In Portugal, cork oak (Quercus suber L.) stands cover 737 Mha, being the most predominant species of the montado agroforestry system, contributing for the economic, social and environmental development of the country. Cork oak decline is a known problem since the late years of the 19th century that has recently worsen. The causes of oak decline seem to be a result of slow and cumulative processes, although the role of each environmental factor is not yet established. The availability of Sentinel-2 high spatial and temporal resolution dense time series enables gradual processes monitoring. These processes can be monitored using spectral vegetation indices (VI) once their temporal dynamics are expected to be related with green biomass and photosynthetic efficiency. The Normalized Difference Vegetation Index (NDVI) is sensitive to structural canopy changes, however it tends to saturate at moderate-to-dense canopies. Modified VI have been proposed to incorporate the reflectance in the red-edge spectral region, which is highly sensitive to chlorophyll content while largely unaffected by structural properties. In this research, in-situ data on the location and vitality status of cork oak trees are used to assess the correlation between chlorophyll indices (CI) and NDVI time series trends and cork oak vitality at the tree level. Preliminary results seem to be promising since differences between healthy and unhealthy (diseased/dead) trees were observed.

A pattern of NK cell heterogeneity in each individual determines proliferative and functional responses of NK cells to activating stimuli. Obtaining the progeny of a single cell by cloning original population is one of the ways to study the NK cell heterogeneity. In this work, we used single cell sorting into a plate and stimulation by IL-2 and gene-modified K562 feeder cells expressing membrane-bound IL-21 (K562-mbIL21) that led to generation of phenotypically confirmed and functionally active NK cell clones. We applied two models of clone cultivation, which differently affected their phenotype, lifespan and functional activity. The first model, which included weekly restimulation of clones with K562-mbIL21 and IL-2, resulted in the generation of relatively short-lived (5-7 weeks) clones of highly activated NK cells. HLA-DR expression in the expanded NK cells correlated strongly with IFN-γ production. The second model, in which NK cells were restimulated mainly with IL-2 alone, produced long-lived clones (8-14 weeks) that expanded up to 10⁷ cells with lower ability to produce IFN-γ. Our method is applicable for studying variability in phenotype, proliferative and functional activity of the certain NK cell progeny in response to the stimulation, which may help in selecting NK cells best suited for clinical use.

The peripheral lymphatic system plays a crucial role in the recovery mechanisms after many pathological changes, such as infection, trauma, vascular, or metabolic diseases. The lymphatic clearance of different tissues from waste products, viruses, bacteria and toxic proteins significantly contributes to the correspondent recovery processes. However, understanding of the meningeal lymphatics functions is a challenging problem. The exploration of mechanisms of lymphatic communication with brain fluids as well as the role of the lymphatic system in the brain drainage, clearance and recovery are still in its infancy. Here we review novel concepts on the anatomy and physiology of the lymphatics in the brain, which warrant a substantial revision of our knowledge about the role of lymphatics in the rehabilitation of the brain functions after neural pathologies. We discuss a new vision on how to recruit the meningeal lymphatics by the opening of blood-brain barrier as a trigger mechanism of activation of the meningeal lymphatic drainage. This leads to innovative strategies in neurorehabilitation therapy.

Production of energy is a main task of cancer cells metabolism, since costs of duplicating are enormous. Although energy is derived in cells by dismantling carbon to carbon bonds of any macronutrient, cancer nutritional needs for energetic purposes have been studied primarily as dependent on glycolysis. Since the end of the last century, awareness of dependence of cancer metabolism on amino acids not only for protein syntheses but also for matching energy needs has grown. The roles of specific amino acids, like glutamine, glycine and serine have been explored in different experimental conditions and reviewed. Moreover, there are epidemiological evidences that some amino acids used as supplement for therapeutic reasons (the branched chain ones) may reduce incidence of liver cancer, and some molecular mechanism has been proposed as functional to their protective action. On the contrary, metabolic signature of some pathology connected with increased risk of cancer, like prolonged hyperinsulinemia in insulin resistant patients, is signed by plasma elevated levels of the same branched chain amino acids, posing puzzling questions to clinicians. Most recently, peculiar formulations of amino acids, deeply different if compared to amino acids compositions normally present in foods, have shown the power to master epigenetics slowing growth or driving cancer cells to apoptotic death, while being even beneficial for normal cells and for animals health and life span. In this review, we will analyze and try to disentangle some of the many knots dealing with complexities of amino acids biology and linked to cancer metabolism.

To circumvent the thermodynamic limitation of the synthesis of oxazolidinones starting from 2-aminoethanols and CO2 and realize incorporation CO2 under atmospheric pressure, a protic ionic liquid-facilitated three-component reaction of propargyl alcohols, CO2 and 2-aminoethanols was developed to produce 2-oxazolidinones along with equal amount of α-hydroxyl ketones. The ionic liquid structure, reaction temperature and reaction time were in detail investigated. And 15 mol% [TBDH][TFE] (1,5,7-triazabicylo[4.4.0]dec-5-ene trifluoroethanol) was found to be able to synergistically activate the substrate and CO2, thus catalyzing this cascade reaction under atmospheric CO2 pressure. By employing this task-specific ionic liquid as sustainable catalyst, 2-aminoethanols with different substituents were successfully transformed to 2-oxazolidinones with moderate to excellent yield after 12 h at 80 oC. This three-component reaction running under atmospheric pressure proves to be a clever detour to avoid the thermodynamic issue in the synthesis of 2-oxazolidinones starting from 2-aminoethanols and CO2.

The snow melt from the High Atlas is a critical water resource in Morocco. In spite of its importance, monitoring the spatio-temporal evolution of key snow cover properties like the snow water equivalent remains challenging due to the lack of in situ measurements at high elevation. Since 2015, the Sentinel-2 mission provides high spatial resolution images with a 5 day revisit time, which offers new opportunities to characterize snow cover distribution in mountain regions. Here we present a new data assimilation scheme to estimate the state of the snowpack without in situ data. The model was forced using MERRA-2 data and a particle filter was developed to dynamically reduce the biases in temperature and precipitation using Sentinel-2 observations of the snow cover area. The assimilation scheme was implemented using SnowModel, a distributed energy-balance snowpack model and tested in a pilot catchment in the High Atlas. The study period covers 2015-2016 snow season which corresponds to the first operational year of Sentinel-2A, therefore the full revisit capacity was not yet achieved. Yet, we show that the data assimilation led to a better agreement with independent observations of the snow height at an automatic weather station and the snow cover extent from MODIS. The performance of the data assimilation scheme should benefit from the continuous improvements in MERRA-2 reanalyses and the full revisit capacity of Sentinel-2.

Herpes simplex virus (HSV) infections can be treated with direct acting antivirals like acyclovir and foscarnet, but long-term use can lead to drug resistance, which motivates research into broadly-acting antivirals that can provide a greater genetic barrier to resistance. Photodynamic inactivation (PDI) employs a photosensitizer, light, and oxygen to create a local burst of reactive oxygen species that inactivate microorganisms. The botanical plant extract Orthoquin^TM is a powerful photosensitizer with antimicrobial properties. Here we report that Orthoquin also has antiviral properties. Photoactivated Orthoquin inhibited herpes simplex virus type 1 (HSV-1) and herpes simplex virus type 2 (HSV-2) infection of target cells in a dose-dependent manner, across a broad range of sub-cytotoxic concentrations. HSV inactivation required direct contact between Orthoquin and the inoculum, whereas pre-treatment of target cells had no effect. Orthoquin did not cause appreciable damage to viral capsids or pre-mature release of viral genomes as measured by qPCR for the HSV-1 genome. By contrast, immunoblotting for HSV-1 antigens in purified virion preparations suggested that higher doses of Orthoquin had a physical impact on certain HSV-1 proteins that altered protein mobility or antigen detection. Orthoquin PDI also inhibited the non-enveloped adenovirus (AdV) in a dose-dependent manner, whereas Orthoquin-mediated inhibition of the enveloped vesicular stomatitis virus (VSV) was light-independent. Together, these findings suggest that broad antiviral effects of Orthoquin-mediated PDI may stem from damage to viral attachment proteins.

An efficient, eco-compatible and very cheap method for the construction of triazoles via eliminative azide–olefin cycloaddition (EAOC) reaction has been developed by a catalytic system IL/FeCl3, offering an highly regioselective approach to structurally diverse 1,5-disubstituted 1,2,3-triazoles in up to 95% yield. This strategy features the reuse of catalytic system through simple operations. Mechanistic studies indicated that an asynchronous concerted dipolar cycloaddition-elimination process might be involved.

The combination of freeze-dried aronia, red ginseng, ultraviolet-irradiated shiitake mushroom and natokinase (AGM; 3.4: 4.1: 2.4: 0.1) was examined to evaluate its effects on insulin resistance, insulin secretion and gut microbiome in a non-obese type 2 diabetic animal model. Pancreatectomized (Px) rats were provided high fat diets supplemented with either of 1) 0.5 g AGM (AGM-L), 2) 1 g AGM (AGM-H), 3) 1 g dextrin (control), or 4) 1g dextrin with 120 mg metformin (positive-control) per kg body weight for 12 weeks. AGM (1 g) contained 6.22 mg cyanidin-3-galactose, 2.5 mg ginsenoside Rg3 and 0.6 mg β-glucan. Px rats had decreased bone mineral density in the lumbar spine and femur and lean body mass in the hip and leg compared to the normal-control and AGM-L and AGM-H prevented the decrease. Visceral fat mass was lower in the control group than the normal-control group and its decrease was smaller by AGM-L and AGM-H. HOMA-IR was lower in descending order of the control, positive-control, AGM-L, AGM-H and normal-control groups. Glucose tolerance was deteriorated in the control group and it was improved by AGM-L and AGM-H more than in the positive-control group. Glucose tolerance is associated with insulin resistance and insulin secretion. Insulin tolerance indicated insulin resistance was highly impaired in diabetic rats, but it was improved in the ascending order of the positive-control, AGM-L and AGM-H. Insulin secretion capacity, measured by hyperglycemic clamp, was much lower in the control group than the normal-control group and it was improved in the ascending order of the positive-control, AGM-L and AGM-H. Diabetes modulated the composition of gut microbiome and AMG prevented the modulation of gut microbiome. In conclusion, AGM improved glucose metabolism by potentiating insulin secretion and reducing insulin resistance in insulin deficient type 2 diabetic rats. The improvement of diabetic status alleviated body composition changes and prevented changes of gut microbiome composition.

Metformin use in pregnancy is increasing worldwide as randomised controlled trial (RCT) evidence is emerging demonstrating its safety and efficacy. The Metformin in Gestational Diabetes (MiG) RCT changed practice in many countries demonstrating that metformin had similar pregnancy outcomes to insulin therapy with less maternal weight gain and a high degree of patient acceptability. A multicentre RCT is currently assessing the addition of metformin to insulin in pregnant women with type 2 diabetes. RCT evidence is also available for the use of metformin for women with Polycystic Ovarian Syndrome and for non-diabetic women with obesity. No evidence of an increase in congenital malformations or miscarriages has been observed even when metformin is started before pregnancy and continued to term. Body composition and metabolic outcomes at two, seven and nine years have now been reported for the offspring of mothers treated in the MiG study. In this review, we will briefly discuss the action of metformin and then consider the evidence from the key clinical trials.

Though melatonin is known to improve ultraviolet B (UVB)-induced oxidative damage and inflammatory conditions via blockade of nuclear factor (NF)-κB, interleukin (IL)-6, there is no report on anti-wrinkle effect of melatonin to date. Hence in the present study, anti-wrinkle mechanism of melatonin was elucidated in UVB treated HaCaT keratinocytes and hairless mice. Herein melatonin protected against a radical initiator tert-Butyl hydroperoxide (t-BOOH) induced reactive oxygen species (ROS) production, matrix metalloprotease 1 (MMP-1) and cytotoxicity in HaCaT keratinocytes. Also, melatonin suppressed the expression of sonic hedgehog (SHH) and GLI for hedgehog signaling, p-NF-kB, cyclooxygenase (COX-2), p-ERK for inflammatory responses in UVB treated HaCaT keratinocytes. Furthermore, melatonin protected skin from wrinkle formation, transdermal water loss in hairless mice irradiated by UVB for 8 weeks. Notably, melatonin prevented against epidermal thickness and dermal collagen degradation in UVB irradiated hairless mice by Hematoxylin & Eosin and Masson’s trichrome staining. Taken together, these findings suggest that melatonin reduces wrinkle formation via inhibition of ROS/SHH and inflammatory proteins such as NF-kB/COX-2/ERK/MMP1.

Shiga toxin (Stx) produced by Escherichia coli is the main pathogenic factor of diarrhea-associated hemolytic uremic syndrome (HUS), which is characterized by obstruction of renal microvasculature by platelet-fibrin thrombi. It is well known that the oxidative imbalance generated by Stx induces platelet activation, contributing to thrombus formation. Moreover, activated platelets release soluble CD40 ligand (sCD40L) which in turn contributes to oxidative imbalance, triggering the release of reactive oxidative species (ROS) on various cellular types. The aim of this work was to determine if the interaction between the oxidative response and platelet-derived sCD40L participates in the pathogenic mechanism during HUS. Activated human glomerular endothelial cells (HGEC) by Stx2 induced platelets to adhere to them. Although platelet adhesion did not contribute to endothelial damage, high levels of sCD40L were released to the medium. The release of sCD40L by activated platelets was inhibited by antioxidant treatment. Furthermore, we found increased levels of sCD40L in plasma from HUS patients, which were also able to trigger the respiratory burst in monocytes, in a sCD40L-dependent manner. Thus, we concluded that platelet-derived sCD40L and the oxidative response are reciprocally stimulated during Stx2-associated HUS. This process may contribute to the evolution of glomerular occlusion and the microangiopathic lesions.

Distribution systems can form islands when faults occur. Each island represents a subsection with variable boundaries subject to the location of a fault(s) in the system. A subsection with variable boundaries is referred to as island in this paper. For operation in autonomous mode, it is imperative to detect the island configurations and stabilize these subsections. This paper presents a novel scheme for the detection of islanding boundaries and stabilizing the system during autonomous operation. In the first stage, a boundary detection method is proposed to detect the configuration of the island. In the second stage a dynamic voltage sensitivity factor (DVSF) is proposed to assess the dynamic performance of the system. In the third stage, a wide area load shedding program is adopted based on DVSF to shed the load in weak busbars and stabilize the system. The proposed scheme is validated and tested on a generic 18-bus system using a combination of EMTDC/PSCAD and MATLAB softwares.

β-Lactams are pharmacologically important compounds because of their various biological uses, including antibiotic and so on. β-Lactams were synthesized from benzylidene-inden derivatives and acetoxyacetyl chloride. The inhibitory effect of these compounds was also examined for human carbonic anhydrase I and II (hCA I, and II) and acetylcholinesterase (AChE). The results reveal that β-lactams are inhibitors of hCA I, II and AChE. The K_i values of β-lactams (2a-k) were 0.44-6.29 nM against hCA I, 0.93-8.34 nM against hCA II, and 0.25-1.13 nM against AChE. Our findings indicate that β-lactams (2a-k) inhibit both CA isoenzymes and AChE at low nanomolar concentrations.

