The search for more efficacy and fewer toxic effects in cancer treatments is the main objective of research into new therapies. Vincristine (VCR) is a chemotherapeutic used in different types of tumors. Epigallocatechin gallate (EGCG) is a green tea metabolite that has shown an antineoplastic effect in different investigations, so the objective of this work was to evaluate the antitumor effect of the EGCG/VCR combination on tumor volume and survival. To achieve this objective, the solid model of lymphoma L5178Y was used in BALB/c mice with different doses of VCR, EGCG and their combination; Tumor grow and survival time were recorded. Once the tumors were obtained, they were measured and immunohistochemistry was performed for p53, Bcl2 and CD1. The results showed that the EGCG/vincristine combination had a greater antitumor effect that vincristine and EGCG. This can be partly attributed to the fact that the greatest Bcl2 inhibition was present in the combination of EGCG with vincristine. Therefore, it can be concluded that the combination of EGCG with vincristine has a better antineoplastic effect by inhibiting tumor development and increasing survival than both substances independently.

This study presents a methodology to fabricate Ti6Al4V cylindrical compacts with a highly porous core and dense shell with the purpose to mimic the bone microstructure. Compacts with different core diameters were obtained by conventionally press and sintering. Large pores were created with the aid of pore formers. Sintering kinetics was determined by dilatometry, whereas characterization was performed by X-ray computed tomography. Also, permeability was evaluated on the 3D microstructure and the mechanical strength was evaluated by compression tests. Results indicated that sintering is constraint by the different densification rates of the porous and dense layers. Nonetheless, defectless compacts were obtained due to neck bonding between Ti6Al4V particles. Large pores were located in the designed core with similar pore size distribution. Permeability increased following a power law as a function of the pore volume fraction. Stiffness of bilayer components was driven by the porous core, meanwhile, the strength resulted from the combination of both layers. Bilayer materials obtained showed a permeability and mechanical properties, as well as admissible strain (σy /E) similar to those of human bones.

The aim of this research is to investigate and use a variety of immersive multisensory media techniques in order to create convincing digital models of fossilised tree trunks for use in XR. This is made possible via the use of geospatial data derived from sources such as aerial imaging using UAS, terrestrial material using cameras and also include both the visual and audio element for better immersion, accessible and explorable in 6 Degrees of Freedom (6DoF). Immersiveness is a key factor in order to result in output that is especially engaging to the user. Both conventional and alternative methods are explored and compared, emphasising in the advantages made possible via the help of Machine Learning Computational Photography. Material is collected using both UAS and terrestrial camera devices, including a 3D-360º camera with 6 sensors, using stitched panoramas as sources for photogrammetry processing. Difficulties such as capturing large free standing objects using terrestrial means were overcome using practical solutions involving mounts and remote streaming solutions. Conclusions indicated that superior fidelity can be achieved by the help of Machine Learning Computational Photography processes and higher resolutions and technical specs of equipment not necessarily translating to superior outputs.

Research has shown the role of growth factors in lung cancer angiogenesis. Angiogenesis promotes lung cancer progression by stimulating tumor growth, enhancing tumor invasion, contributing to metastasis, and modifying immune system responses within the tumor microenvironment. As a result, new treatment techniques based on the anti-angiogenic characteristics of compounds have been developed. These compounds selectively block the growth factors themselves, their receptors, or the downstream signaling pathways activated by these growth factors. The EGF and VEGF families are the primary targets in this approach, and several studies are being conducted to propose anti-angiogenic drugs that are increasingly suitable for the treatment of lung cancer, either as monotherapy or as combined therapy. The efficacy results are encouraging, but a caution must be placed on the higher risk of toxicity, outlining the importance of personalized follow-up in the management of these patients.

Delineating the epidemic of vaccine injury from the coterminous condition long covid is a challenging prospect, but one with many implications not just for treatment, but also has important legal considerations for settlements of vaccine injury. The shared etiological factor of the spike protein in both vaccine injury and long covid make differentiation difficult, and while treatment is largely similar between vaccine injury and long covid, there are important distinctions. Furthermore, diagnostics are important for monitoring treatment progress and assessing the extent of subclinical vaccine injury in population having received a covid-19 vaccine. The development of rigorous diagnostics is an important step towards the recognition of both long covid and vaccine injury, as those suffering these conditions have faced immense challenges in having their conditions recognized, treated, and compensated by insurance companies or national health services.

