In this study, we have focused on studying the heterogenous degradation kinetics of regarding the decomposition of emergency contraceptive agent levonorgestrel (LNG), which is a second-generation synthetic progestogen that is the active component of the racemic mixture of norgestrel. The degradation processes of the active pharmaceutical ingredient (API) were compared with the ones obtained from model system containing the API along with the excipients that are found in a commercialized pharmaceutical formulation in a mass ratio of 1:1 (LNGMIX), in order to observe if the excipients have a stabilizing or destabilizing effect for the degradation of this progestogen. To achieve this, the following investigational methods were used: FTIR (Fourier transform infrared) spectroscopy and thermal analysis (TG/DTG/DSC analysis). For the kinetic analysis the data obtained from two main decomposition processes observed on the DTG curves were used and processed with a preliminary method, namely ASTM E698 and two isoconversional methods: Friedman and Flynn-Wall-Ozawa. The isoconversional study revealed that the decomposition mechanism of both LNG and LNGMIX are complex, and the excipients have a stabilizing effect over decomposition of API in tablet.

The large American liver fluke (Fascioloides magna) is considered an invasive trematode parasite in Europe. Its origin dates back before the Cretaceous-Paleogene Mass Extinction, after which it survived at least three population bottlenecks, and successful host switches before it arrived in Europe. The authors review the evolutionary history of F. magna, the distribution by its ancient proboscidean hosts and the probable drivers of switch to the white-tailed deer (Odocoileus virginianus). The review collects knowledge on the biology of intermediate hosts, which help understand the factors that influence the epidemiology of F. magna in aquatic ecosystems. The authors demonstrate the adaptation potential of the parasite by data from both the North American and the European endemics. Finally, the study calls attention to the epidemiological risk of human induced global change, with a special interest to the invasive snail species, Pseudosuccinea columella.

Cardiovascular disease (CVD), comprising heart and blood vessel disorders, persists as the foremost contributor to global morbidity and mortality. In modern times, the intricate composition of gut microbiota has garnered significant focus, particularly for its varying impact on diverse ailments. Perturbations in gut microbiota and consequent dysbiosis have demonstrated connections with the advancement and origin of CVD, including conditions like atherosclerosis, hypertension, and heart failure. This comprehensive review delves into the pivotal role of gut microbiota in maintaining cardiovascular well-being.

Single-cell RNA sequencing (scRNA-seq) technology has significantly advanced our understanding of the diversity of cells and how this diversity is implicated in diseases. Yet, translating these findings across various scRNA-seq datasets poses challenges due to technical variability and dataset-specific biases. To overcome this, we present a novel approach that employs both an LLM-based framework and explainable machine learning to facilitate generalization across single-cell datasets and identify gene signatures to capture disease-driven transcriptional changes. Our approach uses scBERT, which harnesses shared transcriptomic features among cell types to establish consistent cell-type annotations across multiple scRNA-seq datasets. Additionally, we employ a symbolic regression algorithm to pinpoint highly relevant yet minimally redundant models and features for inferring a cell type’s disease state based on its transcriptomic profile. We ascertain the versatility of these cell-specific gene signatures across datasets, showcasing their resilience as molecular markers to pinpoint and characterize disease-associated cell types. Validation is carried out using four publicly available scRNA-seq datasets from both healthy individuals and those suffering from ulcerative colitis (UC). This demonstrates our approach’s efficacy in bridging disparities specific to different datasets, fostering comparative analyses. Notably, the simplicity and symbolic nature of the retrieved gene signatures facilitate their interpretability, allowing us to elucidate underlying molecular disease mechanisms using these models.

Microwave absorbers with lightweight, good stability and high efficiency have attracted much attention for their applications in many contemporary fields. In this work, the 3D porous (Ni@NO-C)n/NO-C composite absorber was prepared by a wet chemistry method with Ni chains and melamine as precursors, in which NO-C (N,O-doped carbon) encapsulated Ni particles are homogenously dispersed in the 3D porous networks of NO-C in the form of (Ni@NO-C)n chains. The special microstructure of the as-prepared material is proved to be benefit for the improvement of its microwave adsorption performance. The as-synthesized (Ni@NO-C)n/NO-C composite ab-sorber exhibited an effective absorption bandwidth of 4.1 GHz and an extremely large reflection loss of -72.3 dB. The excellent microwave absorbing performances can be ascribed to the coopera-tive consequence of dielectric loss and magnetic loss along with the balance between attenuation capability and impedance match.

This mini-review deals with some non-starter lactic acid bacteria (NSLAB) species with a controversial nature known to be both human and animal pathogens but also health-promoting and probiotic. The focus is put on Lactococcus garvieae, two Streptococcus species (Str. uberis and Str. parauberis), four Weissella species (W. hellenica, W. confusa, W. paramesenteroides and W. cibaria) and Mammalicoccus sciuri which worldwide are often found within the microbiotas of different kinds of cheese, mainly traditional artisanal ones made from raw milk and/or relying on environmental bacteria for their ripening. Based on literature data, their virulence and health-promoting effects are examined, and some of the mechanisms of these actions are investigated. Additionally, their possible roles in cheese ripening are also discussed. The analysis so far showed that, in general, the pathogenic and the beneficial strains, despite belonging to the same species, show pretty different genetic constitutions. Yet, when the safety of a given strain is assessed, genomic analysis on its own is not enough, and a polyphasic approach is needed including additional physiological and functional tests.

Land use and land cover (LULC) datasets for Jinan in 1992, 1998, 2002, 2006, 2011, 2017, and 2022 were developed from Landsat images using the Random Forest (RF) classification approach. The relationships between social-economic, political factors and time-series LULC data were exam-ined for the periods between 1992 and 2022. The results showed the effectiveness of using the RF classification method for LULC classification with time series of Landsat images. Combined with driving forces analysis, our research can effectively explain the detailed LULC change tra-jectories corresponding to different stages and give new insights into Jinan LULC change pat-terns. The results show a significant increase in impervious surface which opposite change to bare land which experienced a huge decline declined by 95%, due to urbanization and rapid in-crease of population. The driving forces behind these changes are related to population growth, economic development, and climate change. Moreover, the present research employed Principal Components Analysis (PCA) methodology in order to understand the relative significance of disparate driving factors. The analysis results prove that the economy (population, GDP) and climate change were the primary factors that have an obvious impact on land use/land cover changes and that the driving factors for impervious surface, bare land, woodland, farmland, and water were distinct. Government policies also have a substantial impact on LULC change as well, such as the Construction of Harmonious Jinan (COHJ). The results were helpful for better understanding the mechanisms of LULC change and can provide useful knowledge for effective land resource management and planning.

Increased insulin levels may support the development of neural circuits involved in cognition, while chronic mild inflammation may also result in cognitive impairment. This study aimed to gain more insight into whether cognition is impacted already during adolescence in a genetic rat model for obesity and type 2 diabetes. Cognitive functioning throughout adolescence and early adulthood was investigated in Zucker Diabetic Fatty (ZDF), ZDF lean and healthy outbred Long Evans rats using operant touchscreens. Blood glucose, insulin and lipids were longitudinally analyzed. Histological analyses were performed in the liver, white adipose tissues and the prefrontal cortex. Adolescent ZDF obese rats outperformed lean rats on visual discrimination performance. During the longitudinal cognitive testing period, insulin levels sharply increased over weeks in ZDF obese rats and were significantly enhanced from 6 weeks of age onwards. Early signs of liver steatosis and enlarged adipocytes in white adipose tissue were observed in ZDF early adult obese rats. Histological analyses at early adulthood showed no group differences in the number of prefrontal cortex neurons and microglia, nor PSD95 and SIRT1 mRNA expression levels. Together, our data show that adolescent obese ZDF rats even display enhanced cognition despite their early diabetic profile.

Currently, efficient utilization of low-grade thermal energy is a great challenge. Thermoelectricity is an extremely promising method of generating electrical energy from temperature differences. As a promising energy conversion technology, thermo-electrochemical cells (TECs) have attracted much attention in recent years for their ability to convert thermal energy directly into electricity with high thermal power. Within TECs, anions and cations gain and lose electrons, respectively at the electrodes using the potential difference between the hot and cold terminals of the electrodes by redox couples. Additionally, the anions and cations therein are constantly circulating and mobile via concentration diffusion and thermal diffusion, providing an uninterrupted supply of power to the exterior. This review article focuses mainly on the operation of TECs, recent ad-vances in redox couples, electrolytes, and electrodes. The outlook for optimization strategies re-garding TECs is also presented in this paper.

Transmission electron microscopy methods were used to analyze the cementite substructure in the head of special-purpose long rails of DT400IK category made of hypereutectoid steel after long-term operation on an experimental track on the Russian Railways ring (the passed tonnage is 187 million tonnes). It is noted that the study of various aspects of cementite – its structure, morphology, chemical composition, crystal lattice defects is relevant. The steel structure is represented by three morphological components at a distance of 10 mm from the sample surface: lamellar perlite, fractured and fragmented perlite. The volume fraction of lamellar perlite in the material is 65%. It is shown that after operation, the cementite plates are bent and separated by ferrite bridges. In the plates of ferrite and cementite, a dislocation substructure is formed which is of chaotically distributed and network type in ferrite and of ordered type in cementite. An increased density of dislocations at ferrite-cementite interfaces compared to the volume of ferrite plates was noted. Two possible mechanisms of deformation transformation of lamellar perlite grains are indicated: fracture of cementite plates and carbon pulling out from the lattice of the carbide phase. It is indicated that in the dissolution of cementite plates, the interfacial boundaries “α-phase-cementite” play an important role. The removal of carbon from cementite plates occurs most intensively near defects in ferrite and cementite. The formed nanosized particles of tertiary cementite are unevenly distributed in the ferrite plates, most of them are observed at the locations of ferrite subgrains and interfacial boundaries. This results in non-uniform diffraction contrast in dark-field images of cementite plates. Nanosized particles of cementite can be taken out into the interlamellar space of pearlite colonies in the process of dislocation slip, or they are formed as a result of deformation decomposition, which is less likely. Fragmentation of ferrite and cementite plates is revealed and azimuthal components of total misorientation angles are estimated. The mechanisms of mass transfer of carbon atoms over interstitial sites, deformation vacancies, dislocation tubes, grain boundaries and fragments are considered. According to all the established patterns of the cementite substructure transformation, a comparison with the results for rails made of hypoeutectoid steel was performed.

Current stock market forecasting methods encompass fundamental, technical, emotional, and bargaining factors. Predominantly, price prediction hinges on order volume and price, although correlating these two within existing models proves challenging. This study employs Cycle Generative Adversarial Network (Cycle GAN) to unravel the intricate price-volume relationship, combining it with Bollinger Bands for trading signal analysis, overcoming hurdles in short-term forecasting prevalent in numerical analysis and AI. Focusing on TSMC (2330.TW) stock price, the research leverages Cycle GAN in deep learning to master the price-volume nexus, juxtaposed with LSTM and RNN. Historical TSMC closing prices and transaction counts are model inputs, scrutinizing their interconnectedness for predictions. This innovative approach aligns stock price, volume, market value, taxes, and prior changes via system engineering. By intertwining Bollinger Bands with stock price forecasts, trading signals are distilled, factoring in extended index %b for a comprehensive market picture.

This work is aimed at showcasing one of the most engaging geoparks in Europe, the Gole della Breggia Geopark. By following its geotrail, the visitors can observe a great deal of features that encompass a wide variety of sedimentary, stratigraphic, tectonic and paleogeographic processes. Its contents are valorized by a comprehensive geotrail that encompasses 23 geostops, enriched with explanatory panels, which enable viewers to gain an overall picture of the complex processes that led to the present-day configuration of the outcrops encountered in the Geopark. We have selected five significative outcrops, which we have regarded as fully-fledged geosites, and which encompass the whole 170-million-year interval, from Early Jurassic to Late Miocene times, during which the rocks of the Geopark were deposited and deformed. We have performed an assessment of the five geosites, using the most common criteria that can be applied for geosite evaluation. The result of the assessment show that the most valuable geosite is the Lombardian Maiolica, highly representative of a pelagic limestone, which is rich in fossil contents, marked by integrity, scien-tific interest and has a major educational value. All geosites, thanks to a QR code added to each figure along the text, can be viewed as Virtual Geosites (VGs), integrated by 360° videos.