Severe acute respiratory syndrome coronavirus 2 (SARS-Cov-2/2019-nCoV) infection is an emerging pandemic. The virus binds to angiotensin converting enzyme 2 (ACE2) and TMPRSS2 which are abundantly expressed on various human cells including lung epithelial cells and intestinal cells and the virus can infect these cells. Currently no specific treatments or vaccines are available for this disease. A per oral live attenuated vaccine can be beneficial in SARS-Cov-2 infection because the attenuated virus initially infects the gut, stimulates the mucosa associated immune system sparing the respiratory system during the initial immune response. The live virus can also spread in the community boosting herd immunity.

Traditional photodynamic therapy (PDT), a clinical cancer therapeutic approach using light in killing cancer cells, is often limited by insufficient light penetration, inefficient photosensitizer energy transfer, and inadequate oxygen in hypoxic tumors. Employing X-ray to activate photosensitizer in PDT can potentially overcome these limitations. Here, we compared protocols to synthesize a novel nano-photosensitizer composed of a europium-doped yttrium oxide core with a silica shell (Y₂O₃:Eu@SiO₂) which can be utilized in such therapeutic method, i.e., X-ray activated PDT (XPDT). Transmission electron microscopy (TEM) and dihydroethidium (DHE) were utilized to evaluate the effects of various synthesis conditions on the characteristics of Y₂O₃:Eu@SiO₂ and their ability to generate reactive oxygen species (ROS). The in vivo tumor suppression effects of the Y₂O₃:Eu@SiO₂ were assessed by ¹⁸F-fluorothymidine position emission tomography (¹⁸F-FLT PET) in human ovarian cancer xenografts using radiation sensitive CAOV3 and radiation resistant SKOV3 cell lines. Our data revealed a positive correlation between nanoparticle condensation time and core size as well as a negative correlation between urea concentrations and core size. Addition of cetyltrimethylammonium bromide (CTAB) during core synthesis enhanced particle dispersion. Two silica coating conditions showed the greatest efficiency in the enhancement of ROS generation. Furthermore, our in vivo study revealed suppression of tumor growth by Y₂O₃:Eu@SiO₂ administration when compared to non-treated control. Silica shell provides flexibility to conjugate moieties that specifically target to cancers. This nano-photosensitizer demonstrates the significant promise for overcoming limitations of conventional PDT and combating various cancers in clinical applications.

(1) Background: The COVID-19 pandemic had a devastating impact on the world, causing widespread illness and death. It is essential to focus on prevention strategies to limit the spread of the disease. Despite the advent of vaccines, maintaining a vigilant approach to prevention remains paramount. While vaccines are essential, they do not guarantee absolute immunity, and their protective effect may diminish over time; (2) Methods: We reviewed effective strategies to prevent COVID-19 transmission. We focused on me-ta-analyses (MA), literature reviews (LR) and the health care context. Various prevention measures and interventions were reviewed. Both es-tablished practices and unresolved issues were considered; (3) Results: Standard precautions (SP) as the cornerstone of infection control, with hand hygiene and mask use as key components. Debate about the relative importance of droplet versus aerosol transmission led to differences in recommendations between agencies at the onset of the pandemic. We have clarified the role of personal protective equipment (PPE), including eye protection. The effectiveness of masks in pre-venting transmission is reviewed. The use of surgical masks is recommended to prevent droplet transmission, while eye protection is recommended in combination with masks. Although data show some risk reduction, the clear superiority of N95/FFP2 over surgical masks remains unproven. In terms of room occupancy, ventilation is critical in reducing the risk of transmission in poorly ventilated environments. The use of negative pressure isolation rooms (NPIRs) is being investigated. The presence of viral RNA on surfaces does not necessarily indicate infectivity, and the risk of transmission by surface contact is low if surfaces are properly maintained and hand hygiene is practised regularly. Testing for SARS-CoV-2 in asymptomatic persons in healthcare settings may help prevent transmission; (4) Conclusions: Prevention of SARS-CoV-2 transmission requires a multifaceted approach, including reducing particle emissions from infected persons by wearing masks, eliminating aerosols by ventilation, ensuring physical separation, and protecting exposed persons with masks and eye protection.

Evidence-based medicine (EBM) is in crisis, in part due to bad methods, which are understood as misuse of statistics that is considered correct in itself. This article exposes two related common misconceptions in statistics, the effect size (ES) based on correlation (CBES) and a misconception of contingency tables (MCT). CBES is a fallacy based on misunderstanding of correlation and ES and confusion with 2 × 2 tables, which makes no distinction between gross crosstabs (GCTs) and contingency tables (CTs). This leads to misapplication of Pearson’s Phi, designed for CTs, to GCTs and confusion of the resulting gross Pearson Phi, or mean-square effect half-size, with the implied Pearson mean square contingency coefficient. Generalizing this binary fallacy to continuous data and the correlation in general (Pearson’s r) resulted in flawed equations directly expressing ES in terms of the correlation coefficient, which is impossible without including covariance, so these equations and the whole CBES concept are fundamentally wrong. MCT is a series of related misconceptions due to confusion with 2 × 2 tables and misapplication of related statistics. The misconceptions are threatening because most of the findings from contingency tables, including CBES-based meta-analyses, can be misleading. Problems arising from these fallacies are discussed and the necessary changes to the corpus of statistics are proposed resolving the problem of correlation and ES in paired binary data. Since exposing these fallacies casts doubt on the reliability of the statistical foundations of EBM in general, we urgently need to revise them.

Cornea severe inflammation produces opacity or even perforation, scarring, and angiogenesis, resulting in blindness. The cornea can be used to study the effect of new anti-angiogenic chemopreventive agents. We researched the anti-angiogenic effect of two extracts, Methanol (Met) and Hexane (Hex), from the seed of Cucurbita argyrosperma, in the inflamed corneas. The corneas of Wistar rats were alkali-injured and treated intragastrically for seven successive days. Clinical manifestation as opacity score, corneal neovascularization (CNV) area, re-epithelialization percentage, and histological evaluation were performed. Inflammatory (COX-2, NF-κB, and IL-1β), and angiogenic (VEGF-A, VEGFR1, VEGFR2) markers were assessed by immunohistochemistry. Cox-2, Il-1β, and Vegf-a mRNA levels were also determined. After treatments, we observed slim corneal thickness with lower opacity scores and low cell infiltration compared to untreated rats. Treatment also accelerated wound healing and decreased CNV area. The staining of inflammatory and angiogenic factors was significantly decreased. These effects are related to a down-expression of Cox-2, Il-1β, and Vegf. These results suggest that intake of C. argyrosperma seed can be used to attenuate the angiogenesis secondary to inflammation in corneal chemical damage.

Appropriate animal models of human diseases are a cornerstone in the advancement of science and medicine. To create animal models of neuropsychiatric and neurobehavioral diseases such as ASD necessitates the development of sufficient neurobehavioral measuring tools to translate human behavior to expected measurable behavioral features in animals. Indeed, at least in rodents, adequate neurobehavioral and neurological tests have been developed. Since ASD is characterized by a number of specific behavioral trends with significant severity, animal models of autistic-like behavior have to demonstrate the specific characteristic features, namely impaired social interactions, and communication, restricted, repetitive behavioral patterns with association to several additional impairments such as somatosensory, motor and memory impairments. Thus, an appropriate model must show behavioral impairment of a minimal number of neurobehavioral characteristics using an adequate number of behavioral tests. The proper animal models enable the study of ASD like-behavior from the etiologic, pathogenetic and therapeutic aspects. From the etiologic aspects, models have been developed by the use of immunogenic substances like polyinosinic-polycytidylic acid (PolyIC), Lipopolysaccharide (LPS) and propionic acid or other well-documented immunogens or pathogens, like mycobacterium tuberculosis. Another approach is the use of chemicals like valproic acid, Polychlorinated biphenyls (PCBs), organophosphate pesticides - chlorpyrifos (CPF) and others. These substances were administered either prenatally, generally after the period of major organogenesis, or, especially in rodents, during the early postnatal life. In addition, using modern genetic manipulation methods, genetic models have been created of almost all human genetic diseases that are manifested by autistic like behavior (i.e. fragile X, Rett syndrome, SHANK gene mutation Neuroligin genes and others). Ideally, we should not only evaluate the different behavioral modes affected by the ASD-like behavior but also assess the severity of the behavioral deviations by an appropriate scoring system, as applied to humans.

The increasing concern regarding climate change continues to motivate research in the Arctic. Within the delicate cycle of the cryosphere, leads are an important kinematic feature that regulate heat balances in the Arctic. Therefore, it is necessary to quantify the genesis of leads over time to identify when and where changes are occurring. The use of a principal component analysis (PCA) is one such tool that is used to identify the characteristics of seasonal ice variability. The PCA not only identifies “normal” or “dominant” conditions or features, but also extract anomalous spatial features from an archive of long-term sequence of images.

(1) Background: Several chronic respiratory diseases could be a risk factor for acquiring SARS-CoV-2 infection: among them, Primary Ciliary Dyskinesia (PCD) is a rare (about 1:10.000) inherited ciliopathy (MIM 242650) characterized by recurrent upper and lower respiratory tract infections due to a dysfunctioning of the respiratory cilia; We aimed to investigate if some polymorphisms of the TAS2R38 bitter taste receptor correlate with an increased prevalence of SARS-CoV-2 infection and severity of symptoms in a cohort of PCD subjects; (2) Methods: Patients answered several questions about possible SARS-CoV-2 infection, experienced symptoms and vaccinations; in case of infection, they also filled out a SNOT-22 and ARTIQ questionnaires; (3) Results: Forty PCD adult patients (mean age 36.6 ± 16.7 years, 23 females) participated to the study, out of which 30 % had tested positive for COVID-19 during the last four years; most of them reported a mildly symptomatic disease. We found no differences in age or sex, but a statistic significant difference (p=0.03) was observed in body mass index (BMI), that was higher in the COVID-acquired group (23.2 ± 3.3 vs 20.1 ± 4.1 kg/m2). Genotyping for TAS2R38 polymorphisms showed a prevalence of 28.6% PAV/PAV, 48.6% PAV/AVI and 22.8% AVI/AVI individuals in our cohort. In contrast to our hypothesis, we did not observe a protective role of PAV allele towards SARS-CoV-2 infection; (4) Conclusions: Our findings suggest that subjects with PCD may not be at increased risk of severe outcomes from COVID-19 and the TAS2R38 bitter taste receptor genotype type does not affect SARS-CoV-2 infection.

A phase 1-2, prospective, multicenter, randomized, open-label clinical trial (Code RPCEC00000382, https://rpcec.sld.cu/trials/RPCEC00000382-En/), with parallel groups, involving 1161 participants was designed to assess safety and immunogenicity of two Cuban COVID-19 vaccines (Mambisa and Abdala) in boosting COVID-19 immunity of convalescent adults after receiving one dose of either vaccine. The main safety outcome was severe vaccination adverse events occurring in <5% of vaccinees. Main immunogenicity success endpoints were ≥4-fold anti-RBD IgG seroconversion or ≥20% increase in ACE2-RBD inhibitory antibodies in >55% of vaccinees in Phase 1 and >70% in Phase 2. Neutralizing antibody titers against SARS-CoV-2 variants were evaluated. Both vaccines were safe; no deaths or severe adverse events occurred. Mild intensity adverse events were the most frequent (>73%); headache predominated for both vaccines. Phase 1 responders were 83.3% (p = 0.0018) for Abdala. Mambisa showed similar results. Phase 2 responders were 88.6% for Abdala (p <0.0001) and 74.2% for Mambisa (p = 0.0412). In both phases, anti-RBD IgG titers, inhibition percentages and neutralizing antibody titers increased significantly after the booster dose. Both vaccines were safe and their immunogenicity surpassed the study endpoints.

This study describes the synthesis and characterization of mixed hydrotalcite–organosilica membrane for gas separation. Hydrotalcite exhibits the capability to adsorb carbon dioxide at elevated temperatures. High surface area and favorable coating properties are essential to harness its potential for practical applications. Stable alcohol-based dispersions are needed for thin film applications of mixed membranes containing hydrotalcite. Currently, producing such dispersions without the need for delamination and dispersion agents is a challenging task. This work introduces for the first time a manufacturing approach to overcoming the drawbacks mentioned above. It includes a synthesis of hydrotalcite nanoparticles, followed by agent-free delamination of their layers and final dispersion into alcohol without dispersion agents. Further, the hydrotalcite-derived sorption agent is dispersed in a matrix based on organo-silica gels derived from 1,2-bis(triethoxysilyl)ethane (BTESE). The analytical results indicate that the interconnection between hydrotalcite and BTESE-derived gel occurs via forming a strong hydrogen bonding system between the interlayer species (OH groups, CO32-) of hydrotalcite and oxygen and silanol active gel centers. These findings lay the foundation for applications involving incorporating hydrotalcite-like compounds into silica matrices, ultimately enabling the development of materials with exceptional mass transfer properties. In part 2 of this study, gas separation performance of the organo-silica and the hydrotalcite-like materials and their combined form will be investigated

In late December 2019 a novel RNA beta-coronavirus was recognized as the causative agent of previously pneumonia cases of unknown origin. The virus was successively named Severe Acute Respiratory Syndrome CoronaVirus 2 (SARS-CoV-2) as well as the respiratory illness that it causes Coronavirus disease 19 (COVID-19) (1, 2). The global spread of SARS-CoV-2 and the thousands of deaths caused by COVID-19 led the World Health Organization (WHO) to declare a pandemic on 11 March 2020. To date, the world has paid a high toll in this pandemic in terms of human lives lost, economic repercussions and increased poverty. Indeed, even if most patients with COVID-19 are asymptomatic or experience mild self-limiting disease, 14% of them progress to severe disease and 5% to critical illness with complications, such as interstitial pneumonia, respiratory failure with acute respiratory distress syndrome (ARDS) and multiple organ dysfunction syndromes (MODS) (3). It is accepted that SARS-CoV-2 primarily affects the respiratory system, although other organs are also involved (4). The virus enters host cells by attaching its Spike like surface projections to the angiotensin-converting enzyme-2 (ACE2) receptor which is mainly expressed on alveolar epithelial cells and in nearly all human organs in varying degrees. Thus, although the central target of SARS-CoV-2 infection is the lung, the wide distribution of ACE2 receptors in other organs may lead to cardiovascular, gastrointestinal, kidney, liver, central nervous system and ocular damages that have to be closely monitored during the disease (5, 6). The virus then activates the innate and adaptive immune system resulting in a large number of cytokines release, known as “cytokine storm”, that is directly correlated with tissue injury and unfavourable prognosis of severe lung disease (7). In particular, interleukin (IL)-6 seems to plays an important role in driving this cytokine release so that its increased levels have been recognized as a hallmark inflammatory signature in sera of COVID-19 patients (8). IL-6 is a polyfunctional cytokine with both anti-inflammatory and pro-inflammatory properties which exerts its several functions through two main signal transduction pathways (9). In the classical signal transduction pathway, IL-6 binds to IL-6-trans membrane receptor (IL-6R) to form a complex that, then, binds to the trans membrane glycoprotein gp130, inducing its homo-dimerization and initiating intracellular signal transduction. This kind of signaling is limited to cells (hepatocytes, macrophages, neutrophils, T cells, etc.) that express IL-6R on their cell surface (10). Nevertheless, cells do not express IL- 6R, as stromal and epithelial cells, are able to still respond to IL-6 because the soluble form of the receptor (sIL-6R) binds to IL-6 in circle and then anchors to membrane gp130 receptor, initiating the trans-signaling pathway. For this reason, sIL-6R is able to increase the function of IL-6 and is considered the agonist form of its receptor. When the level of IL-6 increases, its effects are widely expressed because gp130 molecules are ubiquitous and, therefore, also present in cells without IL-6R in the membrane form. On the contrary, a soluble form of the glycoprotein 130 (sgp130) can complex with sIL-6R to prevent the sIL-6R from binding to the membrane-bound gp130. In this case sgp130 is able to decrease the function of IL-6 and is considered the antagonist form of IL-6 receptor system (11). Based on the central role of IL-6 in the inflammatory pathology of COVID-19 and the consistent association between elevated levels of the cytokine and severe disease outcomes found in the first phase of infection, we sought to analysis IL-6 and its soluble receptor complex behavior during the different waves of COVID-19 pandemic, in order to evaluate the possible differences which occur among them and to hypothesize if they might be used as prognostic markers of disease severity.

