Background: The purpose of this study was to examine the prevalence and effects of current smoking on adverse outcomes among hospitalized COVID-19 patients. Methods: We performed a systematic review of the literature (PubMed) for studies published until April 25. Studies were included into the analysis if they satisfied all of the following criteria: 1. To present hospitalized patients with COVID-19. 2. To classify patients into less and more severe disease, irrespective of the severity definition (defined as “adverse ourtcome”). 3. To present data on the smoking status, separately for each severity classification. We identified 18 (from a total of 1398) relevant studies. Pooled current smoking prevalence was compared with the gender-adjusted, population-based expected prevalence by calculating Prevalence Odds Ratio (POR). The association between current, compared to non-current and former, smoking and adverse outcome was examined by calculating Odds Ratio (OR). All analyses were performed using random-effects meta-analysis. Results: Among 6515 patients, 440 of whom were current smokers, the pooled prevalence of current smoking was 6.8% (95%CI: 4.8-9.1%) and the POR was 0.21 (95%CI: 0.16-0.26, P < 0.001). In Chinese studies only, the POR was 0.22 (95%CI: 0.17-0.27, P < 0.001). Current smokers were more likely to have an adverse outcome compared to non-current smokers (OR: 1.53, 95%CI: 1.06-2.20, P = 0.022). However, they were less likely to have an adverse outcome compared to former smokers (OR: 0.42, 95%CI: 0.27-0.74, P = 0.003). Conclusion: An unexpectedly low prevalence of current smoking was observed among hospitalized patients with COVID-19. Hospitalized current smokers had higher odds compared to non-current smokers but lower odds compared to former smokers for an adverse outcome. The possibility that nicotine may have a protective effect in COVID-19 which may be masked by smoking-related toxicity and by the abrupt cessation of nicotine intake when smokers are hospitalized should be explored.

Objective: On March 11, 2020 the WHO declared that COVID-19 is pandemic. Among the risk factors for many infectious diseases, a role of the ABO blood group system is reported in the literature. We argue whether it is necessary to investigate the relationship between ABO blood groups and susceptibility to SARS-CoV-2 infection and if we should consider some blood groups as potential risk factors for COVID-19. Results: Based on the scientific evidence reported in this letter, we believe that further studies are needed to investigate how the ABO polymorphism influences the host susceptibility, individual response and clinical risk for SARS-CoV-2 infection.

In this paper we first provide a primer on SARS-CoV-2 and Covid-19 delineating the etiopathogenesis, epidemiology, clinical manifestations and the natural history of the disease. We then trace the evolution of the Covid-19 pandemic highlighting the characteristics of the epidemic in China where the pandemic originated, select countries of Europe which peaked during April, and Brazil, US and India where the pandemic has taken serious turns recently. We also project some possible trajectories for the mega cities of India based on the demographic characteristics of these cities in comparison to New York city. This is an updated version of the article from mid-April published online.

Aims: The sequencing data of SARS-CoV-2 (Severe Acute Respiratory Syndrome Coronavirus-2) are rapidly emerging. The mutation profile across SARS-CoV-2 populations is an important inference of the evolution of coronaviruses. Materials & Methods: With 4,521 lines of SARS-CoV-2, we obtained 3,169 unique point mutation sites in the SARS-CoV-2 genome. We counted the numbers and calculated the MAF (minor allele frequency) of each mutation type. Results: Nearly half of the point mutations are C-T mismatches and 20% are A-G mismatches. The MAF of C-T and A-G mismatches is significantly higher than MAF of other mutation types. Conclusions: The excessive C-T mismatches do not resemble the random mutation profile, and are likely to be explained by the cytosine-to-uridine deamination system in hosts. Not only the population analyses in previous studies are questionable, but also the 17% divergence between SARS-CoV-2 and RaTG13 could be erroneous due to the deamination.

Importance: The COVID-19 pandemic is currently accelerating. Patients with locally advanced non-small cell lung cancer (LA-NSCLC) may require treatment in locations where resources are limited and the prevalence of infection is high. Patients with LA-NSCLC frequently present with comorbidities that increase the risk for severe morbidity and mortality from COVID-19. These risks may be further increased by treatments for LA-NSCLC. Observation: We present expert thoracic oncology multidisciplinary (radiation oncology, medical oncology, surgical oncology) consensus of alternative strategies for the treatment of LA-NSCLC during a pandemic. The overarching goals of these approaches are to reduce the number of visits to a healthcare facility, reduce the risk of SARS-CoV-2 exposure, and attenuate the immunocompromising effects of lung cancer therapies. Patients with resectable disease can be treated with definitive non-operative management if surgical resources are limited or the risks of perioperative care are high. Non-operative options include chemotherapy, chemoimmunotherapy, and radiation therapy with sequential schedules. The order of treatments may be based on patient factors and clinical resources. Whenever radiation therapy is delivered without concurrent chemotherapy, hypofractionated schedules are appropriate. For patients who are confirmed to have COVID-19, usually cancer therapies may be withheld until symptoms have resolved with negative viral test results. Conclusions and Relevance: The risk of severe treatment-related morbidity and mortality is significantly elevated for patients undergoing treatment for LA-NSCLC during the COVID-19 pandemic. Adapting alternative treatment strategies as quickly as possible may save lives and should be implemented through communication with the multidisciplinary cancer team.

COVID-19 disease outbreak was started in the December, 2019 in the Wuhan city of China which is also known as the largest transportation hub of China. During the spring festival of China the situation become epidemic. Soon, the virus is imported to many regions including the low income countries. Till now, 234073 infected reported cases of the COVID-19 in the world with the total of 9840 deaths (March 20, 2020). The common symptoms of the COVID-19 are the cough, high fever, sore throat, fatigue and breathlessness. The disease is found to be mild in most of the people, some of cases reported to the pneumonia also with multi organ dysfunction and acute ARDS (acute respiratory distress syndrome). It is found that the incubation period for the infection is 2-14 days which is usually 4 days in maximum of cases. India has reported 283 cases of COVID-19 infections till now with 4 deaths. India is still at stage 2 on local transmission as per WHO report 60. WHO reported 60 clearly stated that there is no community transmission occurred in India yet which can be prevented by the avoiding mass gathering and proper screening of the people. Govt. of India has taken many initiatives to minimize the spread of COVID-19 infection in the country. The infection rate of the COVID-19 in India remains low related to population size of the country. It is because of fast government action to quarantine the suspected people and shut down all its borders. There is a great slowdown in the global economy due to COVID-19 attack which is likely to costs around $1 trillion. The spread of COVID-19 infection can be reduced by minimizing the H-H transmissions. Still there is need of Anti-n-CoV drug development which can replace the supporting therapies for the treatment of infection.

The current emergency due to the worldwide spread of the COVID-19 caused by the new SARS-CoV-2 is a great concern for global public health. Already in the past, the outbreak of severe acute respiratory syndrome (SARS) in 2003 and Middle Eastern respiratory syndrome (MERS) in 2012 demonstrates the potential of coronaviruses to cross-species borders and further underlines the importance of identifying new-targeted drugs. An ideal antiviral agent should target essential proteins involved in the lifecycle of SARS-CoV. Currently, some HIV protease inhibitors (i.e., Lopinavir) are proposed for the treatment of COVID-19, although their effectiveness was not yet assessed. The main protease (Mpro) provides a highly validated pharmacological target for the discovery and design of inhibitors. We identified potent Mpro inhibitors employing computational techniques that entail the screening of a Marine Natural Product (MNP) library. MNP library was screened by hyphenated pharmacophore model, and molecular docking approaches. Molecular dynamics and re-docking further confirmed the results obtained by structure-based techniques and allowed to highlight some crucial aspects. Seventeen potential SARS-CoV-2 Mpro inhibitors have been identified among the natural substances of marine origin. As these compounds were extensively validated by a consensus approach and by molecular dynamics, the likelihood that at least one of these compounds could be bioactive is excellent.

A novel strategy is presented for reliable diagnosis and progression prediction of diseases with special attention to COVID-19 pandemy. A plan is presented for how the model can be implemented worldwide in healthcare and how novel treatments and targets can be detected. The idea is based on poikilosis, pervasive heterogeneity and variation at all levels, systems and mechanisms. Poikilosis in diseases can be taken account in pathogenicity model, which is based on distribution of three independent condition measures – extent, modulation and severity. Pathogenicity model is a population or cohort-based description of disease components. Evidence-based thresholds can be applied to the pathogenicity model and used for diagnosis as well as for early detection of patients in risk of developing the most severe forms of the disease. Analysis of patients with differential course of disease can help in detecting biomarkers of diagnostic and prognostic significance. A practical and feasible plan is presented how the concepts can be implemented in practice. Collaboration of many actors, including the World Health Organization and national health authorities, will be essential for success.

The global pandemic of COVID-19 accounts for more than 14,000 deaths worldwide. However, little is known about the host genetics interaction with infection and COVID-19 progression. To better understand the role of host genetics, we review the current literature, aggregate readily available genetic resources, and provide some updated analysis relevant to COVID-19 and associated phenotypes. Using the unrelated individuals in UK Biobank (total n = 337,579 across 5 populations), we aggregate human leukocyte antigen and ABO blood type frequencies. We find significant and consistent risk reduction of blood group O reported in Zhao et al. and encourage broad sharing of ABO blood type frequencies that are readily accessible across COVID-19 with mild, moderate, and severe/critical symptoms for robust inferences at https://tinyurl.com/abo-covid19. In addition, we generate polygenic risk scores (PRSs) weights for 29 blood measurements, including clinically relevant haematological measurements for COVID-19, such as lymphocyte count and percentage. Focusing on the 8 most COVID-19 clinically relevant blood measurements, we performed PRS-PheWAS analysis across 44 disease antigen measurements (n = 6,643 unrelated individuals in White British group), infectious diseases and acute respiratory infections (n = 20,928 cases and 349,000 controls across 3 population groups) and deaths (n = 1,846 cases and 368,082 controls), recorded in hospital inpatient record and death registry data, respectively, in UK Biobank, and find host genetic PRS associations with disease risk. Taken together, we anticipate these resources (https://github.com/rivas-lab/covid19) will aid in improving our understanding of host genetic risk factors playing a role in SARS-CoV-2 infection and COVID-19 disease severity.

SARS-CoV-2 is the causative agent for the ongoing COVID19 pandemic, and this virus belongs to the Coronaviridae family. Like other members of this family, the virus possesses a positive-sense single-stranded RNA genome. The genome encodes for the nsp12 protein, which houses the RNA-dependent-RNA polymerase (RdRP) activity responsible for the replication of the viral genome. A homology model of nsp12 was prepared using the structure of the SARS nsp12 (6NUR) as a model. The model was used to carry out in silico screening to identify molecules among natural products, or FDA approved drugs that can potentially inhibit the activity of nsp12. This exercise showed that vitamin B12 (methylcobalamin) may bind to the active site of the nsp12 protein. A model of the nsp12 in complex with substrate RNA and incoming NTP showed that Vitamin B12 binding site overlaps with that of the incoming nucleotide. A comparison of the calculated energies of binding for RNA plus NTP and methylcobalamin suggested that the vitamin may bind to the active site of nsp12 with significant affinity. It is, therefore, possible that methylcobalamin binding may prevent association with RNA and NTP and thus inhibit the RdRP activity of nsp12. Overall, our computational studies suggest that methylcobalamin form of vitamin B12 may serve as an effective inhibitor of the nsp12 protein.

The outbreak of 2019-novel coronavirus (SARS-CoV-2) that causes severe respiratory infection (COVID-19) has spread in China, and the world health organization declared it pandemic. However, no approved drug or vaccines are available, and treatment is mainly supportive and through a few repurposed drugs. In this urgency situation, development of SARS-CoV-2 based vaccines is immediately required. Immunoinformatic and molecular modelling are generally used time-efficient methods to accelerate the discovery and design of the candidate peptides for vaccine development. In recent years, the use of multiepitope vaccines is proved to be a promising immunization strategy against viruses and pathogens, which induce more comprehensive protective immunity. The current study demonstrated a comprehensive in-silico strategy to design stable multiepitope vaccine construct (MVC) from B-cell and T-cell epitopes of essential SARS-CoV-2 proteins with the help of adjuvants and linkers. The integrated molecular dynamics simulations analysis revealed the stability of MVC and its interaction with human Toll-like receptors (TLRs), which trigger an innate and adaptive immune response. Later, the in-silico cloning in a known pET28a vector system also estimated the possibility of MVC expression in E. Coli. Despite this study lacks validation of this vaccine construct in terms of its efficacy, the current integrated strategy encompasses the initial multiple epitope vaccine design concepts. After validation, this MVC can present to be a better prophylactic solution against COVID-19.

Introduction: An epidemic of Coronavirus Disease 2019 (COVID-19) begun in December 2019 in China, causing a Public Health Emergency of International Concern. Among raised questions, clinical, laboratory, and imaging features have been partially characterized in some observational studies. No systematic reviews have been published on this matter. Methods: We performed a systematic literature review with meta-analysis, using three databases to assess clinical, laboratory, imaging features, and outcomes of COVID-19 confirmed cases. Observational studies, and also case reports, were included and analyzed separately. We performed a random-effects model meta-analysis to calculate the pooled prevalence and 95% confidence interval (95%CI). Results: 660 articles were retrieved (1/1/2020-2/23/2020). After screening by abstract/title, 27 articles were selected for full-text assessment. Of them, 19 were finally included for qualitative and quantitative analyses. Additionally, 39 case report articles were included and analyzed separately. For 656 patients, fever (88.7%, 95%CI 84.5-92.9%), cough (57.6%, 40.8-74.4%) and dyspnea (45.6%, 10.9-80.4%) were the most prevalent manifestations. Among the patients, 20.3% (95%CI 10.0-30.6%) required intensive care unit (ICU), with 32.8% presenting acute respiratory distress syndrome (ARDS) (95%CI 13.7-51.8), 6.2% (95%CI 3.1-9.3) with shock and 13.9% (95%CI 6.2-21.5%) of hospitalized patients with fatal outcomes (case fatality rate, CFR).Conclusion: COVID-19 brings a huge burden to healthcare facilities, especially in patients with comorbidities. ICU was required for approximately 20% of polymorbid, COVID-19 infected patients and this group was associated with a CFR of over 13%. As this virus spreads globally, countries need to urgently prepare human resources, infrastructure, and facilities to treat severe COVID-19.