Graphene-based nanoparticles possess remarkable physiochemical properties, making them promising for diverse applications in biomedicine, agriculture, food, and industrial applications. These nanoparticles have also been used in the fight against COVID-19. Human and environmental exposure to graphene-based nanomaterials is increasing at an unprecedented rate. However, there is still a huge knowledge gap regarding its safety in clinical applications. The topic remains controversial; although several routes of degradation exist, the cytotoxicity of graphene-based nanoparticles has been demonstrated. Various factors that can influence the cytotoxicity of graphene-based materials are discussed. This review summarizes the physiochemical properties of graphene-based materials and critically examines the possible effects of graphene-based nanoparticles on the molecular level and adverse health outcomes. While oxidative stress-mediated cell damage has been proposed as a primary cytotoxicity mechanism for graphene-based materials, various in vivo biodistribution and cytotoxicity mechanisms are also highlighted. Therefore, this review of the literature provides an overview of the cytotoxicity of GBMs and raises concerns about their widespread application with potential hazardous consequences on the environment and human health.

Blood gas analysis plays a central role in modern medicine. Advances in technology have expanded the range of available parameters and increased the complexity of their interpretation. By applying user-centered design principles, it is possible to reduce the cognitive load associated with interpreting blood gas analysis. In this international, multicenter study, we explored anesthesiologists' perspectives on Visual Blood, a novel visualization technique for presenting blood gas analysis results. We conducted interviews with participants following two computer-based simulation studies: the first utilizing Virtual Reality (VR) (50 participants) and the second without VR (70 participants). Employing the template approach, we identified key themes in the interview responses and formulated six statements, which were rated using Likert scales: from 1 (strongly disagree) to 5 (strongly agree) in an online questionnaire. The most frequently mentioned theme was the positive usability features of Visual Blood. The online survey revealed that participants found Visual Blood to be an intuitive method for interpreting blood gas analysis (median 4, IQR 4-4, p<0.001). Participants noted that minimal training was required to effectively learn how to interpret Visual Blood (median 4, IQR 4-4, p<0.001). However, adjustments are necessary to reduce visual overload (median 4, IQR 2-4, p<0.001). Overall, Visual Blood received a favorable response. The strengths and weaknesses derived from these data will help optimize future versions of Visual Blood to improve the presentation of blood gas analysis results.

In this work, we report the caloric effect for an electronic system of the antidot type, modeled by combining a repulsive and attractive potential (parabolic confinement). In this system, we consider the action of a perpendicular external magnetic field and the possibility of having an Aharonov-Bohm flux (AB-flux) generated by a current passing through a solenoid placed inside the forbidden zone for the electron. The energy levels are obtained analytically, and the model is known as the Bogachek and Landman model. We propose to control the caloric response of the system by varying only the AB-flux, finding that in the absence of an external magnetic field, the maximization of the effect always occurs at the same AB-flux intensity independent of the temperature while fixing the external magnetic field at a non-zero value breaks this symmetry and changes the point where the caloric phenomenon is maximized and is different depending on the temperature to which the process is carried. Due to the great diversity in technological applications that have antidots in electronics, the possibility of controlling their thermal response just by varying the intensity of the internal current inside the solenoid can be a platform of interest for experimental studies.

Mercury toxicity significantly threatens aquatic ecosystems, particularly impacting fish populations and human well-being. This article exposes the effects of mercury contamination on aquatic life and their habitats. Mercury primarily originates from natural degassing and anthropogenic activities and accumulates in aquatic organisms, most notably in predatory fish, through bio-accumulation and bio-magnification. This bio-accumulation, driven by microbial transformation to methyl-mercury, leads to elevated concentrations in top-level predators. The consequences of mercury exposure on fish physiology are stunted growth, reproductive impairments, and compromised immunity, with potential ramifications for population dynamics and ecosystem resilience. This study delves into specific impacts of mercury on fish, ranging from bone deformities to liver damage, developmental anomalies, neurotoxic effects, and disruptions in reproductive systems. The interplay between ecological, physiological, and human health effects underscores the need for a comprehensive understanding of mercury's underlying mechanisms. Monitoring mercury levels in aquatic systems emerges as a crucial strategy for ensuring fish populations' health and ecosystems' sustainability. Urgent collaborative efforts are imperative to address this global concern, promote harmonious coexistence between human activities and aquatic environments, and secure the availability of safe and nutritious fish for future generations. In conclusion, this article highlights the urgent necessity for targeted interventions and informed decision-making to mitigate the influence of mercury contamination on aquatic ecosystems.