Spinors are used for the computation of probability in quantum mechanics. They are treated as elements of a complex vector space in contrast to a real vector space. Spinor theory is abstract mathematics with an ambiguous interpretation. The overall phase of spinors does not affect the computation of probability in quantum mechanics. If two spinors have an overall phase of imaginary number i, then they can be treated like vectors in a real vector space. The square of the magnitude of the number, which is the sum of dot product and the term having basis vector i of cross product of two such vectors, is equal to the probability computed using the corresponding spinors. Therefore, the geometry of such spinors can be easily depicted in a three-dimensional space like vectors in a real vector space. Spinors are not isotropic vectors in Hilbert space. The sum of dot product and cross product of two complex numbers is equivalent to the quotient of the division of one complex number by another. Similarly, the sum of dot product and cross product of two vectors is the quotient of the division of one vector by another. Using the rules of division of vectors, we can find the rules of multiplication of vectors. The rules of multiplication and division of basis vector i match the rules of multiplication and division of imaginary number i. Therefore, basis vector i is nothing but imaginary number i. Multiplication of dot and cross product of two vectors to the second vector will give us the components of the first vector that are parallel and orthogonal to the second vector. Vectors are also made up of complex numbers like spinors. The reason for finding dot product of complex numbers in the process of computing the probability is to ignore the overall phase in contrast to the phase difference. This is misconstrued as complex vector space in quantum mechanics. 3-D number which is nothing but a spinor with new notation is an extension of vector algebra. It can have a real number as a term in addition to the terms i, j and k. In all other respects, it is a vector. 3-D numbers are part of the number system like real numbers and complex numbers. The real numbers are one dimensional numbers, the complex numbers are two-dimensional numbers and the 3-D numbers as well as vectors and spinors are three-dimensional numbers. As polarisation and spin are one and the same, we can straight away apply 3-D numbers to polarisation of light. 3-D numbers will greatly simplify the study of areas of science where three-dimensional space is involved.

Bone growth plate abnormalities and skull shape defects are seen in hypophosphatasia, a heritable disorder in humans that occurs due to deficiency of Tissue Nonspecific Alkaline Phosphatase (TNAP, Alpl) enzyme activity. Abnormal development of the cranial base growth plates (synchondroses) and abnormal skull shapes have also been demonstrated in global TNAP-/- mice. To distinguish local vs. systemic effects of TNAP on skull development, we utilized P0-Cre to knockout TNAP only in cranial neural crest derived tissues using TNAP flox mice. Here we show that TNAP deficiency in cranial neural crest leads to leads to skull shape defects and deficient growth of the intersphenoid synchondrosis (ISS). ISS chondrocyte abnormalities included increased proliferation in resting and proliferative zones with decreased apoptosis in hypertrophic zones. ColX expression is increased, indicative of premature differentiation in the absence of TNAP. Sox9 expression is increased in both resting and prehypertrophic zones of mutant mice. Expression of PTHrP and IHH were also increased. Finally, cranial base organ culture revealed that inorganic phosphate (Pi) and pyrophosphate (PPi) have specific effects on cell signaling and phenotype changes in the ISS. Together, these results demonstrate that TNAP expression in growth plate chondrocytes is essential for normal development, and that the mechanism likely involves Sox9, PTHrP, IHH and PPi.

This study aimed to evaluate the proliferation and migration of fibroblast cells derived from chronic wounds and investigate the impact of low-level laser therapy (LLLT) on their growth and migration. A total of 60 dermal samples were obtained from three sites of chronic pressure ulcers and diabetic ulcers in 20 patients. Following collection in the operating room, the dermal samples were isolated using the procedure described by Freshney RI. Fibroblasts from the wound base (Site 1) exhibited a slow proliferation rate and a decrease in proliferative capacity. Fibroblasts from wound margins (Site 2) and adjacent healing skin (Site 3) could be successfully isolated and maintained for multiple generations without any morphological changes. Fibroblasts from chronic wounds at Sites 2 and 3 showed slower proliferation rates and reduced migration capabilities compared to normal dermal fibroblasts (control samples). The fibroblast cells were exposed to LLLT at different energy levels (2.5, 3, and 3.5 J/cm2). The laser-treated groups demonstrated a significantly higher increase in cell count compared to the control sample, with the highest increase observed at an energy level of 3 J/cm2. These findings suggest that LLLT at an energy level of 3 J/cm2 could effectively enhance fibroblast migration, indicating its potential as a therapeutic intervention for chronic wounds.

We overview recent findings achieved in the field of model-driven development of additively manufactured porous materials for development of a new generation of bioactive implants for orthopedic applications. Porous structures produced of biocompatible titanium alloys by selective laser melting can present a promising material to design scaffolds with regulated mechanical properties and with capacity to be loaded with pharmaceutical products. Adjusting pore geometry, one could control elastic modulus and strength/fatigue properties of the engineered structures to be compatible with bone tissues, thus preventing the stress shield effect when replacing a diseased bone fragment. Adsorption of medicals by internal spaces would make it possible to emit the antibiotic and anti-tumor agents into surrounding tissues. We critically analyze the recent advances in the field featuring model design approaches, virtual testing of the designed structures, capabilities of additive printing of porous structures, biomedical issues of the engineered scaffolds and so on. A special attention is paid to highlight the current troubles in the field and the ways of their solutions.

BACKGROUNDː The so-called Low Cardiac Output Syndrome (LCOS) is one of the most common complications in pediatric patients with congenital heart disease undergoing corrective surgery. LCOS requires high concentrations of inotropes to support cardiac contractility and improve cardiac output, allowing for a better systemic perfusion. To date, serum lactate concentrations and central venous oxygen saturation (ScVO2) are the most commonly used perfusion markers, but they are not completely reliable to identify a state of global tissue hypoxia. The study aims to evaluate whether the venoarterial carbon dioxide difference/arterial-venous oxygen difference ratio [P(v-a)CO2/C(a-v)O2] can be a good index to predict the development of LCOS in the aforemen-tioned patients, so as to treat it promptly. METHODSː This study followed a population of 98 children undergoing corrective cardiac surgery from June 2018 to October 2020 at the Department of Cardiac Surgery of University Hospital Inte-grated Trust and their subsequent admission at the Postoperative Cardiothoracic Surgery Intensive Care Unit. During the study, central arterial and venous blood gas analysis were carried out before and after cardiopulmonary bypass (CPB) (pre-CPB and post-CPB), at admission to intensive care unit, before and after extubation and at any time of instability or modification of the patient’s clinical and therapeutic conditions. RESULTSː The data analysis shows that 46.9% of the children developed a LCOS (in line with the current literature) but that there is no statistically significant association between the P(v-a)CO2/C(a-v)O2 ratio and LCOS onset. Despite the limits of statistical significance, however, a 31% increase in the ratio emerged from the pre-CPB phase to the post-CPB phase when LCOS is present. CONCLUSIONSː This study confirms a statistically significant association between the most used markers in adult patients (serum lactate concentration, ScVO2 and oxygen extraction ratio-ERO2) measured in the pre-CPB phase and the incidence of LCOS onset, especially in patients with he-modynamic instability before surgery.

Dementia is a public health priority, in which memory impairments are prevalent and affects an individual’s daily activities. Research has tried to find ways to support memory problems of individuals with dementia. Self reference effect (SRE) has been shown to benefit memory in healthy, non-dementia group. The study aimed to investigate if SRE will improve memory performance of individuals with dementia. We used ecologically valid Ownership Procedure and the Remember/Know Paradigm to examine the Self-Reference Effect (SRE) on memory. It was hypothesised that participants living with dementia will perform differently in the recall of items that were self-referentially encoded compared to items other-referentially encoded and that the memory will be different in control participants than in those that live with dementia. The research found that self-referential processes did not have effect on memory in individuals with dementia. We suggest that impaired self-awareness may have contributed to the lack of this effect. However, we had a small sample size and these findings should be treated with caution.

Low-resource languages often face the problem of insufficient data, which leads to poor quality in machine translation. One approach to address this issue is data augmentation. Data augmentation involves creating new data by transforming existing data through methods such as flipping, cropping, rotating, and adding noise. Traditionally, pseudo-parallel corpora are generated by randomly replacing words in low-resource language machine translation. However, this method can introduce ambiguity as the same word may have different meanings in different contexts. This study proposes a new approach for low-resource language machine translation, which involves generating pseudo-parallel corpora by replacing phrases. The performance of this approach is compared with other data augmentation methods, and it is observed that combining it with other data augmentation methods further improves performance. To enhance the robustness of the model, R-Drop regularization is also used. R-Drop is an effective method for improving the quality of machine translation. The proposed method was tested on Chinese-Kazakh (Latin script) translation tasks, resulting in performance improvements of 4.99 and 7.7 for Chinese-to-Kazakh and Kazakh-to-Chinese translations, respectively.

Ebola virus disease (EVD) represents a global health threat. The etiological agents of EVD are 6 species of Orthoebolaviruses, with Orthoebolavirus zairense (EBOV) having the greatest public health and medical significance. EVD disease pathogenesis occurs as a result of broad cellular tropism of the virus, robust viral replication and a potent and dysregulated production of cytokines. In vivo, tissue macrophages are some of the earliest cells infected and contribute significantly to virus load and cytokine production. While EBOV is known to infect macrophages and to generate high titer virus in the liver, EBOV infection of liver macrophages, Kupffer cells, has not previously been examined in tissue culture or experimentally manipulated in vivo. Here, we employed primary murine Kupffer cells (KC) and an immortalized murine Kupffer cell line (ImKC) to assess EBOV-eGFP replication in liver macrophages. KCs and ImKCs were highly permissive for EBOV infection and IFN-γ polarization of these cells suppressed their permissiveness to infection. The kinetics of IFN-γ-elicited antiviral responses were examined using a biologically-contained model of EBOV infection termed EBOV ΔVP30. The antiviral activity of IFN-γ was transient, but a modest ~3-fold reduction of infection persisted for as long as 6 days post treatment. To assess the interferon stimulated gene products (ISGs) responsible for protection, the efficacy of secreted ISGs induced by IFN-γ were evaluated. Secreted ISGs blocked recombinant VSV expressing EBOV GP (rVSV/EBOV GP) infection, but failed to block EBOV ΔVP30. Our studies define new cellular tools for the study of EBOV infection that can potentially aid the development of new antiviral therapies. Furthermore, our data underscore the importance of macrophages in EVD pathogenesis and those IFN-γ-elicited ISGs that help to control EBOV infection.

The COVID-19 pandemic caused many enduring changes in everyday life of families with negative effects on parents’ and children well-being. However, literature lacks of studies exploring emotional reactions and coping strategies of both mothers and children of different ages. Furthermore, most studies used only self-reports. This study aimed to identify the emotions and coping strategies of children, adolescents and their mothers and to verify the association between maternal and children well-being. A mixed-method design using interviews and questionnaires was applied to collect information on well-being (emotional reactions, behavioral/emotional problems) and coping strategies of both mothers (n=65), and their children (n=35, 8-10 year; n=30, 11-13 year) during the second wave of the pandemic (December 2020). No differences between the groups emerged concerning the emotional reactions reported. In contrast, mothers and children of different ages reported different self-regulation and other-regulation strategies. Moreover, maternal strategies had different effects on children well-being. The integration of qualitative and quantitative results was informative to understand how families adapted to the radical changes of everyday life caused by the pandemic. Implications for developing interventions in such similar stressful situations to promote family well-being are discussed.

The degradation of Proton-exchange membrane fuel cell (PEMFC) gasket materials is crucial in electric vehicles as it can cause hazardous hydrogen fuel leaks, which are usually due to high temperatures, pressures, and hydrogen fuel exposure. Degradation of gasket materials in PEMFC presents a critical concern for electric vehicle safety due to potential hydrogen fuel leaks. This study utilizes finite element analysis (FEA) to assess the suitability of gasket materials for PEMFC applications, focusing on aging and tensile conditions. The dual degradation framework, incorporating contact pressure and von Mises stress, is employed to evaluate Liquid Silicon Rubber (LSR) and Ethylene Propylene Diene Monomer (EPDM) materials. Under aging techniques, the Yeoh model exhibits the least Mean Absolute Percentage Error (MAPE) and computational cost of 0.27 seconds, while the Ogden model records the highest computational cost of 0.89 seconds. In evaluating MAE, Root Mean Square Error (RMSE), and R-squared metrics, LSR and EPDM materials demonstrate respective averages of 0.25%, 0.275%, 0.945%, and 0.815%, 0.685%, 0.77%. Tensile testing (Uniaxial) reveals RMSE and MAE values of 0.30%, 0.40%, and 0.50%, 0.40%, respectively. FEA proves instrumental in identifying suitable gasket materials for PEMFC applications. LSR emerges as the superior choice, demonstrating enhanced FEA modelling performance under aging and tensile conditions. These findings contribute valuable insights to the design and development of improved gasket materials, bolstering the safety and reliability of electric vehicles.

Myelodysplastic syndromes or neoplasms (MDS) are a heterogeneous group of myeloid clonal disorders characterized by peripheral blood cytopenias, blood and marrow cell dysplasia and an increased risk for evolution to acute myeloid leukemia (AML). Non-coding RNAs, especially microRNAs and long non-coding RNAs serve as regulators of normal and malignant hematopoiesis and have been implicated in carcinogenesis. This review will present a comprehensive summary of the biology and role of non-coding RNAs, including the less studied circRNA, siRNA, piRNA, and snoRNA as potential prognostic and/or predictive biomarkers or therapeutic targets in MDS.

The accessibility of public transportation is also known as the last mile problem, and it is one of the main obstacles that affect travelers to choose public transport. Although autonomous vehicles (AVs) have made much progress, they have not been officially put into commercial use. This paper adopts stated preference experiments to explore the impact of shared AVs on train trips’ last-mile travel behavior and takes Wuhan as an example for case analysis. First of all, this paper establishes a structural equation model (SEM) based on the theory of planned behavior to explore the latent psychological variables, including travelers’ attitudes (ATTs), subjective norms (SNs), perceived behavior control (PBC), and behavioral intention to use (BIU) toward AVs. These latent psychological variables are incorporated into the latent class (LC) logit model to establish a hybrid model to study the factors and degree of influence on the travel mode choice for the last mile of train trips. The results show that travelers have preference heterogeneity for the travel mode choice of the last mile of train trips. Through the analysis of LCs, education, career, and income significantly impact the classification of LCs. The latent psychological variables towards AVs have a significant impact on the travel behavior of respondents, but the impacts vary among different segments. Elastic analysis results illustrate that a 1% increase in the travel cost for shared AV in segment 1 leads to a 7.598% decrease in the choice probability of shared AV. Respondents from different segments vary significantly in their willingness to pay, and the value of travel time for high-income groups is relatively higher.