Formaldehyde (HCHO), an indoor volatile organic compound, is seriously harmful to human health. Therefore, green and effective decomposition of HCHO is essential. TiO₂ has been employed for the degradation of HCHO via photocatalytic generation of reactive oxygen species (ROS) (O^2-, ·OH), yet the low specific surface area of crystalline TiO₂ depressed the catalytic performance. Herein, we prepared TiO₂ aerogels with high specific surface area and high porosity by sol-gel method, and added PVA to introduce flexible molecular chains for pore size regulation. The photocatalytic performance test verifies that the pore size of TiO₂ aerogel is one of the important factors for HCHO decomposition. Notably, through the establishment of theoretical model and calculation, we validated that the efficiency of HCHO decomposition is related to the oxygen pressure in the pores of TiO₂ aerogel, and the oxygen pressure is inversely proportional to the pore size. Accordingly, the optimal pore size of TiO₂ aerogel for the photocatalytic HCHO decomposition is 2 nm~10 nm. This study provides a theoretical idea for TiO₂ aerogels in the decomposition reaction of HCHO, which is expected to inspire more breakthroughs in the study of TiO₂ aerogels for green chemistry.

We produced a recombinant eel luteinizing hormone (rec-eel LH) analog with high potency in Chinese hamster ovary DG44 (CHO DG44) cells. The eel LH mutant (LH-M), which had a linker comprising the equine chorionic gonadotropin (eCG) β-subunit carboxyl-terminal peptide (CTP) region (amino acids 115 to149), was inserted between the β-subunit and α-subunit of wild-type tethered eel LH (LH-wt). Monoclonal cells transfected with the eel LH-wt and eel LH-M plasmids were isolated from five and nine clones of CHO DG44 cells, respectively. The secreted quantities abruptly increased on day 3, with peak levels of 5,000–7,500 ng/mL on day 9. The molecular weight of eel LH-wt was 32–36 kDa while that of eel LH-M increased to approximately 38–44 kDa, indicating the detection of two bands. Treatment with peptide N-glycanase F decreased the molecular weight by approximately 8 kDa. The oligosaccharides at the eCG β-subunit O-linked glycosylation sites were appropriately modified post-translation. The EC50 value and maximal responsiveness of eel LH-M increased by approximately 2.90- and 1.29-fold, respectively, indicating that the mutant exhibited more potent biological activity than eel LH-wt. Phosphorylated extracellular regulated kinase (pERK1/2) activation resulted in a sharp peak 5 min after agonist treatment, with a rapid decrease thereafter. These results indicate that the new rec-eel LH analog which contains the eCG β-subunit CTP linker comprising O-linked glycosylation sites, had more potent activity than the wild-type in vitro. Taken together, this new eel LH analog can be produced in large quantities using a stable CHO DG44 cell system.

In this research, the primary goal was to investigate the relationship between strategic planning and organizational performance in Iraq's manufacturing context. The study's primary data sources were 360 manager respondents. The structured questionnaire was used to collect primary data from manufacturing firms located throughout Iraq. To analyze the result, the researcher used descriptive statistics, correlation, and multiple regression analysis. SPSS version 16 software was used to conduct data analysis. The result reveals that the process of strategic planning has a beneficial effect on financial performance. Environmental scanning has a statistically significant positive effect on a company's non-financial performance. Management participation and planning formality positively and statistically significantly affect a business's non-financial performance at the 10 percent level. The domain of strategy and technique has not impacted the company's non-financial performance.

This study aimed to produce single-chain recombinant eel follicle-stimulating hormone (rec-eel FSH) analogs with high activity in Chinese hamster ovary DG44 (CHO DG44) cells. We recently reported that an O-linked glycosylated carboxyl-terminal peptide (CTP) of the equine chorionic gonadotropin (eCG) β-subunit plays contributes on high activity and time-dependent secretion in mammalian cells. We constructed a mutant (FSH-M) in which a linker including the eCG β-subunit CTP region (amino acids 115 to149) was inserted between the β-subunit and α-subunit of wild-type single chain eel FSH (FSH-wt). Plasmids containing eel FSH-wt and eel FSH-M were transfected into CHO DG44 cells. Single cells expressing each protein were isolated from 10 and 7 clones, respectively. Secretion increased gradually during the cultivation period and peaked at 4,000–5,000 ng/mL on day 9. The molecular weight of eel FSH-wt was 34–40 kDa, while that of eel FSH-M increased substantially, with two bands at 39–46 kDa. Treatment with PNGase F to remove the N glycosylation sites decreased the molecular weight remarkably to approximately 8 kDa. The EC50 value and maximal responsiveness of eel FSH-M were approximately 1.23- and 1.06-fold higher than those of eel FSH-wt, indicating that the mutant showed slightly higher biological activity. Phosphorylated extracellular regulated kinase (pERK1/2) activation exhibited a sharp peak at 5 min, followed by a rapid decline. These findings indicate that the new rec-eel FSH molecule with the eCG β-subunit CTP linker showed potent activity and could be produced in massive quantities using the stable CHO DG44 cell system.

A two-year experiment was conducted with a local maize hybrid under full irrigation (F), deficit irrigation (D) and rainfed conditions (R) to estimate maize evapotranspiration in Bosnia and Herzegovina. Three approaches (Allen & Pereira (A&P), SIMDualKc (SD), and Vegetation Index (VI)) were used to estimate the actual crop coefficient (Kc act), actual basal crop coefficient (Kcb act), and actual crop evapotranspiration (ETc act) were applied with the dual crop coefficient method and remote sensing (RS) data. While Kcb act from all approaches matched FAO56 tabulated values, SD showed differences, in comparison to A&P, of up to 0.24 in D and R conditions, especially in initial and mid-season stages. VI demonstrated very good performance in all treatments. In F, the obtained Kc act for all approaches during the initial and end stages were higher than the tabulated values, ranging from 0.71-0.87 for Kc ini act and from 0.80-1.06 for Kc end act, while the mid-season period showed very good agreement with the literature. Maize crop evapotranspiration range is 769-813 mm, 480-752 mm, and 332-618 mm for F, D and R, respectively. The results confirmed the suitability of both approaches (SD and VI) to estimate maize crop evapotranspiration under F, with the VI approach demonstrating an advantage in calculating Kcb act, Kc act, and ETc act values under water stress conditions. The 67.6% increase in grain yields with irrigation emphasizes the need to transition from rainfed to irrigation-dependent agriculture, even for drought-resistant crops like maize.

: Climate change necessitates urgent actions to mitigate carbon dioxide (CO2) emissions from fossil fuel-based energy generation. Among various strategies, the deployment of carbon capture and storage (CCS) solutions are critical for reducing emissions from point sources such as power plants and heavy industries. In this context, cryogenic carbon capture (CCC) via desublimation has emerged as a promising technology. While CCC offers high separation efficiency, minimal downstream compression work, and integration potential with existing industrial processes, challenges such as low operating temperatures and equipment costs persist. Ongoing research aims to address these hurdles in order to optimize the desublimation processes for widespread implementation. This review consolidates diverse literature works, providing insights into the strengths and limitations of CCC technology, including the latest pilot plant scale demonstrations. The transformative potential of CCC is first assessed on a theoretical basis, such as thermodynamic aspects and mass transfer phenomena. Then, recent advancements in the proposed process configurations are critically assessed and compared through key performance indicators. Furthermore, future research directions for this technology are clearly highlighted.

Proteases represent common targets in combating infectious diseases including COVID-19. The 3-chymotrypsin-like protease (3CLpro) is a validated molecular target for COVID-19 and it is key for developing potent and selective inhibitors for inhibiting viral replication of SARS-CoV-2. In this review, we discuss structural relationships and diverse subsites of 3CLpro, shedding light on the pivotal role of dimerization and active site architecture in substrate recognition and catalysis. Our analysis of bioinformatics and other published studies unveil a proposal of a novel catalytic mechanism for the SARS-CoV-2 polyprotein cleavage by 3CLpro, centering on the triad mechanism involving His41-Cys145-Asp187 and its indispensable role in viral replication. Recognizing Asp187 as a crucial component in the catalytic process underscores its significance as a fundamental pharmacophoric element in drug design. Next, we provide an overview of both covalent and non-covalent inhibitors, elucidating advancements in drug development observed in preclinical and clinical trials. By highlighting various chemical classes and their pharmacokinetic profiles, our review aims to guide future research directions toward the development of highly selective inhibitors, underscore the significance of 3CLpro as a validated therapeutic target, and propel the progression of drug candidates through preclinical and clinical phases.

Long COVID, a name often given to the persistent symptoms following acute SARS-CoV-2 infection, poses a multifaceted challenge for health. This review explores the intrinsic relationship between comorbidities and autoimmune responses in shaping the trajectory of long COVID. Autoantibodies have emerged as significant players in COVID-19 pathophysiology, with implications for disease severity and progression. Studies show immune dysregulation persisting months after infection, marked by activated innate immune cells and high cytokine levels. The presence of autoantibodies against various autoantigens suggests their potential as comorbid factors in long COVID. Additionally, the formation of immune complexes may lead to severe disease progression, highlighting the urgency for early detection and intervention. Furthermore, long COVID is highly linked to cardiovascular complications and neurological symptoms, posing challenges in diagnosis and management. Multidisciplinary approaches, including vaccination, tailored rehabilitation, and pharmacological interventions, are used for mitigating long COVID's burden. However, numerous challenges persist, from evolving diagnostic criteria to addressing the psychosocial impact and predicting disease outcomes. Leveraging AI-based applications holds promise in enhancing patient management and improving our understanding of long COVID. As research continues to unfold, unravelling the complexities of long COVID remains paramount for effective intervention and patient care.

Despite Low Power Wide Area Networks’ ability to offer an extended range, it might still encounter challenges with coverage blind spots in the network. This article proposes an innovative energy-efficient nature-inspired relay selection algorithm for LoRa-based LPWAN networks, serving as a solution for challenges related to poor signal range in areas with limited coverage. A behavior swarm-inspired approach has been utilized to select the relays’ localization in the network, providing network energy efficiency and radio signal extension. These relays help bridge communication gaps, significantly reducing the impact of coverage blind spots by forwarding signals from devices with poor direct connectivity with the gateway. The proposed algorithm considers critical factors for the LoRa standard, such as the Spreading Factor or device energy budget analysis. The simulation experiments validate the proposed scheme’s effectiveness in terms of energy efficiency under diverse multi-gateway topology scenarios involving thousands of devices. Specifically, it has been verified that the proposed approach outperforms the reference method in preventing the battery depletion of relays, which is vital for battery-powered IoT devices. Furthermore, for some large-scale problems, the proposed heuristic method achieves over twice the speed of the exact method with a negligible accuracy loss of less than 2%.

Gastric inflammation-related disorders are commonly observed digestive system illnesses char-acterized by the activation of proinflammatory cytokines, particularly tumor necrosis factor-α (TNF-α). This results in the induction of cyclooxygenase-2 (COX-2)/prostaglandin E2 (PEG2) and matrix metallopeptidase-9 (MMP-9). These factors contribute to the pathogenesis of gastric in-flammation disorders. We examined the preventive effects of Lonicera japonica Thunb. ethanol ex-tract (Lj-EtOH) on gastric inflammation induced by TNF-α in normal GES-1 cells. The GES-1 cell line was used to establish a model that simulated the overexpression of COX-2/PGE2 and MMP-9 proteins induced by TNF-α, to examine the anti-inflammatory properties of Lj extracts. The re-sults indicated that Lj-EtOH exhibits significant inhibitory effects on COX-2/PEG2 and MMP-9 ac-tivity, attenuates cell migration, and provides protection against TNF-α-induced gastric inflam-mation. The protective effects of Lj-EtOH are associated with the modulation of COX-2/PEG2 and MMP-9 through activation of TNFR–ERK 1/2 signaling pathways as well as the involvement of c-Fos and nuclear factor kappa B (NF-κB) signaling pathways. Based on our findings, Lj-EtOH ex-hibits a preventive effect on human gastric epithelial cells. Consequently, it may represent a novel treatment for the management of gastric inflammation.

Based on screening in computational biology and biological in vitro assays, five natural products isolated from extracts of the herbal medicine toad skin, such as cinobufagin (CBFi), bufalin (BFi), arenobufagin (ABFi), telocinobufagin (TBFi), bufotalin (BFTi), were subjected to molecular docking calculations with the use of SARS-CoV-2 main protease (PDB 6LU7 and 7BTF) and top-scoring ligand-receptor complexes were obtained. The results showed that the binding energy of ABFi to the 3CL protein was -17.044kcal/mol, which was higher than CBFi and TBFi. However, the binding energy of ABFi to the RdRp protease was -23.250 kcal/mol, which was much lower than that of CBFi and TBFi, EVEN lower than that of ABFi to the 3CL protein. ABFi also has polar interactions with amino acids such as Glu811, Ser814, Ser681 and Thr680 of RdRp enzyme. The results revealed that ABFi had a moderate inhibitory effect on the cell proliferation of SARS-CoV-2 in vitro, with an inhibition rate of 61.12%, even weaker than Remdesivir. This new discovery provides us with new ideas for in-depth studies on the development of natural products with this class of structural generalizations as inhibitors of SARS-CoV-2, and provides an experimental basis for the next step of mechanistic studies.