Natural killer cells are associated with the pathogenesis of ulcerative colitis (UC), but their precise contributions remain unclear. The present study sought to investigate the diagnostic value of activated NK-associated genes (ANAGs) in UC. Bulk RNA-seq and scRNA-seq datasets were obtained from the Gene Expression Omnibus (GEO) and Single Cell Portal (SCP) databases. In the bulk RNA-seq, 92 differentially expressed genes (DEGs) were screened out by the “Batch correction” and “Robust rank aggregation” (RRA) methods. The immune infiltration landscape was estimated by single-sample gene set enrichment analysis (ssGSEA) and CIBERSORT, which revealed a higher abundance of activated NK cells in noninflamed UC tissues. 54 DEGs correlated with activated NK cells were identified as ANAGs. Protein-protein interaction (PPI) analysis and least absolute shrinkage and selection operator (LASSO) regression were utilized to screen out 4 key ANAGs (SELP, TIMP1, MMP7, and ABCG2) and establish an activated NK-associated gene score (ANAG score). The ANAG score demonstrated excellent diagnostic value and was validated in three external datasets. The expression of the 4 key ANAGs was validated in UC patients and healthy controls (HC) samples. Through scRNA-seq data analysis, higher expression levels of SELP, TIMP1, MMP7, and ABCG2 were observed in post-capillary venules, inflammatory fibroblasts, enterocytes, and immature enterocytes. The cell scores based on the ANAGs showed enrichment in endothelial cells and fibroblasts. In conclusion, we established and validated an ANAG score with the ability to precisely diagnose UC. The 4 key ANAGs have the potential to serve as therapeutic targets in UC.

Embryological development of pancreas is a complex phenomenon and therefore, it can have multiple developmental aberrations. Fortunately, majority of these pancreatic ductal anomalies are asymptomatic with no clinical relevance and are incidentally detected during diagnostic cross sectional imaging or endoscopic retrograde cholangiopancreatography (ERCP) or autopsy. Occasionally, pancreatic duct anomalies can result in symptoms like abdominal pain or recurrent pancreatitis. Also, accurate pre-operative diagnosis of ductal anomalies can prevent inadvertent duct injury during surgery. Conventionally, ERCP had been used for accurate diagnosis of pancreatic duct anomalies. However, because of being invasive and associated with risk of pancreatitis, it has been replaced with magnetic resonance cholangiopancreatography (MRCP). MRCP has demonstrated high sensitivity and specificity for diagnosis of ductal anomalies which can be further improved with use of secretin enhanced MRCP. Endoscopic ultrasound (EUS) is a new diagnostic and interventional tool in the armamentarium of endoscopists and has demonstrated promising results in detection of pancreatic duct variations and anomalies. In this article, we will focus on the role of EUS in diagnosis of various pancreatic duct anomalies.

Short bowel syndrome (SBS) in adults is defined as having less than 180 to 200 cm of remaining small bowel [1–4]. Many literature sources do not provide precise epidemiological data, challenges in estimating the prevalence of SBS include its multifactorial etiology and varying definitions [1–7]. The most common pathologies leading to SBS include Crohn disease, mesenteric ischemia, radiation enteritis, post-surgical adhesions, and post-operative complications [1,2,4–6]. In advanced SBS, parenteral nutrition may be required to ensure that all vital nutrients are delivered directly through the venous system, bypassing the gastrointestinal tract [1,8–10]. In this article, we present a clinical case of a patient who underwent parenteral nutrition for four months due to SBS. The surgical team performed reconstructive re-anastomosis of both the small and large bowel, leading to the discontinuation of parenteral nutrition and the resumption of a regular diet.