Water deficit greatly affects global crop growth and productivity, particularly in water-limited environments like upland rice cultivation, leading to reduced grain yield. Plants activate various defense mechanisms during water deficit, involving numerous genes and complex metabolic pathways. Exploring orthologous genes, linked to enhanced drought tolerance, can aid functional validation in target species using genomic data from model organisms. Here, we studied the OsCPK5 gene in upland rice, an AtCPK6 ortholog from A. thaliana, by overexpressing it in the BRSMG Curinga cultivar. Transformants were assessed under two conditions: water deficit applied 79 days after seeding, lasting 14 days, followed by 7 days of irrigation at 80% field capacity. Physiological data and samples were collected at R3, R6, and R8 stages. GM plants consistently exhibited higher OsCPK5 gene expression across stages, peaking during grain filling. During this phase, GM plants displayed reduced stomatal conductance, photosynthetic rate, and increased water use efficiency compared to non-GM plants under drought. GM plants also exhibited higher filled grain percentage in both irrigation conditions. Their drought susceptibility index was 0.9 times lower than NGM plants, and they maintained a higher chlorophyll a/b index, indicating sustained photosynthesis. NGM plants under water deficit exhibited more leaf senescence, while OsCPK5-overexpressing plants retained green leaves. Overall, OsCPK5 overexpression induced diverse drought tolerance mechanisms, hinting at potential for future development of more drought-tolerant rice cultivars.

Being a great source of protein, B-vitamins and minerals, meat and fish are staple foods in many cultures. However, cooking at high temperatures can produce chemicals associated with an increased risk of developing cancer. This review investigates the possible carcinogenic activity of chemicals formed during the cooking of meat and fish including heterocyclic amines (HCAs), polycyclic aromatic hydrocarbons (PAHs), and advanced glycation end products (AGEs). High-temperature cooking methods for meat, including grilling or frying, result in the formation of HCAs. Meat that has been smoked, grilled, or cooked over an open flame produces PAHs whereas, dry heat methods including roasting, grilling, and frying results in formation of AGEs. In vitro studies have shown that these compounds can damage DNA, cause mutations, and promote the growth of cancer cells. Research shows that thoroughly cooked meat increases the risk of cancer, particularly colorectal, pancreatic, and prostate cancer. Alternative cooking techniques, marinades, and incorporating fruits and vegetables can help to mitigate this risk. For determining the efficacy of these measures, additional studies are required. For the purpose of lowering the potential carcinogenic activity of chemicals formed during the cooking of meat and fish, mitigation techniques must be understood and put into practice. Cancer can be avoided by informing people about the dangers of eating meat and fish that have been cooked at high temperatures and by encouraging better diets and cooking styles. In order to lessen the possible health concerns related to the eating of meat and fish, further studies are required.

The oil spilled from the Gulf war caused land pollution and various petroleum compounds. Among petroleum compounds, polycyclic aromatic hydrocarbons (PAHs) are known for toxicity, and have been designated as carcinogenic, mutagenic, and endocrine disrupting substances by the United States Environmental Protection Agency (USEPA). According to the USEPA, toxic equivalents quotient (TEQ), and mutagenic equivalents quotient (MEQ) can be calculated by multiplying the toxic equivalency factor (TEF) and mutagenic equivalency factor (MEF) by the concentration of PAHs. The USEPA calculates the relative TEF for other PAHs by setting the TEF value of benzo(a)pyrene, which is highly toxic, to 1. Relative MEF is also calculated in the same way. In this study, the TPH concentrations of crude oil-contaminated soils collected from the Burgan in Kuwait were measured to be 5, 8, and 20% and TEQ and MEQ of the soils were calculated by multiplying the 16 PAHs concentrations measured for each sample by TEF and MEF, respectively. When the TPH concentration was increased by 4 times from 5% to 20%, the TEQ was increased by about 9 times and the MEQ was increased by about 10 times. Therefore, it was concluded that as the TPH concentration increases, the carcinogenicity and mutation rate increase greatly. In addition, ecotoxicity assessment was performed using luminescent bacteria to compare the relationship between the calculated TEQ and MEQ and actual ecotoxicity, and benzo(a)pyrene among 16 PAHs showed a coefficient of determination of 0.95. In this study, ecotoxicity in PAHs-contaminated environment can be estimated by analyzing benzo(a)pyrene as a representative substance.

Abstract: The advent of Artificial Intelligence (AI) has in just a few years invested multiple areas of knowledge, also affecting the medical-scientific sector. An increasing number of AI-based applications have been developed, among which conversational AI has emerged. Among these, ChatGPT has risen to the headlines, scientific and otherwise, for its distinct propensity to simulate a 'real' discussion with its interlocutor, based on appropriate prompts. Although several clinical studies using ChatGPT have already been published in the literature, very little has yet been written about its potential application in human pathology. We conduct a systematic review following the Preferred Reporting Items for Systematic Re-views and Meta-Analyses (PRISMA) guidelines, using PubMed and Scopus as databases, with the fol-lowing keywords: ChatGPT OR Chat GPT, in combination with each of the following: Pathology, di-ag-nostic pathology, anatomic pathology. A total of 90 records were initially identified in the literature search, of which 6 were duplicates. After screening for eligibility and inclusion criteria, only 5 publications were ultimately included. The majority of publications were original articles (n = 2), followed by case reports (n = 1), letter to the editor (n = 1) and review (n = 1). Although the premises are exciting and ChatGPT is able to co-advise the pathologist in providing large amounts of scientific data for use in routine microscopic diagnostic practice, there are many limitations that need to be addressed and resolved, with the caveat that an AI-driven system should always provide support and never a decision-making motive during the anatomo-pathological diagnostic process.

This paper investigates the roll parameter estimation of periodic disturbances where the amplitude, frequency, offset, and phase are hardly recognized in real practice. The key problem is to make an estimation that could eliminate the unknown disturbance parameters. An adaptive mechanism applies these four parameters to the globally exponential convergence using linear second-order filters and parameter estimation errors. Then, a backstepping controller is employed to make an exponential convergence to zero of the state variables. Moreover, reservoir computing is used to forecast chaotic roll motions to support predictability using Lyapunov exponents and the Poincaré map. Numerical simulations are demonstrated to validate the dynamical behaviors and efficacy of the proposed control scheme with machine learning.

A maxillary totally edentulism was rehabilitated with one-piece implants starting from pre-existing totally removable denture. A 3D digital scan of the removable denture and upper and lower arches was performed. On this basis, a prototype with optimal esthetic and functional outcomes was re-alized and turned into a custom-made radiological stent with markers. The superimposition of STL and DICOM files allowed the virtual planning of one-piece implants ideal position. The stackable templates composed of a fixed component, namely base template, and removable components, were realized. The fixed component, once secured with anchor pins to the bone, was no longer removed. The removable components, screwed to the fixed component, were used to perform the implant surgery and the immediate prosthetic loading. A base template allowed for maintaining a fixed reference during the entire workflow, improving the transition between the digital project, the surgical procedure, and the prosthetic rehabilitation.

Smartphone Addiction is a social issue caused by excessive smartphone use, affecting decision-making processes. Current research on the risky decision-making abilities of smartphone addicts is limited. This study used the fNIRS brain imaging technique and a Sequential Risk-Taking Task experimental paradigm to investigate the decision-making behavior and brain activity of smartphone addicts under varying risk levels. Using a mixed experimental design, the research assessed decision-making ability and brain activation levels as dependent variables across two groups (addiction and control), two risk amounts (high and low), and two outcomes (gain and loss). The study included 42 participants, with 25 in the addiction group and 17 in the control group. Results indicated that risk level significantly impacted the decision-making ability of smartphone addicts, with high-risk levels leading to weaker decision-making ability and increased risk-taking. However, at low risk levels, decision-making abilities between addicts and healthy individuals showed no significant difference. Furthermore, brain imaging results using fNIRS revealed stronger brain activation in the dlPFC region for smartphone addicts under loss outcome conditions, with no significant differences between the two groups in terms of brain activation at varying risk volumes. These findings are critical in promoting healthy smartphone use, guiding clinical treatment, and advancing brain mechanism research.

Online education allows learners to develop knowledge and skills flexibly and conveniently—such observation among students whose characteristics involve student engagement, self-regulation, and self-efficacy. However, studies to characterize Filipino online learners seem lacking. Thus, this study aimed to characterize science education tertiary students in the Philippines concerning their online student engagement (OSE), self-regulated learning (SRL), and online learning self-efficacy (OLSE). The unprecedented events brought by COVID-19 pandemic also urged the implementation of online modalities while there is no available information on students’ online learning profiles. Hence, researchers used a survey research employed through ex post facto approach to determine the effects of the demographic profile on OSE, SRL, and OLSE. The survey was participated by N=373 respondents who answered the questionnaire with informed consent administered via Google Forms. Results revealed that OSE indicators moderately characterized students, while SRL and OLSE indicators are true of them, substantiated by the overall mean M=3.85(SD=0.90), M=3.86(SD=0.92), and M=3.14(SD=0.73), respectively. Also, multivariate tests showed no significant effect among the independent groups (p>0.05), except for gender and OLSE interaction (p<0.05) so, only in OLSE was a significant difference found in gender. In conclusion, Filipino online learners are moderate across aspects of student engagement, self-regulation, and self-efficacy.

According to WHO, reducing salt intake to less than 5 g/day means less death, disability, and suffering from heart disease and stroke, with around 1.89 million lives saved every year. In this scoping review, we have reviewed the salt consumption pattern of South Asia. For this purpose, we searched online databases and websites and consulted key informants to address relevant unpublished reports. The inclusion criteria are English-language publications between January 2011 and October 2021, as well as research that evaluated salt intake in the South Asian region and reported salt/sodium 24-hr urine or spot urine samples involving at least 100 participants. A total of 2043 studies were screened, out of which 12 studies fulfilled all the criteria. Our review revealed that reported salt intake in the South Asian region ranges from 6.7-13.3 g/day, which was higher than the WHO-recommended maximum level of 5 g/day in all countries. Men consumed more salt than women. This review demonstrates the critical importance of implementing a salt reduction program in South Asian countries.

New ideas on the framework of Neutrosophic SuperHyperGraph for different styles of Neutrosophic SuperHyper-Bipartite and Neutrosophic SuperHyper-Path are introduced. More instances and more clarifications alongside sufficient references.

The predominance of traffic lights in urban settings often induces fluctuations in traffic patterns and energy utilization among vehicles. To counteract the adverse effects of traffic lights on the energy efficiency of electric vehicles (EVs), a Multi-Intersections-Based Eco-Approach and Departure strategy (M-EAD) is proposed. This strategy aims to enhance vehicle energy efficiency, traffic flow, and battery longevity, all while upholding satisfactory driving comfort. The M-EAD strategy unfolds in two distinct stages: the optimization of an eco-friendly green signal window and the refinement of speed trajectories. The initial stage tackles the optimization of traffic light green signal windows, underpinned by the minimization of travel delays via solving the shortest path problem. In the subsequent stage, a receding horizon framework takes center stage, leveraging an iterative dynamic programming algorithm to tackle the speed optimization challenge. The objective here is to curtail energy consumption and reduce battery wear by finding an optimal speed trajectory. Furthermore, the real-world efficacy of this approach is substantiated through on-road vehicle tests, attesting to its viability in actual road scenarios.

Depression is considered a widespread mental health problem worldwide. Moreover, anxiety symptoms are very closely related to depression patients, and it is known that the coexistence rate of depression and anxiety diagnosed simultaneously is high. Treatment and preventive management of depression and anxiety are essential for public health. Forest healing is attracting attention as a form of low-cost preventive medicine that is safe and has no side effects. However, although the physiological and psychological effects have been scientifically proven, it is insufficient to reveal a direct relationship between forest healing and depression. This study investigated the benefits of an urban forest healing program on depression and anxiety symptoms of depressive disorders. We employed a randomized controlled trial design. Forty-seven depression patients were randomly divided into an urban forest healing program group and a control group. Measures included the Montgomery-Asberg depression rating scale (MADRS), the Hamilton Anxiety Rating Scale (HARS), and the State-Trait Anxiety Inventory (STAI) questionnaires. Our results revealed that the combination of general treatment and forest healing programs for patients with depression is more effective in improving depression and anxiety than routine treatment alone. We expect our work to serve as a starting point for more sophisticated research in discussing the availability of non-pharmacological treatments in forest healing.

