza) associated with an increase in goblet and basal activated cells. Overall, this study elucidates sex, airway location, disease endotype and changes in epithelial heterogeneity as factors underlying asthmatic susceptibility, or lack thereof, to COVID-19.

late in December 2019 2019-nCoV was identified as the pathogen responsible for an outbreak of severe respiratory distress in Wuhan, China. The virus was detected in multiple countries during January, but it is believed widespread community transmission began late in February or early March. Since March the virus has caused over 100k confirmed deaths in the US, with some states more severely impacted, notably NY and NJ. Here I examine excess mortality at the national and state level from January through July 2020. I find that the increase in excess mortality began in late February, suggesting the pathogen was circulating undetected earlier than assumed. The timing and intensity of the increase in excess mortality varied across states, with two patterns emerging: an early, sharp increase reaching a peak during April-May, best exemplified by NY and NJ, and a shallower, sustained increase, reaching a peak in late July, observed mostly in the southern regions of the US.

Neuroinflammation, defined as inflammatory reactions mediated by cytokines, chemokines, reactive oxygen species, and secondary messengers in the central nervous system (CNS) including the brain and spinal cord is the basis of many neurological disorders. Recently, erythropoietin (EPO) has been considered and studied as a modulator of neuroinflammation. On this article minireview of pathophysiology of neuroinflammation and the neuroprotective effects of EPO is discussed and a case of subacute huge subdural hematoma with double mydriasis operated urgently, treated with low daily dose (vs high dose once or twice a month in the literature) of EPO and recovered fully and discharged home with good consciousness is reported. In addition, the probable unfavorable outcome of erythropoietin administration in patients with neuroinflammation in COVID-19 is considered.

Diabetes mellitus – type 2 (DM2) is a hypercoaguable state with enhanced platelets (PLTs) activation and increased clotting factor production. Simultaneously, the fibrinolytic cell system is inhibited due to formation of clots with high resistance to fibrinolysis. The stages of PLTs "activation" have been well-characterized microscopically, morphometrically and nanomechanically (by light microscope, transmisiion electron microscope - TEM, scanning electron microscope - SEM and atomic force microscope - AFM). Thrombocytes in "acivated" (pro-coagulant) state play central role in two main biological processes: hemostasis and repair of vascular vessels. Pro-coagulant PLTs participate in generation of thrombin and in development of fibrin fibers in the clot matrix. Enhanced PLTs reactivity in dibetic- (diabetes mellitus - DM2) patients is considered as a "pro-thrombotic" state. In the retrospective- and prospective- studies on the topic, the higher are the PLTs' hematometrical indices: PLTs (count), MPV (mean platelet volume), PDW (platelet distribution width), PCR (plateletcrit), as well as PLTs/Ly ratio. The PLТs parameters/indices are usefull biomarkers in early diagnosis and prognosis of DM2. The precise studies of PLTs' state of activation during DM2 might be useful for creation of new diabetes (DM2) treatment strategies and effective medicines. Using the amount of blood glucose, attached to hemoglobin (HbA1c values) as markers of glycemic control in diabetic patients, researchers have observed association between MPV and medications as Insulin, Metformin, sulphonyl ureas. Computational modellng of PLTs' activation in DM2 is also a controlling factor for thrombocyte distribution and margination in bood vessels, associated with micro- and macrovascular disease in DM2. PLTs-derived miRNAs are novel molecular biomarkers for diagnosis and prognosis of DM2, insulin resistance and diabetes complications. We have proposed (2010) oleic acid (OA) as a substance suppressing "PLT hyperactivation" and inhibiting “thrombocyte aggregation”. Antiplatelet agents, natural plant products including, could be effective in the prevention and the secondary treatment of micro- and macrovascular complications in the type 2 Diabetes mellitus. Our proposal on following up of a combination of hematological-, hemorheological- and hemostatic parameters (indices) as a new way in diagnosis, treatment, predicting and management of DM2 and its related vascular complications, probably could be more explored in future studies.