Background Critical patients with novel coronavirus pneumonia ( COVID-19) have worse outcome and high mortality. However, the histopathology of critical patient with COVID-19 remains undisclosed. Methods We performed the whole lung biopsy, and described the pathological changes of critical COVID-19 patient done with transplant by HE staining, immunohistochemistry and special staining observed under the microscopy. Findings The whole lungs displayed diffuse congestive appearance and partly haemorrhagic necrosis on gross examination. The haemorrhagic necrosis was prominently present in outer edge of the right lower lung. The cut surfaces of the lung displayed severe congestive and haemorrhagic changes. The main pathological changes showed massive pulmonary interstitial fibrosis, and partly hyaline degeneration, variable degrees of hemorrhagic pulmonary infarction. Small vessels hyperplasia, vessel wall thickening, lumen stenosis, occlusion and microthrombosis formation. Focal monocytes, lymphocytes and plasma cells infiltrating into pulmonary interstitium. Bronchiolitis and alveolitis with proliferation, atrophy, desquamation and squamous metaplasia of epithelial cells. Atrophy, vacuolar degeneration, proliferation, desquamation and squamous metaplasia in alveolar epithelial cells. Alveolar cavity congestion was prominent, and contained mucus, edema fluid, desquamated epithelial cells, and inflammatory cells. We also found several multinucleate giant cells and intracytoplasmic viral inclusion bodies. Special stains including Masson stain, sirius red staining, reticular fibers staining indicated massive pulmonary interstitial fibrosis. Immunohistochemistry showed positive for immunity cells including CD3, CD4, CD8, CD20, CD79a, CD5, CD38 and CD68. Interpretation We demonstrate the pathological findings of critical patient with COVID-19, which might provide a deep insight of the pathogenesis and severity of this disease.

Background: In 80% of patients, COVID-19 presents as mild disease^1,2. 20% of cases develop severe (13%) or critical (6%) illness. More severe forms of COVID-19 present as clinical severe acute respiratory syndrome, but include a T-predominant lymphopenia³, high circulating levels of proinflammatory cytokines and chemokines, accumulation of neutrophils and macrophages in lungs, and immune dysregulation including immunosuppression⁴. Methods: All major SARS-CoV-2 proteins were characterized using an amino acid residue variation analysis method. Results predict that most SARS-CoV-2 proteins are evolutionary constrained, with the exception of the spike (S) protein extended outer surface. Results were interpreted based on known SARS-like coronavirus virology and pathophysiology, with a focus on medical countermeasure development implications. Findings: Non-neutralizing antibodies to variable S domains may enable an alternative infection pathway via Fc receptor-mediated uptake. This may be a gating event for the immune response dysregulation observed in more severe COVID-19 disease. Prior studies involving vaccine candidates for FCoV^5,6 SARS-CoV-1^7-10 and Middle East Respiratory Syndrome coronavirus (MERS-CoV) ¹¹ demonstrate vaccination-induced antibody-dependent enhancement of disease (ADE), including infection of phagocytic antigen presenting cells (APC). T effector cells are believed to play an important role in controlling coronavirus infection; pan-T depletion is present in severe COVID-19 disease³ and may be accelerated by APC infection. Sequence and structural conservation of S motifs suggests that SARS and MERS vaccine ADE risks may foreshadow SARS-CoV-2 S-based vaccine risks. Autophagy inhibitors may reduce APC infection and T-cell depletion^{12 13}. Amino acid residue variation analysis identifies multiple constrained domains suitable as T cell vaccine targets. Evolutionary constraints on proven antiviral drug targets present in SARS-CoV-1 and SARS-CoV-2 may reduce risk of developing antiviral drug escape mutants. Interpretation: Safety testing of COVID-19 S protein-based B cell vaccines in animal models is strongly encouraged prior to clinical trials to reduce risk of ADE upon virus exposure.

The disease COVID-19 is highly infectious, and infectious in asymptomatic incubation period. The national epidemic development has been effectively controlled and continues improving, especially in areas outside Hubei province. Such periodical results were achieved by the joint efforts of the whole society, including not only the hard work and dedication of the front-line medical workers but also the active cooperation of the general public. The strict epidemic prevention and control measurements have brought remarkable control results. In the present study, the basic infection number of the coronavirus R0 (basic replication number of the infection) before and after prevention and control measurements was simulated to elaborate the measurements of the Chinese government on epidemic prevention and control, providing reference for the people around the world.

It is proposed that both human creativity and human consciousness are (unintended) consequences of the human brain’s extraordinary energy efficiency. The topics of creativity and consciousness are treated separately, though have a common sub-structure. It is argued that creativity arises from a synergy between two cognitive modes of the human brain (which broadly coincide with Kahneman’s Systems 1 and 2). In the first, available energy is spread across a relatively large network of neurons. As such, the amount of energy per active neuron is so small that the operation of such neurons is susceptible to thermal (ultimately quantum decoherent) noise. In the second, available energy is focussed on a small enough subset of neurons to guarantee a deterministic operation. An illustration of how this synergy can lead to creativity with implications for computing in silicon are discussed. Starting with a discussion of the concept of free will, the notion of consciousness is defined in terms of an awareness of what are perceived to be nearby counterfactual worlds in state space. It is argued that such awareness arises from an interplay between our memories on the one hand, and quantum physical mechanisms (where, unlike in classical physics, nearby counterfactual worlds play an indispensable dynamical role) in the ion channels of neural networks. As with the brain’s susceptibility to noise, it is argued that in situations where quantum physics plays a role in the brain, it does so for reasons of energy efficiency. As an illustration of this definition of consciousness, a novel proposal is outlined as to why quantum entanglement appears so counter-intuitive.

In this review, we discuss the insulin resistance (IR) and its development in the insulin target tissues that leads to diabetes. Also, we highlight the use of induced pluripotent stem cells (iPSCs) to understand the mechanisms underlying the development of IR. IR is associated with several metabolic disorders, including type 2 diabetes (T2D). The development of IR in insulin target tissues involves genetic and acquired factors. Persons at genetic risk for T2D tend to develop IR several years before glucose intolerance. Although there are currently several mouse models for both IR and T2D that had provided a lot of information about the disease, these models cannot recapitulate all the aspects of this complex disease as seen in each individual. Patient-specific iPSCs can overcome the hurdles faced with the classical mouse models for studying IR. iPSC technology can generate cells genetically identical to IR individuals, which can help in distinguishing between genetic and acquired defects in insulin sensitivity. Combining the technologies of the genome editing and iPSCs may provide important information about the inherited factors underlying the development of different forms of IR. Further studies are required to fill the gaps in understanding the pathogenesis of IR and diabetes.

In Portugal, cork oak (Quercus suber L.) stands cover 737 Mha, being the most predominant species of the montado agroforestry system, contributing for the economic, social and environmental development of the country. Cork oak decline is a known problem since the late years of the 19th century that has recently worsen. The causes of oak decline seem to be a result of slow and cumulative processes, although the role of each environmental factor is not yet established. The availability of Sentinel-2 high spatial and temporal resolution dense time series enables gradual processes monitoring. These processes can be monitored using spectral vegetation indices (VI) once their temporal dynamics are expected to be related with green biomass and photosynthetic efficiency. The Normalized Difference Vegetation Index (NDVI) is sensitive to structural canopy changes, however it tends to saturate at moderate-to-dense canopies. Modified VI have been proposed to incorporate the reflectance in the red-edge spectral region, which is highly sensitive to chlorophyll content while largely unaffected by structural properties. In this research, in-situ data on the location and vitality status of cork oak trees are used to assess the correlation between chlorophyll indices (CI) and NDVI time series trends and cork oak vitality at the tree level. Preliminary results seem to be promising since differences between healthy and unhealthy (diseased/dead) trees were observed.

A pattern of NK cell heterogeneity in each individual determines proliferative and functional responses of NK cells to activating stimuli. Obtaining the progeny of a single cell by cloning original population is one of the ways to study the NK cell heterogeneity. In this work, we used single cell sorting into a plate and stimulation by IL-2 and gene-modified K562 feeder cells expressing membrane-bound IL-21 (K562-mbIL21) that led to generation of phenotypically confirmed and functionally active NK cell clones. We applied two models of clone cultivation, which differently affected their phenotype, lifespan and functional activity. The first model, which included weekly restimulation of clones with K562-mbIL21 and IL-2, resulted in the generation of relatively short-lived (5-7 weeks) clones of highly activated NK cells. HLA-DR expression in the expanded NK cells correlated strongly with IFN-γ production. The second model, in which NK cells were restimulated mainly with IL-2 alone, produced long-lived clones (8-14 weeks) that expanded up to 10⁷ cells with lower ability to produce IFN-γ. Our method is applicable for studying variability in phenotype, proliferative and functional activity of the certain NK cell progeny in response to the stimulation, which may help in selecting NK cells best suited for clinical use.

The peripheral lymphatic system plays a crucial role in the recovery mechanisms after many pathological changes, such as infection, trauma, vascular, or metabolic diseases. The lymphatic clearance of different tissues from waste products, viruses, bacteria and toxic proteins significantly contributes to the correspondent recovery processes. However, understanding of the meningeal lymphatics functions is a challenging problem. The exploration of mechanisms of lymphatic communication with brain fluids as well as the role of the lymphatic system in the brain drainage, clearance and recovery are still in its infancy. Here we review novel concepts on the anatomy and physiology of the lymphatics in the brain, which warrant a substantial revision of our knowledge about the role of lymphatics in the rehabilitation of the brain functions after neural pathologies. We discuss a new vision on how to recruit the meningeal lymphatics by the opening of blood-brain barrier as a trigger mechanism of activation of the meningeal lymphatic drainage. This leads to innovative strategies in neurorehabilitation therapy.

Production of energy is a main task of cancer cells metabolism, since costs of duplicating are enormous. Although energy is derived in cells by dismantling carbon to carbon bonds of any macronutrient, cancer nutritional needs for energetic purposes have been studied primarily as dependent on glycolysis. Since the end of the last century, awareness of dependence of cancer metabolism on amino acids not only for protein syntheses but also for matching energy needs has grown. The roles of specific amino acids, like glutamine, glycine and serine have been explored in different experimental conditions and reviewed. Moreover, there are epidemiological evidences that some amino acids used as supplement for therapeutic reasons (the branched chain ones) may reduce incidence of liver cancer, and some molecular mechanism has been proposed as functional to their protective action. On the contrary, metabolic signature of some pathology connected with increased risk of cancer, like prolonged hyperinsulinemia in insulin resistant patients, is signed by plasma elevated levels of the same branched chain amino acids, posing puzzling questions to clinicians. Most recently, peculiar formulations of amino acids, deeply different if compared to amino acids compositions normally present in foods, have shown the power to master epigenetics slowing growth or driving cancer cells to apoptotic death, while being even beneficial for normal cells and for animals health and life span. In this review, we will analyze and try to disentangle some of the many knots dealing with complexities of amino acids biology and linked to cancer metabolism.

To circumvent the thermodynamic limitation of the synthesis of oxazolidinones starting from 2-aminoethanols and CO2 and realize incorporation CO2 under atmospheric pressure, a protic ionic liquid-facilitated three-component reaction of propargyl alcohols, CO2 and 2-aminoethanols was developed to produce 2-oxazolidinones along with equal amount of α-hydroxyl ketones. The ionic liquid structure, reaction temperature and reaction time were in detail investigated. And 15 mol% [TBDH][TFE] (1,5,7-triazabicylo[4.4.0]dec-5-ene trifluoroethanol) was found to be able to synergistically activate the substrate and CO2, thus catalyzing this cascade reaction under atmospheric CO2 pressure. By employing this task-specific ionic liquid as sustainable catalyst, 2-aminoethanols with different substituents were successfully transformed to 2-oxazolidinones with moderate to excellent yield after 12 h at 80 oC. This three-component reaction running under atmospheric pressure proves to be a clever detour to avoid the thermodynamic issue in the synthesis of 2-oxazolidinones starting from 2-aminoethanols and CO2.

The snow melt from the High Atlas is a critical water resource in Morocco. In spite of its importance, monitoring the spatio-temporal evolution of key snow cover properties like the snow water equivalent remains challenging due to the lack of in situ measurements at high elevation. Since 2015, the Sentinel-2 mission provides high spatial resolution images with a 5 day revisit time, which offers new opportunities to characterize snow cover distribution in mountain regions. Here we present a new data assimilation scheme to estimate the state of the snowpack without in situ data. The model was forced using MERRA-2 data and a particle filter was developed to dynamically reduce the biases in temperature and precipitation using Sentinel-2 observations of the snow cover area. The assimilation scheme was implemented using SnowModel, a distributed energy-balance snowpack model and tested in a pilot catchment in the High Atlas. The study period covers 2015-2016 snow season which corresponds to the first operational year of Sentinel-2A, therefore the full revisit capacity was not yet achieved. Yet, we show that the data assimilation led to a better agreement with independent observations of the snow height at an automatic weather station and the snow cover extent from MODIS. The performance of the data assimilation scheme should benefit from the continuous improvements in MERRA-2 reanalyses and the full revisit capacity of Sentinel-2.

Herpes simplex virus (HSV) infections can be treated with direct acting antivirals like acyclovir and foscarnet, but long-term use can lead to drug resistance, which motivates research into broadly-acting antivirals that can provide a greater genetic barrier to resistance. Photodynamic inactivation (PDI) employs a photosensitizer, light, and oxygen to create a local burst of reactive oxygen species that inactivate microorganisms. The botanical plant extract Orthoquin^TM is a powerful photosensitizer with antimicrobial properties. Here we report that Orthoquin also has antiviral properties. Photoactivated Orthoquin inhibited herpes simplex virus type 1 (HSV-1) and herpes simplex virus type 2 (HSV-2) infection of target cells in a dose-dependent manner, across a broad range of sub-cytotoxic concentrations. HSV inactivation required direct contact between Orthoquin and the inoculum, whereas pre-treatment of target cells had no effect. Orthoquin did not cause appreciable damage to viral capsids or pre-mature release of viral genomes as measured by qPCR for the HSV-1 genome. By contrast, immunoblotting for HSV-1 antigens in purified virion preparations suggested that higher doses of Orthoquin had a physical impact on certain HSV-1 proteins that altered protein mobility or antigen detection. Orthoquin PDI also inhibited the non-enveloped adenovirus (AdV) in a dose-dependent manner, whereas Orthoquin-mediated inhibition of the enveloped vesicular stomatitis virus (VSV) was light-independent. Together, these findings suggest that broad antiviral effects of Orthoquin-mediated PDI may stem from damage to viral attachment proteins.

An efficient, eco-compatible and very cheap method for the construction of triazoles via eliminative azide–olefin cycloaddition (EAOC) reaction has been developed by a catalytic system IL/FeCl3, offering an highly regioselective approach to structurally diverse 1,5-disubstituted 1,2,3-triazoles in up to 95% yield. This strategy features the reuse of catalytic system through simple operations. Mechanistic studies indicated that an asynchronous concerted dipolar cycloaddition-elimination process might be involved.