Background: Pancreatic cancer (PC) is a disease with poor prognosis and survival rate. There is a pertinent need to identify the risk factors of this disease. The purpose of this study is to identify a subset of factors (a.k.a. features) as predictors of PC from the Prostate, Lung, Colorectal and Ovarian (PLCO) cancer dataset consisting of responses to 65 questions about demographics, cancer and health history, medication usage, and smoking habits from 154,897 participants. Method: There are two challenges to selecting the subset of features that predict PC with highest probability: the problem is computationally intractable, and the PLCO dataset is highly imbalanced. We use an innovative method to use the dataset in a balanced way, without involving up- or down-sampling. We use nine feature selection methods to select the optimal subset of features from the preprocessed and balanced dataset. Results: Our preprocessed dataset consists of 32 risk factors (8 demographics, 5 cancer history, 13 health history, 2 medication usage, 4 smoking habits). Risk factors belonging to cancer and health history, followed by smoking habits, were consistently chosen by the feature selection methods. We also discuss findings in the medical sciences literature that corroborate our findings. Conclusions: The study found that risk factors belonging to cancer and health history are the most prominent ones for PC. In particular, previously diagnosed with PC is chosen as the most prominent risk factor by majority of methods. While most of our findings are consistent with the literature, some of our findings shed light on novel factors that may not have received their due attention by the research community.

The construction of sustainable road and highway networks in the world, despite numerous feasibility, pre-feasibility and execution studies, are always confronted with the demands and vagaries of foreseeable and unforeseeable natural disasters. Studying cyclones, earthquakes, fracturing and landslide zones along roads is therefore a challenge for the sustainability of these infrastructures. In many countries around the world, the methods generally used for these studies are not only expensive and time-consuming, but the results obtained are not always efficient. This work examines whether Landsat 8 (with a high cloud level) and SRTM data can be used in both equatorial and coastal Central Africa zones to produce relevant mapping, locating fracture and landslide zones, in order to contribute not only to better road layout at lower cost and in a relatively short time, but also to better prevention of geological disasters that may occur on its network. To this end, a map of the main road network was produced and validated with field data, as well as the maps of the main unstable slopes, faults and fractures zones intersecting the road or highway network. These approaches are useful for sustainable planning, management, monitoring and extension of roads worldwide especially, in Central Africa.

In addition to identifying and prosecuting cyber attackers, attack attribution activities can provide valuable information guiding the defenders’ security procedures and giving them greater confidence in incident response and remediation. However, technical analysis involved in cyberattack attribution requires high skills, experience, access to up-to-date Cyber Threat Intelligence, and significant investigators’ effort. Attribution results are not always reliable, and skilful attackers often work hard to cover their traces and mislead or confuse investigators. In this article, we present a tool designed to support technical attack attribution and implemented as a machine learning model extending the OpenCTI platform. We also discuss the tool’s performance in the investigation of a recent cyberattack.

In recent years, there has been an increasing demand for personalized experiences in various domains, including the cultural and educational sectors. Museums, as custodians of art, history, and scientific knowledge, are seeking innovative ways to engage their visitors and provide tailored content that enhances their understanding and appreciation of the exhibits. This article presents ExhibitXplorer, a distributed architecture service that leverages geofencing, artificial intelligence, and microservices to enable personalized content delivery in museums. By combining implicit and explicit segmentation of museum visitors and utilizing the GPT API for content generation, ExhibitXplorer offers a dynamic experience to different visitor segments, including researchers, students, casual visitors, and children. The system utilizes push notifications triggered by visitor location changes, allowing seamless delivery of personalized information both indoors and outdoors. Tests were conducted to evaluate the user experience of visitors to an outdoor ethnographic museum. The results showed that 55% of the test participants were satisfied and 45% very satisfied with the way personalized content was delivered.

Recently, various applications of indoor location-based services using Wi-Fi fingerprint data have been studied. However, since fingerprint data collected at a specific location does not have continuous information between signals and correlation information between signals, path data cannot exist in principle. Therefore, most indoor positioning technologies are based on predicting the position of a stationary positioner at a specific location based on signal data collected at a specific location in the indoor space. Due to the discontinuous nature of these signals, they are unable to account for user movement. Therefore, there is a need for techniques to improve the accuracy of indoor positioning in moving situations. This paper proposes a method for enriching all data points with relevant information to obtain improved indoor positioning results and an improved technique for generating movement path data. The proposed technique generates relevant information with continuity by expressing data points as Bounding Boxes (BB) and subsequently clustering them using grid cells. Through the proposed method, we represented and expanded the indoor location data, which consists of data points, as BB. However, data points represented by BB do not have any adjacency information with each other, and as a result, it is not possible to create a movement path between neighboring BB. To solve the problem, we used clustering, a machine learning technique that categorizes data points into groups, to group BBs. This was done by constructing a YOLO (You Only Look Once) grid cell that included all BBs and clustered them into grid cells that were divided into specific regions through the suggestion phase. The clustering results align with the indoor structure of the building, indicating that the data points have been appropriately clustered. BBs inside a grid cell are contained within a moveable area and have related information. We also generated association information between neighboring grid cells through the proposal technique, and then generated path information that can be traveled between grid cells. In this paper, we use the movement path information generated from a dataset as training data for machine learning, and through this, we propose an enhanced indoor positioning technology.

Melanoma is a highly aggressive type of skin cancer produced by malignant transformation of melanocytes and it is usually associated with a poor prognosis. Clinically, melanoma has several stages associated with migration and invasion of the cells through the skin layers, rapid cell spreading and formation of tumors in multiple organs. The main problem is the emergence of resistance of melanoma to the applied methods of treatment, thus it is of primary importance to find more crucial signaling pathways that control the progression of this type of cancer and could be targeted to prevent melanoma spreading. The main life-threatening stage of melanoma is metastasis formation, and 3D cell spheroids are better suited for the study of this process. Using a combinative approach (RT-PCR, immunofluorescence, patch-clamp and calcium imaging) we showed the functional expression of mechanosensitive Piezo1 channels in SK-MEL-2 aggressive melanoma cell line. We found that chemical activation of Piezo1 by its selective agonist Yoda1 completely prevents melanoma spheroid formation, and could be considered as a novel approach for the prevention of melanoma development.

This review delves into the significance of chemical communication in mammals, with an emphasis on the role of the vomeronasal system in sensing pheromone-mediated interactions. The vomeronasal system shapes a variety of social and sexual behaviors, including reproduction, hierarchy formation, maternal bonding, and species recognition. Intriguingly, this system presents a vast degree of evolutionary variability, more so than variations observed in the olfactory system. This adaptive diversity underscores the challenges in studying the vomeronasal system, emphasizing the need for detailed research into its neuroanatomy and functional morphology. This review traverses an array of topics central to our understanding of chemical communication in mammals. We begin with the foundational role and basic concepts of chemocommunication. This is followed by an in-depth exploration of the olfactory systems. Subsequently, the neuroanatomical underpinnings of the vomeronasal system are juxtaposed against those of the olfactory system. Our focus then shifts to an exhaustive study of the sensory element of the vomeronasal system, the vomeronasal organ, and the integrating center of this information, the accessory olfactory bulb. The discussion extends to secondary projections of both the olfactory and vomeronasal systems in the light of the dual olfactory hypothesis. The review culminates with a detailed look at four specific models of vomeronasal system organization belonging to four evolutionarily distinct mammalian families: rodents, marsupials, herpestids, and bovids. These have been meticulously analyzed by the authors, aiming to spotlight the significant morphofunctional differences stemming from the adaptive changes imprinted on the system.

Keywords: Antisense Oligonucleotides, Cell Penetrating Peptides, Delivery, DG9 peptide, Phosphorodiamidate morpholino oligomers (PMO), Pip, R6G.

The Sustainable Development Goals (SDGs) represent a central framework to guide sustainable urban development (2030 Agenda). However, it is not clear how and where SDG 11 (Sustainable Cities and Communities) is being implemented, and how such implementation might be improved. We investigated this subject by analyzing United Nations (UN) SDG Good Practices data from 2018 to 2021. We applied five criteria to the 336 SDG 11 responses: (1) geography; (2) actors; (3) progress toward targets; (4) areas of implementation; and (5) scale of action. Overall, 86 of the 193 countries that adopted the 2030 Agenda submitted at least one SDG 11 good practice. 33 countries contributed 73.8% of the total, and most developing countries did not make submissions. A very small number of responses (between 2.6 and 9.1%) addressed equity-related targets. Good practices from developed countries were usually more technology-based and system-forming; developing countries typically focused on issues of day-to-day concern. Overall, this analysis points to the need for better and more systematic reporting on SDG 11 implementation, a more active public sector role in SDG implementation and reporting, more focus on dimensions related to social equity, and better formulation of urban sustainability targets and indicators in the future.

The first Network Arch Bridge (NAB) was opened to traffic 60 years ago and since then the idea spread around the world. It is a type of a tied arch bridge that combines the benefits of tied arch bridges and trusses in a single system, thus it has a very good stiffness even in the case of extremely slender structures. In a Network Arch the hangers are inclined and some of them intersect each other at least twice. The core of a NAB is the hanger arrangement that minimizes the bending moment in the arch to very small values, leading thus to compression in the arch. This paper reviews the Network Arch idea devised by prof. Tveit and extended by researchers and engineers worldwide. A comprehensive review of the literature about the Network Arch is provided and the situation of NABs around the world from the standpoint of location, span, structural system used for the cross-section, bridge type (road, railway, combined or pedestrian) and opening year is discussed.

Stellatolides are natural compounds that have shown promising biological activities, including antitumor, antimicrobial, and anti-inflammatory properties, making them potential candidates for drug development. Chemical Reactivity Theory (CRT) is a branch of chemistry that explains and predicts the behavior of chemical reactions based on the electronic structure of molecules. Conceptual Density Functional Theory (CDFT) and Computational Peptidology (CP) are computational approaches used to study the behavior of atoms, molecules, and peptides. In this study, we present the results of our investigation of the chemical reactivity and ADMET properties of Stellatolides A-H using a novel computational approach called Conceptual DFT-based Computational Peptidology (CDFT-CP). Our study uses CDFT and CP to predict the reactivity and stability of molecules and to understand the behavior of peptides at the molecular level. We also predict the ADMET properties of the Stellatolides A-H to provide insight into their effectiveness, potential side effects, and optimal dosage and route of administration. This study sheds light on the potential of Stellatolides A-H as promising candidates for drug development and highlights the potential of CDFT-CP for the study of other natural compounds and peptides.

For Synthetic Aperture Radar (SAR) image registration, successive processes following feature extraction are required by both the traditional feature-based method and the deep learning method. Among these processes, the feature matching process—whose time and space complexity are related to the number of feature points extracted from sensed and reference images, as well as the dimension of feature descriptors—proves to be particularly time-consuming. Additionally, the successive processes introduce data sharing and memory occupancy issues, requiring an elaborate design to prevent memory leaks. To address these challenges, this paper introduces the OptionEM-based reinforcement learning framework to achieve end-to-end SAR image registration. This framework outputs registered images directly without requiring feature matching and calculation of the transformation matrix, leading to significant processing time savings. The Transformer architecture is employed to learn image features, while a correlation network is introduced to learn the correlation and transformation matrix between image pairs. Reinforcement learning, as a decision process, can dynamically correct errors, making it more efficient and robust compared to supervised learning mechanisms like deep learning. We present a hierarchical reinforcement learning framework combined with episodic memory to mitigate the inherent problem of invalid exploration in generalized reinforcement learning algorithms. This approach effectively combines coarse and fine registration, further enhancing training efficiency. Experiments conducted on three sets of SAR images, acquired by TerraSAR-X and Sentinel-1A, demonstrate that the proposed method’s average runtime is sub-second, achieving subpixel registration accuracy.

Heat using behavior has a large impact on in heating energy in heat metering system, and therefore a better understanding can assist in behavior guidance to reduce energy. To understand the current situation of indoor thermal environment and heat using behavior for heat metering households in northern China, including adjusting heating end valves and operating windows, 30 households were measured and surveyed. The factors influencing heat using behavior, including outdoor and indoor environmental parameters and time of the day, were analyzed. The results are :1) Thermal neutral temperature for heat metering households is relatively high, up to 24.5℃; 2) The heat using behavior of households is lack of rationality: low proportion of active households; high indoor temperature setting; more frequency of window opening. Improving indoor comfort is the main reason for households to adjust the heating end valve, and only 7.15% of households have considered the economic benefits brought by adjusting the valve. " Thermostat control valve does not work" is the main reason for households without adjustment; 3) Time of the day and indoor temperature affect active households’ willingness to adjusting heating end valve. Time of the day, indoor temperature and outdoor temperature have impacts on opening window during heating period.