With the aim to produce new heterocycle molecules, the previously reported 2-(aminomethyl)-2-(4-chlorophenyl)-2,3-dihydroquinazolin-4(1H)-one was converted efficiently by reacting with N,N’-dithiocarbonyldiimidazole (DTCI), to produce the substituted imidazolidine-2-thione moiety inserted in a three fused ring scaffold of the title compound. The molecular composition was confirmed by a high-resolution MS experiment, and its structure was elucidated by 1H, 13CNMR, and IR analyses. The thioacetamide form of the product was supported by density functional theory (DFT)-NMR analysis where 13C chemical shifts of thioacetamide form and of its iminothiol tautomer were calculated in chloroform at the BP86 /Jgauss-TZP2 level of theory. The very good linear correlation between 13C chemical shifts by experiment and by calculation for the NHC=S form confirmed the structure.

Recent advancements in communication technology have catalyzed the widespread adoption of realistic content, with augmented reality (AR) emerging as a pivotal tool for seamlessly inte-grating virtual elements into real-world environments. In construction, architecture, and urban design, the integration of mixed reality (MR) technology enables rapid interior spatial mapping, providing clients with immersive experiences to envision their desires. The rapid advancement of MR devices, or devices that integrate MR capabilities, offers users numerous opportunities for enhanced entertainment experiences. However, to support designers at a high level of expertise, it is crucial to ensure the accuracy and reliability of the data provided by these devices. This study explores the potential of utilizing spatial mapping within various methodologies for surveying architectural interiors. The objective is to identify optimized spatial mapping procedures and determine the most effective applications for their use. Experiments were conducted to evaluate the interior survey performance, using HoloLens 2, iPhone 13 Pro for spatial mapping, and photogrammetry. The findings indicate that HoloLens 2 is most well-suited for the tasks exam-ined in the scope of experiments. Nonetheless, based on the acquired parameters, the author also proposes approaches to apply the other technologies in specific real-world scenarios.

Predicting type 2 diabetes mellitus (T2DM) using phenotypic data with machine learning (ML) techniques has received significant attention in recent years. PyCaret, an ML tool that enables the simultaneous application of 16 different algorithms, was used to predict T2DM using phenotypic variables from the “Nurses’ Health Study” and “Health Professionals’ Follow-up Study” datasets. Ridge classifier, Linear Discriminant Analysis, and Logistic Regression (LR) were the best-performing models for the male-only data subset. For the female-only data subset, LR, Gra-dient Boosting Classifier, and CatBoost Classifier were the strongest models. The AUC, accuracy, and precision were 0.77, 0.70, and 0.70 for males and 0.79, 0.70, and 0.71 for females, respective-ly. The feature importance plot showed that familial history of diabetes (famdb), never having smoked, and high blood pressure (hbp) were the most influential features in females, while famdb, hbp, and current smoking were the major variables in males. In conclusion, PyCaret was used successfully for speed analysis for the prediction of T2DM by simplifying complex ML tasks. Gen-der differences are an important consideration for T2DM prediction. Despite this comprehensive ML tool, phenotypic variables alone may not be sufficient for early T2DM prediction; genotypic variables could also be used in combination for future studies.

Epigallocatechin gallate (EGCG), the principal catechin in green tea, exhibits diverse therapeutic properties. However, its clinical efficacy is hindered by poor stability and low bioavailability. This study investigated solid particle-in-oil-in-water (S/O/W) emulsions stabilized by whey protein isolate (WPI) and sodium caseinate (NaCas) as carriers to enhance the bioavailability and intestinal absorption of EGCG. Molecular docking revealed binding interactions between EGCG and these macromolecules. The emulsions exhibited high encapsulation efficiencies and augmented EGCG bioaccessibility by 64% compared to free EGCG in a simulated gastrointestinal digestion model. EGCG-loaded emulsions demonstrated minimal cytotoxicity towards Caco-2 cells and facilitated EGCG transport across the intestinal epithelial layer without compromising tight junction integrity. Notably, EGCG-loaded emulsions protected Caco-2 cells against oxidative stress by suppressing intracellular reactive oxygen species generation. The results demonstrate the potential of WPI- and NaCas-stabilized S/O/W emulsions to enhance the bioavailability, intestinal absorption, and bioactivity of EGCG, expanding its applications in functional foods and nutraceuticals.