Hepatocellular carcinoma (HCC) is a heterogeneous malignancy with complex carcinogenesis. Although there has been significant progress in the treatment of HCC over the past decades, drug resistance to chemotherapy remains a major obstacle in its successful management. In this study we were able to reduce chemoresistance in cisplatin-resistant HepG2 cells by either silencing the expression of transglutaminase type 2 (TG2) using siRNA or by pre-treatment of cells with the TG2 enzyme inhibitor cystamine. Further analysis revealed that, whereas the full-length TG2 isoform (TG2-L) was almost completely cytoplasmic in its distribution, the majority of the short TG2 isoform (TG2-S) was membrane-associated in both parental and chemoresistant HepG2 cells. Following induction of cisplatin toxicity in non-chemoresistant parental cells, TG2-S together with cisplatin quickly relocated to the cytosolic fraction. Conversely, no cytosolic relocalisation of TG2-S or nuclear accumulation cisplatin was observed following identical treatment of chemoresistant cells, where TG2-S remained predominantly membrane-associated. This suggests that deficient subcellular relocalisation of TG2-S from membranous structures into the cytoplasm may limit the apoptic response to cisplatin toxicity in chemoresistant cells. Structural analysis of TG2 revealed the presence of binding motifs for interaction of TG-S with the membrane scaffold protein LC3/LC3 homologue that could contribute to a novel mechanism of chemotherapeutic resistance in HepG2 cells.

During the last two decades several cases of venous thrombosis (VTE) after a prolonged period at a computer has been described, denominated “eThrombosis”. Video gaming on a computer has become very popular and can be a social activity where several players are gathered to play against each other or in a virtual environment for several days (“LAN (i.e., Local Area Network) parties”) where the participants are sedentary and consuming calorie-rich food items. The aim of this study was to investigate a potential coagulation activation during a 42 hour LAN party. Nine male gamers volunteered for the LAN party. Citrated blood was sampled before and every 6 hours, and plasma was analyzed for thrombin generation, and Thrombin-antithrombin-complexes (TAT), prothrombin Fragment 1+2 (F1+2), and D-dimer. Thrombin generation increased slightly but not significantly during the LAN party, whereas the coagulation activation markers were unchanged. These results do not indicate that the coagulation system is activated significantly during 42 h gaming with minimal physical activity. Although an increased activity cannot be excluded, it does not directly indicate a risk of VTE in general. It may be specific and particularly susceptible in-dividuals who are prone to thrombosis and, therefore, are at risk of developing e-thrombosis.

Background: The monocyte-phagocyte system (MPS), including monocytes/macrophages and dendritic cells (DCs), plays a key role in anti-viral immunity. We aimed to analyze the prognostic value of the MPS components on in-hospital mortality in a cohort of 58 patients (M/F ; mean ageSD years) with COVID-19 pneumonia and 22 age- and sex-matched healthy controls. Methods: We measured frequencies and absolute numbers of peripheral blood CD169+ monocytes, conventional CD1c+ and CD141+ (namely cDC2 and cDC1), and plasmacytoid CD303+ DCs by means of multi-parametric flow cytometry. A gene profile analysis of 770 immune-inflammatory related human genes and 20 SARS-CoV-2 genes was also performed. Results: Median frequencies and absolute counts of CD169-expressing monocytes were significantly higher in COVID-19 patients than in controls (p 0.04 and p 0.01, respectively). Conversely, percentages and absolute numbers of all DC subsets were markedly depleted in patients (p

Nucleoside analogs are commonly used drugs for the treatment of cancer and viral infections. Nucleoside deoxyribosyltransferase (NDT) is one of the key enzymes required for the biosynthesis of deoxynucleotides. The feasibility of biochemical transformation processes is usually greatly dependent on the cost of biocatalysts. Therefore, immobilizing and reusing biocatalysts is an approach to be considered to bring biotransformations closer to industrial feasibility, since it not only allows enzymes to be reused but can also improve their stability under several reaction conditions. In this work, histidine tags have been successfully fused to a Nucleoside deoxyribosyltransferase from Lactobacillus reuteri (LrDNT), which has been produced in a bench-scale reactor using a facile araBAD promoter-based protein expression system in an industrial microorganism, the E. coli BL21(DE3) strain. The overexpressed LrNDT was bound to a nickel-chelating agarose affinity chromatography medium via a one-step purification and immobilization process with a 99% yield, retaining about 97% of its initial activity. The optimal conditions for the immobilized LrNDT maintain high enzyme activity within the range of 20-45°C and pH 6.0-7.5. Finally, the immobilized enzyme reactor (IMER) of LrNDT was applied for the continuous-flow biosynthesis of 2'-deoxyadenosine and retained 90% of its activity after 16 hours, providing a theoretical basis for the industrial production of nucleoside analogs.

The late diagnosis of Type 2 Diabetes Mellitus can occur due to lack of access to the primary health care system and the non-manifestation of symptoms. Faced with this problem, this work presents the creation of a mobile application, called DiabetesCheck, for predicting the risk of Type 2 Diabetes Mellitus. A mathematical model is used, which classifies the risk of Type 2 Diabetes Mellitus for a group of patients with intervention and for a comparative group, using Fuzzy Classification and Decision Trees. The proposed application allows the health professional to monitor patients through the history stored in a database, allowing a representation of the evolution of patients and indication of medications. Therefore, this proposal aims to carry out the diagnosis in the initial phase of the disease and help in the prescription of more effective treatments and in the proposition of public policy strategies in epidemiology and screening.

Despite widespread vaccination, early treatments, and improved understanding of the disease, the effects of SARS-CoV-2 infection remain significant worldwide. Many patients still suffer from severe COVID-19, necessitating admission to intensive care units. Remdesivir is a primary treatment option among viral RNA polymerase inhibitors for hospitalized SARS-CoV-2 patients. However, there is a lack of studies examining factors influencing its effectiveness in this context. We conducted a retrospective study throughout 2022, analyzing clinical, laboratory, and sociodemographic data from 252 hospitalized COVID-19 patients treated with remdesivir. Six machine learning algorithms were compared and validated to predict factors associated with the loss of clinical benefit from remdesivir in terms of mortality and hospital stay. Data were extracted from electronic health records. The eXtreme Gradient Boost (XGB) method achieved the highest balanced accuracy for both mortality (95.45%) and hospital stay (94.24%). Factors associated with worse outcomes of remdesivir use in terms of mortality included limitation of life support treatment, need for ventilatory support (especially invasive mechanical ventilation) on day 14 after the first dose of remdesivir, lymphopenia, low levels of albumin and hemoglobin, presence of flu and/or coinfection, and cough. Factors associated with worse outcomes of remdesivir use in terms of hospital stay included the number of doses of the COVID-19 vaccine, patchy lung density, bilateral pulmonary radiological status, number of comorbidities, oxygen therapy, troponin and lactate dehydrogenase levels, and asthenia. These findings highlight the effectiveness of XGB as a strong candidate for accurately categorizing COVID-19 patients undergoing remdesivir treatment.

Nanocomposites of TiO₂ Degussa P25 nanoparticles/activated carbon (TiO₂/AC ) were prepared at various mass ratios of (4:1), (3:2), (2:3), and (1:4) by a facile process. The effects of TiO₂/AC mass ratios on the structural, morphological, and photocatalytic properties were systematically studied in comparison with bare TiO₂ and bare AC. TiO₂ nanoparticles exhibited dominant anatase and minor rutile phases, and a crystallite size of approximately 21 nm; while AC had XRD peaks of graphite and carbon, and a crystallite size of 49 nm. The composites exhibited tight decoration of TiO₂ nanoparticles on micron-/submicron AC particles, and uniform TiO₂/AC composites were obtained as evidenced by the uniform distribution of Ti, O, and C in an EDS mapping. Moreover, Raman spectra show the typical vibration modes of anatase TiO₂ (e.g., E_1g⁽¹⁾, B_1g⁽¹⁾, E_g⁽³⁾) and carbon materials with D and G bands. The TiO₂/AC with (4:1), (3:2), and (2:3) possessed higher reaction rate constants (k) in photocatalytic degradation of methylene blue (MB) than that of either TiO₂ or AC. Among the investigated materials, TiO₂/AC = 4:1 achieved the highest photocatalytic activity with a high k of 55.2×10^-3 min^-1 and an MB removal efficiency of 96.6% after 30 min treatment under UV-Vis irradiation (120 mW/cm²). The enhanced photocatalytic activity for TiO₂/AC is due to the synergistic effect of the high adsorption capability of AC and the high photocatalytic activity of TiO₂. Furthermore, TiO₂/AC promotes the separation of photoexcited electron/hole (e^-/h⁺) pairs to reduce their recombination rate and thus enhance photocatalytic activity. The optimal TiO₂/AC composite in this study can be used for treating industrial or household wastewater with organic pollutants.

This report provides a comprehensive overview of occupational asthma and respiratory hypersensitivity, focusing on some chemicals used in the workplace Includes numerous case studies and research papers related to occupational exposure methacrylates, such as HEMA-HPMA, and respiratory hypersensitivity are discussed And the relationship is explored The book also examines asthma pathophysiology, emerging drug delivery systems used to treat asthma, and the potential of nanoparticles , dendrimers and micellar systems have to improve pulmonary drug delivery in detail The worldwide prevalence of asthma is highlighted, with higher rates in high-GDP countries. The book highlights the need to improve asthma diagnosis, treatment and biomarkers, particularly in rural and low-income countries where the disease is often underdiagnosed and inadequately treated, and discusses the role of inflammation in asthma, in particular secondary inflammation characterized by specific cytokines and inflammation cells In addition, the paper explores various drug delivery methods, such as parenteral and parenteral drugs, pressurized inhalers (pMDIs), dry powder inhalers ( DPIs), nebulizers, nanoparticles, liposomes, micellar systems, microparticles , dendrimers, and gene therapy . These systems aim to increase pulmonary delivery of drugs and improve clinical outcomes. The potential of dendrimer bilirubin-based nanoparticles and micellar systems in the treatment of asthma and lung inflammatory diseases, including asthma, has been discussed in summary, this paper provides an overview of occupational asthma and respiratory hypersensitivity, and this discussion highlights the association between methacrylate exposure and respiratory hypersensitivity.

Neurological involvement following COronaVIrus Disease 19 (COVID-19) is thought to have a neuroinflammatory etiology. Co-ultraPEALut (an antiinflammatory molecule) and luteolin (an antioxidant) yielded promising results as neuroinflammation antagonists. This study aimed at describing cognitive impairment in post-COVID patient treated with co-ultraPEALut. Montreal Cognitive Assessment (MoCA), Prospective-Retrospective Memory Questionnaire (PRMQ), Fatigue Severity Scale (FSS) and a subjective evaluation were administered at baseline and after 10 months. Co-ultraPEALut-treated patients were retrospectively compared with controls. 26 co-ultraPEALut-treated patients showed significant improvement in PRMQ (T0: 51.94±10.55, T1: 39.67±13.02, p

To accurately and non-destructively monitor the growth of spring wheat in the Hetao Irrigation Area, UAV remote sensing was employed during various fertility stages. Digital image indices from diverse fertilization treatments were calculated and compared with physiological indices to identify the most sensitive digital image indices corresponding to these indices. The study underscored the critical importance of the flowering stage in the growth of spring wheat, thus highlighting the necessity of focusing on this stage. This finding reiterated that the flowering stage was pivotal for spring wheat development in the Hetao Irrigation Area. Several digital image indices, such as GLA, R, G, INT, g, GRVI, MGRVI, RGBVI, EXG, and GRRI, exhibited a high frequency of significant correlations with physiological indices during the four primary reproductive stages of wheat. Consequently, these sensitive digital image indices during the flowering stage can more effectively characterize the physiological indices of spring wheat.

Background: The aim was to diagnose Candida in the oral cavity of subjects with type 2 diabetes mellitus (T2DM) using a genotyping technique and to compare the results with those from con-ventional diagnosis by Papanicolau (Pap) staining. Methods: Palatal mucosa smears were per-formed in 18 dental care patients diagnosed with T2DM and grade I, II, and III prosthetic stomatitis who met the inclusion criteria; 18 healthy control subjects were also included in the study. He-moglobin A1c (HbA1c) levels were determined from total blood. Using exfoliative cytology, the Pap staining technique was used to diagnose candidiasis. Exfoliative cytology was also used for molecular diagnosis; DNA was obtained for Candida genotyping and RNA was used for gene ex-pression studies. Results: Clinical patterns indicated that all subjects were positive for Candida; however, Pap analysis revealed only three positive subjects, whereas end-point polymerase chain reaction (PCR) analysis revealed fifteen subjects with some type of Candida. The most common Candida species found were Candida guilliermondii (38.8%), Candida krusei (33.3%), Candida tropicalis, and Candida lusitaniae (22.2%). Interestingly, the coexpression of different species of Candida was found in various patients. In all patients, HbA1c levels were increased. Gene expression analysis showed a significant decrease (p ≤ 0.05) in TLR2 expression in positive subjects, whereas TLR4 expression did not differ significantly among patients. Conclusions: The end-point PCR technique showed better sensitivity for diagnosis of Candida when compared with diagnosis by Pap staining. T2DM subjects showed an increased presence of C. guilliermondii that was correlated with decreased TLR2 expression

Type II pneumocytes are the target of SARS-CoV-2 which alters their redox homeostasis to increase reactive oxygen species (ROS). Melatonin (MT) has antioxidant proprieties and protects mitochondrial function. Here we evaluated whether the treatment with MT compensated for the redox homeostasis alteration in serum from COVID-19 patients. We determined oxidative stress (OS) markers such as carbonyls, glutathione (GSH), total antioxidant capacity (TAC), thiols, nitrites (NO2–), lipid peroxidation (LPO), and thiols groups in serum. We also studied the enzymatic activities of glutathione peroxidase (GPx), -S-transferase (GST), reductase (GR), thioredoxin reductase (TrxR), extracellular superoxide dismutase (ecSOD) and peroxidases. There was a significant increase in LPO and carbonyls (p≤0.03) and a decrease in TAC, NO2–, thiols, GSH, (p<0.001) in COVID-19 patients. The activities of the ecSOD, TrxR, GPx, GST, GR and peroxidases were decreased (p≤ 0.04). The treatment with MT favored the activity of the antioxidant enzymes which contributed to increase TAC and restored the lost redox homeostasis. MT also modulated glucose homeostasis functioning as a glycolytic agent and inhibited the Warburg effect. Thus, MT restores the redox homeostasis which is altered in COVID-19 patients and can be used as adjuvant therapy in the SARS-CoV-2 infection.