The combination of freeze-dried aronia, red ginseng, ultraviolet-irradiated shiitake mushroom and natokinase (AGM; 3.4: 4.1: 2.4: 0.1) was examined to evaluate its effects on insulin resistance, insulin secretion and gut microbiome in a non-obese type 2 diabetic animal model. Pancreatectomized (Px) rats were provided high fat diets supplemented with either of 1) 0.5 g AGM (AGM-L), 2) 1 g AGM (AGM-H), 3) 1 g dextrin (control), or 4) 1g dextrin with 120 mg metformin (positive-control) per kg body weight for 12 weeks. AGM (1 g) contained 6.22 mg cyanidin-3-galactose, 2.5 mg ginsenoside Rg3 and 0.6 mg β-glucan. Px rats had decreased bone mineral density in the lumbar spine and femur and lean body mass in the hip and leg compared to the normal-control and AGM-L and AGM-H prevented the decrease. Visceral fat mass was lower in the control group than the normal-control group and its decrease was smaller by AGM-L and AGM-H. HOMA-IR was lower in descending order of the control, positive-control, AGM-L, AGM-H and normal-control groups. Glucose tolerance was deteriorated in the control group and it was improved by AGM-L and AGM-H more than in the positive-control group. Glucose tolerance is associated with insulin resistance and insulin secretion. Insulin tolerance indicated insulin resistance was highly impaired in diabetic rats, but it was improved in the ascending order of the positive-control, AGM-L and AGM-H. Insulin secretion capacity, measured by hyperglycemic clamp, was much lower in the control group than the normal-control group and it was improved in the ascending order of the positive-control, AGM-L and AGM-H. Diabetes modulated the composition of gut microbiome and AMG prevented the modulation of gut microbiome. In conclusion, AGM improved glucose metabolism by potentiating insulin secretion and reducing insulin resistance in insulin deficient type 2 diabetic rats. The improvement of diabetic status alleviated body composition changes and prevented changes of gut microbiome composition.

Metformin use in pregnancy is increasing worldwide as randomised controlled trial (RCT) evidence is emerging demonstrating its safety and efficacy. The Metformin in Gestational Diabetes (MiG) RCT changed practice in many countries demonstrating that metformin had similar pregnancy outcomes to insulin therapy with less maternal weight gain and a high degree of patient acceptability. A multicentre RCT is currently assessing the addition of metformin to insulin in pregnant women with type 2 diabetes. RCT evidence is also available for the use of metformin for women with Polycystic Ovarian Syndrome and for non-diabetic women with obesity. No evidence of an increase in congenital malformations or miscarriages has been observed even when metformin is started before pregnancy and continued to term. Body composition and metabolic outcomes at two, seven and nine years have now been reported for the offspring of mothers treated in the MiG study. In this review, we will briefly discuss the action of metformin and then consider the evidence from the key clinical trials.

Though melatonin is known to improve ultraviolet B (UVB)-induced oxidative damage and inflammatory conditions via blockade of nuclear factor (NF)-κB, interleukin (IL)-6, there is no report on anti-wrinkle effect of melatonin to date. Hence in the present study, anti-wrinkle mechanism of melatonin was elucidated in UVB treated HaCaT keratinocytes and hairless mice. Herein melatonin protected against a radical initiator tert-Butyl hydroperoxide (t-BOOH) induced reactive oxygen species (ROS) production, matrix metalloprotease 1 (MMP-1) and cytotoxicity in HaCaT keratinocytes. Also, melatonin suppressed the expression of sonic hedgehog (SHH) and GLI for hedgehog signaling, p-NF-kB, cyclooxygenase (COX-2), p-ERK for inflammatory responses in UVB treated HaCaT keratinocytes. Furthermore, melatonin protected skin from wrinkle formation, transdermal water loss in hairless mice irradiated by UVB for 8 weeks. Notably, melatonin prevented against epidermal thickness and dermal collagen degradation in UVB irradiated hairless mice by Hematoxylin & Eosin and Masson’s trichrome staining. Taken together, these findings suggest that melatonin reduces wrinkle formation via inhibition of ROS/SHH and inflammatory proteins such as NF-kB/COX-2/ERK/MMP1.

Shiga toxin (Stx) produced by Escherichia coli is the main pathogenic factor of diarrhea-associated hemolytic uremic syndrome (HUS), which is characterized by obstruction of renal microvasculature by platelet-fibrin thrombi. It is well known that the oxidative imbalance generated by Stx induces platelet activation, contributing to thrombus formation. Moreover, activated platelets release soluble CD40 ligand (sCD40L) which in turn contributes to oxidative imbalance, triggering the release of reactive oxidative species (ROS) on various cellular types. The aim of this work was to determine if the interaction between the oxidative response and platelet-derived sCD40L participates in the pathogenic mechanism during HUS. Activated human glomerular endothelial cells (HGEC) by Stx2 induced platelets to adhere to them. Although platelet adhesion did not contribute to endothelial damage, high levels of sCD40L were released to the medium. The release of sCD40L by activated platelets was inhibited by antioxidant treatment. Furthermore, we found increased levels of sCD40L in plasma from HUS patients, which were also able to trigger the respiratory burst in monocytes, in a sCD40L-dependent manner. Thus, we concluded that platelet-derived sCD40L and the oxidative response are reciprocally stimulated during Stx2-associated HUS. This process may contribute to the evolution of glomerular occlusion and the microangiopathic lesions.

Distribution systems can form islands when faults occur. Each island represents a subsection with variable boundaries subject to the location of a fault(s) in the system. A subsection with variable boundaries is referred to as island in this paper. For operation in autonomous mode, it is imperative to detect the island configurations and stabilize these subsections. This paper presents a novel scheme for the detection of islanding boundaries and stabilizing the system during autonomous operation. In the first stage, a boundary detection method is proposed to detect the configuration of the island. In the second stage a dynamic voltage sensitivity factor (DVSF) is proposed to assess the dynamic performance of the system. In the third stage, a wide area load shedding program is adopted based on DVSF to shed the load in weak busbars and stabilize the system. The proposed scheme is validated and tested on a generic 18-bus system using a combination of EMTDC/PSCAD and MATLAB softwares.

β-Lactams are pharmacologically important compounds because of their various biological uses, including antibiotic and so on. β-Lactams were synthesized from benzylidene-inden derivatives and acetoxyacetyl chloride. The inhibitory effect of these compounds was also examined for human carbonic anhydrase I and II (hCA I, and II) and acetylcholinesterase (AChE). The results reveal that β-lactams are inhibitors of hCA I, II and AChE. The K_i values of β-lactams (2a-k) were 0.44-6.29 nM against hCA I, 0.93-8.34 nM against hCA II, and 0.25-1.13 nM against AChE. Our findings indicate that β-lactams (2a-k) inhibit both CA isoenzymes and AChE at low nanomolar concentrations.

4-aminopyridine (4-AP) is a non-selective blocker of voltage-dependent K+ channels used to im-prove walking in multiple sclerosis patients, and it may be useful in the treatment of cerebellar diseases. In animal models, 4-AP is used as a convulsant agent. Intrahippocampal 4-AP induces acute local glucose hypermetabolism and significant brain damage, while i.p. administration causes less neuronal damage. This study aimed to investigate the effects of a single i.p. admin-istration of 4-AP on acute brain glucose metabolism and to assess the short-term effects on neu-ronal viability and signs of neuroinflammation. We evaluated 4-AP-induced acute changes in brain glucose metabolism by [18F]FDG PET neuroimaging evaluated by standard volumes of interest (VOIs) and voxel-based (SPM) analyses. We show that 4-AP induces acute generalized brain glucose hypometabolism, except in the cerebellum, area that was significantly more resilient to this effect. Accordingly, to the appropriate neurohistochemical assays, 4-AP induced hippocampal astrocyte reactivity 3 days after the insult, without changes in signs of neuronal integrity or micro-glia-mediated neuroinflammation. Thus, acute brain glucose metabolic and short-term neuroin-flammatory profiles in response to 4-AP i.p. clearly differ from that reported for intracerebral administration. Our results also suggest cerebellar metabolism as a potential marker of the effects of 4-AP.

During the last few years, the world witnessed one of the worst calamities affecting humankind- the COVID-19 pandemic. We also witnessed the development of vaccines at an unprecedented pace against the SARS-CoV-2, the causative agent. India, which was one of the countries most impacted by COVID-19, developed its indigenous vaccine in addition to utilizing the ones developed by other countries. Initially, the antibody level and the neutralizing antibody titer against the pathogen were considered as the correlates of immune protection from the disease. The long-term protection from the pathogen is provided by the immune memory cells viz. T and B memory cells and their ability of efficient recall responses. In this regard, global research focused mainly on the mRNA-based vaccines. The studies on immune memory response, particularly- the B cell memory response bestowed by the vaccines given to Indians is relatively obscure. In this work, we examined the level of RBD specific memory B cells in the peripheral circulation of the study participants and the ability of B cells to secrete antigen-specific antibodies among Indians vaccinated with Covaxin (BBV152), Covishield (AZD1222), Corbevax (BECOV2D) and Sputnik Light as well as unvaccinated individuals. Our study revealed that Corbevax and Sputnik Light conferred better antibody-secreting cell (ASC) responses.

Severe acute respiratory syndrome coronavirus 2 (SARS-Cov-2/2019-nCoV) infection is an emerging pandemic. The virus binds to angiotensin converting enzyme 2 (ACE2) and TMPRSS2 which are abundantly expressed on various human cells including lung epithelial cells and intestinal cells and the virus can infect these cells. Currently no specific treatments or vaccines are available for this disease. A per oral live attenuated vaccine can be beneficial in SARS-Cov-2 infection because the attenuated virus initially infects the gut, stimulates the mucosa associated immune system sparing the respiratory system during the initial immune response. The live virus can also spread in the community boosting herd immunity.

(1) Background: The COVID-19 pandemic had a devastating impact on the world, causing widespread illness and death. It is essential to focus on prevention strategies to limit the spread of the disease. Despite the advent of vaccines, maintaining a vigilant approach to prevention remains paramount. While vaccines are essential, they do not guarantee absolute immunity, and their protective effect may diminish over time; (2) Methods: We reviewed effective strategies to prevent COVID-19 transmission. We focused on me-ta-analyses (MA), literature reviews (LR) and the health care context. Various prevention measures and interventions were reviewed. Both es-tablished practices and unresolved issues were considered; (3) Results: Standard precautions (SP) as the cornerstone of infection control, with hand hygiene and mask use as key components. Debate about the relative importance of droplet versus aerosol transmission led to differences in recommendations between agencies at the onset of the pandemic. We have clarified the role of personal protective equipment (PPE), including eye protection. The effectiveness of masks in pre-venting transmission is reviewed. The use of surgical masks is recommended to prevent droplet transmission, while eye protection is recommended in combination with masks. Although data show some risk reduction, the clear superiority of N95/FFP2 over surgical masks remains unproven. In terms of room occupancy, ventilation is critical in reducing the risk of transmission in poorly ventilated environments. The use of negative pressure isolation rooms (NPIRs) is being investigated. The presence of viral RNA on surfaces does not necessarily indicate infectivity, and the risk of transmission by surface contact is low if surfaces are properly maintained and hand hygiene is practised regularly. Testing for SARS-CoV-2 in asymptomatic persons in healthcare settings may help prevent transmission; (4) Conclusions: Prevention of SARS-CoV-2 transmission requires a multifaceted approach, including reducing particle emissions from infected persons by wearing masks, eliminating aerosols by ventilation, ensuring physical separation, and protecting exposed persons with masks and eye protection.

Evidence-based medicine (EBM) is in crisis, in part due to bad methods, which are understood as misuse of statistics that is considered correct in itself. This article exposes two related common misconceptions in statistics, the effect size (ES) based on correlation (CBES) and a misconception of contingency tables (MCT). CBES is a fallacy based on misunderstanding of correlation and ES and confusion with 2 × 2 tables, which makes no distinction between gross crosstabs (GCTs) and contingency tables (CTs). This leads to misapplication of Pearson’s Phi, designed for CTs, to GCTs and confusion of the resulting gross Pearson Phi, or mean-square effect half-size, with the implied Pearson mean square contingency coefficient. Generalizing this binary fallacy to continuous data and the correlation in general (Pearson’s r) resulted in flawed equations directly expressing ES in terms of the correlation coefficient, which is impossible without including covariance, so these equations and the whole CBES concept are fundamentally wrong. MCT is a series of related misconceptions due to confusion with 2 × 2 tables and misapplication of related statistics. The misconceptions are threatening because most of the findings from contingency tables, including CBES-based meta-analyses, can be misleading. Problems arising from these fallacies are discussed and the necessary changes to the corpus of statistics are proposed resolving the problem of correlation and ES in paired binary data. Since exposing these fallacies casts doubt on the reliability of the statistical foundations of EBM in general, we urgently need to revise them.

Cornea severe inflammation produces opacity or even perforation, scarring, and angiogenesis, resulting in blindness. The cornea can be used to study the effect of new anti-angiogenic chemopreventive agents. We researched the anti-angiogenic effect of two extracts, Methanol (Met) and Hexane (Hex), from the seed of Cucurbita argyrosperma, in the inflamed corneas. The corneas of Wistar rats were alkali-injured and treated intragastrically for seven successive days. Clinical manifestation as opacity score, corneal neovascularization (CNV) area, re-epithelialization percentage, and histological evaluation were performed. Inflammatory (COX-2, NF-κB, and IL-1β), and angiogenic (VEGF-A, VEGFR1, VEGFR2) markers were assessed by immunohistochemistry. Cox-2, Il-1β, and Vegf-a mRNA levels were also determined. After treatments, we observed slim corneal thickness with lower opacity scores and low cell infiltration compared to untreated rats. Treatment also accelerated wound healing and decreased CNV area. The staining of inflammatory and angiogenic factors was significantly decreased. These effects are related to a down-expression of Cox-2, Il-1β, and Vegf. These results suggest that intake of C. argyrosperma seed can be used to attenuate the angiogenesis secondary to inflammation in corneal chemical damage.

Aim: This study aims to analyze the structure and impact of research collaborations in colonoscopy from 2000 to 2023 by examining co-authorship networks. The goal is to understand the evolution of these networks, identify key contributors, and assess how collaborative relationships influence the field. Method: I conducted a comprehensive network analysis of co-authorship patterns using data from the Web of Science (WoS) Core Collection database. The analysis included 41,213 articles related to colonoscopy published between 2000 and 2023. Using Python (Version 3.10.5) and PyCharm (Software Version 2022.1.3), we evaluated the networks through macro-level indicators (network density, clustering coefficient, number of components, average distance) and micro-level indicators (degree centrality, closeness centrality, betweenness centrality).Result: The analysis revealed a network with increasing but still fragmented collaboration over the years. The network density showed low proportions of realized connections relative to potential ones, with a high clustering coefficient indicating tight-knit groups when collaborations occurred. The number of components remained high, reflecting a fragmented structure. Prominent researchers such as Hassan, Cesare (Italy) and Dekker, Evelien (Netherlands) consistently emerged as central figures across different periods, demonstrating significant roles in facilitating connections between various research clusters.Conclusion: The study highlights a growing but fragmented collaborative landscape in colonoscopy research. Key researchers have played central roles in connecting different parts of the network, yet there remains substantial room for further integration. Strengthening collaborations across isolated groups could enhance the cohesiveness and impact of research in this field.