Recent studies revealing varied responses of infected cells to LRAs underscore the limited effectiveness of these agents and emphasize the wide array of determinants contributing to the heterogeneity of reservoirs, including virus genetic background, cell model, cell type, silencing mechanisms, tissue reservoirs, integration sites, patient, and gender specific factors. The enhancer region of the HIV-1 LTR contains two adjacent NF-κB binding sites that play a central role in mediating inducible HIV-1 gene expression. Beyond the involvement of various transcription factors, such as NF-κB, epigenetic constraints also play a pivotal role in suppressing the initiation of latent HIV transcription. Consequently, even latent viruses containing functional NF-κB sites remain unresponsive to drugs that activate NF-κB. Thus, it is evident that the activation of NF-κB alone does not suffice to trigger latent HIV, contradicting the central hypothesis of this study. The author used bioinformatics methods to analyze the viral proteins and their primer binding sites. The results show that the amino acid sequence ARG of Gag proteins of HTLV-1, HTLV-2, STLV-1 and STLV-2 match their primer binding site GGGGGCTCG in the 3'-to-5' direction and that the amino acid sequence SPR of Gag proteins of HIV-1, HIV-2, SIV and FIV match their primer binding site GGCGCCCGA in the 3'-to-5' direction. Related studies have shown that the genomic Gag/Gag-Pol complex recruits the LysRS/tRNA complex. The selective packaging of the tRNA primer requires HIV-1 Gag and Gag-Pol, and an interaction between LysRS and Gag is observed in vitro. In HIV-1, Gag/LysRS interaction depends on Gag sequences within the CTD of CA around amino acids 283-363 and motif 1 of LysRS around amino acids 208-259. It should be noted that the amino acid sequence SPR of the Gag protein is located at amino acids 148-150 within the NTD of CA, specifically at the NTD-NTD interface 1. Although this research is purely bioinformatics analysis, the relevant studies have demonstrated that Gag proteins match the HIV-1 primer binding site and possess the potential to directly activate dormant retroviruses.

This study will lead to the development of a numerical data set that will assist in the design of Savonius wind turbines. A major objective of this study is to develop a better design for Savonius turbine blades in order to increase their torque coefficients, rotational speeds, and pressure coefficients. As part of the experimental design methodology, a full dataset was generated by simulating three-dimensional scale models utilizing computational fluid dynamics (CFD) simulations that were validated by wind tunnel data. This process is multi-objective optimization for optimizing turbine performance. The twist angle, aspect ratio, and overlap ratio are all important factors in determining the optimal torque and power coefficients. The group method of data handling (GMDH) algorithm was utilized to model objective functions based on input-output data. The Pareto fronts were plotted using polynomial models obtained from the evolutionary Pareto-based optimization approach (modified NSGA-II), and the optimal commercial points were determined using TOPSIS. A comparison of three- and two-objective optimization data revealed that two-objective optimization data lie within the boundaries of a three-objective optimization problem. The torque coefficient, rotational speed, and power coefficient are all improved by 13.74%, 0.071%, and 5.32%, respectively, using multi-objective optimization. As a result of the multi-objective optimization of the turbine, some significant characteristics of objective functions were discovered.

The search for more efficacy and fewer toxic effects in cancer treatments is the main objective of research into new therapies. Vincristine (VCR) is a chemotherapeutic used in different types of tumors. Epigallocatechin gallate (EGCG) is a green tea metabolite that has shown an antineoplastic effect in different investigations, so the objective of this work was to evaluate the antitumor effect of the EGCG/VCR combination on tumor volume and survival. To achieve this objective, the solid model of lymphoma L5178Y was used in BALB/c mice with different doses of VCR, EGCG and their combination; Tumor grow and survival time were recorded. Once the tumors were obtained, they were measured and immunohistochemistry was performed for p53, Bcl2 and CD1. The results showed that the EGCG/vincristine combination had a greater antitumor effect that vincristine and EGCG. This can be partly attributed to the fact that the greatest Bcl2 inhibition was present in the combination of EGCG with vincristine. Therefore, it can be concluded that the combination of EGCG with vincristine has a better antineoplastic effect by inhibiting tumor development and increasing survival than both substances independently.

This study presents a methodology to fabricate Ti6Al4V cylindrical compacts with a highly porous core and dense shell with the purpose to mimic the bone microstructure. Compacts with different core diameters were obtained by conventionally press and sintering. Large pores were created with the aid of pore formers. Sintering kinetics was determined by dilatometry, whereas characterization was performed by X-ray computed tomography. Also, permeability was evaluated on the 3D microstructure and the mechanical strength was evaluated by compression tests. Results indicated that sintering is constraint by the different densification rates of the porous and dense layers. Nonetheless, defectless compacts were obtained due to neck bonding between Ti6Al4V particles. Large pores were located in the designed core with similar pore size distribution. Permeability increased following a power law as a function of the pore volume fraction. Stiffness of bilayer components was driven by the porous core, meanwhile, the strength resulted from the combination of both layers. Bilayer materials obtained showed a permeability and mechanical properties, as well as admissible strain (σy /E) similar to those of human bones.

The aim of this research is to investigate and use a variety of immersive multisensory media techniques in order to create convincing digital models of fossilised tree trunks for use in XR. This is made possible via the use of geospatial data derived from sources such as aerial imaging using UAS, terrestrial material using cameras and also include both the visual and audio element for better immersion, accessible and explorable in 6 Degrees of Freedom (6DoF). Immersiveness is a key factor in order to result in output that is especially engaging to the user. Both conventional and alternative methods are explored and compared, emphasising in the advantages made possible via the help of Machine Learning Computational Photography. Material is collected using both UAS and terrestrial camera devices, including a 3D-360º camera with 6 sensors, using stitched panoramas as sources for photogrammetry processing. Difficulties such as capturing large free standing objects using terrestrial means were overcome using practical solutions involving mounts and remote streaming solutions. Conclusions indicated that superior fidelity can be achieved by the help of Machine Learning Computational Photography processes and higher resolutions and technical specs of equipment not necessarily translating to superior outputs.

Research has shown the role of growth factors in lung cancer angiogenesis. Angiogenesis promotes lung cancer progression by stimulating tumor growth, enhancing tumor invasion, contributing to metastasis, and modifying immune system responses within the tumor microenvironment. As a result, new treatment techniques based on the anti-angiogenic characteristics of compounds have been developed. These compounds selectively block the growth factors themselves, their receptors, or the downstream signaling pathways activated by these growth factors. The EGF and VEGF families are the primary targets in this approach, and several studies are being conducted to propose anti-angiogenic drugs that are increasingly suitable for the treatment of lung cancer, either as monotherapy or as combined therapy. The efficacy results are encouraging, but a caution must be placed on the higher risk of toxicity, outlining the importance of personalized follow-up in the management of these patients.

Delineating the epidemic of vaccine injury from the coterminous condition long covid is a challenging prospect, but one with many implications not just for treatment, but also has important legal considerations for settlements of vaccine injury. The shared etiological factor of the spike protein in both vaccine injury and long covid make differentiation difficult, and while treatment is largely similar between vaccine injury and long covid, there are important distinctions. Furthermore, diagnostics are important for monitoring treatment progress and assessing the extent of subclinical vaccine injury in population having received a covid-19 vaccine. The development of rigorous diagnostics is an important step towards the recognition of both long covid and vaccine injury, as those suffering these conditions have faced immense challenges in having their conditions recognized, treated, and compensated by insurance companies or national health services.

Graphene-based nanoparticles possess remarkable physiochemical properties, making them promising for diverse applications in biomedicine, agriculture, food, and industrial applications. These nanoparticles have also been used in the fight against COVID-19. Human and environmental exposure to graphene-based nanomaterials is increasing at an unprecedented rate. However, there is still a huge knowledge gap regarding its safety in clinical applications. The topic remains controversial; although several routes of degradation exist, the cytotoxicity of graphene-based nanoparticles has been demonstrated. Various factors that can influence the cytotoxicity of graphene-based materials are discussed. This review summarizes the physiochemical properties of graphene-based materials and critically examines the possible effects of graphene-based nanoparticles on the molecular level and adverse health outcomes. While oxidative stress-mediated cell damage has been proposed as a primary cytotoxicity mechanism for graphene-based materials, various in vivo biodistribution and cytotoxicity mechanisms are also highlighted. Therefore, this review of the literature provides an overview of the cytotoxicity of GBMs and raises concerns about their widespread application with potential hazardous consequences on the environment and human health.

Blood gas analysis plays a central role in modern medicine. Advances in technology have expanded the range of available parameters and increased the complexity of their interpretation. By applying user-centered design principles, it is possible to reduce the cognitive load associated with interpreting blood gas analysis. In this international, multicenter study, we explored anesthesiologists' perspectives on Visual Blood, a novel visualization technique for presenting blood gas analysis results. We conducted interviews with participants following two computer-based simulation studies: the first utilizing Virtual Reality (VR) (50 participants) and the second without VR (70 participants). Employing the template approach, we identified key themes in the interview responses and formulated six statements, which were rated using Likert scales: from 1 (strongly disagree) to 5 (strongly agree) in an online questionnaire. The most frequently mentioned theme was the positive usability features of Visual Blood. The online survey revealed that participants found Visual Blood to be an intuitive method for interpreting blood gas analysis (median 4, IQR 4-4, p<0.001). Participants noted that minimal training was required to effectively learn how to interpret Visual Blood (median 4, IQR 4-4, p<0.001). However, adjustments are necessary to reduce visual overload (median 4, IQR 2-4, p<0.001). Overall, Visual Blood received a favorable response. The strengths and weaknesses derived from these data will help optimize future versions of Visual Blood to improve the presentation of blood gas analysis results.

In this work, we report the caloric effect for an electronic system of the antidot type, modeled by combining a repulsive and attractive potential (parabolic confinement). In this system, we consider the action of a perpendicular external magnetic field and the possibility of having an Aharonov-Bohm flux (AB-flux) generated by a current passing through a solenoid placed inside the forbidden zone for the electron. The energy levels are obtained analytically, and the model is known as the Bogachek and Landman model. We propose to control the caloric response of the system by varying only the AB-flux, finding that in the absence of an external magnetic field, the maximization of the effect always occurs at the same AB-flux intensity independent of the temperature while fixing the external magnetic field at a non-zero value breaks this symmetry and changes the point where the caloric phenomenon is maximized and is different depending on the temperature to which the process is carried. Due to the great diversity in technological applications that have antidots in electronics, the possibility of controlling their thermal response just by varying the intensity of the internal current inside the solenoid can be a platform of interest for experimental studies.

Mercury toxicity significantly threatens aquatic ecosystems, particularly impacting fish populations and human well-being. This article exposes the effects of mercury contamination on aquatic life and their habitats. Mercury primarily originates from natural degassing and anthropogenic activities and accumulates in aquatic organisms, most notably in predatory fish, through bio-accumulation and bio-magnification. This bio-accumulation, driven by microbial transformation to methyl-mercury, leads to elevated concentrations in top-level predators. The consequences of mercury exposure on fish physiology are stunted growth, reproductive impairments, and compromised immunity, with potential ramifications for population dynamics and ecosystem resilience. This study delves into specific impacts of mercury on fish, ranging from bone deformities to liver damage, developmental anomalies, neurotoxic effects, and disruptions in reproductive systems. The interplay between ecological, physiological, and human health effects underscores the need for a comprehensive understanding of mercury's underlying mechanisms. Monitoring mercury levels in aquatic systems emerges as a crucial strategy for ensuring fish populations' health and ecosystems' sustainability. Urgent collaborative efforts are imperative to address this global concern, promote harmonious coexistence between human activities and aquatic environments, and secure the availability of safe and nutritious fish for future generations. In conclusion, this article highlights the urgent necessity for targeted interventions and informed decision-making to mitigate the influence of mercury contamination on aquatic ecosystems.

Natural killer cells are associated with the pathogenesis of ulcerative colitis (UC), but their precise contributions remain unclear. The present study sought to investigate the diagnostic value of activated NK-associated genes (ANAGs) in UC. Bulk RNA-seq and scRNA-seq datasets were obtained from the Gene Expression Omnibus (GEO) and Single Cell Portal (SCP) databases. In the bulk RNA-seq, 92 differentially expressed genes (DEGs) were screened out by the “Batch correction” and “Robust rank aggregation” (RRA) methods. The immune infiltration landscape was estimated by single-sample gene set enrichment analysis (ssGSEA) and CIBERSORT, which revealed a higher abundance of activated NK cells in noninflamed UC tissues. 54 DEGs correlated with activated NK cells were identified as ANAGs. Protein-protein interaction (PPI) analysis and least absolute shrinkage and selection operator (LASSO) regression were utilized to screen out 4 key ANAGs (SELP, TIMP1, MMP7, and ABCG2) and establish an activated NK-associated gene score (ANAG score). The ANAG score demonstrated excellent diagnostic value and was validated in three external datasets. The expression of the 4 key ANAGs was validated in UC patients and healthy controls (HC) samples. Through scRNA-seq data analysis, higher expression levels of SELP, TIMP1, MMP7, and ABCG2 were observed in post-capillary venules, inflammatory fibroblasts, enterocytes, and immature enterocytes. The cell scores based on the ANAGs showed enrichment in endothelial cells and fibroblasts. In conclusion, we established and validated an ANAG score with the ability to precisely diagnose UC. The 4 key ANAGs have the potential to serve as therapeutic targets in UC.

Embryological development of pancreas is a complex phenomenon and therefore, it can have multiple developmental aberrations. Fortunately, majority of these pancreatic ductal anomalies are asymptomatic with no clinical relevance and are incidentally detected during diagnostic cross sectional imaging or endoscopic retrograde cholangiopancreatography (ERCP) or autopsy. Occasionally, pancreatic duct anomalies can result in symptoms like abdominal pain or recurrent pancreatitis. Also, accurate pre-operative diagnosis of ductal anomalies can prevent inadvertent duct injury during surgery. Conventionally, ERCP had been used for accurate diagnosis of pancreatic duct anomalies. However, because of being invasive and associated with risk of pancreatitis, it has been replaced with magnetic resonance cholangiopancreatography (MRCP). MRCP has demonstrated high sensitivity and specificity for diagnosis of ductal anomalies which can be further improved with use of secretin enhanced MRCP. Endoscopic ultrasound (EUS) is a new diagnostic and interventional tool in the armamentarium of endoscopists and has demonstrated promising results in detection of pancreatic duct variations and anomalies. In this article, we will focus on the role of EUS in diagnosis of various pancreatic duct anomalies.