Flexible polymer-based dye-sensitized solar cells (DSSCs) offer promising potential for lightweight, cost-effective and versatile photovoltaic applications. However, the critical challenge in their widespread applications is the weak thermal stability of the majority of polymeric substrates, which can only withstand a maximum temperature processing of 150°C. In this study, we propose a facile and low-cost strategy to develop at low temperature DSSC flexible photoanode based on a polymeric matrix. Highly porous nanocomposites fibrous mats composed of polyethylene terephthalate (PET) and titanium dioxide (TiO2) nanobars were prepared through electrospinning process using different configurations (uniaxial electrospinning, coaxial electrospinning, and electrospray-assisted electrospinning). These techniques enabled precise control of the microstructure and the positioning of TiO2 within the composite nanofibers. Therefore, the as-produced photoanodes were loaded with N719 dye and tested in DSSC prototype using iodide-triiodide electrolyte and platinum (Pt) coated counter electrode. The results show that incorporating TiO2 on the fiber surface through the electrospray-assisted electrospinning enhanced the performance of the nanofiber composite, leading to improved dye loading capacity, electron transfer efficiency and photovoltaic performance.

The study conducts a comparative analysis of solar radiation estimation methods, assessing the efficacy of the Heliosat-2 algorithm against ground measurements across seven distinct countries: Netherlands, Spain, Japan, Namibia, South Africa, Saudi Arabia, and India. To achieve this, it utilizes two distinct satellite data sources—Himawari-8 for Japan and Metosat Second Generation-MSG for the rest of the countries—spanning the years Jan 2022 to April 2024. A robust methodology for determining albedo parameters specific to Heliosat-2 was developed. During cloudy days, the estimates provided by Heliosat-2 generally exceeded the ground measurements in all the countries. Conversely, on clear days, there was a tendency for underestimation, as indicated by the median value of the mean bias (MB) across most of the countries. The Heliosat-2 model slightly underestimates daily radiation values, with a median MB ranging from −27.5 to +10.2 W.m⁻². Notably, the median root mean squared error (RMSE) on clear days is significantly lower, with values ranging from 24.8 to 108.7 W.m⁻², compared to cloudy days where RMSE values lie between 75.3 and 180.2 W.m⁻². In terms of R² values, both satellites show a strong correlation between the estimated and actual values, with a median value consistently above 0.86 on a monthly scale and over 92% of daily data points falling within ±2 standard deviation.

A two-qubit Hamiltonian model exhibiting an SU(2) symmetry is considered. The related dynamical problem results to be then exactly solvable both in the time-independent and in the time-dependent case. Basing on the formal, general form of the related time evolution operator, the time-dependence of the level of entanglement of some initial conditions is studied within both the Rabi and the Landau-Majorana-Stückelber-Zener scenarios.

Metabolic syndrome (MS), a complex pathology with features like abnormal body fat distribution, insulin resistance, and dyslipidaemia, contributes to higher cardiovascular (CV) risk. A cross-sectional study including 87 individuals, assessed CV risk in elderly patients with type 2 diabetes and MS in Algarve, Portugal. The 10-year CV risk was estimated using the ADVANCE risk score calculator. The reductions in CV risk were estimated by adjusting the data inputted on the online tool to achieve systolic blood pressure (SBP) <130 or <120 mmHg, and LDL-cholesterol <70 mg/dL. Beyond waist circumference, the mean number of clinical features of MS was 3.14±0.84, without significant sex differences. The mean CV risk was 22.5% (CI: 20.3-24.7). Sex-specific analysis showed higher risk in males (24.2%, CI: 21.3-27.0) vs. females (19.7%, CI: 16.2-23.3; p=0.028). Hypothetical risk reductions show that lowering SBP to <130 mmHg could significantly lower the risk by an average of 9.2% (CI: 7.7-10.7), whereas 34.5% of the participants would be out of the diagnostic criteria for MS. When comparing each potential intervention with current risk, all interventions significantly reduce the 10-years CV risk. The study highlights the potential of blood pressure control in reducing CV risk and the importance of multifaceted risk reduction strategies.