Appropriate governance structures are extremely important for the fishery dependent communities to develop integrated territorial development strategies and adaptive capacity to change, including the climate one. This paper assesses to what extent fisheries co-management schemes (e.g Fisheries LAGs, being regional/local governance instruments in fishing communities) are strengthening sustainability. The latter includes improving energy efficiency, promoting renewable energy sources (RES), coping with climate crisis, minimizing environmental impacts, and promoting sustainable blue economy. For detecting policy aspects of aligning climate neutrality and sustainable blue economy, the research lens focuses on the Greek Fisheries Local Action Groups (FLAGs) given that these are mostly located in coastal/marine and insular territories with significant blue growth potential. To map and assess their capacity and efficiency in pursuing Green Deal objectives, a co-development process with FLAG managers was put in place. The results and findings of this process reveal the scarcity of sustainability and blue economy related strategies. Key conclusion is that transition to a post-carbon blue economy on a local level, requires the understanding of the evolutionary dynamics of fisheries co-management schemes. The latter, being multi-sectoral structures, may boost dialogue and cooperation to harmonize local development strategies and EU policies. Maritime Spatial Planning (MSP) as an evolutionary governance process itself, can be a driver for making FLAGs evolve, and strengthen commonization and blue justice and equity for fishers.

The corona (COVID-19) pandemic offers an opportunity for dealing with persistent problems, through a transformative recovery process. It is a crisis that offers opportunities for dealing with three interrelated crises: the ecological crisis (climate change, loss of biodiversity, resource depletion, pollution and ecosystem destruction), the confidence crisis (people losing trust in government, politics, companies, regular news channels, science, each other and the future), and the inequality crisis (the widening of the gap between rich and poor). Our argument is that sustainability transitions will not succeed without a different economy and another social contract with the associated rights and duties of care (for the environment and the well-being of others, including future generations). A different social contract is not only desirable from the point of view of sustainability and fairness, justice and equality, but is also necessary to restore citizens' trust in politics, government, companies and each other. In the paper we discuss mechanisms towards a Natural Social Contract, systemic leverage points for system transformations and possibilities for co-evolutionary governance by actor coalitions interested in transformative change. The combination of those three elements helps to synchronize different agendas and reduce the chance that they will work against each other.

Diabetes complications appear with the severity of hyperglycemia and the age of the disease. In type 2 diabetes mellitus (T2DM), herbal medicines are also effective in reducing hyperglycemia and can be used for this purpose to manage complications. This study aimed to prove the effectiveness of Amaranthus spinosus root extract on type 2 diabetes (T2D) and its microvascular complications. A high-fat diet and low-dose streptozocin were used for 20 days to induce T2D syndrome and complications in rats. The validated animal models were treated orally with the dried hydroethanolic extract of A. spinosus for three weeks; then the hematological, biochemical, and histological markers were evaluated. The results showed that the extract at a dose of 500 mg/kg bw was effective against diabetes and its complications. This effectiveness was linked to a significant reduction (p &lt; 0.0001) in basal blood glucose, tissue oxidative stress, serum cardiovascular and hepato-renal markers, and an improvement in insulin secretion and utilization. The protective activity of the extract against macular edema and renal fibrosis was confirmed by histopathological examinations. These findings prove that A. spinosus root extract contains bioactive compounds that may be useful in preventing or reversing diabetic retinopathy and renal fibrosis.

Wastewater-based epidemiology (WBE) is a promising approach that has been used to monitoring the exposure to pathogens and understanding the status of disease outbreaks in defined population groups. Viral RNAs of SARS-Cov-2 and influenza A and B were detected and quantified by two commercial kits in three wastewater treatment plants (WWTP) selected in different regions of Canton Ticino (Switzerland). We have monitored the presence of SARS-CoV-2 during two big waves of pandemic, from March 2021 until June 2023, when number of confirmed cases and tests decreased. The presence of influenza A and B viruses was investigated from October 2022 to June 2023. We confirmed the presence of SARS-CoV-2 and influenza A and B in all the WWTP monitored; RNA concentration in wastewater could be correlated with clinical cases confirming that WBE is a powerful tool to monitor diseases dissemination supporting the management of an epidemic.

Amidst the ongoing global challenge of the SARS-CoV-2 pandemic, the quest for effective antiviral medications remains paramount. This comprehensive review delves into the dynamic landscape of FDA-approved medications repurposed for COVID-19, categorized as antiviral and non-antiviral agents. Our focus extends beyond conventional narratives, encompassing vaccination targets, repurposing efficacy, clinical studies, innovative treatment modalities, and future outlooks. Unveiling the genomic intricacies of SARS-CoV-2 variants, including the WHO-designated Omicron variant, we explore diverse antiviral categories such as Fusion inhibitors, Protease inhibitors, Transcription inhibitors, Neuraminidase inhibitors, Nucleoside reverse transcriptase, and non-antiviral interventions like Importin α/β1-mediated nuclear import inhibitors, Neutralizing antibodies and convalescent plasma. Notably, Molnupiravir emerges as a pivotal player, now licensed in the UK. This review offers a fresh perspective on the historical evolution of COVID-19 therapeutics, from repurposing endeavors to the latest developments in oral anti-SARS-CoV-2 treatments, ushering in a new era of hope in the battle against the pandemic.

Cycle threshold (Ct) values of SARS-CoV-2 real-time reverse transcriptase-polymerase chain reaction (RT-PCR) tests are associated with infectivity and viral load, and they could be an aid to forecast the evolution of SARS-CoV-2 outbreaks. The objective was to know the Ct values related to the incidence and reinfection of SARS-CoV-2 in successive outbreaks, which took place in nursing homes in Castellon (Spain) during 2020-2022, and to test its usefulness as an instrument of epidemic surveillance in nursing homes. Poisson regression and multinomial logistic regression were used in the analysis. We studied four nursing home SARS-CoV-2 outbreaks, and the average infection rate, reinfection rate, and case fatality were 72.7%, 19.9%, and 5.5%, respectively; 98.9% of residents were vaccinated with three doses of a mRNA SARS-CoV-2 vaccine. Ct values for first infections and reinfections were 27.1±6.6 and 31.9±5.4 (p = 0.000). Considering Ct values ≥30 versus

The continues evolution of coronaviruses has gained considerable attention prior to the outbreak of COVID 19. Although, COVID-19 is currently not recognized as a global pandemic, the virus's ability to evolve and cause disease outbreaks in both humans and animals necessitates ongoing research into its genetic and structural characteristics. Therefore, understanding the molecular origin, rapid evolution, as were as the immunogenicity of coronaviruses is a critical step towards preparing for and preventing future outbreaks. This study aimed to uncover the genetic diversity and evolutionary relationships among the main viral proteins of SARS-CoV-2 and other related coronaviruses. Amino acid sequences of structural viral proteins spike glycoprotein, nucleocapsid protein, membrane protein, and envelope protein were retrieved from the NCBI database for SARS-CoV-2 and 13 other coronaviruses. Here, we identified that SARS-CoV-2 is closely related to BatCoV RaTG13 and Pangolin-CoV, suggesting their potential role in the emergence of the virus. Additionally, we predicted novel epitopes, glycosylation sites, and cleavage sites, identifying three novel glycosylation sites (NATR, NXSN, and NGTK) and six new CTL epitopes (XSNQVAVLY, NSFTRGVYY, NATRFASVY, STQDLFLPF, NSASFSTFK, and ASFSTFKCY). Our comparative analysis revealed that BatCoV RaTG13 has the closest cleavage site to SARS-CoV-2, with significant similarities also observed with Pangolin-CoV. The study highlighted the unique features of SARS-CoV-2, including its furin cleavage site, which may account for its high infectivity during the pandemic. These findings contribute to the understanding of SARS-CoV-2 evolution and its relationship with other coronaviruses, providing critical insights for the development of broad-spectrum vaccines and antiviral therapies.

The viticulture sector, spanning over 7.3 million hectares worldwide, plays a crucial economic role but faces challenges such as labor shortages, rising production costs, market competition, and climate change stresses. Addressing these issues requires monitoring the spatial and temporal variability in vineyard productivity. Traditional ground-based observations, though accurate, are time-consuming and limited in scope. Precision viticulture, leveraging technologies like GPS, remote sensing, and artificial intelligence, offers efficient, non-destructive monitoring tools. This study aims to develop and test a technological workflow using the mobile app Digivit, integrated with the AgroSat platform, to estimate yield variability in vineyards. The workflow was performed during the 2023 growing season in a series of vineyards near Siena (Italy) and involved two main steps: spatial variability characterization using AgroSat and yield estimation using the mobile Digivit app. AgroSat processed Sentinel-2 NDVI data to identify homogeneous zones, while Digivit used smartphone images of grape clusters to estimate yields. The field campaign, performed three weeks before harvest, involved monitoring representative vines within identified zones and uploading georeferenced images for cluster segmentation analysis. Yield estimates were validated against measured weights, showing a strong linear correlation (R²=0.85, RMSE=43.74g). Excluding one outlier improved correlation to R²=0.95, RMSE=14.58g. Vineyard-level yield predictions were compared with harvest data, achieving an overall error of approximately 7%, in agreement with other methods in the literature. The study demonstrates that the Digivit app provides accurate, timely yield prediction, supporting farmers in harvest planning and winemaking management. The user-friendly mobile app approach facilitates a broader adoption of precision viticulture technologies among farmers, overcoming barriers related to technical expertise.

Background: Monogenic Alzheimer's disease (AD) has severe health and socioeconomic repercussions. Its rarest cause are presenilin 2 (PSEN2) gene mutations. We present two new cases with presumed PSEN2-AD, with unusual clinical and neuroimaging findings in order to provide more information on the pathophysiology and semiology of these patients. Methods: Women aged 69 and 62 years at clinical onset, marked by prominent behavioral and language dysfunction, progressing to severe dementia within three years. Neuroimaging, laboratory study, genetic testing. In addition, a systematic review of the PSEN2-AD were performed. Results: Neuroimaging revealed pronounced frontal white matter hyperintensities (WMH) and frontotemporal atrophy/hypometabolism. The genetic study unveiled PSEN2 variants: c.772G>A (p.Ala258Thr) and c.1073-2_1073-1del. Both cerebrospinal fluid (CSF) and experimental blood biomarkers shouldered AD etiology. Conclusions: Prominent behavioral and language dysfunction suggesting frontotemporal dementia (FTD) may be underestimated in the literature as a clinical picture in PSEN2 mutations. Thus, it may be reasonable to include PSEN2 in genetic panels when suspecting FTDL. PSEN2 mutations may cause striking WMH, arguably related with myelin disruption induced by amyloid accumulation.

Objective: Subclinical left ventricular disfunction (LVD) is common in asymptomatic patients with type 2 diabetes (T2D). Many patients with diabetes have an impaired diastolic and systolic function. With preserved ejection fraction LV (EFLV), the latter is defined as reduced global longitudinal strain (GLS), detected using the speckle-tracking echocardiography. This study is aimed to define the long-term structural and functional disorders of the LV myocardium in patients with T2D without CVD. Methods: Of the 120 patients with and without T2D of both sexes aged from 45 to 75 years (57.11±7.9 years), included in the study in 2012-2013, only 57 responded to the follow-up study. The patients were divided into two groups: one with T2D (n=29), the other without it, control (n=28). All patients underwent transthoracic two-dimensional echocardiography with assessment of standard indicators of systolic and diastolic cardiac function, as well as GLS. In addition, all participants underwent laboratory diagnostics of carbohydrate metabolism disorders markers, NT-proBNP and CRP. The median follow-up duration was 7.2 [7.0-7.8] years. Results: During the follow-up, a statistically significant increase in the incidence of diastolic dysfunction (DD) in the type 2 diabetes group was found from 53% to 61% (p = 0.004); no significant dynamics were noted in the control group (p = 0.48). The presence of T2D significantly increases the risk of developing DD (p=0.04). The presence of T2D, increased fasting glucose levels, and an increased HOMA index were independent predictors of the development of DD. Impairment of LVEF was not observed in both groups. At the same time, the proportion of patients with reduced GLS (< -18%) increased in the T2D group (p = 0.036). A significant difference in the frequency of decreased GLS depending on T2D was demonstrated. The presence of obesity, an increase in the HOMA index and an increase in CRP levels are independent predictors of impaired GLS. Conclusions: T2D is an independent risk factor for the worsening of subclinical left ventricular dysfunction in asymptomatic patients with T2D without CVD over 7-year follow-up. Diastolic dysfunction is represented by delayed relaxation of the LV myocardium; with preserved LVEF, reduced 2D GLS identifies systolic dysfunction. The tight control of glycemia, lipidemia, blood pressure and body weight is associated with the absence of poor clinical outcomes.

Caudal type homeobox transcription factor 2 (CDX2) is a gastrointestinal cancer biomarker that regulates epithelial development and differentiation. Absence or low levels of CDX2 have been associated with poor prognosis and proposed as a chemotherapy response predictor. Tumour tissue of 668 patients with stage I-IV colorectal cancer were stained for CDX2 and stratified into two subgroups according to expression levels. Statistical tests evaluated CDX2 relationship with survival and chemotherapy response. Of 646 samples successfully stained, 51 (7.9%) had low and 595 (92.1%) had high CDX2 levels. Low CDX2 staining was associated with poor differentiation, presence of lymphovascular or perineural invasion, and more common in colon and right sided tumours. Overall survival (p&lt;0.001) and disease-free survival (p=0.009) was lower in low CDX2 expressing patients. Multivariable analysis validated CDX2 as an independent poor prognostic factor after excluding confounding variables. There was no statistically significant improvement in survival with adjuvant chemotherapy in stage II colon cancer (p=0.11). In the rectal cohort, there was no relationship between CDX2 levels and therapy response. While confirming the prognostic utility of CDX2 in colorectal cancer, our study highlights larger studies are required to confirm utility as a predictive chemotherapy biomarker, especially in left sided and rectal cancers.

Metabolic dysfunction-associated steatotic liver disease (MASLD) is a serious health problem, and recent evidence indicates that gut microbiota plays a key role in its development. It is known that 2-oleoyl glycerol (2-OG) produced by the gut microbiota is associated with hepatic fibrosis, but it is not known whether this metabolite is involved in the development of hepatic steatosis. The aim of this study was to evaluate how a high-fat sucrose diet (HFS) increases 2-OG production through gut microbiota dysbiosis and to identify whether this metabolite modifies hepatic lipogenesis and mitochondrial activity for the development of hepatic steatosis as well as whether a combination of functional foods can reverse this process. Wistar rats were fed HFS diet for 7 mo. At the end of the study, body composition, biochemical parameters, gut microbiota, protein abundance of lipogenic and antioxidant enzymes, measurement of liver 2-OG, and mitochondrial function were assessed in rats and we studied the effect of HFS with functional foods. In humans with MASLD, we analyzed gut microbiota and serum 2-OG. Consumption of HFS diet in Wistar rats caused oxidative stress, hepatic steatosis and gut microbiota dysbiosis, decreasing α-diversity and increased Blautia producta abundance, which increased 2-OG. This metabolite increased de novo lipogenesis through ChREBP and SREBP-1. 2-OG significantly increased mitochondrial dysfunction. Addition of functional foods to the diet modified the gut microbiota, reducing B. producta and 2-OG levels, leading to a decrease in body weight gain, body fat mass, serum glucose, insulin, cholesterol, triglycerides, fatty liver formation, and increased mitochondrial function. In order to use 2-OG as biomarker, this metabolite was measured in healthy subjects or with MASLD and it was observed that subjects with hepatic steatosis II and III had significantly higher 2-OG than healthy subjects, suggesting that the abundance of this circulating metabolite could be a predictor marker of hepatic steatosis.