Short bowel syndrome (SBS) in adults is defined as having less than 180 to 200 cm of remaining small bowel [1–4]. Many literature sources do not provide precise epidemiological data, challenges in estimating the prevalence of SBS include its multifactorial etiology and varying definitions [1–7]. The most common pathologies leading to SBS include Crohn disease, mesenteric ischemia, radiation enteritis, post-surgical adhesions, and post-operative complications [1,2,4–6]. In advanced SBS, parenteral nutrition may be required to ensure that all vital nutrients are delivered directly through the venous system, bypassing the gastrointestinal tract [1,8–10]. In this article, we present a clinical case of a patient who underwent parenteral nutrition for four months due to SBS. The surgical team performed reconstructive re-anastomosis of both the small and large bowel, leading to the discontinuation of parenteral nutrition and the resumption of a regular diet.

Interior designers play a pivotal role in shaping the built environment and catalyzing positive change through the adoption of sustainable design practices. This study centers on the analysis of prevailing attitudes held by interior designers in Jordan towards sustainable interior design practices. Through a comprehensive methodology involving a literature review and a three-part questionnaire, the research explores the benefits, challenges, and integration of sustainability principles. The study highlights substantial awareness (85%) of sustainable interior design's environmental impact and resource preservation. Additionally, 81% acknowledge its enduring significance, and 89% recognize its diverse benefits. While 61% exhibit familiarity, 27% claim professional experience. Among sustainability indicators, energy efficiency scores 4.25, resource efficiency 4.27, and "Design aligns with laws and regulations by the Ministry of Labor" ranks highest at 4.37. This study significantly augments our understanding of sustainable interior design by introducing a comprehensive evaluation framework that encompasses the three sustainability dimensions. It equips decision-makers with a robust tool to identify specific practices that bolster sustainability performance, further advancing the field.

Glucose is an important carbon sources for microbial growth, and its content in infertile soils is essential for the growth of the bacterium. Since the mechanism of oligotrophic bacterium adaptation in barren soils is unclear, the research employed RNA Seq technology to examine the impact of glucose concentration on the low nutrient bacteria BS-G1 in soil affected by desertification. RNA-Seq revealed that differentially expressed genes（DEG）histidine metabolism, glutamate synthesis, HIF-1 signalling pathway, sporulation, and TCA cycle pathway of BS-G1 were significantly enriched in 0.015 g/L glucose concentration, compared with 10 g/L glucose concentration. DEG amino acids system, two-component system, Metal Ion Transport, and nitrogen metabolism system of B. subtilis BS-G1 were significantly enriched in 5 g/L glucose concentration, compared with 10 g/L glucose concentration. In addition, The present study identified its regulation pattern and key genes under the low glucose environment (7 mRNAs, 16 sRNAs). This study primarily investigates the variances in the regulatory pathways of oligotrophic bacteria BS-G1, which holds substantial importance in comprehending the mechanism underlying the limited sugar tolerance of oligotrophic bacteria.

Forests play a pivotal role within the ecological milieu, with alterations to forested areas not only impacting the local environment but also serving as a significant contributing factor to the occurrence of landslide disasters. However, the significance of forests in connection with deep seated landslides is diminished. In instances of extreme events, heavy rainfall, highly weak slopes, or seismic events, it is improbable for forest cover to exert any influence. Due to extensive agricultural irrigation, the Heifangtai terrace of China has experienced a significant rise in groundwater levels, leading to the occurrence of numerous landslides. Through field investigations and remote sensing interpretation, this study has revealed dramatical geomorphological changes in the Heifangtai terrace due to the occurrence of widespread landslides. These changes are likely to disrupt the pre-existing hydrological balance within the study area, thereby altering the conditions for landslides. Therefore, understanding how the evolution patterns of loess landslides can be assessed is a crucial scientific issue for predicting the conditions of landslide occurrence. Taking the evolution of landslides along the edge of the Heifangtai terraces as an example, this study first classified different types of loess landslides. Subsequently, the temporal and spatial distribution characteristics of these landslides were analyzed. Finally, utilizing the FLAC3D software, the stability of the loess slopes at the edge of the Heifangtai terrace was examined under the lateral evolution mode. The research findings indicate that the current loess landslides in the Heifangtai terrace exhibits longitudinal multi-periodicity and lateral group-occurring behavior, which is significant for assessing loess landslides along the edge of Heifangtai terraces.

Polymer hydrogels are 3D networks consisting of hydrophilic crosslinked macromolecular chains, able to swell and retain water. Since their invention in the 1960s, they have become an outstanding pillar in the design, development, and application of engineered polymer systems suitable for biomedical and pharmaceutical applications (such as drug or cell delivery, regeneration of hard and soft tissues, wound healing, and bleeding prevention, among others). Despite several well-established synthetic routes of polymer hydrogels based on batch polymerization techniques, about fifteen years ago academia started to look for alternative methods involving simpler reaction paths, shorter reaction times, and lower energy consumption. In this context, frontal polymerization (FP) undoubtedly has become an alternative and efficient reaction model that allows for converting monomers into polymers via a localized and propagating reaction, by exploiting the formation and propagation of a “hot” polymerization front, able to self-sustain and propagate throughout the monomeric mixture. Therefore, the present work aims to summarize the main research outcomes, achieved during the last years, concerning the design, preparation, and application of FP-derived polymeric hydrogels, demonstrating the feasibility of this technique for the obtainment of functional 3D networks, and providing the reader with some perspectives for the forthcoming years.

Bisphenol F (BPF) and bisphenol S (BPS) are increasingly used as substitutes for bisphenol A (BPA) in the plastic industry, driven by concerns over the adverse effects of BPA. However, there is a lack of infor-mation on the extent of exposure to these chemicals in children. This study aims to assess the extent of BPA, BPF, and BPS exposure and determine factors that influence such exposure. A group of Thai children (age 6-13 years, n=358) were recruited between October 2019-2020. Two first morning void was collected one week apart. Demographic and exposure-related information was gathered. Urinary concentrations of bisphenols were analyzed by liquid-chromatography and tandem mass spectrometry. Correlation between bisphenol concentrations and various factors was determined using generalized estimating equations with linear model. BPA, BPF, and BPS were detected at 79.6%, 31.0%, and 16.8%, with geometric mean (GM) concentrations of 1.41, 0.013, and 0.014 ng/mL respectively. Younger children aged < 10 years exhibited 1.3-1.6 times higher GM levels of all bisphenols compared to older children. Exposure to food stored in plas-tic containers were associated with higher levels of BPF and BPS. In conclusion, BPA was the most fre-quently detected bisphenol in urine samples from Thai children, followed by BPF and BPS.

The development and use of selenium and iodine elements in agriculture aim to enrich agricultural food products for humans. This study was carried out as a three-factor factorial experiment in a completely randomized design (CRD). Three concentrations of sodium selenate fertilizer (0, 2, 4 mg/l), three potassium iodate (0, 2, 4 mg/l), and two supplementary radiation levels (blue light and sunlight) were used. The results showed that the highest and the lowest (3.44 & 3.12 mg/g f.w) leaf protein value was related to blue light and sunlight treatments, respectively. In the blue light treatment, the maximum and the minimum (4.77 & 3.39 mg/g f.w) leaf sugar amount was observed at 4 and 0 mg/l of the iodine, respectively. At 0 mg/l of selenium, the highest and the lowest (8.63 & 5.34 mg/g f.w) leaf vitamin C amount was recorded at the 4 and 0 mg/l of iodine, respectively. In blue light + 0 mg/l of the selenium, the highest and the lowest (2.94 & 2.10 mg/g f.w) leaf flavonoid quantity was seen at 2 and 0 mg/l of the iodine, respectively. In the blue light conditions, (5.20%) leaf nitrogen content was achieved in the selenium 4 mg/l group. In the same conditions, the maximum and the minimum (3.09 & 2.18%) leaf potassium amount was attained at selenium 2 and 4 mg/l, respectively. Under blue light conditions, the highest and the lowest (0.58 & 0.24 mg/kg dry matter) leaf selenium level was observed at 4 and 0 mg/l, respectively. In sunlightradiation levels, the maximum and the minimum (0.36 & 0.25 mg/kg dry matter) leaf selenium level were found at 4 and 0 mg/l of selenium, respectively. In the blue light conditions, the most and the lowest (1.65 & 0.72 mg/kg dry matter) seed selenium content was related to 4 and 0 mg/l of the selenium, respectively. In the blue light conditions, the highest and the lowest (8.49 & 4.25 mg/kg dry matter) leaf iodine level was recorded at 4 and 0 mg/l of iodine, respectively. In the blue light conditions, the maximum and the minimum (30.56 & 20.62 mg/kg dry matter) seed iodine value was related to 4 and 0 mg/l of the iodine, respectively. In the sunlight, the most and the lowest (24.96 & 20.29 mg/kg dry matter) seed iodine amount was achieved at 4 and 0 mg/l of the selenium, respectively.

In Burkina Faso, the infant flours produced are intended for weaning-age and malnourished children. This study was to evaluate the management of infant flour production in Ouagadougou. A survey was conducted among the production units to determine the raw materials used in the production of infant flours, the production processes, the methods of conservation of raw materials and infant flours, the types of infant flours produced as well as their packaging. The results showed that 45.45% of the production units surveyed were of the semi-industrial type against 54.54% from the artisanal and CREN types. Among the raw materials, the most used cereals were millet, sorghum and maize. As for legumes, peanuts and soybeans were the most used at respectively 35% and 31%. For the conservation of raw materials, 85.71% of infant flour producers had storage warehouses and 66% used storage pesticides. These flours produced were intended for children of wean age (37.14%) and children in nutritional recovery (62.86%). Flours were stored in an airy (94.29%), dry area/environment (88.57%) and in the presence of light (91.43%). All the results of this survey reflect that efforts are still expected to further improve the nutritional and sanitary quality of the infant flours produced.

Various studies on the physical characteristics of the canopy gaps in tropical and subtropical regions but that in the mangrove swamp forest in Malaysia is little known. The objectives of this study are to assess the canopy gaps physical characteristics (size, form, direction), to assess the changes in soil physical characteristics and microenvionment in and around the canopy gaps. Five canopy gaps were selected formed by lightning strikes, gaps size and shapes were determined using the portable Global Positioning System and photographic images were analysed using ForestCrown. Result shows that canopy gap opening has increased the total light reaching the forest floor, changed the canopy gap microenvironment. Strong correlation between canopy opening percentage and temperature of gaps explains the changes of canopy gaps characteristics. These changes have contributed to new seedling germination, regeneration and maintaining the canopy gap dynamics.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Induction heating (IH) technology is widely recognized and utilized in residential applications due to its high efficiency and safe operating characteristics. Resonant inverter circuits are widely used in IH systems because of their high efficiency and ability to perform soft-switching. Among the various resonant inverters used in IH systems, the single-switch quasi-resonant (SSQR) inverter topology is typically preferred for low-cost and low-output-power applications. Despite its cost advantage, the SSQR topology has a relatively narrow soft-switching range, which can be unstable depending on the electrical parameters of the load and the resonant converter circuit. Accurately determining the capacitance value of the resonant capacitor and the inductance value of the induction coil, which are the key circuit elements of the SSQR induction cooker, is crucial for designing a reliable, efficient, and durable cooking system. In other words, there exists a critical relationship between the resonant converter circuit parameters, load characteristics, and safe operating conditions. Additionally, when considering closed-loop control methods used for power control and safety, selecting appropriate resonant circuit elements becomes vital in ensuring both reliable and efficient operation. This paper focuses on a novel and simplified design method for the SSQR inverter utilized in household appliances. The proposed method and its advantages in terms of the safe operating area of the switch are theoretically investigated and verified through simulations and prototype circuits.

Combined sewer overflow (CSO) is a significant environmental concern and public health (e.g., water contamination, eutrophication, and beach closure). The Environmental Protection Agency (EPA) has introduced the National Pollutant Discharge Elimination System (NPDES) permitting program to regulate and address this matter. This program mandates the control of CSOs for more than 700 municipalities obligated to devise Long-term Control Plans (LTCPs) to curb combined sewer overflows and bring them down to safe levels. LTCP involves diverse strategies, including sewer separation, green infrastructure improvements, and conventional gray infrastructure upgrades. This study investigates several municipalities’ solutions for CSO problems in conventional methods and wireless sensor technology as real-time control. The investigation mainly focuses on a comparative analysis of two cities, Richmond, Virginia, and South Bend, Indiana, such as average rainfall, the frequency of overflows, and the capacity of treatment plants. The findings indicate that integrating sensor technology could significantly enhance modeling endeavors, bolster the capacity of existing structures, and substantially enhance preparedness for storm events. The EPA’s Storm Water Management Modeling (SWMM) software is utilized. Through an analysis of SWMM data, the study suggests the potential for leveraging wireless sensor technology to achieve more robust control over CSOs as a part of LTCPs.