Membrane gas absorption technology has been considered as a promising approach to mitigate CO2 emissions from power plants. The aim of this study is to evaluate the environmental impacts of CO2 absorption and desorption processes by hollow fiber membrane contactors using life cycle assessment methodology. On the basis of ReCipe 2016 Midpoint and ReCipe 2016 Endpoint methods, the research results show that, membrane gas absorption system exhibits the lowest environmental impacts across the majority assessed categories in comparison with chemical absorption and membrane gas separation systems. The CO2 capture process via membrane gas absorption has the most significant impact on METP category, with heat consumption as the primary contributing factor accounting for 55%, followed by electricity consumption accounting for 43.1%. According to the sensitivity analysis, heating by natural gas shows a better performance than other heat supply sources in improving overall environmental impacts. In addition, the increasing utilization of renewable energy in electricity supply reduces the global warming potential, fossil resource consumption and ozone formation.

Background and Objectives: To investigate the relationship between the SII index and the micro-macro complications and death that develop in the first year and the following 3 years, following the calculation of the index in type 2 diabetic retinopathy patients. Materials and Methods: This study was performed retrospectively with 523 type 2 diabetic retinopathy patients admitted to the endocrinology outpatient clinic of our hospital between January 2019 and December 2019. The demographic, and clinical characteristics of the patients were evaluated using descriptive statistics. Shapiro-Wilk test was used for the normal distribution of quantitative data; Mann-Whitney U, Mc Nemar Chi-square, and Cochran's Q tests were used to analyze SII values between groups and complication rates by years; sensitivity and specificity were determined by ROC analysis and considered statistically significant with a significance level of P

Reservoirs created by damming rivers significantly modify the environment and problems may arise: the storage of nutrients and organic matter in reservoirs often leads to decreased water quality due to eutrophication. Reservoirs built on lowland rivers are exposed to significant nutrient loads, often leading to eutrophication. In this article, the Sulejów Reservoir, in Central Poland, was the subject of the research, which focused on the use of Sentinel-2 remote sensing data to detect phytoplankton blooms, and on understanding the pattern of wind-driven surface currents using the CCHE2D model (a depth-averaged hydrodynamic model). The calculation of the total phosphorus load has shown that the reservoir mainly acts as nutrient storage. Still, during the low flow and intensive phytoplankton bloom, it can be a source of nutrients. The distribution of phytoplankton bloom on the Sulejów Reservoir was documented using eight Sentinel-2 satellite images from the vegetation season of 2020 and the Normalized Difference Chlorophyll Index (NDCl). Coupling remote sensing data and numerical modelling helps to interpret the hydrodynamic model results and understand nutrients and sediment dynamics within the reservoir. Hydrodynamic modelling combined with remote sensing data can be a valuable tool for selecting appropriate locations for water quality measurements at monitoring stations.