Appropriate animal models of human diseases are a cornerstone in the advancement of science and medicine. To create animal models of neuropsychiatric and neurobehavioral diseases such as ASD necessitates the development of sufficient neurobehavioral measuring tools to translate human behavior to expected measurable behavioral features in animals. Indeed, at least in rodents, adequate neurobehavioral and neurological tests have been developed. Since ASD is characterized by a number of specific behavioral trends with significant severity, animal models of autistic-like behavior have to demonstrate the specific characteristic features, namely impaired social interactions, and communication, restricted, repetitive behavioral patterns with association to several additional impairments such as somatosensory, motor and memory impairments. Thus, an appropriate model must show behavioral impairment of a minimal number of neurobehavioral characteristics using an adequate number of behavioral tests. The proper animal models enable the study of ASD like-behavior from the etiologic, pathogenetic and therapeutic aspects. From the etiologic aspects, models have been developed by the use of immunogenic substances like polyinosinic-polycytidylic acid (PolyIC), Lipopolysaccharide (LPS) and propionic acid or other well-documented immunogens or pathogens, like mycobacterium tuberculosis. Another approach is the use of chemicals like valproic acid, Polychlorinated biphenyls (PCBs), organophosphate pesticides - chlorpyrifos (CPF) and others. These substances were administered either prenatally, generally after the period of major organogenesis, or, especially in rodents, during the early postnatal life. In addition, using modern genetic manipulation methods, genetic models have been created of almost all human genetic diseases that are manifested by autistic like behavior (i.e. fragile X, Rett syndrome, SHANK gene mutation Neuroligin genes and others). Ideally, we should not only evaluate the different behavioral modes affected by the ASD-like behavior but also assess the severity of the behavioral deviations by an appropriate scoring system, as applied to humans.

The increasing concern regarding climate change continues to motivate research in the Arctic. Within the delicate cycle of the cryosphere, leads are an important kinematic feature that regulate heat balances in the Arctic. Therefore, it is necessary to quantify the genesis of leads over time to identify when and where changes are occurring. The use of a principal component analysis (PCA) is one such tool that is used to identify the characteristics of seasonal ice variability. The PCA not only identifies “normal” or “dominant” conditions or features, but also extract anomalous spatial features from an archive of long-term sequence of images.

(1) Background: Several chronic respiratory diseases could be a risk factor for acquiring SARS-CoV-2 infection: among them, Primary Ciliary Dyskinesia (PCD) is a rare (about 1:10.000) inherited ciliopathy (MIM 242650) characterized by recurrent upper and lower respiratory tract infections due to a dysfunctioning of the respiratory cilia; We aimed to investigate if some polymorphisms of the TAS2R38 bitter taste receptor correlate with an increased prevalence of SARS-CoV-2 infection and severity of symptoms in a cohort of PCD subjects; (2) Methods: Patients answered several questions about possible SARS-CoV-2 infection, experienced symptoms and vaccinations; in case of infection, they also filled out a SNOT-22 and ARTIQ questionnaires; (3) Results: Forty PCD adult patients (mean age 36.6 ± 16.7 years, 23 females) participated to the study, out of which 30 % had tested positive for COVID-19 during the last four years; most of them reported a mildly symptomatic disease. We found no differences in age or sex, but a statistic significant difference (p=0.03) was observed in body mass index (BMI), that was higher in the COVID-acquired group (23.2 ± 3.3 vs 20.1 ± 4.1 kg/m2). Genotyping for TAS2R38 polymorphisms showed a prevalence of 28.6% PAV/PAV, 48.6% PAV/AVI and 22.8% AVI/AVI individuals in our cohort. In contrast to our hypothesis, we did not observe a protective role of PAV allele towards SARS-CoV-2 infection; (4) Conclusions: Our findings suggest that subjects with PCD may not be at increased risk of severe outcomes from COVID-19 and the TAS2R38 bitter taste receptor genotype type does not affect SARS-CoV-2 infection.

A phase 1-2, prospective, multicenter, randomized, open-label clinical trial (Code RPCEC00000382, https://rpcec.sld.cu/trials/RPCEC00000382-En/), with parallel groups, involving 1161 participants was designed to assess safety and immunogenicity of two Cuban COVID-19 vaccines (Mambisa and Abdala) in boosting COVID-19 immunity of convalescent adults after receiving one dose of either vaccine. The main safety outcome was severe vaccination adverse events occurring in &lt;5% of vaccinees. Main immunogenicity success endpoints were ≥4-fold anti-RBD IgG seroconversion or ≥20% increase in ACE2-RBD inhibitory antibodies in &gt;55% of vaccinees in Phase 1 and &gt;70% in Phase 2. Neutralizing antibody titers against SARS-CoV-2 variants were evaluated. Both vaccines were safe; no deaths or severe adverse events occurred. Mild intensity adverse events were the most frequent (&gt;73%); headache predominated for both vaccines. Phase 1 responders were 83.3% (p = 0.0018) for Abdala. Mambisa showed similar results. Phase 2 responders were 88.6% for Abdala (p &lt;0.0001) and 74.2% for Mambisa (p = 0.0412). In both phases, anti-RBD IgG titers, inhibition percentages and neutralizing antibody titers increased significantly after the booster dose. Both vaccines were safe and their immunogenicity surpassed the study endpoints.

In late December 2019 a novel RNA beta-coronavirus was recognized as the causative agent of previously pneumonia cases of unknown origin. The virus was successively named Severe Acute Respiratory Syndrome CoronaVirus 2 (SARS-CoV-2) as well as the respiratory illness that it causes Coronavirus disease 19 (COVID-19) (1, 2). The global spread of SARS-CoV-2 and the thousands of deaths caused by COVID-19 led the World Health Organization (WHO) to declare a pandemic on 11 March 2020. To date, the world has paid a high toll in this pandemic in terms of human lives lost, economic repercussions and increased poverty. Indeed, even if most patients with COVID-19 are asymptomatic or experience mild self-limiting disease, 14% of them progress to severe disease and 5% to critical illness with complications, such as interstitial pneumonia, respiratory failure with acute respiratory distress syndrome (ARDS) and multiple organ dysfunction syndromes (MODS) (3). It is accepted that SARS-CoV-2 primarily affects the respiratory system, although other organs are also involved (4). The virus enters host cells by attaching its Spike like surface projections to the angiotensin-converting enzyme-2 (ACE2) receptor which is mainly expressed on alveolar epithelial cells and in nearly all human organs in varying degrees. Thus, although the central target of SARS-CoV-2 infection is the lung, the wide distribution of ACE2 receptors in other organs may lead to cardiovascular, gastrointestinal, kidney, liver, central nervous system and ocular damages that have to be closely monitored during the disease (5, 6). The virus then activates the innate and adaptive immune system resulting in a large number of cytokines release, known as “cytokine storm”, that is directly correlated with tissue injury and unfavourable prognosis of severe lung disease (7). In particular, interleukin (IL)-6 seems to plays an important role in driving this cytokine release so that its increased levels have been recognized as a hallmark inflammatory signature in sera of COVID-19 patients (8). IL-6 is a polyfunctional cytokine with both anti-inflammatory and pro-inflammatory properties which exerts its several functions through two main signal transduction pathways (9). In the classical signal transduction pathway, IL-6 binds to IL-6-trans membrane receptor (IL-6R) to form a complex that, then, binds to the trans membrane glycoprotein gp130, inducing its homo-dimerization and initiating intracellular signal transduction. This kind of signaling is limited to cells (hepatocytes, macrophages, neutrophils, T cells, etc.) that express IL-6R on their cell surface (10). Nevertheless, cells do not express IL- 6R, as stromal and epithelial cells, are able to still respond to IL-6 because the soluble form of the receptor (sIL-6R) binds to IL-6 in circle and then anchors to membrane gp130 receptor, initiating the trans-signaling pathway. For this reason, sIL-6R is able to increase the function of IL-6 and is considered the agonist form of its receptor. When the level of IL-6 increases, its effects are widely expressed because gp130 molecules are ubiquitous and, therefore, also present in cells without IL-6R in the membrane form. On the contrary, a soluble form of the glycoprotein 130 (sgp130) can complex with sIL-6R to prevent the sIL-6R from binding to the membrane-bound gp130. In this case sgp130 is able to decrease the function of IL-6 and is considered the antagonist form of IL-6 receptor system (11). Based on the central role of IL-6 in the inflammatory pathology of COVID-19 and the consistent association between elevated levels of the cytokine and severe disease outcomes found in the first phase of infection, we sought to analysis IL-6 and its soluble receptor complex behavior during the different waves of COVID-19 pandemic, in order to evaluate the possible differences which occur among them and to hypothesize if they might be used as prognostic markers of disease severity.

We produced a recombinant eel luteinizing hormone (rec-eel LH) analog with high potency in Chinese hamster ovary DG44 (CHO DG44) cells. The eel LH mutant (LH-M), which had a linker comprising the equine chorionic gonadotropin (eCG) β-subunit carboxyl-terminal peptide (CTP) region (amino acids 115 to149), was inserted between the β-subunit and α-subunit of wild-type tethered eel LH (LH-wt). Monoclonal cells transfected with the eel LH-wt and eel LH-M plasmids were isolated from five and nine clones of CHO DG44 cells, respectively. The secreted quantities abruptly increased on day 3, with peak levels of 5,000–7,500 ng/mL on day 9. The molecular weight of eel LH-wt was 32–36 kDa while that of eel LH-M increased to approximately 38–44 kDa, indicating the detection of two bands. Treatment with peptide N-glycanase F decreased the molecular weight by approximately 8 kDa. The oligosaccharides at the eCG β-subunit O-linked glycosylation sites were appropriately modified post-translation. The EC50 value and maximal responsiveness of eel LH-M increased by approximately 2.90- and 1.29-fold, respectively, indicating that the mutant exhibited more potent biological activity than eel LH-wt. Phosphorylated extracellular regulated kinase (pERK1/2) activation resulted in a sharp peak 5 min after agonist treatment, with a rapid decrease thereafter. These results indicate that the new rec-eel LH analog which contains the eCG β-subunit CTP linker comprising O-linked glycosylation sites, had more potent activity than the wild-type in vitro. Taken together, this new eel LH analog can be produced in large quantities using a stable CHO DG44 cell system.

In this research, the primary goal was to investigate the relationship between strategic planning and organizational performance in Iraq's manufacturing context. The study's primary data sources were 360 manager respondents. The structured questionnaire was used to collect primary data from manufacturing firms located throughout Iraq. To analyze the result, the researcher used descriptive statistics, correlation, and multiple regression analysis. SPSS version 16 software was used to conduct data analysis. The result reveals that the process of strategic planning has a beneficial effect on financial performance. Environmental scanning has a statistically significant positive effect on a company's non-financial performance. Management participation and planning formality positively and statistically significantly affect a business's non-financial performance at the 10 percent level. The domain of strategy and technique has not impacted the company's non-financial performance.

This study aimed to produce single-chain recombinant eel follicle-stimulating hormone (rec-eel FSH) analogs with high activity in Chinese hamster ovary DG44 (CHO DG44) cells. We recently reported that an O-linked glycosylated carboxyl-terminal peptide (CTP) of the equine chorionic gonadotropin (eCG) β-subunit plays contributes on high activity and time-dependent secretion in mammalian cells. We constructed a mutant (FSH-M) in which a linker including the eCG β-subunit CTP region (amino acids 115 to149) was inserted between the β-subunit and α-subunit of wild-type single chain eel FSH (FSH-wt). Plasmids containing eel FSH-wt and eel FSH-M were transfected into CHO DG44 cells. Single cells expressing each protein were isolated from 10 and 7 clones, respectively. Secretion increased gradually during the cultivation period and peaked at 4,000–5,000 ng/mL on day 9. The molecular weight of eel FSH-wt was 34–40 kDa, while that of eel FSH-M increased substantially, with two bands at 39–46 kDa. Treatment with PNGase F to remove the N glycosylation sites decreased the molecular weight remarkably to approximately 8 kDa. The EC50 value and maximal responsiveness of eel FSH-M were approximately 1.23- and 1.06-fold higher than those of eel FSH-wt, indicating that the mutant showed slightly higher biological activity. Phosphorylated extracellular regulated kinase (pERK1/2) activation exhibited a sharp peak at 5 min, followed by a rapid decline. These findings indicate that the new rec-eel FSH molecule with the eCG β-subunit CTP linker showed potent activity and could be produced in massive quantities using the stable CHO DG44 cell system.

A two-year experiment was conducted with a local maize hybrid under full irrigation (F), deficit irrigation (D) and rainfed conditions (R) to estimate maize evapotranspiration in Bosnia and Herzegovina. Three approaches (Allen & Pereira (A&P), SIMDualKc (SD), and Vegetation Index (VI)) were used to estimate the actual crop coefficient (Kc act), actual basal crop coefficient (Kcb act), and actual crop evapotranspiration (ETc act) were applied with the dual crop coefficient method and remote sensing (RS) data. While Kcb act from all approaches matched FAO56 tabulated values, SD showed differences, in comparison to A&P, of up to 0.24 in D and R conditions, especially in initial and mid-season stages. VI demonstrated very good performance in all treatments. In F, the obtained Kc act for all approaches during the initial and end stages were higher than the tabulated values, ranging from 0.71-0.87 for Kc ini act and from 0.80-1.06 for Kc end act, while the mid-season period showed very good agreement with the literature. Maize crop evapotranspiration range is 769-813 mm, 480-752 mm, and 332-618 mm for F, D and R, respectively. The results confirmed the suitability of both approaches (SD and VI) to estimate maize crop evapotranspiration under F, with the VI approach demonstrating an advantage in calculating Kcb act, Kc act, and ETc act values under water stress conditions. The 67.6% increase in grain yields with irrigation emphasizes the need to transition from rainfed to irrigation-dependent agriculture, even for drought-resistant crops like maize.

Proteases represent common targets in combating infectious diseases including COVID-19. The 3-chymotrypsin-like protease (3CLpro) is a validated molecular target for COVID-19 and it is key for developing potent and selective inhibitors for inhibiting viral replication of SARS-CoV-2. In this review, we discuss structural relationships and diverse subsites of 3CLpro, shedding light on the pivotal role of dimerization and active site architecture in substrate recognition and catalysis. Our analysis of bioinformatics and other published studies unveil a proposal of a novel catalytic mechanism for the SARS-CoV-2 polyprotein cleavage by 3CLpro, centering on the triad mechanism involving His41-Cys145-Asp187 and its indispensable role in viral replication. Recognizing Asp187 as a crucial component in the catalytic process underscores its significance as a fundamental pharmacophoric element in drug design. Next, we provide an overview of both covalent and non-covalent inhibitors, elucidating advancements in drug development observed in preclinical and clinical trials. By highlighting various chemical classes and their pharmacokinetic profiles, our review aims to guide future research directions toward the development of highly selective inhibitors, underscore the significance of 3CLpro as a validated therapeutic target, and propel the progression of drug candidates through preclinical and clinical phases.