The average sizes \ {\bar{L}}_{i\ } and their dispersion W_i along the i-th axis of crystallites in powders are used to determine the X-ray diffraction sizes, D_{i\ XRD}, averaged over crystallite columns within the BWA method. Numerical calculations have been carried out for an orthorhombic lattice of crystallites, such as LiFePO4, NMC, having Lamé's g-type superellipsoid shape. For Lognormal distributions, the analytical expression for the normalized coefficient Kn is found and includes two constants. The first K_{g,0} is a constant at W→0, the second K_g is a constant depending on the g -type shape. The dependences of D_{i\ XRD} are also calculated for Normal distribution. A fairly simple equation can be obtained as a result of analytical transformations in the framework of experimentally validated approximations. However, a simpler way is to carry out numerical computer calculations with subsequent approximation of the calculated curves. Using the obtained analytical expressions to control technologies from nuclear fuel to cathode materials will improve the efficiency of flexible energy network especially storage in autonomous and standby power plants.

Regenerative endodontic procedures (REPs) aim at recreating dental pulp tissue using biomaterials such as hydrogels. Their bioactivity is mostly linked to the nature of biomolecules or chemical compounds that will compose the endodontic hydrogel. However, many other parameters, such as hydrogel concentration, type, bioactive molecules solubility, of apex size were reported to influence the hydrogel behavior, leading to the inability to predict the clinical outcome. This lack of knowledge and the various parameters that should be considered, suggest that biological activity of endodontic hydrogel is impossible to anticipate and could hinder the bench to bedside transition. We formulated in this article our opinion that most of these parameters could be identified, described, and studied. A second part of the document lists some challenges and perspectives, including development of future mathematical models able to explain and predict the bioactivity of these endodontic hydrogel in clinic.

With the changes in the spatial structure of China's economic development, urban clusters have become the primary carriers of China's regional economy and green growth. The article uses annual data from 2010 to 2021 to study the carbon emission characteristics and carbon reduction pathways of 36 cities in the Yangtze River Delta region. Firstly, cities in the Yangtze River Delta region are divided into six carbon emission types based on decoupling elasticity coefficient and carbon intensity indicators. Then, the STIRPAT model is used to regress the panel data of different carbon emission types for 11 years, analyze the driving factors of carbon emissions, and develop differentiated carbon emission reduction paths for cities with six carbon emission types. According to the results, the city of Type I needs to accelerate low-carbon technology innovation, Type II needs to improve energy efficiency and strengthen low-carbon technology research and development, Type V needs to suppress foreign investment in high energy consumption and high emission projects in the local area, Type VI needs to accelerate the process of new urbanization and optimize industrial structure. Types III and IV have not received effective emission reduction paths, and further research is required on other emission reduction policies and measures.

Globally, bridges fail mostly due to hydrological causes such as scour or flooding. Therefore, under a hydrological approach, this study proposes a methodology that contributes to prioritize the intervention of bridges to prevent their collapse. Through an exhaustive literature review, an evaluation matrix subdivided into 4 dimensions was developed and a total of 18 evaluation parameters were considered, distributed as follows: 4 environmental, 6 technical, 4 social and 4 economic. This matrix was applied to eight bridges with a history of hydrological problems in the same river and validated through semi-structured interviews with specialists. Data were collected through field visits, journalistic information, review of the gauged basin historical hydrological flow rates and consultations with the population. Then, the modeling, which considered the influence of gullies that discharge additional flow, was carried out using HEC-HMS and HEC-RAS and subsequently calibrated. The application of the matrix revealed that five bridges have a high vulnerability, and three bridges have a medium vulnerability. The multidimensional approach can be adapted for studies of other riverine bridges.

Quality control is a critical component in industrial manufacturing, directly influencing efficiency, product reliability, and ultimately, customer satisfaction. In the dynamic environment of industrial manufacturing, traditional methods of inspection may not adequately meet the evolving complexity, necessitating innovative approaches to bolster precision and productivity. In this study, we explore the application of mixed reality (MR) technology for real-time quality control in the assembly process. Our methodology involved the integration of smart glasses with a server-based image recognition system, designed to conduct real-time component analysis. The innovative aspect of our study lies in the harmonization of MR and computer vision algorithms, providing immediate visual feedback to inspectors and thereby improving the speed and accuracy of defect detection. YOLOv8 have been adopted in this study for detection object model. The project implementation occurred in a controlled environment to enable a comprehensive evaluation of the system functionality, the identification of possible problems and improvements in the system performance. The results indicated the viability of mixed reality as a powerful tool for enhancing traditional inspection processes. The fusion of MR and computer vision offers possibilities for future advancements in industrial quality control, paving the way for more efficient and reliable manufacturing ecosystems.

Recent advancements in the study of the protein complex photosystem II have clarified the sequence of events leading to the formation of oxygen during the S3->S4->S0 tran-sition, wherein the inorganic Mn4Ca(µ-O)6(OHx)4 cluster finishes photo-catalyzing the water splitting reaction (Greife et al, Nature 2023, 617, 623-628; Bhowmick et al, Nature 2023, 617, 629-636) . During this final step a tyrosine radical (TyrZ), stable for a couple of milliseconds, oxidizes a cluster bound oxygen while the hydrogen bonding patterns of nearby waters shift a proton away. A treatment of this redox reaction within the context of accepted transition state theories predicts rate constants that are significantly higher than experimentally recovered values (10^12s^-1 versus 10^3s^-1). In an effort to understand this disparity, temperature dependent experiments have revealed large entropic con-tributions to the rates with only a moderate energy of activation. We suggest that the entropic source may be related to the observed proton rearrangements, and further possible near isoenergetic variations in the nearby extended h-bonding network de-laying the realization of an ‘ideal’ transition state. In the following we explore this re-lation in the context of Eyring’s transition state theory and Marcus’ electron transfer theory, and evaluate their compatibility with the experimental evidence.

Due to increasing concerns about global warming and energy crisis, intensive efforts have been made to explore renewable and clean energy sources. Single-atom metals and two-dimensional (2D) nanomaterials have attracted extensive attention in the fields of energy and environment because of their unique electronic structures and excellent properties. In this review, we sum-marize the state-of-art progress on the single-atom metal supported at 2D MoS2 (single-atom metal/2D MoS2) for electrochemical CO2 reduction and water splitting. First, we introduce the advantages of single-atom metal/2D MoS2 catalysts in the fields of electrocatalytic CO2 reduction and water splitting, followed by the strategies for improving electrocatalytic performances of single-atom metal/2D MoS2 hybrid nanomaterials and the typical preparation methods. Further, we discuss the important applications of the nanocomposites in electrocatalytic CO2 reduction and water splitting via some typical examples, particularly focusing on their synthesis routes, modification approaches, and physiochemical mechanisms for improving their electrocatalytic performances. Finally, our perspectives on the key challenges and future directions of exploring high-performance metal single-atom catalysts are presented based on recent achievements in the development of single-atom metal/2D MoS2 hybrid nanomaterials.

In potato, high levels of nitrogen (N) can lead to excessive vegetative growth at the expense of tuber development, resulting in lower yield and poor quality tubers. We found that Solanum tuberosum CLE4 (StCLE4) is expressed most strongly in the roots on N-rich media and positively regulates root growth of potato in N-deficient conditions. We noted that StCLE4 functions as a negative regulator of normal shoot apex development similar to CLV3 in Arabidopsis. Transcriptomic analysis revealed that overexpression of StCLE4 results in repression of the StIT1 gene, a regulator of potato tuber initiation. Overexpressing StCLE4 stolons were transformed into branches that were similar to milder it1 phenotype. We also found that NIN-like proteins, key regulators of nitrate signaling, bind to the regulatory sequence of StIT1 in yeast one-hybrid assay. Taken together, our findings suggest that StCLE4 regulates shoot, root and stolon growth in potato.

The Canadian Prairies are associated with high natural hydroclimatic variability including the frequent periodic occurrence of droughts and pluvials. These extremes carry various risks in-cluding significant damage to the economy, environment and society. The well-documented level of damage necessitates further risk assessment and planned reductions to vulnerability, particu-larly in light of a warming climate. A logical starting point involves awareness and information about the changing characteristics of such climate extremes. We focus on the compound occurrence of droughts and pluvials as the risks from this type of event are magnified compared to the hy-droclimatic extremes in isolation. Also, research on compound droughts and pluvials is limited. Therefore, the purpose of this paper is to synthesize recent literature concerning the risks of com-pound droughts and pluvials, including examples of past occurrences, with a focus on the Cana-dian Prairies. Since literature from the Prairies is limited, global work is also reviewed. Rela-tionships between drought and pluvials are characterized using the SPEI Global Monitor for the Prairies, emphasizing the recent past, and through synthesis from the Prairie literature. That re-search mostly considers drought and pluvials as separate events, but is integrated here to charac-terize the relationships of these extremes. Examples of periods of compound droughts and exces-sive rainfall provide insights into the regional hydroclimatic variability. Furthermore, most lit-erature on future projections strongly suggests that this variability is likely to increase, mainly driven by anthropogenic climate change. These findings suggest means of decreasing vulnerabil-ity and associated damages. Although the study area is the Canadian Prairies, the work is rele-vant to other regions that are becoming more vulnerable to increasing risks of and vulnerabilities to such compound extremes.

In this article, we discuss problems that exist in modern SCADA systems and present a Controls-kt (formerly DataForge-controls) software development kit, that allows both to create a control system from scratch and provide integration with existing systems via Magix specification and connector.

The surging electricity demand driven by a growing global population, coupled with the increasing electrification of industries, transportation, and power-intensive appliances, poses a substantial challenge to electricity systems worldwide. This challenge is further compounded by the pressing issue of climate change. To address climate change and mitigate the environmental consequences of fossil fuel use, renewable energy sources are expected to play a pivotal role. However, certain renewable sources, such as wind and solar, exhibit stochastic behavior, resulting in unpredictable power output and significant fluctuations. This intermittency presents a challenge in maintaining a stable and reliable power supply. To overcome this challenge and ensure a balanced electricity grid, the strategic deployment of energy storage devices throughout the power system becomes critically important. Energy storage technologies play a vital role in mitigating the mismatch between renewable power generation and consumption. Additionally, they enable the storage of surplus energy generated from renewable sources during periods of high production for later use during periods of low or no generation. Each technology possesses unique characteristics and applications, providing flexibility and diversity in energy storage solutions. This work provides an overview of different energy storage technologies and explores their role in establishing a sustainable power system.

Aminoacyl-tRNA synthetases (aaRSs) originated from an ancestral bidirectional gene (mirror symmetry) and through the evolution of the genetic code the twenty aaRSs exhibit a symmetrical distribution in a 6-dimensional hypercube of the Standard Genetic Code. In this work, we assume a primeval RNY code, and the Extended Genetic RNA code type II which includes codons of the type YNY, YNR and RNR. Each of the 4 subsets of codons can be represented in a 4-dimensional hypercube. Altogether these 4 subcodes constitute the 6-dimensional representation of the SGC. We identify the aaRSs' symmetry groups in each of these hypercubes. We show that each of the four hypercubes contains the following sets of symmetries for the two known Classes of synthetases: RNY: dihedral group D2; YNY: binary group Z2; YNR: amplified octahedral group Oh; and RNR: binary group Z2. We demonstrate that for each hypercube, the group of symmetries of Class 1 is the same as the group of symmetries of Class 2. The biological implications of these findings are discussed.

Nanoparticles are of great importance for various scientific and technological applications, drug discovery, ecology, molecular biology, etc. Size is a basic characteristic of any particle, and dynamic light scattering is beyond competition when measuring particle size in dispersions ranging from nanometers to micrometers. Unfortunately, this method has a serious problem in processing and interpreting experimental data. Instrument noise and polydispersity of the sample lead to the situation when one initial autocorrelation function corresponds to several different particle size distributions. Sometimes these different solutions of the inverse task can be found by changing parameters in the software. Sometimes the scientist cannot be suspicious of possible other solutions, having one result from the program. In this article I demonstrate the problem on model and experimental data using three known programs: CONTIN, the Malvern Zetasizer and DynaLS. I also present my own free program Autocor, which allows to test our own hypotheses about the modality and shape of the particle size distribution by optimizing the parameters of our own models with a small number of degrees of freedom.

By using the Black-Derman-Toy (BDT) model, we predict the future trend of the riskless rate, and then we build an equation that relates the market price of zero-coupon bonds and the theoretical price of zero-coupon bonds calculated using a binomial option pricing model. Based on this, we can find the implied daily return μ, implied natural upturn probability p, and implied daily volatility σ with respect to different time-to-maturity values of zero-coupon bonds. With these results, we can give some suggestions to bond traders.

Developing low-cost and stable materials for converting solar energy into electricity is vital in meeting the world's energy demand. Metal-organic frameworks (MOFs) have gained attention for solar cells due to their natural porous architectures and tunable chemical structures. This review commences with an exploration of the synthetic methods of MOFs. Moreover, we discuss the various roles of MOFs, including photoanodes and counter electrodes in dye-sensitized solar cells and interfacial layers and charge carriers in perovskite solar cells. Ultimately, burdensome tasks and possible directions for advancing MOFs-based nanomaterials are provided for solar cells.