(1) Background: Among the chronic complications of type 2 diabetes mellitus, cancer became the leading cause of death in several countries. Our objective was the determination of whether prevalent type 2 diabetes mellitus is associated with a higher incidence of cancer. (2) Methods: This study is a nationwide analysis performed in Hungary. Study population was divided into a group with type 2 diabetes mellitus and into a non-diabetic group. The primary outcome was the risk related to overall cancer incidence. A key secondary outcome was the overall incidence of cancer in distinct study years. Further outcomes were the annual percent changes. (3) Results: The odds ratio related to the overall incidence of cancer was 2.50 (95% confidence interval: 2.46-2.55, P&lt;0.0001) in patients with diabetes as related to controls. The odds ratio was higher in males than in females. The highest risk was found in the 18-39-year-old subgroup. The annual cancer incidence rate declined in controls, but not in patients with diabetes. Several types of cancer showed a decreasing tendency in non-diabetic controls.; (4) Conclusions: type 2 diabetes is associated with a higher risk of cancer. High risk in young patients with type 2 diabetes suggests that these young individuals should be considered as a risk group.

The aim of this study was to determine the microbial stability, challenge to L. monocytogenes, and some physicochemical properties of turkey breast meat by alginate-based coating enriched with postbiotics (8% concentration, CFS) of Bifidobacterium bifidum DSM 20456 and Bifidobacterium bifidum BB12 strains. For this purpose, firstly, some antimicrobial and total phenolic matter, flavonoid, and DPPH activity values of postbiotics were determined. In addition, FTIR analysis was performed to see the intermolecular interactions of the biological coating agent. As a result of the study, alginate solution with postbiotic showed significant differences in pH, a*, b*, yeast-mold values of turkey meat during storage (7 days), while L* value, total aerobic mesophilic bacteria count (TMAP), psychrotrophic bacteria (PAB), lactic acid bacteria (LAB) and Listeria monocytogenes count were not effective (p&gt;0.05).

(1) Background: The aim of study was to investigate the salt consumption by children and adolescents from the Silesian Province (Poland), taking into account the region’s dietary traditions and number of years of school education. (2) Methods : 300 students aged 10–18 from different types of schools, were enrolled in the study and divided into groups in terms of: school, sex, the state of nutrition. The survey questionnaire about dietary habits, including the frequency and serving size with respect to 12 salty products was used. On the basis of the frequency and the amount of consumed products, as well as the data on salt content, the amount of total daily intake of salt was estimated.; (3) Results: The mean daily intake of salt by children and adolescents was 1.083 g ( 0.433 g of sodium); children aged 10–12 consumed the highest amount of salt (1.296 g/day) compared to pupils aged 13–15 (1.131 g of sodium) and adolescents aged 16–18 (0.863 g/day); (4) Conclusions: With age, as a result of various factors, the consumption of salt declines. The parents impact and the familial socio-environmental factors begin to wane, and other factors start to have influence, e.g. school education of healthy lifestyle, health behavior of peers.

Abstract Background: Metabolic syndrome (MetS) is a complex disorder characterized by insulin resistance (IR), central obesity, atherogenic dyslipidemia and higher glucose levels. It increases the risk of cardiovascular disease (CVD) and type 2 diabetes mellitus (T2DM), imposing an economic burden on the healthcare system. However, the historical origins of MetS as well as the development and evolution of its definitions have not been conclusively documented in the literature. Aim: This study seeks to enhance the understanding of the developmental trends of MetS during the preceding two decades, placing particular emphasis on the definition, diagnosis and prevalence. Methods: An extensive search was performed from 1920 to 2023 across prominent scientific research engines, including Scopus, PubMed, MDPI, and others. Results: Despite advancements, many aspects of MetS remain inadequately understood. As the understanding of the nature and pathophysiology of MetS progresses, the development and refinement of its diagnostic criteria, and assessment and treatment guidelines will continue. Additionally, there exists significant variation in the global prevalence of metabolic syndrome, ranging from 14 to 39%. This prevalence is projected to increase due to the adoption of less healthy dietary patterns and sedentary lifestyles. The observed disparities in metabolic syndrome prevalence can be attributed to multiple factors, including demographic characteristics. Furthermore, the lack of a standardized definition across studies also contributes to the variation in reported prevalence rates. Conclusion: Further studies focusing on the standardization of the MetS definition across different research are crucial. The establishment of consistent criteria would enhance the reliability and validity of research findings, enabling more meaningful comparisons and interpretations.