The possible future emergence of new SARS-CoV-2 virus variants pushes the development of new chemoprophylaxis protocols complementary to the unspecific and specific immune-prophylaxis measures currently used. The SARS-CoV-2 virus is particularly sensitive to oxidation due to the relevant positive electrical charge of its spike protein used as a ligand for target cells. The present study evaluated the safety and efficacy of a new oxidant preparation, liquid hyperoxygen (IOL), to neutralize the SARS-CoV-2 virus. IOL was incubated with throat swabs containing a human wild-type virus. The samples were then incubated with cells expressing the ACE2 receptor and therefore very sensitive to SARS-CoV-2 infection. The ability to neutralize SARS-CoV-2 was determined by assessing the amount of viral nucleic acid inside cells by PCR. The results obtained indicate that IOL, even at considerable dilutions, is capable, after incubation times of less than 30 min and even equal to 5 min, to completely inhibit SARS-CoV-2 infection. This inhibitory effect has been shown to be due to the oxidizing capacity of the IOL. This oxidizing capacity is exerted towards the virus but does not damage eukaryotic cells either in the in vitro or in the in vivo skin model. Obtained results indicate that the use of IOL, a hydrophilic liquid mixture saturated with highly reactive oxygen and nitrogen species, is a new powerful, safe, and effective tool for preventing possible future outbreaks of COVID-19 disease.

Nowadays, it is highly desired to develop highly active and humidity resistive ozone decomposition catalyst to eliminate the ozone contaminant, one of the primary pollutants in air. In this work, a series of Cu2S hollow structured materials are rapidly synthesized using different structured Cu2O templates. The Cu2S from porous Cu2O shows the highest ozone catalytic decomposition efficiency of >95% to 400 ppm ozone with a weight hourly space velocity of 480,000 cm3g-1h-1 in dry air. Importantly, the conversion still keeps >85% in a high relative humidity of 90%. The mechanism is explored by diffusive reflectance infrared spectroscopy which shows the decomposition intermediate of O22-, and the X-ray photoelectron spectroscopy reveals the dual active site of both Cu and S. All these results show the effective decomposition of ozone by Cu2S especially in harsh environments, promising for active ozone elimination.

To analyze the viral titers of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and respiratory syncytial virus (RSV) at the anterior nasal site (ANS) and nasopharyngeal site (NS), evaluate their virological dynamics, and validate the usefulness of a newly developed two antigen-detecting rapid antigen diagnostic test (Ag-RDT) that simultaneously detects SARS-CoV-2 and RSV using clinical specimens. This study included 195 asymptomatic to severely ill patients. Overall, 668 specimens were collected simultaneously from the ANS and NS. The cycle threshold (Ct) values calculated from real-time polymerase chain reaction were used to analyze temporal changes in viral load and evaluate the sensitivity and specificity of the Ag-RDT. The mean Ct values for SARS-CoV-2-positive, ANS, and NS specimens were 28.8, 28.9, and 28.7, respectively. The mean Ct values for RSV-positive, ANS, and NS specimens were 28.7, 28.8, and 28.6, respectively. SARS-CoV-2 and RSV showed the same trend in viral load, although the viral load of NS was higher than that of ANS. The sensitivity and specificity of the newly developed Ag-RDT were excellent in specimens collected up to 10 days after the onset of SARS-CoV-2 infection and up to 6 days after the onset of RSV infection.

As humans age, aberrancies in several signaling pathways occur. In the aging population, some patients display abnormal bone morphogenetic protein (BMP) signaling. This can lead to osteoporosis (OP), a debilitating bone disorder caused by an imbalance between osteoblasts and osteoclasts. In 2002, the Food and Drug Administration (FDA) approved usage of recombinant human BMP-2 (rhBMP-2) during spinal fusion surgery as it is crucial for bone formation. However, complications have been reported with rhBMP-2 and primary osteoblasts isolated from OP patients are unresponsive to BMP-2. While patient samples are available, previous medical history may alter results. Therefore, C57BL/6 mice, an aging model that displays aberrant BMP-signaling, can be utilized to investigate OP and aging. We show that BMP receptor type Ia (BMPRIa) is upregulated in the bone marrow stromal cells (BMSCs) of 15-month mice similar to previous data. We show that a conjugation between BMP-2 and Quantum Dots (QDot®s) effectively binds to BMPRIa and can investigate BMP-2 activity. After incubating BMSCs with methyl-β-cyclodextrin (MβCD), BMP-signaling is restored in 15-month mice as shown by western blotting and the von Kossa assay. MβCD may be used to rescue BMPRIa and the BMP-signaling pathway can be utilized by future therapeutics to treat OP.

Tamm Plasmon Polariton (TPP) is a nanophotonic phenomenon that has attracted much attention due to its spatial strong field confinement, ease of mode excitation and polarization independence. TPP has applications in sensing, storage, lasing, perfect absorber, solar cell, nonlinear optics, and many others. In this work, we demonstrate a biosensing platform based on TPP resonant mode. Both theoretical analyses based on Transfer Matrix Method and experimental validation through nonspecific detection of liquids of different refractive indices and specific detection of SARS-CoV-2 nucleocapsid protein (N-protein) are presented. Results show that TPP biosensor has high sensitivity and good specificity. For N-protein detection, the sensitivity is 1.5 nm/(µg/ml) and the limit of detection can reach down to below 7 ng/ml with spectrometer of 0.01 nm resolution of wavelength shift. This work paves the way for design, optimization, fabrication, characterization, and performance analysis of TPP based biosensors

In its prefusion state, the SARS-CoV-2 Spike protein (similarly to other class I viral fusion proteins) is metastable, which is considered to be an important feature for optimizing or regulating their functions. After the binding process of its S1 subunit (S1) with the ACE2, the Spike protein (S) suffers a dramatic conformational change where S1 splits from the S2 subunit, which then penetrates the membrane of the host cell, promoting the fusion of the viral and cell membranes. This results in the infection of the host cell. In a previous work, we showed -using large scale molecular dynamics simulations- that the application of external electric fields (EF) induces drastic changes and damage in the receptor-binding domain (RBD) of the wild type Spike protein, as well of the Alpha, Beta and Gamma variants, leaving a structure which cannot be recognized any more by ACE2. In this work, we first extend the study to the Delta and Omicron variants and confirm the high sensitivity and extreme vulnerability of S to moderate EF (as weak as 104 V m-1), but, more importantly, we also show that, in contrast, the postfusion state of the spike protein does not suffer structural damage even if electric field intensities four orders of magnitude higher are applied. These results provide a solid scientific basis to confirm the prefusion state metastability roots of the SARS-CoV-2 Spike protein susceptibility to be damaged by EF. After the virus docks to the ACE2 receptor, the stable and robust postfusion conformation develops, which exhibits a similar resistance to EF (damage threshold higher than 108 V m-1) like most globular proteins.

Background. Type 2 diabetes mellitus (T2DM) is becoming a major global health concern, especially in poorer nations. The high prevalence of obesity and the ensuing diabetes is attributed to rapid economic progress, physical inactivity, consumption of high-calorie foods, and changing lifestyles. Objectives. We investigated the role of pro-inflammatory chemokines; CCL1, 2, 4 and 5 with varying levels of obesity in T2DM in the Asir region of Saudi Arabia. Materials and methods. 170 confirmed T2DM patients and a normal control group were enrolled. The demographic data, serum levels CCL-1, 2, 4 and 5 and the biochemical indices were assessed in patients and control groups by standard procedures. Results. T2DM patients were divided into four groups: A (normal body weight), B (Overweight), C (obese), and D (highly obese). n controls. We observed that male and female control patients had similar mean serum concentrations of pro-inflammatory chemokines CCL 1, 2, 4, and 5. Chemokines CCL1, CCL2, and CCL4 in the serum of Type 2 Diabetes Mellitus patients with normal or overweight body weights were significantly higher than the control group, regardless of gender. In T2DM individuals with obesity and severe obesity, the rise was most significant. There was a progressive rise in the concentrations of CCL1, 2, and 4 in T2DM) patients with increasing BMI. Serum CCL5 levels increased significantly in all T2DM patient groups. The increase in CCL5 was more predominant in normal-weight people as compared to overweight and obese T2DM patients. Conclusions. Male and female control patients had similar serum levels of pro-inflammatory chemokines CCL 1, 2, 4, and 5. The progressive rise in blood concentrations of three Pro-inflammatory chemokines; CCL1, 2, and 4 in T2DM patients with increasing BMI supports the idea that dyslipidemia and obesity contribute to chronic inflammation and insulin resistance. Serum CCL5 levels increased significantly in all T2DM patient groups. The selective and more pronounced increase of CCL5 in the T2DM group with normal BMI as compared to patients with varying degrees of obesity, was rather surprising. Further research is needed to determine if CCL5 under-expression in overweight and obese T2DM patients is due to some unexplained counterbalancing processes.

SARS-CoV-2 attachment and entry inside mammalian cells is mainly mediated by human angiotensin-converting enzyme 2 (ACE2) and its interaction with spike protein. However, it is well known that spike protein also interacts with other molecules like glycosaminoglycans (GAG), e.g., heparan sulfate (HS) or Enoxaparin (EX), which are linear, anionically charged polysaccharides known for their biological activities. The mode of action of these two polysaccharides is to bind spike protein to block the interaction with ACE2 receptors. This study aimed to assess a model capable of confirming the activity of these GAGs in both the wild-type strain of SARS-CoV-2 and its variants, such as the highly variable BA.2.86. This was achieved by combining in silico modeling with in vitro determination using BacMam technology. The results showed the antiviral activity of HS and EX both in vitro and through the in-silico analysis, reconciling conflicting findings from recent studies on the cellular entry of SARS-CoV-2. In conclusion, it is possible to highlight the ability of these molecules to circumvent the high variability of SARS-CoV-2, providing valuable insights into intervention strategies targeting cell entry mechanisms and establishing a safe in vitro model.

Cognitive reserve is the adaptability of cognitive processes in the face of brain aging and pathology. This study aimed to validate the Arabic version of the Cognitive Reserve Index Questionnaire (CRIq) in a healthy Lebanese sample. CRIq assesses cognitive reserve through three domains: education, working activity, and leisure time. Statistical measures, including descriptive and regression analysis along with structural equation modeling, were utilized to investigate the convergent and discriminant validity of CRIq, incorporating fluid intelligence (Gf) and measures of cognitive function, long-term memory encoding and retrieval (Glr), and processing speed (Gs). Results from 174 participants revealed that the activities assessed by CRIq-Arabic were comparable to the original CRIq study, with slight cultural differences. The internal consistency of CRIq-Arabic was good (Cronbach's α = 0.88), indicating reliability. Convergent validity was confirmed, with moderate to high loadings on the cognitive reserve latent construct. Discriminant validity was supported as correlations between cognitive reserve variables and non-target constructs (Gf, Glr, Gs) were less than 1. The findings provide an initial psychometric validation of the CRIq-Arabic. Further research in clinical samples is needed to enhance its utility in neuropsychological practice.

Optimal detection strategies for effective convalescent immunity after SARS-CoV-2 infection and vaccination remain unclear. The objective of this study was to characterize convalescent immunity targeting the SARS-CoV-2 spike protein using a multiparametric approach. At the beginning of the pandemic, we recruited 30 COVID-19 unvaccinated convalescent donors and 7 unexposed asymptomatic controls. Peripheral blood mononuclear cells (PBMCs) were obtained from leukapheresis cones. The humoral immune response was assessed by measuring serum anti-SARS-CoV-2 spike S1 subunit IgG semiquantitative ELISA and T cell immunity against S1 and S2 subunits were studied by IFN-γ Enzyme-Linked Immune absorbent Spot (ELISpot), flow cytometric (FC) activation-induced marker (AIM) assays and the assessment of cytotoxic CD8+ T-cell function (in the subset of HLA-A2 positive patients). No single immunoassay was sufficient in identifying anti-spike convalescent immunity among all patients. There was no consistent correlation between adaptive humoral and cellular anti-spike responses. Our data indicate that the magnitude of anti-spike convalescent humoral and cellular immunity is highly heterogeneous and highlights the need for using multiple assays to comprehensively measure SARS-CoV-2 convalescent immunity. These observations might have implications for COVID-19 surveillance, and optimal vaccination strategies for emerging variants. Further studies are needed to determine the optimal assessment of adaptive humoral and cellular immunity following SARS-CoV-2 infection, especially in the context of emerging variants and unclear vaccination schedules.

COVID-19 has rapidly spread worldwide since December 2019. During the pandemic, SARS-CoV-2 repeatedly mutated from Alpha to Omicron. The severity and mortality are related to age, sex, and underlying diseases (respiratory, cerebrovascular, cardiovascular, metabolic, cancer, and immune diseases). We retrospectively studied 44 hospitalized stroke patients infected with the SARS-CoV-2 Omicron variant. The mortality rate of hospitalized stroke patients with COVID-19 was 6 (13.6%). The cause of death was coagulopathy in 3 cases of ischemic stroke. High modified Rankin Scale score（mRS）of stroke patient was correlated with severity of COVID-19. The timing of vaccination is inversely correlated with COVID-19 severity. In conclusion, stroke patients with COVID-19 have high mortality rates attributed to coagulopathy. Stroke patients with high mRS scores are more likely to develop severe COVID-19. In high mRS scores, therapy for severe COVID-19 should be administered.

: (1) Background: Healthcare workers (HCWs) are a well-known risk group for coronavirus infections with increased working hours in a potentially infectious environment. We evaluated both IgG and Neutralizing antibody levels, with IgG avidity index and persistence among health workers. (2) Methods: 1001 HCWs were tested for both IgG and Neutralizing antibodies. IgG avidity testing and one-year follow-up testing were done on selected HCWSs. (3) Results: COVID-19 IgG antibody levels were high among 299 (94.62%) HCWs with a history of COVID-19 infection (p <0.0001) compared with 479 (69.92%) HCWs who were not infected with COVID-19 during the first and second wave. A total of 899 (89.81%) HCWs had more than 50% neutralizing antibodies while the remaining 102 (10.19%) HCWs had less than 50% of Neutralizing antibodies. The avidity index was maintained at almost 40% (Gray zone). Both antibody levels were found markedly increased after one year when compared to initial results. (4) Conclusions: Healthcare workers are at a 2.29-fold higher risk of infection; Two folds higher IgG levels in HCWs involved in COVID-19 duty and their persistence for a longer time than in other groups signifies IgG antibody role in the prevention of severe disease in HCWs involved in Covid-19 patient care.

Type 2 diabetes mellitus (T2DM) is a common metabolic disease characterised by insulin resistance and elevated blood glucose levels, affecting millions of people worldwide. T2DM patients with dyslipidaemia have an increased risk of cardiovascular disease (CVD). A complex interplay of risk factors such as hyperglycaemia, dyslipidaemia, hypertension, obesity, inflammation and oxidative stress favour the development of atherosclerosis, a central mechanism in the pathogenesis of cardiovascular disease. Dyslipidaemia, a hallmark of T2DM, is characterised by elevated triglycerides, decreased high-density lipoprotein (HDL) cholesterol and the presence of small, dense low-density lipoprotein (LDL) particles, all of which promote atherosclerosis. In this article, we have attempted to present various treatment strategies that include pharmacological interventions such as statins, ezetimibe, PCSK9 inhibitors, fibrates and omega-3 fatty acids. We have also tried to highlight the pivotal role of lifestyle modifications, including physical activity and dietary changes, in improving lipid profiles and overall cardiovascular health in T2DM patients. We have also tried to present the latest clinical guidelines for the management of dyslipidaemia in T2DM patients. In conclusion, the treatment of dyslipidaemia in T2DM patients is of great importance as it lowers lipid particle levels, slows the progression of atherosclerosis and ultimately reduces susceptibility to cardiovascular disease.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

The Main Protease (Mpro) plays a pivotal role in the replication of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and is considered a highly conserved viral target. Disruption of the catalytic activity of Mpro produces a detrimental effect on the course of the infection, making this target one of the most attractive for the treatment of COVID-19. The current success of the SARS-CoV-2 Mpro inhibitor Nirmatrelvir, the first oral drug for the treatment of severe forms of COVID-19, has further focused the attention of researchers on this important viral target, making the search for new Mpro inhibitors a thriving and exciting field for the development of antiviral drugs active against SARS-CoV-2 and related coronaviruses.