This study analyzes the influence of CEO types on corporate governance, focusing on de facto (substantial) CEOs. We examine how substantial CEOs impact ESG activities (Hypothesis 1) and corporate value (Hypothesis 2). Data were collected from KIS-VALUE and DART (Electronic Disclosure System) of the Financial Supervisory Service, defining substantial CEOs as highest remuneration recipients exceeding the representative director of the company pay. Results sup-port Hypothesis 1, showing companies with substantial CEOs are more engaged in ESG activities, potentially to improve public image while concealing self-serving behaviors. Hypothesis 2 is validated, indicating lower corporate value in companies with substantial CEOs due to prioritizing personal interests over long-term profit maximization. Despite limitations in exploring governance relationships beyond remuneration data, the study offers key contributions. It expands research on corporate governance and ESG activities by identifying substantial CEOs through objective remuneration data. It highlights the importance of an independent board for transparent governance and positive corporate value. Lastly, empirical evidence shows the negative impact of misdirected ESG activities on corporate value. By using remuneration as an indicator, this study illuminates substantial CEOs' influence on corporate value and ESG activities, providing insights for future research in corporate governance and ESG.

This paper presents a design and performance analysis of a 10-element 5G massive MIMO antenna array for sub-6GHz mobile handsets, specifically for LTE bands 42 (3400-3600 MHz), 43 (3600-3800 MHz), 48/49 (3550-3700 MHz) applications. The proposed antenna array consists of 10 closely spaced linearly polarized inverted-F antennas with a compact size of 20 × 9 mm2 of a single element. The proposed antenna array provides high gain, high efficiency, and low correlation between the antenna elements, which results in improved channel capacity, increased data rate, and enhanced signal quality. The performance of the antenna array is evaluated in terms of the radiation pattern, gain, efficiency, and correlation coefficient. The simulation and measured results show that the proposed antenna array achieves an approximate peak gain of 3.1 dBi at the resonance frequency, a total efficiency of 65 %, and a low correlation coefficient of 0.06 between the antenna elements. Therefore, the proposed 5G massive MIMO antenna array is a promising candidate for sub-6 GHz mobile handsets, particularly for LTE bands 42/43/48/49 applications.

Broad-spectrum antifungal drug deployed for topical therapy, specific for onychomycosis, Itraconazole was used as the active pharmaceutical ingredient in a nail lacquer formulation¹. The objective of the study was to optimize an antifungal nail lacquer, which when applied topically onto the dorsal surface of the nail plate would facilitate the transungual penetration of the drug. Itraconazole hydrochloride was synthesized to aid the formulation of the lacquers. The optimization involved comparing four different formulations of 1%w/w Itraconazole nail lacquers containing combinations of penetration enhancers (Papain, Salicylic acid, Urea) based on their ability to facilitate diffusion of the drug through the nail plate over five days. The drug uptake was quantified by extracting the drug from the nail clippings and analyzing it. The tests conducted to account for the quality of the optimized formulation were drug content, spread ability, check for precipitation, and accelerated stability. The results demonstrated that the optimized 1%w/w Itraconazole nail lacquer contained 5%w/w Papain, 5 %w/w Salicylic Acid, and 2.8% w/w Urea. The drug uptake from nail clippings was higher than the literature derived reference MIC90 value for T. Rubrum strain, and the quality of the optimized lacquer was not compromised throughout three weeks [2]. The hypothesis stated that the inclusion of Salicylic acid, Papain, and Urea in an Itraconazole (1%w/w) nail lacquer would have the highest transungual penetration on application to the nail plate. In conclusion, the hypothesis was accepted, and the optimized lacquer passed the drug uptake evaluation and all quality control tests.

Skeletal muscle is a specialized tissue consisting of nondividing and multinucleated muscle fibers. Skeletal muscle-specific myostatin (MSTN) is a secreted protein that acts as a negative regulator of muscle mass by inhibiting proliferation and differentiation of myoblasts. In this study, we established a screening platform to monitor myostatin promoter activity in rat L8 myoblasts. Extract of Glycyrrhiza uralensis (GUE), an oriental herbal medicine, was identified through this screening platform and, the active fractions of GUE were identified by process-scale liquid column chromatography system. For in vivo study, the GUE as a feed additive was investigated in growth-finishing pigs. The results showed that GUE significantly increased body weight, carcass weight and lean content in pigs. Microbiota analysis indicated that GUE did not affect the composition of gut microbiota in pigs. In summary, this established rodent myoblast screening platform was used to identify a myogenesis-related phytogenic, GUE, and further demonstrated that the active fractions inhibited MSTN expression. These finding suggest a novel application for GUE in growth performance enhancement through modulation of MSTN expression. Furthermore, this established screening platform has great potential for identification and evaluation of a wide variety of phytogenics involving in myogenesis.

Youth is the essential entrepreneurial force for every country's social, political, and economic development. Urban youth make up about 34.27 percent of the population in Ethiopia. The youth unemployment crisis is one of the serious challenges that Ethiopia is facing nowadays, and it should be mentioned in the nation's public discourse. Therefore, the main objective of this study is to specify the socioeconomic and demographic factors that influence urban youth unemployment in the Somali Regional State, specifically in Jigjiga, Degahbour, Kebridahar, Gode, and Dollo Ado towns. Both primary and secondary data sources were employed. A multi-stage sampling technique has been used to select 385 sample respondents from the total population of the study. This study found that almost 63% of youth in the study area were unemployed, and a large number of unemployed youths live in Jigjiga and Dollo Ado Towns as compared to other city administrations. The econometric model's findings indicate that factors like gender, education level, work experience, access to credit, access to information, time applied for job vacancy, active job seeker, social network (network with clan elders, government officials, businessmen, and other friends), and residence in Jigjiga and Gode town have a significant association with the likelihood of youth unemployment in the Somali regional state. Therefore, this study recommends that the regional government and local city administration should develop effective policies and strategies to address the underlying causes of gender inequality, improving access and quality of education, supporting freshman graduates to find jobs, providing access to credit and job vacancies, ensuring fair and free job competition, and managing youth migration for job seeking.

Tyrosinases (TYR) play an important role in oxidizing phenols and catechols, leading to the formation of catechols and ortho-quinones, respectively. In mammals, TYR catalyzes the conversion of L-Tyrosine to quinone, a pivotal step in melanogenesis, which generates melanin pigments responsible for protecting against UV radiation and oxidative stress. Given TYR's importance in melanin-related disorders and cosmetic applications, the inhibition of TYR has garnered attention for controlling melanin production. However, current inhibitors like hydroquinone, arbutin, and kojic acid (KA) have limitations in terms of side effects and effectiveness. A novel class of TYR inhibitors featuring arylpiperidine and arylpiperazine components has demonstrated potent inhibitory activity. This study presents a computational analysis of these inhibitors using molecular docking, molecular dynamics (MD) simulations, and the Linear Interaction Energy (LIE) method was used to estimate binding free energies. The arylpiperidine and arylpiperazine inhibitors exhibit remarkable stability within the TYR active site during simulations. The van der Waals interactions are notably sustained, indicating effective inhibition mechanisms. The results from LIE calculations closely align with experimental binding affinities. In summary, these results contribute to the understanding of TYR inhibition and underscore the potential of arylpiperidine and arylpiperazine derivatives as effective agents for modulating melanin production in both cosmetic and pharmaceutical applications. Overall, this study sheds light on the intricate interactions between inhibitors and TYR, opening avenues for the development of novel therapies and interventions.

The overexploitation of fossil fuels and their negative environmental impact has attracted the attention of researchers worldwide to propose alternatives to produce bioenergy. Microbial fuel cells (MFCs) systems are sustainable biotechnologies that use bacterial activity to break down organic matter while generating bioelectricity. MFCs have bioelectricity from domestic wastewater (DWW), municipal wastewater (MWW), and potato and fruit waste, reducing environmental contamination and decreasing energy consumption and treatment cost. This review focuses on the recent advancements regarding the designs and configurations, the operation mode of MFCs, and their capacity to produce bioelectricity (e.g., 2203 mW/m2) and fuels (i.e., H2: 438.7 mL/g and CH4: 358.7 mL/g, respectively). Besides, this review highlights practical applications, challenges, techno-economic, and life cycle assessments (LCA) of MFCs. Despite MFC's promising biotechnology, great efforts should be made to implement it in real-time and commercialization.

Maxillary sinus augmentation with a lateral approach (MSA) is a well-established treatment. In this prospective study, we evaluated risk factors for postoperative bone-graft displacement and report the clinical application of long-term resorbable GMEM-B-2 (L-lactic acid/-caprolactone [P(LA/CL)]) as a barrier membrane to cover the open window in the lateral wall in MSA. Twenty-four patients underwent MSA according to the relevant criteria; CT data obtained before and 1 week (1W) and 5–6 months (5M) post-MSA, bone height changes, bone height reduction rates at 1W and 5M post-MSA, bone-graft displacement measurements, and risk factors were examined. All patients showed bone height increments (p &lt; 0.005). However, no difference was observed between 1W and 5M post-MSA. Bone-graft displacement was observed in eight patients; the reduction rate from 1W to 5M post-MSA was 8.38% ± 4.88%. Sex, septa, maxillary sinus floor–palatal bone distance, and maxillary sinus floor–natural mouth distance were associated with bone-graft displacement (p &lt; 0.05). Height from the maxillary sinus floor to the palatal bone and the sinus angle influenced the augmentation amount (p &lt; 0.05). The L-lactic acid/ε-caprolactone [P(LA/CL)] membrane compared favourably with other membranes and may be useful as a barrier membrane for the MSA open window.

Numerical simulations and experiments on evaporative condensers in air conditioning systems using R744 were performed. Two configurations were given to study the feasibility of operating the subcritical R744 cycle. It indicated the capable of evaporative cooling condensing R744 to liquify by analyzing the outlet temperature at the end of the condenser reached from 28.7oC to 30.3oC with the operating pressure from 72.6 bar to 68.5 bar. The mass flow rate in the study increases from 14.34 kg/h to 46.08 kg/h, the pressure drop also increases from 0.23 bar to 0.47 bar for the simulation and 0.4 bar to 0.5 bar for the experiment, respectively. This study indicates that a 5-layers of copper tubes configuration causes a higher pressure drop and lower COP when compared to an 8-layers of copper tubes that split into 2 sets for smaller pressure drop. In this study, the evaporative condensers using mini tubes that are flooded in the cooling water tank are suitable for the subcritical R744 air conditioning system. The results obtained from the experimental data are in good agreement with those obtained from the numerical results, with the deviation less than 5%.

Recycled asphalt mixture is a material remixed with old asphalt recycled material (RAP) and new aggregate, and its application is of great significance in environmental protection.Due to the wear and tear of the old asphalt mixture, the road performance of the recycled asphalt mixture will decrease. This paper uses IPP software to obtain the shape characteristics of the old and new aggregates, and found that the roundness of the old aggregate of 9.5mm-16mm is the most serious wear. Therefore, the 30% RAP, and the influence of the roundness of the recycled asphalt mixture on the road performance is studied.

The purpose of this study was to determine the effects of aerobic exercise on carotid to femoral pulse wave velocity (cf-PWV), cell adhesion molecules (intracellular adhesion molecules (ICAM-1), vascular cell adhesion molecules (VCAM-1), and endothelial selectin (E-selectin), and oxidized-LDL in elderly women aged 70–85 years, and to identify the effect of and correlation with vascular stiffness. Forty participants were recruited and divided into three groups; vascular stiffness (VSG, n=14), obesity (OG, n=14), and normal (NG, n=12). All groups were given a 16-week intervention of aerobic exercise, and the data collected before and after exercise were analyzed using SPSS Ver. 23.0. Two-way repeated-measures ANOVA was used to evaluate between-group and time-dependent interaction effects. One-way ANOVA was used to evaluate between-group variations. In addition, the significance was tested using a post-hoc test (Scheffe). The within-group variations by time before and after exercise were examined using a paired t-test, and correlation analysis was performed using Pearson correlation coefficients. Simple regression analysis was performed for variables showing significant differences. The results indicated interaction effects for cf-PWV (p<.001), VCAM-1 (p<.01), E-selectin (p<.05) and oxidized LDL (p<.001). The rate of change of cf-PWV was positively correlated with that of VCAM-1 (r=.352, p<.05) and that of oxidized-LDL (r=.325, p<.05) with statistical significance. To determine the effect of the rate of change of cf-PWV on the rate of change of VCAM-1, the variables were tested, and the coefficient of determination in the regression analysis was .124, indicating that 12.4% of the tested variables fit the standard regression line. The variables for the effect of the rate of change of cf-PWV on the rate of change of oxidized LDL were also tested, and the coefficient of determination in the regression analysis was .106, indicating that 10.6% of the tested variables fit the standard regression line. Thus, the 16-week regular and consistent aerobic exercise program had significant effects on the cf-PWV, ICAM-1, VCAM-1, E-selectin, and oxidized-LDL in elderly Korean women with vascular stiffness, suggesting improvements in vascular stiffness, based on which the intervention is predicted to contribute to the prevention of vascular dysfunction by lowering the risk of cardiovascular disease due to atherosclerosis, as well as having a positive effect in the prevention of impairment of vascular endothelial cells.