The APIS Breast Cancer Subtyping Kit is an mRNA-based assessment of the three biomarkers routinely assessed in all newly diagnosed breast cancers (BC), estrogen receptor (ER), progesterone receptor (PR), and HER2 as well as an additional four genes that create a novel proliferation signature, MKI67, PCNA, CCNA2, KIF23. Taken together the data is used to produce a molecular sub-type for every sample. The kit was evaluated against the current standard protocol of immunohistochemistry (IHC) and/or in situ hybridization (ISH) in breast cancer patients. The data was presented at the weekly breast Multidisciplinary Team (MDT) meeting. 98 consecutive cases of pre-operative breast cancer core biopsies and two core biopsy of nodal metastases yielding 100 cases were assessed. IHC and APIS Results were available for 100 and 99 cases. ER was concordant in 97% cases, PR in 89% and HER2 results were concordant with IHC/ISH in 100% of the cases. Ki-67 IHC was discordant in 3% cases when compared with MK167 alone but discordant in 24% when compared with the four gene proliferation signature. In conclusion, our study, indicates that the APIS Breast Cancer Subtyping Kit is highly concordant when compared to the results produced for ER/PR/HER2 by IHC and/or ISH. The assay could play a role in the routine assessment of newly diagnoses Breast Cancer (BC) specimens.

Keywords: Spine surgery 1; Metastatic spinal cord compression 2; Spinal metastasis 3; Cancer treatment.

Results showed that mulberry leaves could significantly reduce backfat thickness (P&lt;0.05) and increase intramuscular fat (IMF) content (P&lt;0.05). Lipidomics analysis showed that mulberry leaves improved lipid profile composition and increased the proportion of triglycerides (TG). Interestingly, IMF content was positively correlated with acyl C18:2 and negatively correlated with C18:1 of differential TGs. In addition, cecal microbiological analysis showed that mulberry leaves could increase the abundance of bacteria such as UCG−005, Muribaculaceae_norank, Prevotellaceae_NK3B31_group, Limosilactobacillus, and so on. At the same time improve the L-tyrosine-baton rouge ester, Oleic acid methyl ester, 21-deoxycortisol, N-acetyldihydrosphingosine, Mulberrin relative abundance. In this study, we found that mulberry leaves could extremely significantly increasing the mRNA relative expression of lipoprotein lipase (LPL), fatty acid-binding protein 4 (FABP4) and peroxisome proliferators-activated receptor γ (PPARγ) in muscle (P＜0.01), significantly increasing mRNA relative expression of diacylglycerol acyltransferase 1 (DGAT1) (P＜0.05) and significantly decreasing the mRNA relative expression of acetyl CoA carboxylase (ACC) (P＜0.05), and aignificantly upregulated hormone-sensitive triglyceride lipase (HSL), peroxisome proliferators-activated receptor α (PPARα) mRNA relative expression (P＜0.05) in backfat. In addition mulberry leaves could increased serum leptin and adiponectin (P＜0.01). Ultimately lead to up-regulation of IMF and down-regulation of backfat.

Tocilizumab against interleukin-6 receptor (IL-6R) has been demonstrated to inhibit the progression of diverse cancers in vitro and in vivo. Nonetheless, evidence regarding the anti-tumor effects of Tocilizumab on human colorectal carcinoma (CRC) corresponding to IL-6R expression levels re-mains scarce. To investigate the influence of IL-6R expression, SW480 and HT-29 cells inoculated subcutaneously into NU/NU mice were used as our human CRC xenograft models with anti-IL-6R antibody (Tocilizumab) therapy. IL-6R expression levels, the histology of CRC growth/ invasiveness and tumor growth-related signaling pathway were estimated by H&E and immunohistochemical staining. SW480 tumor cells with higher IL-6R expression levels exerted better responsiveness in Tocilizumab therapy than the treated HT-29 group. Likewise, therapeutic effects of Tocilizumab on the proliferative ability with mitotic index and Ki-67 expressions, the invasiveness with MMP-9 proteinase expressions, ERK 1/2 and STAT3 signaling transduction in SW480 treatment group were superior to HT-29 treatment group. In light of our results, IL-6R is the key indicator for the efficacy of Tocilizumab treatment in CRC xenografts. From the perspective of precision medicine, tumor response to anti-IL-6R antibody therapy could be predicted on the basis of IL-6R expression levels. In this manner, Tocilizumab may serve as a targeted and promising anti-CRC therapy.