Long COVID, a name often given to the persistent symptoms following acute SARS-CoV-2 infection, poses a multifaceted challenge for health. This review explores the intrinsic relationship between comorbidities and autoimmune responses in shaping the trajectory of long COVID. Autoantibodies have emerged as significant players in COVID-19 pathophysiology, with implications for disease severity and progression. Studies show immune dysregulation persisting months after infection, marked by activated innate immune cells and high cytokine levels. The presence of autoantibodies against various autoantigens suggests their potential as comorbid factors in long COVID. Additionally, the formation of immune complexes may lead to severe disease progression, highlighting the urgency for early detection and intervention. Furthermore, long COVID is highly linked to cardiovascular complications and neurological symptoms, posing challenges in diagnosis and management. Multidisciplinary approaches, including vaccination, tailored rehabilitation, and pharmacological interventions, are used for mitigating long COVID's burden. However, numerous challenges persist, from evolving diagnostic criteria to addressing the psychosocial impact and predicting disease outcomes. Leveraging AI-based applications holds promise in enhancing patient management and improving our understanding of long COVID. As research continues to unfold, unravelling the complexities of long COVID remains paramount for effective intervention and patient care.

Despite Low Power Wide Area Networks’ ability to offer an extended range, it might still encounter challenges with coverage blind spots in the network. This article proposes an innovative energy-efficient nature-inspired relay selection algorithm for LoRa-based LPWAN networks, serving as a solution for challenges related to poor signal range in areas with limited coverage. A behavior swarm-inspired approach has been utilized to select the relays’ localization in the network, providing network energy efficiency and radio signal extension. These relays help bridge communication gaps, significantly reducing the impact of coverage blind spots by forwarding signals from devices with poor direct connectivity with the gateway. The proposed algorithm considers critical factors for the LoRa standard, such as the Spreading Factor or device energy budget analysis. The simulation experiments validate the proposed scheme’s effectiveness in terms of energy efficiency under diverse multi-gateway topology scenarios involving thousands of devices. Specifically, it has been verified that the proposed approach outperforms the reference method in preventing the battery depletion of relays, which is vital for battery-powered IoT devices. Furthermore, for some large-scale problems, the proposed heuristic method achieves over twice the speed of the exact method with a negligible accuracy loss of less than 2%.

Gastric inflammation-related disorders are commonly observed digestive system illnesses char-acterized by the activation of proinflammatory cytokines, particularly tumor necrosis factor-α (TNF-α). This results in the induction of cyclooxygenase-2 (COX-2)/prostaglandin E2 (PEG2) and matrix metallopeptidase-9 (MMP-9). These factors contribute to the pathogenesis of gastric in-flammation disorders. We examined the preventive effects of Lonicera japonica Thunb. ethanol ex-tract (Lj-EtOH) on gastric inflammation induced by TNF-α in normal GES-1 cells. The GES-1 cell line was used to establish a model that simulated the overexpression of COX-2/PGE2 and MMP-9 proteins induced by TNF-α, to examine the anti-inflammatory properties of Lj extracts. The re-sults indicated that Lj-EtOH exhibits significant inhibitory effects on COX-2/PEG2 and MMP-9 ac-tivity, attenuates cell migration, and provides protection against TNF-α-induced gastric inflam-mation. The protective effects of Lj-EtOH are associated with the modulation of COX-2/PEG2 and MMP-9 through activation of TNFR–ERK 1/2 signaling pathways as well as the involvement of c-Fos and nuclear factor kappa B (NF-κB) signaling pathways. Based on our findings, Lj-EtOH ex-hibits a preventive effect on human gastric epithelial cells. Consequently, it may represent a novel treatment for the management of gastric inflammation.

Based on screening in computational biology and biological in vitro assays, five natural products isolated from extracts of the herbal medicine toad skin, such as cinobufagin (CBFi), bufalin (BFi), arenobufagin (ABFi), telocinobufagin (TBFi), bufotalin (BFTi), were subjected to molecular docking calculations with the use of SARS-CoV-2 main protease (PDB 6LU7 and 7BTF) and top-scoring ligand-receptor complexes were obtained. The results showed that the binding energy of ABFi to the 3CL protein was -17.044kcal/mol, which was higher than CBFi and TBFi. However, the binding energy of ABFi to the RdRp protease was -23.250 kcal/mol, which was much lower than that of CBFi and TBFi, EVEN lower than that of ABFi to the 3CL protein. ABFi also has polar interactions with amino acids such as Glu811, Ser814, Ser681 and Thr680 of RdRp enzyme. The results revealed that ABFi had a moderate inhibitory effect on the cell proliferation of SARS-CoV-2 in vitro, with an inhibition rate of 61.12%, even weaker than Remdesivir. This new discovery provides us with new ideas for in-depth studies on the development of natural products with this class of structural generalizations as inhibitors of SARS-CoV-2, and provides an experimental basis for the next step of mechanistic studies.

During the last two decades several cases of venous thrombosis (VTE) after a prolonged period at a computer has been described, denominated “eThrombosis”. Video gaming on a computer has become very popular and can be a social activity where several players are gathered to play against each other or in a virtual environment for several days (“LAN (i.e., Local Area Network) parties”) where the participants are sedentary and consuming calorie-rich food items. The aim of this study was to investigate a potential coagulation activation during a 42 hour LAN party. Nine male gamers volunteered for the LAN party. Citrated blood was sampled before and every 6 hours, and plasma was analyzed for thrombin generation, and Thrombin-antithrombin-complexes (TAT), prothrombin Fragment 1+2 (F1+2), and D-dimer. Thrombin generation increased slightly but not significantly during the LAN party, whereas the coagulation activation markers were unchanged. These results do not indicate that the coagulation system is activated significantly during 42 h gaming with minimal physical activity. Although an increased activity cannot be excluded, it does not directly indicate a risk of VTE in general. It may be specific and particularly susceptible in-dividuals who are prone to thrombosis and, therefore, are at risk of developing e-thrombosis.

Background: The monocyte-phagocyte system (MPS), including monocytes/macrophages and dendritic cells (DCs), plays a key role in anti-viral immunity. We aimed to analyze the prognostic value of the MPS components on in-hospital mortality in a cohort of 58 patients (M/F ; mean ageSD years) with COVID-19 pneumonia and 22 age- and sex-matched healthy controls. Methods: We measured frequencies and absolute numbers of peripheral blood CD169+ monocytes, conventional CD1c+ and CD141+ (namely cDC2 and cDC1), and plasmacytoid CD303+ DCs by means of multi-parametric flow cytometry. A gene profile analysis of 770 immune-inflammatory related human genes and 20 SARS-CoV-2 genes was also performed. Results: Median frequencies and absolute counts of CD169-expressing monocytes were significantly higher in COVID-19 patients than in controls (p 0.04 and p 0.01, respectively). Conversely, percentages and absolute numbers of all DC subsets were markedly depleted in patients (p

Nucleoside analogs are commonly used drugs for the treatment of cancer and viral infections. Nucleoside deoxyribosyltransferase (NDT) is one of the key enzymes required for the biosynthesis of deoxynucleotides. The feasibility of biochemical transformation processes is usually greatly dependent on the cost of biocatalysts. Therefore, immobilizing and reusing biocatalysts is an approach to be considered to bring biotransformations closer to industrial feasibility, since it not only allows enzymes to be reused but can also improve their stability under several reaction conditions. In this work, histidine tags have been successfully fused to a Nucleoside deoxyribosyltransferase from Lactobacillus reuteri (LrDNT), which has been produced in a bench-scale reactor using a facile araBAD promoter-based protein expression system in an industrial microorganism, the E. coli BL21(DE3) strain. The overexpressed LrNDT was bound to a nickel-chelating agarose affinity chromatography medium via a one-step purification and immobilization process with a 99% yield, retaining about 97% of its initial activity. The optimal conditions for the immobilized LrNDT maintain high enzyme activity within the range of 20-45°C and pH 6.0-7.5. Finally, the immobilized enzyme reactor (IMER) of LrNDT was applied for the continuous-flow biosynthesis of 2'-deoxyadenosine and retained 90% of its activity after 16 hours, providing a theoretical basis for the industrial production of nucleoside analogs.

The late diagnosis of Type 2 Diabetes Mellitus can occur due to lack of access to the primary health care system and the non-manifestation of symptoms. Faced with this problem, this work presents the creation of a mobile application, called DiabetesCheck, for predicting the risk of Type 2 Diabetes Mellitus. A mathematical model is used, which classifies the risk of Type 2 Diabetes Mellitus for a group of patients with intervention and for a comparative group, using Fuzzy Classification and Decision Trees. The proposed application allows the health professional to monitor patients through the history stored in a database, allowing a representation of the evolution of patients and indication of medications. Therefore, this proposal aims to carry out the diagnosis in the initial phase of the disease and help in the prescription of more effective treatments and in the proposition of public policy strategies in epidemiology and screening.

Despite widespread vaccination, early treatments, and improved understanding of the disease, the effects of SARS-CoV-2 infection remain significant worldwide. Many patients still suffer from severe COVID-19, necessitating admission to intensive care units. Remdesivir is a primary treatment option among viral RNA polymerase inhibitors for hospitalized SARS-CoV-2 patients. However, there is a lack of studies examining factors influencing its effectiveness in this context. We conducted a retrospective study throughout 2022, analyzing clinical, laboratory, and sociodemographic data from 252 hospitalized COVID-19 patients treated with remdesivir. Six machine learning algorithms were compared and validated to predict factors associated with the loss of clinical benefit from remdesivir in terms of mortality and hospital stay. Data were extracted from electronic health records. The eXtreme Gradient Boost (XGB) method achieved the highest balanced accuracy for both mortality (95.45%) and hospital stay (94.24%). Factors associated with worse outcomes of remdesivir use in terms of mortality included limitation of life support treatment, need for ventilatory support (especially invasive mechanical ventilation) on day 14 after the first dose of remdesivir, lymphopenia, low levels of albumin and hemoglobin, presence of flu and/or coinfection, and cough. Factors associated with worse outcomes of remdesivir use in terms of hospital stay included the number of doses of the COVID-19 vaccine, patchy lung density, bilateral pulmonary radiological status, number of comorbidities, oxygen therapy, troponin and lactate dehydrogenase levels, and asthenia. These findings highlight the effectiveness of XGB as a strong candidate for accurately categorizing COVID-19 patients undergoing remdesivir treatment.

This report provides a comprehensive overview of occupational asthma and respiratory hypersensitivity, focusing on some chemicals used in the workplace Includes numerous case studies and research papers related to occupational exposure methacrylates, such as HEMA-HPMA, and respiratory hypersensitivity are discussed And the relationship is explored The book also examines asthma pathophysiology, emerging drug delivery systems used to treat asthma, and the potential of nanoparticles , dendrimers and micellar systems have to improve pulmonary drug delivery in detail The worldwide prevalence of asthma is highlighted, with higher rates in high-GDP countries. The book highlights the need to improve asthma diagnosis, treatment and biomarkers, particularly in rural and low-income countries where the disease is often underdiagnosed and inadequately treated, and discusses the role of inflammation in asthma, in particular secondary inflammation characterized by specific cytokines and inflammation cells In addition, the paper explores various drug delivery methods, such as parenteral and parenteral drugs, pressurized inhalers (pMDIs), dry powder inhalers ( DPIs), nebulizers, nanoparticles, liposomes, micellar systems, microparticles , dendrimers, and gene therapy . These systems aim to increase pulmonary delivery of drugs and improve clinical outcomes. The potential of dendrimer bilirubin-based nanoparticles and micellar systems in the treatment of asthma and lung inflammatory diseases, including asthma, has been discussed in summary, this paper provides an overview of occupational asthma and respiratory hypersensitivity, and this discussion highlights the association between methacrylate exposure and respiratory hypersensitivity.

To accurately and non-destructively monitor the growth of spring wheat in the Hetao Irrigation Area, UAV remote sensing was employed during various fertility stages. Digital image indices from diverse fertilization treatments were calculated and compared with physiological indices to identify the most sensitive digital image indices corresponding to these indices. The study underscored the critical importance of the flowering stage in the growth of spring wheat, thus highlighting the necessity of focusing on this stage. This finding reiterated that the flowering stage was pivotal for spring wheat development in the Hetao Irrigation Area. Several digital image indices, such as GLA, R, G, INT, g, GRVI, MGRVI, RGBVI, EXG, and GRRI, exhibited a high frequency of significant correlations with physiological indices during the four primary reproductive stages of wheat. Consequently, these sensitive digital image indices during the flowering stage can more effectively characterize the physiological indices of spring wheat.

Background: The aim was to diagnose Candida in the oral cavity of subjects with type 2 diabetes mellitus (T2DM) using a genotyping technique and to compare the results with those from con-ventional diagnosis by Papanicolau (Pap) staining. Methods: Palatal mucosa smears were per-formed in 18 dental care patients diagnosed with T2DM and grade I, II, and III prosthetic stomatitis who met the inclusion criteria; 18 healthy control subjects were also included in the study. He-moglobin A1c (HbA1c) levels were determined from total blood. Using exfoliative cytology, the Pap staining technique was used to diagnose candidiasis. Exfoliative cytology was also used for molecular diagnosis; DNA was obtained for Candida genotyping and RNA was used for gene ex-pression studies. Results: Clinical patterns indicated that all subjects were positive for Candida; however, Pap analysis revealed only three positive subjects, whereas end-point polymerase chain reaction (PCR) analysis revealed fifteen subjects with some type of Candida. The most common Candida species found were Candida guilliermondii (38.8%), Candida krusei (33.3%), Candida tropicalis, and Candida lusitaniae (22.2%). Interestingly, the coexpression of different species of Candida was found in various patients. In all patients, HbA1c levels were increased. Gene expression analysis showed a significant decrease (p ≤ 0.05) in TLR2 expression in positive subjects, whereas TLR4 expression did not differ significantly among patients. Conclusions: The end-point PCR technique showed better sensitivity for diagnosis of Candida when compared with diagnosis by Pap staining. T2DM subjects showed an increased presence of C. guilliermondii that was correlated with decreased TLR2 expression

Type II pneumocytes are the target of SARS-CoV-2 which alters their redox homeostasis to increase reactive oxygen species (ROS). Melatonin (MT) has antioxidant proprieties and protects mitochondrial function. Here we evaluated whether the treatment with MT compensated for the redox homeostasis alteration in serum from COVID-19 patients. We determined oxidative stress (OS) markers such as carbonyls, glutathione (GSH), total antioxidant capacity (TAC), thiols, nitrites (NO2–), lipid peroxidation (LPO), and thiols groups in serum. We also studied the enzymatic activities of glutathione peroxidase (GPx), -S-transferase (GST), reductase (GR), thioredoxin reductase (TrxR), extracellular superoxide dismutase (ecSOD) and peroxidases. There was a significant increase in LPO and carbonyls (p≤0.03) and a decrease in TAC, NO2–, thiols, GSH, (p&lt;0.001) in COVID-19 patients. The activities of the ecSOD, TrxR, GPx, GST, GR and peroxidases were decreased (p≤ 0.04). The treatment with MT favored the activity of the antioxidant enzymes which contributed to increase TAC and restored the lost redox homeostasis. MT also modulated glucose homeostasis functioning as a glycolytic agent and inhibited the Warburg effect. Thus, MT restores the redox homeostasis which is altered in COVID-19 patients and can be used as adjuvant therapy in the SARS-CoV-2 infection.