The SARS-CoV-2 virus, causative agent of COVID-19, is known for its genetic diversity. Virus variants of concern (VOCs) as well as variants of interest (VOIs) are classified by the World Health Organization (WHO) according to their potential risk to global health. This study seeks to enhance the identification and classification of such variants by developing a novel bioinformatics criterion centered on the virus's spike protein (SP1), a key player in host cell entry, immune response, and a mutational hotspot. To achieve this, we pioneered a unique phylogenetic algorithm which calculates EIIP-entropy as a distance measure based on the distribution of the Electron-Ion Interaction Potential (EIIP) of amino acids in SP1. This method offers a comprehensive, scalable, and rapid approach to analyze large genomic data sets and predict the impact of specific mutations. This innovative approach provides a robust tool for classifying emergent SARS-CoV-2 variants into potential VOCs or VOIs. It could significantly augment surveillance efforts and understanding of variant characteristics, while also offering potential applicability to the analysis and classification of other emerging viral pathogens and enhancing global readiness against emerging and re-emerging viral pathogens.

D-Glucaric acid is an important bio-based building block of polymers and is a high value-added chemical that can be used in a variety of applications. In the present study, the Udh target genes from Pseudomonas putida and Pseudomonas syringae were used together to construct the expression vector pETDuet-2×Udh. The transformants of BL21(DE3) with vector pETDuet-2×Udh was applied to produce glucaric acid from glucuronic acid. After optimization of induction conditions, the highest Udh expression were achieved when 0.4 mmol L-1 isopropyl-β-d–thiogalactoside (IPTG) was added to cell cultures at an OD600 value of 0.6 followed by culture at 26℃ for 6 hours. The production of glucaric acid substantially reached 5.24 ± 0.015 g L-1 in fed-batch cultures in a 30 L tank. In the present study, a new system for glucaric acid production was established, which was more economic and friendly to environment.

The COVID-19 pandemic has raised questions about indirect impact in pregnant women on the development of their future children. Investigating the characteristics of lipid metabolism in the "mother-placenta-fetus" system can give information about the pathophysiology of COVID-19 infection during pregnancy. 234 women were included in study. Maternal plasma, cord blood, amniotic fluid lipidome were analyzed using HPLC-MS/MS. Differences in lipid profile were searched by Manna-Whitney and Kruskall-Wallis test, diagnostic model based on logistic regres-sion were bilt by AIC. Elevation levels of lysophospholipids, triglycerides, sphingomyelins, and oxidized lipids was registered in patients’ after COVID-19 maternal and cord plasma. An increase in maternal plasma sphingomyelins and oxidized lipids was observed in cases of infection during the second trimester. In amniotic fluid, compared to the control group, nine lipids are reduced, six lipids are elevated. Levels of phosphoglycerides, lysophosphoglycerides, and phosphatidylinosi-tols decreased during infection in the second and third trimesters of pregnancy. Newborn’s health diagnostic model based on maternal plasma were developed for each group and exhibit good di-agnostic value (AUC> 0.85). Maternal and cord plasma’s lipidome changes during delivery, asso-ciated with Covid-19 infection during pregnancy, are synergistic. The most significant disturbances occur with infections in the second trimester of pregnancy.

One of the hallmarks of microgravity-induced effects in several cellular models is represented by the alteration of oxidative balance with the consequent accumulation of Reactive Oxygen Species (ROS). It is well known that male germ cells are sensitive to oxidative stress and to changes of gravitational force even if published data on germ cell models are scarce. To gain more insights into the mechanisms of male germ cell response to altered gravity, a 3D cell culture model has been established from TCam-2 cells, a seminoma-derived cell line considered the only human cell line available to study in vitro mitotically active human male germ cells. TCam-2 cell spheroids were cultured for 24 hours under unitary gravity (Ctr) or simulated microgravity (s-microgravity) conditions, these last ones were obtained using the Random Positioning Machine (RPM). A significant increase in intracellular ROS and mitochondria superoxide anion levels has been observed after RPM exposure. In line with these results a trend of protein and lipid oxidation increase, and increased pCAMKII expression levels were observed after RPM exposure. The ultrastructural analysis by Transmission Electron Microscopy revealed that RPM-exposed mitochondria appeared enlarged and, even if seldom, disrupted. Notably, even the expression of the main enzymes involved in the redox homeostasis appears modulated by RPM exposure in a compensatory way, being GPX1, NCF1, and CYBB downregulated, whereas NOX4 and HMOX1 upregulated. Interestingly, HMOX1 is involved in the heme catabolism of mitochondria cytochromes, and therefore the positive modulation of this marker can be associated to the observed mitochondria alteration. All together, these data demonstrate TCam-2 spheroid sensitivity to acute SM exposure and indicate the capability of these cells to trigger compensatory mechanisms that allow to overcome the exposure to altered gravitational force.

Systemic sclerosis (SSc) is a multisystem connective tissue disease characterized by pathological processes involving autoimmunity, vasculopathy, and resultant extensive skin and organ fibrosis. Recent studies have demonstrated activation and aberrant wound healing responses in the epithelial layer of the skin in this disease, implicating the epithelial keratinocytes as a source of pro-fibrotic and inflammatory mediators. In this paper we investigated the role of Immunoglobulin G (IgG) autoantibodies directed against epithelial cells, as potential initiators and propagators of pathological keratocyte activation and the ensuing SSc fibrotic cascade. A keratinocyte cell-based ELISA is used to evaluation binding of SSc IgG. SSc skin biopsies were stained by immunofluorescence for the presence of IgG in the keratinocyte layer. Moreover, IgG purified from SSc sera is evaluated for the potential to activate keratinocytes in tissue culture and to induce signaling in TLR2 & 3 reporter cell lines. We demonstrate enhanced binding of SSc IgG to keratinocytes, and activation of these cells leading to release of IL-1α, representing a potential initiating pathway in this disease.

Suffocation syndrome is the leading cause of hypoxia and mortality in the most common lung diseases, asthma and COVID-19. Inhaled corticosteroids (ICSs) have been shown to be the main-stay of critical care in these diseases. Meanwhile, mortality from strangulated hypoxia is highest in low-income countries because ICSs are not currently available to many patients. Warm alkaline hydrogen peroxide solutions (WAHPSs) have reportedly been invented in recent years to urgently turn thick sputum, mucus, pus, serous fluid, blood clots and many other biological masses con-taining the enzyme catalase into a fluffy oxygenated foam. It has been shown that the mechanism of action of WAHPSs consists in alkaline saponification of lipid and protein-lipid complexes of bi-ological masses and their transformation into oxygen foam, because hydrogen peroxide is urgently decomposed into water and oxygen gas under the action of the biological masses catalase enzyme At that excess oxygen is absorbed into blood through lungs and increases blood oxygen saturation. Based on the described mechanism of action of WAHPSs and the high availability of their ingre-dients, it is suggested that mortality from choking and hypoxia in asthma and COVID-19 can be reduced by combining ICSs with inhaled WAHPSs, especially in poor countries. The essence of the inventions underlying the formation of WAHPSs is given.

N'-(5-bromofuran-2-carbonyl)isonicotinohydrazide (1) was obtained as a white solid in 83% yield by 2-methyl-6-nitrobenzoic anhydride (MNBA)/4-dimethylaminopyridine (DMAP)-catalyzed reaction of 5-bromofuran-2-carboxylic acid and isoniazid in dichloromethane at room temperature. The structure of N'-(5-bromofuran-2-carbonyl)isonicotinohydrazide (1) was elucidated by 1H NMR, 13C NMR, FTIR, and the high resolution mass spectrometers. Molecular docking screening of the title compound (1) on the cyclooxygenase-2 (COX-2) protein (PDB ID: 5IKR) exhibited that compound (1) has a good binding affinity, suggesting that it is very interesting for further structure optimization and in-depth research as a potential COX-2 inhibitor.

The Covid-19 pandemic has produced a change in the way of living, socializing and a modification in Health Systems around the world. A multicentre retrospective study was carried out to study orofacial trauma in one of the regions most affected during the first wave of the pandemic, with the participation of the five main tertiary hospitals in Madrid. The aim of this study is to evaluate the epidemiology of orofacial surgical trauma during the 1 year of COVID pandemic and compared to de prior year. Age, sex, mechanism, localization, and treatment were studied. P-value <0.05 was considered statically significative. Reduction of 39.36% (<0.001) in maxillofacial fractures was observed, without significance change in sex, localization or treatment. Significant increase in age (35,92 vs. 40,26) (p = 0.006) was observed. Significant decline in mechanism was noted (p = 0.025), decreasing personal violence (41% vs 35%) and sports (14% vs 8%); increasing in falls (27% vs 35%), precipitation (2 vs 5%), and traffic accidents (12% vs 13%). The mandible was the most frequent fractured bone. The COVID pandemic has produced epidemiological variations in orofacial trauma, making it necessary to monitor social and legal changes that may require reorganization to adjust to population needs.

Adipose tissue is a crucial organ in energy metabolism and thermoregulation. Adipose tissue phenotype is controlled by various signaling mechanisms under pathophysiological conditions. Type II transmembrane serine proteases (TTSPs) are a group of trypsin-like enzymes anchoring on the cell surface. These proteases act in diverse tissues to regulate physiological processes, such as food digestion, salt-water balance, iron metabolism, epithelial integrity, and auditory nerve development. More recently, several members of the TTSP family, namely, hepsin, matriptase-2, and corin, have been shown to play a role in regulating lipid metabolism, adipose tissue phenotype, and thermogenesis, via direct growth factor activation or indirect hormonal mechanisms. In mice, hepsin deficiency increases adipose browning and protects from high-fat diet-induced hyperglycemia, hyperlipidemia, and obesity. Similarly, matriptase-2 deficiency increases fat lipolysis and reduces obesity and hepatic steatosis in high-fat diet-fed mice. In contrast, corin deficiency increases white adipose weights and cell sizes, suppresses adipocyte browning and thermogenic responses, and causes cold intolerance in mice. These findings highlight an important role of TTSPs in modifying cellular phenotype and function in adipose tissue. In this review, we provide a brief description about TTSPs and discuss recent findings regarding the role of hepsin, matriptase-2, and corin in regulating adipose tissue phenotype, energy metabolism, and thermogenic responses.

Keywords: Marine sulfated glycans; SARS-CoV-2; Omicron XBB.1.5, Spike protein; Heparin

Recent studies have confirmed that lung microvascular endothelial injury plays a critical role in the pathophysiology of COVID-19. Our group and others have demonstrated the beneficial effects of H2S in several pathological processes and provided a rationale for considering the therapeutic implications of H2S in COVID-19 therapy. Here, we evaluated the effect of the slow-releasing H2S donor, GYY4137, on the barrier function of a lung endothelial cell monolayer in vitro, after challenging the cells with plasma samples from COVID-19 patients or inactivated SARS-CoV-2 virus. We also assessed how the cytokine/chemokine profile of patients’ plasma, endothelial barrier permeability, and disease severity correlated with each other. Alterations of barrier permeability after treatments with patient plasma, inactivated virus, and GYY4137 were monitored and assessed by electrical impedance measurements in real-time. We present evidence that GYY4137 treatment reduced endothelial barrier permeability after plasma challenge and completely reversed the endothelial barrier disruption caused by inactivated SARS-CoV-2 virus. We also showed that disease severity correlated with the cytokine/chemokine profile of the plasma but not with barrier permeability changes in our assay. Overall, these data demonstrate that treatment with H2S-releasing compounds has the potential to ameliorate SARS-CoV-2–associated lung endothelial barrier disruption.

The mRNA vaccines for SARS-CoV-2 have demonstrated efficacy and immunogenicity in the re-al-world setting. However, most of the research on vaccine immunogenicity has been centered on characterizing the antibody response, with limited exploration into the persistence of spike-specific memory B cell response. Here we monitored the durability of the memory B cell response and characterize the trajectory of spike-specific B cell phenotypes in healthy individuals who have received two doses of the BNT162b2 vaccine up to 9 months post-vaccination. To profile the spike-specific B cell response we applied the tSNE and Cytotree automated approaches. Our data showed the induction of spike-specific IgA+ and IgG+ plasmablasts and IgA+ activated cells 7 days after the second dose which disappeared 3 months later, while subsets of spike-specific IgG+ resting memory B cells became predominant 9 months after vaccination, and they were capable to differentiate into spike-specific IgG secreting cells when in vitro restimulated. Other subsets of spike-specific B cells, such as IgM+ or unswitched IgM+IgD+ or IgG+ double negative/atypical cells, were also elicited by the BNT162b2 vaccine and persisted up to month 9. The analysis of circulating spike-specific IgG, IgA and IgM was in line with the plasmablasts observed. The longitudinal analysis of the antigen-specific B cell response elicited by mRNA-based vaccines provides valuable insights into our understanding of the immunogenicity of this novel vaccine platform destined to a future widespread use, and it is crucial in guiding future decisions and vaccination schedules.

Preterm delivery can be precipitated by infection, and preterm infants are at heightened risk of postnatal infection. Little is known about the ontogeny of inflammatory biomarkers in extremely preterm infants. We hypothesized that suspected prenatal infection (chorioamnionitis or spontaneous preterm labor) and clinically diagnosed postnatal infection would be associated with unique biomarker signatures, and those patterns would be influenced by the degree of prematurity. Venous blood was collected daily for the first week and weekly for up to 14 additional weeks from 142 neonates born at 22-32 weeks gestation. A custom array was utilized to measure monocyte chemoattractant protein-1 (MCP-1) and interleukin-6 (IL-6). C-reactive protein (CRP) levels were obtained from the electronic medical record. 90 infants had suspected prenatal infection and 63 were diagnosed with postnatal infection. Independent of gestational age at delivery, MCP-1 was significantly increased (P &lt; 0.001) in association with maternal preeclampsia, but MCP-1 was decreased (P&lt;0.01) and CRP was increased (P&lt;0.05) in the presence of chorioamnionitis. IL-6 and CRP were both increased in infants diagnosed with postnatal infection with peak levels observed on days 2 and 3, respectively. In conclusion, suspected prenatal and postnatal infections and non-infectious complications of pregnancy are associated with unique biomarker profiles, independent of gestational age. In those clinically diagnosed with a postnatal infection in the absence of antenatal infection concerns, IL-6 increases before CRP, emphasizing a potential role for expanded biomarker screening if antibiotics are initially avoided in infants born exclusively for maternal indications.