Aronia berries contain antioxidants that may have health promoting properties e.g., demonstrated positive effects on hypertension and dyslipidemia. There is a close link between cardiovascular diseases and hypertension and dyslipidemia, and cardiovascular events are the leading cause of death among subjects with T2D. Thus, we investigated the effect of 8 weeks supplementation with fermented aronia extract (FAE), non-fermented aronia extract (AE) and placebo on cardiovascular risk factors. The extracts were incorporated into snack bars containing 34 g (37%) aronia extract, or 17 g (21%) wheat bran for placebo, as well as raisins and coconut oil. The study was randomized and blinded with a triple-cross-over design. We examined the effects of aronia extracts on blood pressure, adiponectin and high-sensitive C-reactive protein and found no effects. After supplementation with placebo, there were significantly higher total-cholesterol, LDL-cholesterol, and HDL-cholesterol, with the placebo group showing significantly higher increases in total-cholesterol and LDL-cholesterol than the FAE group. Furthermore, we observed an increase in HDL-cholesterol in the AE group and an increase in triglyceride in the FAE group. Thus, we assume that raisins may have increased the participants’ cholesterol levels, however, with both AE and FAE having the potential to prevent this increase.

β3-Adrenoceptors mediate several functions in rodents that could be beneficial for the treatment of obesity and type 2 diabetes. This includes promotion of insulin release from the pancreas, of cellular glucose uptake, of lipolysis, and of thermogenesis in brown adipose tissue. In combination, they lead to a reduction of body weight in several rodent models including ob/ob mice and Zucker diabetic fatty rats. These findings stimulated drug development programs in various pharmaceutical companies, and at least nine β3-adrenoceptor agonists have been tested in clinical trials. However, all of these projects were discontinued due to lack of clinically relevant changes of body weight. Following a concise historical account of discoveries leading to such drug development programs we discuss species differences that explain why β3-adrenoceptors are not a meaningful drug target for the treatment of obesity and type 2 diabetes in humans.

The inaugural AIDS Program in Brazil was established in São Paulo in 1983, with the Instituto Adolfo Lutz appointed for laboratory assistance. Subsequently, research on HIV infections and HIV/HTLV (HIV/HTLV-1 and HIV/HTLV-2) co-infections were conducted. This narrative review focuses on studies from the Immunology Department (1983–2017) that significantly influenced AIDS diagnosis or provided epidemiological data such as prevalence rates, sex, age, and risk factors. Ten studies, encompassing over 8,000 individuals, are discussed. During 1983–1985, nearly all AIDS cases were attributed to homosexual/bisexual men aged 31 years old. Subsequently, heterosexual men and women emerged as risk groups owing to intravenous drug use (IDU) and/or unprotected sexual intercourse with AIDS patients or multiple partners per year. From 1985 onwards, vertical transmission led to child infections. HIV/HTLV co-infection rates decreased over time, initially associated with male IDU, and in the 2010s, with females, IDU, and individuals aged &gt;40 years. Trends in HIV and HIV/HTLV co-infections among younger men and women (&lt;30 years of age) were observed from 2015–2017. The changing characteristics and risk groups for HIV and HIV/HTLV co-infections over the years underscore the necessity for ongoing public policies to prevent retrovirus transmission, particularly among adolescents and young adults.