The possible future emergence of new SARS-CoV-2 virus variants pushes the development of new chemoprophylaxis protocols complementary to the unspecific and specific immune-prophylaxis measures currently used. The SARS-CoV-2 virus is particularly sensitive to oxidation due to the relevant positive electrical charge of its spike protein used as a ligand for target cells. The present study evaluated the safety and efficacy of a new oxidant preparation, liquid hyperoxygen (IOL), to neutralize the SARS-CoV-2 virus. IOL was incubated with throat swabs containing a human wild-type virus. The samples were then incubated with cells expressing the ACE2 receptor and therefore very sensitive to SARS-CoV-2 infection. The ability to neutralize SARS-CoV-2 was determined by assessing the amount of viral nucleic acid inside cells by PCR. The results obtained indicate that IOL, even at considerable dilutions, is capable, after incubation times of less than 30 min and even equal to 5 min, to completely inhibit SARS-CoV-2 infection. This inhibitory effect has been shown to be due to the oxidizing capacity of the IOL. This oxidizing capacity is exerted towards the virus but does not damage eukaryotic cells either in the in vitro or in the in vivo skin model. Obtained results indicate that the use of IOL, a hydrophilic liquid mixture saturated with highly reactive oxygen and nitrogen species, is a new powerful, safe, and effective tool for preventing possible future outbreaks of COVID-19 disease.

To analyze the viral titers of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and respiratory syncytial virus (RSV) at the anterior nasal site (ANS) and nasopharyngeal site (NS), evaluate their virological dynamics, and validate the usefulness of a newly developed two antigen-detecting rapid antigen diagnostic test (Ag-RDT) that simultaneously detects SARS-CoV-2 and RSV using clinical specimens. This study included 195 asymptomatic to severely ill patients. Overall, 668 specimens were collected simultaneously from the ANS and NS. The cycle threshold (Ct) values calculated from real-time polymerase chain reaction were used to analyze temporal changes in viral load and evaluate the sensitivity and specificity of the Ag-RDT. The mean Ct values for SARS-CoV-2-positive, ANS, and NS specimens were 28.8, 28.9, and 28.7, respectively. The mean Ct values for RSV-positive, ANS, and NS specimens were 28.7, 28.8, and 28.6, respectively. SARS-CoV-2 and RSV showed the same trend in viral load, although the viral load of NS was higher than that of ANS. The sensitivity and specificity of the newly developed Ag-RDT were excellent in specimens collected up to 10 days after the onset of SARS-CoV-2 infection and up to 6 days after the onset of RSV infection.

As humans age, aberrancies in several signaling pathways occur. In the aging population, some patients display abnormal bone morphogenetic protein (BMP) signaling. This can lead to osteoporosis (OP), a debilitating bone disorder caused by an imbalance between osteoblasts and osteoclasts. In 2002, the Food and Drug Administration (FDA) approved usage of recombinant human BMP-2 (rhBMP-2) during spinal fusion surgery as it is crucial for bone formation. However, complications have been reported with rhBMP-2 and primary osteoblasts isolated from OP patients are unresponsive to BMP-2. While patient samples are available, previous medical history may alter results. Therefore, C57BL/6 mice, an aging model that displays aberrant BMP-signaling, can be utilized to investigate OP and aging. We show that BMP receptor type Ia (BMPRIa) is upregulated in the bone marrow stromal cells (BMSCs) of 15-month mice similar to previous data. We show that a conjugation between BMP-2 and Quantum Dots (QDot®s) effectively binds to BMPRIa and can investigate BMP-2 activity. After incubating BMSCs with methyl-β-cyclodextrin (MβCD), BMP-signaling is restored in 15-month mice as shown by western blotting and the von Kossa assay. MβCD may be used to rescue BMPRIa and the BMP-signaling pathway can be utilized by future therapeutics to treat OP.

Tamm Plasmon Polariton (TPP) is a nanophotonic phenomenon that has attracted much attention due to its spatial strong field confinement, ease of mode excitation and polarization independence. TPP has applications in sensing, storage, lasing, perfect absorber, solar cell, nonlinear optics, and many others. In this work, we demonstrate a biosensing platform based on TPP resonant mode. Both theoretical analyses based on Transfer Matrix Method and experimental validation through nonspecific detection of liquids of different refractive indices and specific detection of SARS-CoV-2 nucleocapsid protein (N-protein) are presented. Results show that TPP biosensor has high sensitivity and good specificity. For N-protein detection, the sensitivity is 1.5 nm/(µg/ml) and the limit of detection can reach down to below 7 ng/ml with spectrometer of 0.01 nm resolution of wavelength shift. This work paves the way for design, optimization, fabrication, characterization, and performance analysis of TPP based biosensors

In its prefusion state, the SARS-CoV-2 Spike protein (similarly to other class I viral fusion proteins) is metastable, which is considered to be an important feature for optimizing or regulating their functions. After the binding process of its S1 subunit (S1) with the ACE2, the Spike protein (S) suffers a dramatic conformational change where S1 splits from the S2 subunit, which then penetrates the membrane of the host cell, promoting the fusion of the viral and cell membranes. This results in the infection of the host cell. In a previous work, we showed -using large scale molecular dynamics simulations- that the application of external electric fields (EF) induces drastic changes and damage in the receptor-binding domain (RBD) of the wild type Spike protein, as well of the Alpha, Beta and Gamma variants, leaving a structure which cannot be recognized any more by ACE2. In this work, we first extend the study to the Delta and Omicron variants and confirm the high sensitivity and extreme vulnerability of S to moderate EF (as weak as 104 V m-1), but, more importantly, we also show that, in contrast, the postfusion state of the spike protein does not suffer structural damage even if electric field intensities four orders of magnitude higher are applied. These results provide a solid scientific basis to confirm the prefusion state metastability roots of the SARS-CoV-2 Spike protein susceptibility to be damaged by EF. After the virus docks to the ACE2 receptor, the stable and robust postfusion conformation develops, which exhibits a similar resistance to EF (damage threshold higher than 108 V m-1) like most globular proteins.

Background. Type 2 diabetes mellitus (T2DM) is becoming a major global health concern, especially in poorer nations. The high prevalence of obesity and the ensuing diabetes is attributed to rapid economic progress, physical inactivity, consumption of high-calorie foods, and changing lifestyles. Objectives. We investigated the role of pro-inflammatory chemokines; CCL1, 2, 4 and 5 with varying levels of obesity in T2DM in the Asir region of Saudi Arabia. Materials and methods. 170 confirmed T2DM patients and a normal control group were enrolled. The demographic data, serum levels CCL-1, 2, 4 and 5 and the biochemical indices were assessed in patients and control groups by standard procedures. Results. T2DM patients were divided into four groups: A (normal body weight), B (Overweight), C (obese), and D (highly obese). n controls. We observed that male and female control patients had similar mean serum concentrations of pro-inflammatory chemokines CCL 1, 2, 4, and 5. Chemokines CCL1, CCL2, and CCL4 in the serum of Type 2 Diabetes Mellitus patients with normal or overweight body weights were significantly higher than the control group, regardless of gender. In T2DM individuals with obesity and severe obesity, the rise was most significant. There was a progressive rise in the concentrations of CCL1, 2, and 4 in T2DM) patients with increasing BMI. Serum CCL5 levels increased significantly in all T2DM patient groups. The increase in CCL5 was more predominant in normal-weight people as compared to overweight and obese T2DM patients. Conclusions. Male and female control patients had similar serum levels of pro-inflammatory chemokines CCL 1, 2, 4, and 5. The progressive rise in blood concentrations of three Pro-inflammatory chemokines; CCL1, 2, and 4 in T2DM patients with increasing BMI supports the idea that dyslipidemia and obesity contribute to chronic inflammation and insulin resistance. Serum CCL5 levels increased significantly in all T2DM patient groups. The selective and more pronounced increase of CCL5 in the T2DM group with normal BMI as compared to patients with varying degrees of obesity, was rather surprising. Further research is needed to determine if CCL5 under-expression in overweight and obese T2DM patients is due to some unexplained counterbalancing processes.

SARS-CoV-2 attachment and entry inside mammalian cells is mainly mediated by human angiotensin-converting enzyme 2 (ACE2) and its interaction with spike protein. However, it is well known that spike protein also interacts with other molecules like glycosaminoglycans (GAG), e.g., heparan sulfate (HS) or Enoxaparin (EX), which are linear, anionically charged polysaccharides known for their biological activities. The mode of action of these two polysaccharides is to bind spike protein to block the interaction with ACE2 receptors. This study aimed to assess a model capable of confirming the activity of these GAGs in both the wild-type strain of SARS-CoV-2 and its variants, such as the highly variable BA.2.86. This was achieved by combining in silico modeling with in vitro determination using BacMam technology. The results showed the antiviral activity of HS and EX both in vitro and through the in-silico analysis, reconciling conflicting findings from recent studies on the cellular entry of SARS-CoV-2. In conclusion, it is possible to highlight the ability of these molecules to circumvent the high variability of SARS-CoV-2, providing valuable insights into intervention strategies targeting cell entry mechanisms and establishing a safe in vitro model.

Cognitive reserve is the adaptability of cognitive processes in the face of brain aging and pathology. This study aimed to validate the Arabic version of the Cognitive Reserve Index Questionnaire (CRIq) in a healthy Lebanese sample. CRIq assesses cognitive reserve through three domains: education, working activity, and leisure time. Statistical measures, including descriptive and regression analysis along with structural equation modeling, were utilized to investigate the convergent and discriminant validity of CRIq, incorporating fluid intelligence (Gf) and measures of cognitive function, long-term memory encoding and retrieval (Glr), and processing speed (Gs). Results from 174 participants revealed that the activities assessed by CRIq-Arabic were comparable to the original CRIq study, with slight cultural differences. The internal consistency of CRIq-Arabic was good (Cronbach's α = 0.88), indicating reliability. Convergent validity was confirmed, with moderate to high loadings on the cognitive reserve latent construct. Discriminant validity was supported as correlations between cognitive reserve variables and non-target constructs (Gf, Glr, Gs) were less than 1. The findings provide an initial psychometric validation of the CRIq-Arabic. Further research in clinical samples is needed to enhance its utility in neuropsychological practice.

Optimal detection strategies for effective convalescent immunity after SARS-CoV-2 infection and vaccination remain unclear. The objective of this study was to characterize convalescent immunity targeting the SARS-CoV-2 spike protein using a multiparametric approach. At the beginning of the pandemic, we recruited 30 COVID-19 unvaccinated convalescent donors and 7 unexposed asymptomatic controls. Peripheral blood mononuclear cells (PBMCs) were obtained from leukapheresis cones. The humoral immune response was assessed by measuring serum anti-SARS-CoV-2 spike S1 subunit IgG semiquantitative ELISA and T cell immunity against S1 and S2 subunits were studied by IFN-γ Enzyme-Linked Immune absorbent Spot (ELISpot), flow cytometric (FC) activation-induced marker (AIM) assays and the assessment of cytotoxic CD8+ T-cell function (in the subset of HLA-A2 positive patients). No single immunoassay was sufficient in identifying anti-spike convalescent immunity among all patients. There was no consistent correlation between adaptive humoral and cellular anti-spike responses. Our data indicate that the magnitude of anti-spike convalescent humoral and cellular immunity is highly heterogeneous and highlights the need for using multiple assays to comprehensively measure SARS-CoV-2 convalescent immunity. These observations might have implications for COVID-19 surveillance, and optimal vaccination strategies for emerging variants. Further studies are needed to determine the optimal assessment of adaptive humoral and cellular immunity following SARS-CoV-2 infection, especially in the context of emerging variants and unclear vaccination schedules.

COVID-19 has rapidly spread worldwide since December 2019. During the pandemic, SARS-CoV-2 repeatedly mutated from Alpha to Omicron. The severity and mortality are related to age, sex, and underlying diseases (respiratory, cerebrovascular, cardiovascular, metabolic, cancer, and immune diseases). We retrospectively studied 44 hospitalized stroke patients infected with the SARS-CoV-2 Omicron variant. The mortality rate of hospitalized stroke patients with COVID-19 was 6 (13.6%). The cause of death was coagulopathy in 3 cases of ischemic stroke. High modified Rankin Scale score（mRS）of stroke patient was correlated with severity of COVID-19. The timing of vaccination is inversely correlated with COVID-19 severity. In conclusion, stroke patients with COVID-19 have high mortality rates attributed to coagulopathy. Stroke patients with high mRS scores are more likely to develop severe COVID-19. In high mRS scores, therapy for severe COVID-19 should be administered.

: (1) Background: Healthcare workers (HCWs) are a well-known risk group for coronavirus infections with increased working hours in a potentially infectious environment. We evaluated both IgG and Neutralizing antibody levels, with IgG avidity index and persistence among health workers. (2) Methods: 1001 HCWs were tested for both IgG and Neutralizing antibodies. IgG avidity testing and one-year follow-up testing were done on selected HCWSs. (3) Results: COVID-19 IgG antibody levels were high among 299 (94.62%) HCWs with a history of COVID-19 infection (p &lt;0.0001) compared with 479 (69.92%) HCWs who were not infected with COVID-19 during the first and second wave. A total of 899 (89.81%) HCWs had more than 50% neutralizing antibodies while the remaining 102 (10.19%) HCWs had less than 50% of Neutralizing antibodies. The avidity index was maintained at almost 40% (Gray zone). Both antibody levels were found markedly increased after one year when compared to initial results. (4) Conclusions: Healthcare workers are at a 2.29-fold higher risk of infection; Two folds higher IgG levels in HCWs involved in COVID-19 duty and their persistence for a longer time than in other groups signifies IgG antibody role in the prevention of severe disease in HCWs involved in Covid-19 patient care.

Type 2 diabetes mellitus (T2DM) is a common metabolic disease characterised by insulin resistance and elevated blood glucose levels, affecting millions of people worldwide. T2DM patients with dyslipidaemia have an increased risk of cardiovascular disease (CVD). A complex interplay of risk factors such as hyperglycaemia, dyslipidaemia, hypertension, obesity, inflammation and oxidative stress favour the development of atherosclerosis, a central mechanism in the pathogenesis of cardiovascular disease. Dyslipidaemia, a hallmark of T2DM, is characterised by elevated triglycerides, decreased high-density lipoprotein (HDL) cholesterol and the presence of small, dense low-density lipoprotein (LDL) particles, all of which promote atherosclerosis. In this article, we have attempted to present various treatment strategies that include pharmacological interventions such as statins, ezetimibe, PCSK9 inhibitors, fibrates and omega-3 fatty acids. We have also tried to highlight the pivotal role of lifestyle modifications, including physical activity and dietary changes, in improving lipid profiles and overall cardiovascular health in T2DM patients. We have also tried to present the latest clinical guidelines for the management of dyslipidaemia in T2DM patients. In conclusion, the treatment of dyslipidaemia in T2DM patients is of great importance as it lowers lipid particle levels, slows the progression of atherosclerosis and ultimately reduces susceptibility to cardiovascular disease.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The Main Protease (Mpro) plays a pivotal role in the replication of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and is considered a highly conserved viral target. Disruption of the catalytic activity of Mpro produces a detrimental effect on the course of the infection, making this target one of the most attractive for the treatment of COVID-19. The current success of the SARS-CoV-2 Mpro inhibitor Nirmatrelvir, the first oral drug for the treatment of severe forms of COVID-19, has further focused the attention of researchers on this important viral target, making the search for new Mpro inhibitors a thriving and exciting field for the development of antiviral drugs active against SARS-CoV-2 and related coronaviruses.