Erectile dysfunction (ED) is a common and feared complication of radical prostatectomy (RP) for prostate cancer. Recently, tissue engineering is being attempted for post-prostatectomy ED, with controlled interactions between cells, growth factors, and extracellular matrix (ECM) being important for nerve regeneration's structural integrity. In this study, we evaluated the effects of biomechanical ECM patch on human bone marrow-derived mesenchymal stem cells (hBMSCs) morphology and behavior in bilateral cavernous nerve injury (BCNI) rat model. The ECM patch, made of decellularized human fibroblast-derived ECM (hFDM) and a biocompatible polyvinyl alcohol (PVA) hydrogel, was tested with human bone marrow-derived mesenchymal stem cells (hBMSCs) on a bilateral cavernous nerve injury (BCNI) rat model. In vitro analysis showed that the hFDM/PVA + hBMSCs patches significantly increased neural development markers. In vivo experiments demonstrated that the rats treated with the hFDM/PVA patch had higher ICP/MAP ratio, a higher ratio of smooth muscle to collagen, increased content of nNOS, higher levels of eNOS protein expression, and a higher cGMP level compared to the BCNI group. These results indicate that the hFDM/PVA patch is effective in promoting angiogenesis, smooth muscle regeneration, and nitrergic nerve regeneration, which could contribute to improved erectile function in post-prostatectomy ED.

Beyond plasma glucose-lowering in patients with type 2 diabetes, sodium- glucose cotransporter 2 inhibitors (SGLT2i) significantly reduced the hospitalization for heart failure (HF) and retarded the progression of chronic kidney disease (CKD). Endothelial dysfunction is not only involved in the development and progression of cardiovascular disease (CVD), and is also associated with the progression of CKD. In patients with type 2 diabetes, hyperglycemia, insulin resistance, hyperinsulinemia and dyslipidemia induce the development of endothelial dysfunction. SGLT2i have shown an improvement in endothelial dysfunction, as assessed by flow-mediated vasodila-tion, in individuals at high risk for CVD. Along with an improvement of endothelial dysfunction, SGLT2i showed improvements in oxidative stress, inflammation, mitochondrial dysfunction, glucotoxicity such as advanced glycation end products signaling and nitric oxide bioavailability. The improvements in endothelial dysfunc-tion and such endothelium-derived factors may play an important role in preventing the development of coronary artery disease, coronary microvascular dysfunction and diabetic cardiomyopathy which cause HF and in retarding CKD. The suppression of the development of HF and the progression of CKD achieved by SGLT2i might have been largely induced by the improvement of vascular endothelial function by SGLT2i.

Natural herbs and functional foods contain bioactive molecules capable of augmenting the immune system and mediating anti-viral functions. Functional foods, such as prebiotics, probiotics, and dietary fibers, have been shown to have positive effects on gut microbiota diversity and immune function. The use of functional foods has been linked with en-hanced immunity, regeneration, improved cognitive function, maintenance of gut mi-crobiota, and significant improvement in overall health. The gut microbiota plays a critical role in maintaining overall health and immune function, and disruptions to its balance have been linked to various health problems. SARS-CoV-2 infection has been shown to affect gut microbiota diversity, and the emergence of variants poses new challenges to combat the virus. SARS-CoV-2 recognizes and infects human cells through ACE2 receptors prevalent in lung and gut epithelial cells. Humans are prone to SARS-CoV-2 infection because the respiratory and gastrointestinal tracts are rich in microbial diversity and contain high ACE2 and TMPRSS2. This review article explores the potential use of functional foods in mitigating the impact of SARS-CoV-2 variants on gut microbiota diversity and the potential use of functional foods as a strategy to combat these effects.

Abstract: The SARS-CoV-2 pandemic has significantly impacted world health and economic status. In response, much work has been undertaken to provide effective, safe vaccines, antibodies and antiviral drugs with which to address this pandemic. Treatment of a pandemic population presents multiple challenges in addition to the primary issue of drug efficacy and safety, such as large scale drug manufacture and distribution, drug stability, oral dosing and pharmacoeconomic considerations. Ideally, these factors must be addressed if new candidate drugs are to be advanced for treatment of large (pandemic) populations. Subsequently, new antivirals have reached the market but choices are few. According to the NIH Covid Treatment Guidelines, only three small molecule antiviral drugs are available to treat COVID-19 disease. As such, a significant part of the research towards discovery of new antiviral drugs has focused on screening and evaluation of ‘repurposed drugs’ or previously approved or clinical stage drugs. Yet, in spite of this increased research activity, one promising clinical stage candidate drug has received little attention regarding its potential as a monotherapy or component of combination therapy for treatment of COVID-19 disease. Tucaresol, with documented human safety and pharmacokinetic data, is an orally active, stable, small molecule amenable to large scale manufacture by a proprietary two-step synthesis developed by us. Tucaresol functions as a host-targeted antiviral by selective protection/reconstitution of CD4+ T helper cells as demonstrated in HIV patients and SIV macaques. In view of similarities between HIV and SARS-CoV-2, especially with respect to host CD4+ T helper cells, and the suitability of Tucaresol for facile treatment of pandemic populations, Tucaresol is presented herein for treatment of mild-to-moderate COVID-19 patients but may also be useful for treatment of advanced disease accompanied by lymphopenia.

Background: The SARS-CoV-2 laboratory PCR tests were generally reported only as binary positive or negative outcomes. Instead test positivity, these results contain a great deal of epidemiological information related to viral transmission patterns in populations. These transmission patterns during India’s SARS-CoV-2 viral waves remain largely undocumented. Methods: We analysed 2.7 million real-time polymerase chain reaction (PCR) testing records collected in Mumbai, a bellwether for other Indian cities. We used the inverse of cycle threshold (Ct) values to determine community-level viral load. We quantified wave-specific differences by age, sex and slum population density. Results: Overall PCR positivity was 3.4% during non-outbreak periods, rising to 23.2% and 42.8% during the Aleph (June-November 2020) and Omicron waves (January 2022), respectively, but only 9.9% during the Delta wave (March-June 2021). The community-level median Ct values fell and rose ~7-14 days prior to PCR positivity rates. Viral loads were 4-fold higher during the Delta and Omicron waves than during non-outbreak months. The Delta wave had high viral loads at older ages, in women and in areas of higher slum density. During the Omicron wave, differences in viral load by sex and for slum density had disappeared, but older adults continued to show higher viral load. Conclusions: Mumbai’s viral waves had markedly high viral loads representing an early signal of pandemic trajectory. Continue the vaccination in elderly Indians could reduce viral load in subsequent waves. Ct values are practicable monitoring tools.

The COVID-19 pandemic has presented an unprecedented challenge to the healthcare system. Identifying the genomics and clinical biomarkers for effective patient stratification and management is critical to controlling the spread of the disease. Omics datasets provide a wealth of information that can aid in understanding the underlying molecular mechanisms of COVID-19 and identifying potential biomarkers for patient stratification. Artificial intelligence (AI) and machine learning (ML) algorithms have been increasingly used to analyze large-scale omics and clinical datasets for patient stratification. In this manuscript, we demonstrate the recent advances and predictive accuracies in AI and ML-based patient stratification modeling linking omics and clinical biomarker datasets, focusing on COVID-19 patients. Our ML model not only demonstrates that clinical features are enough an indicator of COVID-19 severity and survival but also infers what clinical features are more impactful, which makes our approach a useful guide for clinicians for prioritization of best-fit therapeutics for a given cohort of patients. Moreover, with weighted gene network analysis, we are able to provide insights into gene networks that have a significant association with COVID-19 severity and clinical features. Finally, we have demonstrated the importance of clinical biomarkers in identifying high-risk patients and predicting disease progression.

This research intended to report amine-functionalized multiwall carbon nanotubes (MWCNTs) prepared by a simple method for efficient and rapid removal of Reactive Yellow 2 (RY2) from water. EDS analysis showed that the N content increased from 0 to 2.42% and from 2.42 to 8.66% after modification by APTES and PEI, respectively. BET analysis displayed that the specific surface area, average pore size, and total pore volume were reduced from 405.22 to 176.16 m2/g, 39.67 to 6.30 nm, and 4.02 to 0.28 cm3/g, respectively. These results proved that the PEI/APTES-MWCNTs were successfully prepared. pH edge experiment indicated that pH 2 was optimal for RY2 removal. At pH 2 and 25 °C, the time required for adsorption equilibrium was 10, 15, and 180 min at initial concentrations of 50, 100, and 200 mg/L, respectively; and the maximum RY2 uptake calculated by the Langmuir model was 714.29 mg/g. Thermodynamic studies revealed that the adsorption process was spontaneous and endothermic. 0-0.1 mol/L of NaCl showed negligible effect on RY2 removal by PEI/APTES-MWCNTs. Five adsorption/desorption cycles confirmed the good reusability of PEI/APTES-MWCNTs in RY2 removal. Overall, the PEI/APTES-MWCNTs are a potential and efficient adsorbent for reactive dye wastewater treatment.

Vaccines against SARS-CoV-2 have been pivotal in overcoming the Covid-19 pandemic yet understanding the subsequent outcomes and immunological effects remain crucial, especially for at-risk groups e.g. people living with human immunodeficiency virus (HIV) (PLWH). In this study we report the longitudinal IgA and IgG antibody titers, as well as antibody-mediated angiotensin converting enzyme 2 (ACE2) binding blockade, against the SARS-CoV-2 spike (S) proteins after 1 and 2 doses of the ChAdOx1 nCoV-19 vaccine in a population of Black PLWH. Here, we report that PLWH (N = 103) did not produce an anti-S IgA response after infection or vaccination, however, anti-S IgG was detected in response to vaccination and infection, with the highest level detected for infected vaccinated participants. The anti-IgG and ACE2 blockade assays revealed that both vaccination and infection resulted in IgG production, however, only vaccination resulted in a moderate increase in ACE2 binding blockade to the ancestral S protein. Vaccination with a previous infection results in the greatest anti-S IgG and ACE2 blockade for the ancestral S protein. In conclusion, PLWH produce an anti-S IgG response to the ChAdOx1 nCoV-19 vaccine and/or infection, and ChAdOx1 nCoV-19 vaccination with a previous infection produced more neutralizing antibodies than vaccination alone.

In an historic perspective on the development of the Standard Model of particle physics it is shown how mathematically driven axioms have masked the merits of a physically comprehensible structural view. It is concluded that the difference between the two approaches can be traced back to two major issues. Whereas in the Standard Model the quark is a Dirac particle with a single real dipole moment, the quark in the structural model, in confinement with other quarks, is a Dirac particle with two real dipole moments. The second issue is the view that empty space does not exist, but that space is filled with a polarisable energetic fluid. It is shown how recognition of these two issues pave a road to reconcile particle physics with gravity, in which the quark can be seen as a magnetic electron and in which the gluon, as the strong force carrier, can be seen as a massive photon.

In French Polynesia, Wuhan, Delta and Omicron SARS-CoV-2 variants-of-concern (VOCs) caused epidemics with variable severities. We assessed the prevalence and titers of anti-SARS-CoV-2 antibodies related to natural infection and/or vaccination, from a representative sample (N=673) of the adult population of Tahiti recruited during November-December 2021 (after the Delta outbreak and just before the Omicron epidemic). Of the 673 participants tested, 644 (95.7%) had detectable antibodies against SARS-CoV-2-S and/or -N proteins resulting from natural infection and/or vaccination, and 388 (57.7%) were positive only for the detection of anti-N antibodies indicating natural infection. SARS-CoV-2 seroprevalence extrapolated to the adult population of Tahiti was estimated at 95.9%. Concentrations of anti-SARS-CoV-2-S antibodies significantly increased with age, number of self-reported SARS-CoV-2 infections (0 or ≥1), and number of COVID-19 vaccine doses (0, 1, 2, or 3) received by the participants. Elderly people, who are at higher risk of severe outcomes, had received more vaccine doses than younger individuals both in our sample and in the general population. The high level of antibody responses related to past infections and vaccination, especially booster doses, has likely contributed to reducing the severity of the Omicron outbreak in French Polynesia.

It is already well known that infants and children infected with COVID-19 develop mild to mod-erate forms of the disease, with fever and oropharyngeal congestion being the most common symptoms. Nevertheless, there are cases in which the patients accuse respiratory symptoms. These cases need lung evaluation, which can be done using lung ultrasound (LUS), because it is a non-irradiating and repeatable imaging technique. 19 children with COVID-19 pneumonia were eval-uated using LUS. The LUS score (LUSS) for each patient varied between 1 to 8 points from a max-imum of 36 points. The arithmetic mean was 4.47 ± 2.36 (S.D), while 95% CI for the Arithmetic mean was 3.33 to 5.61. The lung changes were correlated with their biomarkers, specifically in-flammatory markers. The correlation between LUSS and LDH, D-dimers and IL-6 was a strong positive one with r=0.66 (p=0.01, 95% CI 0.147 to 0.896) between the LUSS and LDH level at symptomatic infants and children (with cough present) and r=0.66 (p=0.01, 95% CI 0.140 to 0.895) between LUSS and D-dimers level at symptomatic infants and children (with cough pre-sent). The results suggest that LUS could be a good imaging technique that can be used both in ini-tial evaluation of children with respiratory diseases, and, also in their follow-up, correlated with symptoms and biomarkers.

The global threat of COVID-19 has led to the increasing use of metabolomics to study SARS-CoV-2 infection in humans and animals. Despite this, understanding SARS-CoV-2's metabolome during infection remains difficult and incomplete. Here, metabolic responses were characterized from sampled nasal washes collected from an asymptomatic ferret model (n = 20) at different time points before and after the SARS-CoV-2 challenge using an LC-MS-based metabolomics approach. Multivariate analysis of the nasal wash metabolome data resulted in several statistically significant features being observed. Despite no effects of gender or interaction between gender and time on the time course of SARS-CoV-2 infection, 16 metabolites were significantly different at every time point post-infection. Among these altered metabolites, the relative abundance of taurine was elevated post infection which could be an indication of hepatotoxicity, while the accumulation of sialic acids could indicate SARS-CoV-2 invasion. The pathway analysis identified several pathways influenced by SARS-CoV-2 infection. Of these, sugar, glycan, and amino acid metabolisms were the key altered pathways in the upper respiratory channel during infection. These findings provide some new insights into the progression of SARS-CoV-2 infection in ferrets at the metabolic level which could be useful for the development of early clinical diagnosis tools and new or repurposed drug therapies.