The SARS-CoV-2 virus, causative agent of COVID-19, is known for its genetic diversity. Virus variants of concern (VOCs) as well as variants of interest (VOIs) are classified by the World Health Organization (WHO) according to their potential risk to global health. This study seeks to enhance the identification and classification of such variants by developing a novel bioinformatics criterion centered on the virus's spike protein (SP1), a key player in host cell entry, immune response, and a mutational hotspot. To achieve this, we pioneered a unique phylogenetic algorithm which calculates EIIP-entropy as a distance measure based on the distribution of the Electron-Ion Interaction Potential (EIIP) of amino acids in SP1. This method offers a comprehensive, scalable, and rapid approach to analyze large genomic data sets and predict the impact of specific mutations. This innovative approach provides a robust tool for classifying emergent SARS-CoV-2 variants into potential VOCs or VOIs. It could significantly augment surveillance efforts and understanding of variant characteristics, while also offering potential applicability to the analysis and classification of other emerging viral pathogens and enhancing global readiness against emerging and re-emerging viral pathogens.

D-Glucaric acid is an important bio-based building block of polymers and is a high value-added chemical that can be used in a variety of applications. In the present study, the Udh target genes from Pseudomonas putida and Pseudomonas syringae were used together to construct the expression vector pETDuet-2×Udh. The transformants of BL21(DE3) with vector pETDuet-2×Udh was applied to produce glucaric acid from glucuronic acid. After optimization of induction conditions, the highest Udh expression were achieved when 0.4 mmol L-1 isopropyl-β-d–thiogalactoside (IPTG) was added to cell cultures at an OD600 value of 0.6 followed by culture at 26℃ for 6 hours. The production of glucaric acid substantially reached 5.24 ± 0.015 g L-1 in fed-batch cultures in a 30 L tank. In the present study, a new system for glucaric acid production was established, which was more economic and friendly to environment.

The COVID-19 pandemic has raised questions about indirect impact in pregnant women on the development of their future children. Investigating the characteristics of lipid metabolism in the "mother-placenta-fetus" system can give information about the pathophysiology of COVID-19 infection during pregnancy. 234 women were included in study. Maternal plasma, cord blood, amniotic fluid lipidome were analyzed using HPLC-MS/MS. Differences in lipid profile were searched by Manna-Whitney and Kruskall-Wallis test, diagnostic model based on logistic regres-sion were bilt by AIC. Elevation levels of lysophospholipids, triglycerides, sphingomyelins, and oxidized lipids was registered in patients’ after COVID-19 maternal and cord plasma. An increase in maternal plasma sphingomyelins and oxidized lipids was observed in cases of infection during the second trimester. In amniotic fluid, compared to the control group, nine lipids are reduced, six lipids are elevated. Levels of phosphoglycerides, lysophosphoglycerides, and phosphatidylinosi-tols decreased during infection in the second and third trimesters of pregnancy. Newborn’s health diagnostic model based on maternal plasma were developed for each group and exhibit good di-agnostic value (AUC> 0.85). Maternal and cord plasma’s lipidome changes during delivery, asso-ciated with Covid-19 infection during pregnancy, are synergistic. The most significant disturbances occur with infections in the second trimester of pregnancy.

One of the hallmarks of microgravity-induced effects in several cellular models is represented by the alteration of oxidative balance with the consequent accumulation of Reactive Oxygen Species (ROS). It is well known that male germ cells are sensitive to oxidative stress and to changes of gravitational force even if published data on germ cell models are scarce. To gain more insights into the mechanisms of male germ cell response to altered gravity, a 3D cell culture model has been established from TCam-2 cells, a seminoma-derived cell line considered the only human cell line available to study in vitro mitotically active human male germ cells. TCam-2 cell spheroids were cultured for 24 hours under unitary gravity (Ctr) or simulated microgravity (s-microgravity) conditions, these last ones were obtained using the Random Positioning Machine (RPM). A significant increase in intracellular ROS and mitochondria superoxide anion levels has been observed after RPM exposure. In line with these results a trend of protein and lipid oxidation increase, and increased pCAMKII expression levels were observed after RPM exposure. The ultrastructural analysis by Transmission Electron Microscopy revealed that RPM-exposed mitochondria appeared enlarged and, even if seldom, disrupted. Notably, even the expression of the main enzymes involved in the redox homeostasis appears modulated by RPM exposure in a compensatory way, being GPX1, NCF1, and CYBB downregulated, whereas NOX4 and HMOX1 upregulated. Interestingly, HMOX1 is involved in the heme catabolism of mitochondria cytochromes, and therefore the positive modulation of this marker can be associated to the observed mitochondria alteration. All together, these data demonstrate TCam-2 spheroid sensitivity to acute SM exposure and indicate the capability of these cells to trigger compensatory mechanisms that allow to overcome the exposure to altered gravitational force.

Systemic sclerosis (SSc) is a multisystem connective tissue disease characterized by pathological processes involving autoimmunity, vasculopathy, and resultant extensive skin and organ fibrosis. Recent studies have demonstrated activation and aberrant wound healing responses in the epithelial layer of the skin in this disease, implicating the epithelial keratinocytes as a source of pro-fibrotic and inflammatory mediators. In this paper we investigated the role of Immunoglobulin G (IgG) autoantibodies directed against epithelial cells, as potential initiators and propagators of pathological keratocyte activation and the ensuing SSc fibrotic cascade. A keratinocyte cell-based ELISA is used to evaluation binding of SSc IgG. SSc skin biopsies were stained by immunofluorescence for the presence of IgG in the keratinocyte layer. Moreover, IgG purified from SSc sera is evaluated for the potential to activate keratinocytes in tissue culture and to induce signaling in TLR2 &amp; 3 reporter cell lines. We demonstrate enhanced binding of SSc IgG to keratinocytes, and activation of these cells leading to release of IL-1α, representing a potential initiating pathway in this disease.

Suffocation syndrome is the leading cause of hypoxia and mortality in the most common lung diseases, asthma and COVID-19. Inhaled corticosteroids (ICSs) have been shown to be the main-stay of critical care in these diseases. Meanwhile, mortality from strangulated hypoxia is highest in low-income countries because ICSs are not currently available to many patients. Warm alkaline hydrogen peroxide solutions (WAHPSs) have reportedly been invented in recent years to urgently turn thick sputum, mucus, pus, serous fluid, blood clots and many other biological masses con-taining the enzyme catalase into a fluffy oxygenated foam. It has been shown that the mechanism of action of WAHPSs consists in alkaline saponification of lipid and protein-lipid complexes of bi-ological masses and their transformation into oxygen foam, because hydrogen peroxide is urgently decomposed into water and oxygen gas under the action of the biological masses catalase enzyme At that excess oxygen is absorbed into blood through lungs and increases blood oxygen saturation. Based on the described mechanism of action of WAHPSs and the high availability of their ingre-dients, it is suggested that mortality from choking and hypoxia in asthma and COVID-19 can be reduced by combining ICSs with inhaled WAHPSs, especially in poor countries. The essence of the inventions underlying the formation of WAHPSs is given.

N'-(5-bromofuran-2-carbonyl)isonicotinohydrazide (1) was obtained as a white solid in 83% yield by 2-methyl-6-nitrobenzoic anhydride (MNBA)/4-dimethylaminopyridine (DMAP)-catalyzed reaction of 5-bromofuran-2-carboxylic acid and isoniazid in dichloromethane at room temperature. The structure of N'-(5-bromofuran-2-carbonyl)isonicotinohydrazide (1) was elucidated by 1H NMR, 13C NMR, FTIR, and the high resolution mass spectrometers. Molecular docking screening of the title compound (1) on the cyclooxygenase-2 (COX-2) protein (PDB ID: 5IKR) exhibited that compound (1) has a good binding affinity, suggesting that it is very interesting for further structure optimization and in-depth research as a potential COX-2 inhibitor.

The Covid-19 pandemic has produced a change in the way of living, socializing and a modification in Health Systems around the world. A multicentre retrospective study was carried out to study orofacial trauma in one of the regions most affected during the first wave of the pandemic, with the participation of the five main tertiary hospitals in Madrid. The aim of this study is to evaluate the epidemiology of orofacial surgical trauma during the 1 year of COVID pandemic and compared to de prior year. Age, sex, mechanism, localization, and treatment were studied. P-value <0.05 was considered statically significative. Reduction of 39.36% (<0.001) in maxillofacial fractures was observed, without significance change in sex, localization or treatment. Significant increase in age (35,92 vs. 40,26) (p = 0.006) was observed. Significant decline in mechanism was noted (p = 0.025), decreasing personal violence (41% vs 35%) and sports (14% vs 8%); increasing in falls (27% vs 35%), precipitation (2 vs 5%), and traffic accidents (12% vs 13%). The mandible was the most frequent fractured bone. The COVID pandemic has produced epidemiological variations in orofacial trauma, making it necessary to monitor social and legal changes that may require reorganization to adjust to population needs.

Adipose tissue is a crucial organ in energy metabolism and thermoregulation. Adipose tissue phenotype is controlled by various signaling mechanisms under pathophysiological conditions. Type II transmembrane serine proteases (TTSPs) are a group of trypsin-like enzymes anchoring on the cell surface. These proteases act in diverse tissues to regulate physiological processes, such as food digestion, salt-water balance, iron metabolism, epithelial integrity, and auditory nerve development. More recently, several members of the TTSP family, namely, hepsin, matriptase-2, and corin, have been shown to play a role in regulating lipid metabolism, adipose tissue phenotype, and thermogenesis, via direct growth factor activation or indirect hormonal mechanisms. In mice, hepsin deficiency increases adipose browning and protects from high-fat diet-induced hyperglycemia, hyperlipidemia, and obesity. Similarly, matriptase-2 deficiency increases fat lipolysis and reduces obesity and hepatic steatosis in high-fat diet-fed mice. In contrast, corin deficiency increases white adipose weights and cell sizes, suppresses adipocyte browning and thermogenic responses, and causes cold intolerance in mice. These findings highlight an important role of TTSPs in modifying cellular phenotype and function in adipose tissue. In this review, we provide a brief description about TTSPs and discuss recent findings regarding the role of hepsin, matriptase-2, and corin in regulating adipose tissue phenotype, energy metabolism, and thermogenic responses.

Keywords: Marine sulfated glycans; SARS-CoV-2; Omicron XBB.1.5, Spike protein; Heparin

Recent studies have confirmed that lung microvascular endothelial injury plays a critical role in the pathophysiology of COVID-19. Our group and others have demonstrated the beneficial effects of H2S in several pathological processes and provided a rationale for considering the therapeutic implications of H2S in COVID-19 therapy. Here, we evaluated the effect of the slow-releasing H2S donor, GYY4137, on the barrier function of a lung endothelial cell monolayer in vitro, after challenging the cells with plasma samples from COVID-19 patients or inactivated SARS-CoV-2 virus. We also assessed how the cytokine/chemokine profile of patients’ plasma, endothelial barrier permeability, and disease severity correlated with each other. Alterations of barrier permeability after treatments with patient plasma, inactivated virus, and GYY4137 were monitored and assessed by electrical impedance measurements in real-time. We present evidence that GYY4137 treatment reduced endothelial barrier permeability after plasma challenge and completely reversed the endothelial barrier disruption caused by inactivated SARS-CoV-2 virus. We also showed that disease severity correlated with the cytokine/chemokine profile of the plasma but not with barrier permeability changes in our assay. Overall, these data demonstrate that treatment with H2S-releasing compounds has the potential to ameliorate SARS-CoV-2–associated lung endothelial barrier disruption.

The mRNA vaccines for SARS-CoV-2 have demonstrated efficacy and immunogenicity in the re-al-world setting. However, most of the research on vaccine immunogenicity has been centered on characterizing the antibody response, with limited exploration into the persistence of spike-specific memory B cell response. Here we monitored the durability of the memory B cell response and characterize the trajectory of spike-specific B cell phenotypes in healthy individuals who have received two doses of the BNT162b2 vaccine up to 9 months post-vaccination. To profile the spike-specific B cell response we applied the tSNE and Cytotree automated approaches. Our data showed the induction of spike-specific IgA+ and IgG+ plasmablasts and IgA+ activated cells 7 days after the second dose which disappeared 3 months later, while subsets of spike-specific IgG+ resting memory B cells became predominant 9 months after vaccination, and they were capable to differentiate into spike-specific IgG secreting cells when in vitro restimulated. Other subsets of spike-specific B cells, such as IgM+ or unswitched IgM+IgD+ or IgG+ double negative/atypical cells, were also elicited by the BNT162b2 vaccine and persisted up to month 9. The analysis of circulating spike-specific IgG, IgA and IgM was in line with the plasmablasts observed. The longitudinal analysis of the antigen-specific B cell response elicited by mRNA-based vaccines provides valuable insights into our understanding of the immunogenicity of this novel vaccine platform destined to a future widespread use, and it is crucial in guiding future decisions and vaccination schedules.

Preterm delivery can be precipitated by infection, and preterm infants are at heightened risk of postnatal infection. Little is known about the ontogeny of inflammatory biomarkers in extremely preterm infants. We hypothesized that suspected prenatal infection (chorioamnionitis or spontaneous preterm labor) and clinically diagnosed postnatal infection would be associated with unique biomarker signatures, and those patterns would be influenced by the degree of prematurity. Venous blood was collected daily for the first week and weekly for up to 14 additional weeks from 142 neonates born at 22-32 weeks gestation. A custom array was utilized to measure monocyte chemoattractant protein-1 (MCP-1) and interleukin-6 (IL-6). C-reactive protein (CRP) levels were obtained from the electronic medical record. 90 infants had suspected prenatal infection and 63 were diagnosed with postnatal infection. Independent of gestational age at delivery, MCP-1 was significantly increased (P &lt; 0.001) in association with maternal preeclampsia, but MCP-1 was decreased (P&lt;0.01) and CRP was increased (P&lt;0.05) in the presence of chorioamnionitis. IL-6 and CRP were both increased in infants diagnosed with postnatal infection with peak levels observed on days 2 and 3, respectively. In conclusion, suspected prenatal and postnatal infections and non-infectious complications of pregnancy are associated with unique biomarker profiles, independent of gestational age. In those clinically diagnosed with a postnatal infection in the absence of antenatal infection concerns, IL-6 increases before CRP, emphasizing a potential role for expanded biomarker screening if antibiotics are initially avoided in infants born exclusively for maternal indications.