Vehicle HVAC systems can accumulate and recirculate highly infectious respiratory diseases via aerosols. Integrating UVC to complement automobile HVAC systems can protect occupants from developing allergies, experiencing inflammatory problems, or acquiring respiratory infectious diseases by inactivating pathogenic organisms. UVC can add little to no static pressure with minimal space, unlike mercury lamps which are larger and heavier. Additionally, UVC LEDs are effective at low voltage and have no mercury or glass. While previous experiments have shown UVC LED technology can reduce bacteriophage Phi6 concentrations by 1 log in 5 minutes (selected as the average time to clean the cabin air), those studies had not positioned LED within the HVAC itself or studied the susceptibility of the surrogate at the specific wavelength. This study aimed to assess the disinfection performance of UVC LEDs in automotive HVAC systems and determine the dose-response curve for bacteriophage Phi6, a SARS-CoV-2 surrogate. To achieve this, UVC LEDs were installed in a car HVAC system. To determine inactivation efficacy, a model chamber of 3.5 m3, replicating the typical volume of a car, containing the modified automobile HVAC system was filled with bacteriophage Phi6, and the HVAC was turned on with and without the UVC LEDs being turned on. The results revealed that HVAC complemented with UVC reduced bacteriophage Phi6 levels significantly more than the HVAC alone and reduced the viral concentration in the cabin by more than 1 LRV (90% viral reduction) in less than 5 minutes. The performance after 5 minutes is expected to be significantly better against SARS-CoV-2 because of its higher sensitivity to UVC, especially at lower wavelengths (below 270 nm). HVAC alone could not achieve a 90% viral reduction of bacteriophage Phi6 in 15 minutes. Applying UVC LEDs inside an HVAC system is an effective means of quickly reducing the number of aerosolized viral particles in the chamber, by inactivating microorganisms leading to improved cabin air quality.

A significant proportion of SARS-CoV-2 infections in Africa are identified as asymptomatic, facilitating the silent spread of the virus especially in populated urban cities. With the surge of the highly transmissible Omicron variant, the inclusion of asymptomatics in epidemiological surveys is key in estimating true infections and seroprevalence in the population. The aim of the study was to determine seroprevalence, active infection and circulating variants in Accra, the capital city of Ghana during the Omicron wave. The study was a cross-sectional survey conducted in 22 municipalities in December 2021. Naso-oropharyngeal swabs and serum samples were collected from 1027 individuals aged 5 years and above, for detection of infection by RT-qPCR and estimation of total antibodies using the WANTAI ELISA kit. Our results show 10% SARS-CoV-2 prevalence, with the Omicron and Delta variants accounting for 44.1% and 8.8% of infections, respectively. Omicron was most prevalent (48.9.%) among the 20–39-year-olds. Asymptomatic individuals accounted for 75.2% of infections. Seropositivity within the population was 86.8%, with the 60+ year group having significantly higher likelihood of exposure (OR 10.22: 95% CI: 3.51-29.73; p<0.001). This high seroprevalence appears to have been as a result of increased vaccination among this group (OR 2.7: 95% CI 1.78-4.09, p < 0.001). The high seropositivity of SARS-CoV-2 in the capital could be a good indication of herd immunity among the population and while the low infection rate supports the role of vaccination in reducing viral transmission.

Low back pain is a clinically highly relevant musculoskeletal burden and is associated with inflammatory as well as degenerative processes of the intervertebral disc. However, the pathophysiology and cellular pathways contributing to this devastating condition are still poorly understood. Based on previous evidence, we hypothesize that tissue renin-angiotensin system (tRAS) components, including the SARS-CoV-2 entry receptor angiotensin-converting enzyme 2 (ACE2), are present in human nucleus pulposus (NP) cells and associated with inflammatory and degenerative processes. Experiments were performed with NP cells from 4 human donors. The existence of angiotensin II, angiotensin II type 1 receptor (AGTR1), AGTR2, MAS-receptor (MasR), and ACE2 in human NP cells was validated with immunofluorescent staining and gene expression analysis. Hereafter the cell viability was assessed after adding agonists and antagonists of the target receptors as well as angiotensin II in different concentrations for up to 48 hours of exposure. A TNF-α-induced inflammatory in vitro model was employed to assess the impact of angiotensin II addition and the stimulation or inhibition of the tRAS receptors on inflammation, tissue remodeling, expression of tRAS markers, and the release of nitric oxide (NO) into the medium. Further, protein levels of IL-6, IL-8, IL-10, and intracellular as well as secreted angiotensin II were assessed after exposing the cells to the substances, and inducible nitric oxide synthase (iNOS) levels were evaluated utilizing Western Blot. The existence of tRAS receptors and angiotensin II were validated in human NP cells. Cell viability analysis revealed no cytotoxic effects of angiotensin II. The AGTR1 inhibitor Candesartan and the MAS receptors AVE0991 showed cytotoxic effects at high concentrations (100 µM). The addition of angiotensin II only showed a mild impact on gene expression markers. However, there was a significant increase in NO secreted by the cells. The gene expression ratios of pro-inflammatory/anti-inflammatory cytokines IL-6/IL--10, IL-8/IL-10, and TNF-α /IL-10 were positively correlated with the AGTR1/AGTR2 and AGTR1/MAS1 ratios, respectively. The stimulation of the AGTR2 MAS-receptor and the inhibition of the AGTR1 receptor revealed beneficial effects on the gene expression of inflammatory and tissue remodeling markers. This finding was also present at the protein level. We did not find alterations in iNOS protein concentrations after adding the drugs. The current data showed that tRAS components are expressed in human NP cells and are associated with inflammatory and degenerative processes. Further characterization of the associated pathways is warranted. The findings indicate that tRAS modulation might be a novel therapeutic approach to intervertebral disc disease.

One of the models that could be used to understand the adoption of vaccine uptake is the Health Belief Model (HBM). The aim of this study is to assess the role of HBM constructs and perceived health status (PHS) on vaccination status of individuals and to understand the role of socio-demographic variables on HBM scoring. A comparative cross-sectional telephone survey was conducted among 1,325 vaccinated (60.0%) and non-vaccinated (40.0%) vaccinated individuals aged 40 years and above in July 2021 in Punjab province, Pakistan. A higher level of education was the strongest predictor of positive HBM. All constructs of HBM, PHS and cues-to-action were significant predictors of COVID-19 vaccination uptake with perceived benefits as the strongest predictor. In order to expand the vaccination coverage, doubled pronged interventions utilizing both ICT and human resources should be designed that address each barrier perceived by individuals and understandably communicate the benefits of COVID-19 vaccine to the broader population.

During the SARS-CoV-2 vaccination campaign, people with CF (pwCF) were considered a clinically vulnerable population. However, data on immunogenicity of anti-SARS-CoV-2 vaccines in pwCF are lacking. We conducted a prospective study enrolling all patients aged >12 and followed-up in our CF centre, who received two doses of the BNT162b2 vaccine in March-­­­October 2021. They underwent a blood sample for quantification of antibodies to the SARS-CoV-2 spike protein receptor binding domain immediately before receiving the first dose and after 3 and 6 months from the second dose. We enrolled 143 patients (median age: 21 years, range: 13-38); of whom 16 had a previous infection. Median antibody titer (interquartile range) after 3 months from vaccination was 1288 U/mL (730-2115) and decreased to 918 U/mL (534-1488) after 6 months (P<0.0001). Median values were higher among previously infected patients as compared to those naïve to SARS-CoV-2 (9107 vs 1229 U/mL at 3 months and 4810 vs 829 U/mL at 6 months, P<0.0001) with no significant differences in the rate of decline over time (P=0.135). All pwCF mounted an antibody response after two-doses of BNT162b2 vaccine that waned at 6 months from vaccination. Age ≥30 years and use of inhaled corticosteroids were associated with a lower humoral response.

Fusarium culmorum is a major pathogen of grain crops. Infected plants accumulate deoxynivalenol (DON), 3-acetyl-deoxynivalenol (3-ADON), or nivalenol (NIV), which are mycotoxins of the trichothecene B group. These toxins are also produced by F. graminearum species complex. New trichothecenes structurally similar to trichothecenes B but lacking the carbonyl group on C-8, designated NX toxins, were recently discovered in atypical isolates of F. graminearum from North America. Only these isolates and a few strains of a yet to be characterized Fusarium species from South Africa are known to produce NX-2 and other NX toxins. Here we report that among 20 F. culmorum strains isolated from maize, wheat, and oat in Europe and Asia over a period of 70 years, 18 strains produced NX-2 simultaneously with 3-ADON and DON or NIV. Rice cultures of strains producing 3-ADON accumulated NX-2 in amounts corresponding to 2-8% of 3-ADON (1.2 - 36 mg/kg). A strain producing NIV accumulated NX-2 and NIV at comparable amounts (13.6 and 10.3 mg/kg, respectively). In F. graminearum, producers of NX-2 possess a special variant of cytochrome P450 monooxygenase encoded by TRI1 that is unable to oxidize C-8. In F. culmorum, producers and nonproducers of NX-2 possess identical TRI1; the reason for the production of NX-2 is unknown. Our results indicate that production of NX-2 simultaneously with trichothecenes B is a common feature of F. culmorum.

Short Linear Motifs (SLiMs) are short linear sequences that can mediate protein-protein interaction. Mimicking eukaryotic SLiMs to compete with extra or intracellular binding partners or to sequester host proteins is the crucial strategy of viruses to pervert the host system. The evolved proteins in viruses facilitate minimal protein-protein interactions that significantly affect intracellular signaling networks. Unfortunately, very little information about the SARS-CoV-2 SLiMs is known, especially across the SARS-CoV-2 variants. Through ELM database-based sequence analysis of spike protein from all the major SARS-CoV-2 variants, we identified four overriding SLiMs in the SARS-CoV-2 Omicron variant including LIG_TRFH_1, LIG_REV1ctd_RIR_1, LIG_CaM_NSCaTE_8, and MOD_LATS_1. These SLiMs are highly likely to interfere with various immune functions, interact with host intracellular proteins, regulate cellular pathways, and lubricate viral infection and transmission. These cellular interactions possibly serve as potential therapeutic targets for these variants, and this approach can be further exploited to combat emerging SARS-CoV-2 variants.

Conventional methods of crop mapping need ground truth information to train the classifier. Thanks to the frequent acquisition allowed by recent satellite missions (Sentinel 2), we can identify temporal patterns that depend on both phenology and crop management. Some of these patterns are specific to a given crop and thus can be used to map it. Thus, we can substitute ground truth information used in conventional methods with agronomic knowledge. This approach was applied to identify irrigated permanent grasslands (IPG) in the Crau area (Southern France) which play a crucial role in groundwater recharge. The grassland is managed by making three mows during the May-October period which leads to a specific temporal pattern of leaf area index (LAI). The mowing detection algorithm was designed using the temporal LAI signal derived from Sentinel 2 observations. The algorithm includes some filtering to remove noise in the signal that might lead to false mowing detection. A pixel is considered a grassland if the number of detected mows is greater than 1. A data set covering five years (2016-2020) was used. The detection mowing number was done at the pixel level and then results are aggregated at the plot level. A validation data set including 780 plots was used to assess the performances of the classification. We obtained a Kappa index ranging between 0.94-0.99 according to the year. These results were better than other supervised classification methods that include training data sets. The analysis of land-use changes shows that misclassified plots concern grasslands managed less intensively with strong intra-parcel heterogeneity due to irrigation defects or year-round grazing. Time series analysis, therefore, allows us to understand different management practices. Real land-use change in use can be observed, but long time series are needed to confirm the change and remove ambiguities with heterogeneous grasslands.

In this paper, the phases in the Mg-Ti-O system using the 1:1 formulation of MgO:TiO2 mixing synthetic brucite of Mexican origin with TiO2 microparticles of high purity and with a heat treatment at 1100°C for 1 h were studied. The raw materials and formulation by XPS and DRX techniques were characterized. The results demonstrate the presence of different oxidation states in titania and the formation of different oxides in the Mg-Ti-O system when mixed and calcined at 1100°C; additionally, the formation of vacancies in the crystal lattice during the transformation from hexagonal brucite to magnesia with a cubic structure centered on the faces is estimated. With the results, its thermal behavior is warned based on the MgO-TiO2 phase diagram.

Coronavirus Disease-19 (COVID-19) is presently wreaking havoc on public health and socio-economic development. Besides the upper and lower respiratory tract involvement, gastrointestinal symptoms are also reported in COVID-19 patients through gut-lung axis. Finding its way through the feces of infected individuals and other sources, the genetic material of SARS-CoV-2 (ssRNA) is reported widely in wastewater and is being used as a fingerprint for its detection. With millions of cases arriving every day, there is a need to level up the testing speed efficiency. Due to the restricted sampling potential of testing laboratories, clinical testing is unable to track all the symptomatic and asymptomatic cases. Wastewater-based epidemiology (WBE) bestows an auxiliary monitoring tool that will contribute in community level screening. Sample collection, concentration, RNA extraction, quantification and data analysis are the main steps involved in implementation of WBE that can be relied upon as an alarm call for an upcoming wave, emergence of a new variant or any future pandemic. WBE can be a cheaper and more practical alternative to high end and sophisticated clinical testing for community transmission detection. Worldwide, there are more than 300 reports entailing the occurrence of SARS-CoV-2 in wastewater exhibiting unique temporal trends with five of them in India. This review aims to address the present knowledge on surveillance of SARS-CoV-2 in wastewater and its implications.

During the novel coronavirus disease (COVID-19) pandemic, several environmental factors have influenced the activities and the protection policy measures. This has had a major effect on climate change and global environmental catastrophe. In many countries, the strategy of closing various activities such as tourism, industrial production, stopped normal life, transportation, among others. This closure has a positive impact on the environment. However, the massive use of masks and personal protection could significantly increase pollution worldwide. The impact on the environment needs to be calculated to have information for public health actions. In this study, we present a first overview of the potential impacts of COVID-19 on some environmental matrices in Bogota, Colombia.

The purpose of the current study was directed to investigate the effectiveness of docosahexaenoic acid (DHA) as a chemopreventive agent on experimentally induced hamster buccal pouch (HBP) carcinogenesis; Material and methods: 40 Syrian male hamsters, five weeks old, were divided into 4 groups of 10 animals in each as follows, GI: Topical application of liquid paraffin alone (thrice a week for 14 weeks), GII: Topical application of 7, 12 dimethyl benz[a]anthracene (DMBA) alone (0.5 % in liquid paraffin, thrice a week for 14 weeks), GIII: Topical application of DMBA (0.5 % in liquid paraffin, thrice a week for 14 weeks) + Oral administration of DHA (125 mg/kg b.w. in 1 ml distilled water by oral gavage, thrice a week for 14 weeks on alternative days of DMBA application), GIV : Oral administration of DHA alone (125 mg/kg b.w. in 1 ml distilled water by oral gavage, thrice a week for 14 weeks); Results: Gross observations and histopathological findings revealed a-GI: normal stratified squamous epithelium b- GII: well and moderately differentiated squamous cell carcinoma (SCC) c-: GIII: showed variable results ranges from hyperkeratosis, hyperkeratosis and focal hyperplasia, mild dysplasia, and well differentiated SCC with superficial invasion of tumor cells not extended to deeper areas d: GIV: normal similar to GI. Immunohistochemical results revealed that oral DHA treatment to DMBA treated hamsters restored the normal expression of bcl-2; Conclusion: DHA has the potential to be a dietary chemopreventive agent due to its capacity to improve carcinogen detoxification and to block/suppress the initiation and promotion stages of experimentally produced HBP carcinogenesis.