Interior designers play a pivotal role in shaping the built environment and catalyzing positive change through the adoption of sustainable design practices. This study centers on the analysis of prevailing attitudes held by interior designers in Jordan towards sustainable interior design practices. Through a comprehensive methodology involving a literature review and a three-part questionnaire, the research explores the benefits, challenges, and integration of sustainability principles. The study highlights substantial awareness (85%) of sustainable interior design's environmental impact and resource preservation. Additionally, 81% acknowledge its enduring significance, and 89% recognize its diverse benefits. While 61% exhibit familiarity, 27% claim professional experience. Among sustainability indicators, energy efficiency scores 4.25, resource efficiency 4.27, and "Design aligns with laws and regulations by the Ministry of Labor" ranks highest at 4.37. This study significantly augments our understanding of sustainable interior design by introducing a comprehensive evaluation framework that encompasses the three sustainability dimensions. It equips decision-makers with a robust tool to identify specific practices that bolster sustainability performance, further advancing the field.

Glucose is an important carbon sources for microbial growth, and its content in infertile soils is essential for the growth of the bacterium. Since the mechanism of oligotrophic bacterium adaptation in barren soils is unclear, the research employed RNA Seq technology to examine the impact of glucose concentration on the low nutrient bacteria BS-G1 in soil affected by desertification. RNA-Seq revealed that differentially expressed genes（DEG）histidine metabolism, glutamate synthesis, HIF-1 signalling pathway, sporulation, and TCA cycle pathway of BS-G1 were significantly enriched in 0.015 g/L glucose concentration, compared with 10 g/L glucose concentration. DEG amino acids system, two-component system, Metal Ion Transport, and nitrogen metabolism system of B. subtilis BS-G1 were significantly enriched in 5 g/L glucose concentration, compared with 10 g/L glucose concentration. In addition, The present study identified its regulation pattern and key genes under the low glucose environment (7 mRNAs, 16 sRNAs). This study primarily investigates the variances in the regulatory pathways of oligotrophic bacteria BS-G1, which holds substantial importance in comprehending the mechanism underlying the limited sugar tolerance of oligotrophic bacteria.

Forests play a pivotal role within the ecological milieu, with alterations to forested areas not only impacting the local environment but also serving as a significant contributing factor to the occurrence of landslide disasters. However, the significance of forests in connection with deep seated landslides is diminished. In instances of extreme events, heavy rainfall, highly weak slopes, or seismic events, it is improbable for forest cover to exert any influence. Due to extensive agricultural irrigation, the Heifangtai terrace of China has experienced a significant rise in groundwater levels, leading to the occurrence of numerous landslides. Through field investigations and remote sensing interpretation, this study has revealed dramatical geomorphological changes in the Heifangtai terrace due to the occurrence of widespread landslides. These changes are likely to disrupt the pre-existing hydrological balance within the study area, thereby altering the conditions for landslides. Therefore, understanding how the evolution patterns of loess landslides can be assessed is a crucial scientific issue for predicting the conditions of landslide occurrence. Taking the evolution of landslides along the edge of the Heifangtai terraces as an example, this study first classified different types of loess landslides. Subsequently, the temporal and spatial distribution characteristics of these landslides were analyzed. Finally, utilizing the FLAC3D software, the stability of the loess slopes at the edge of the Heifangtai terrace was examined under the lateral evolution mode. The research findings indicate that the current loess landslides in the Heifangtai terrace exhibits longitudinal multi-periodicity and lateral group-occurring behavior, which is significant for assessing loess landslides along the edge of Heifangtai terraces.

Polymer hydrogels are 3D networks consisting of hydrophilic crosslinked macromolecular chains, able to swell and retain water. Since their invention in the 1960s, they have become an outstanding pillar in the design, development, and application of engineered polymer systems suitable for biomedical and pharmaceutical applications (such as drug or cell delivery, regeneration of hard and soft tissues, wound healing, and bleeding prevention, among others). Despite several well-established synthetic routes of polymer hydrogels based on batch polymerization techniques, about fifteen years ago academia started to look for alternative methods involving simpler reaction paths, shorter reaction times, and lower energy consumption. In this context, frontal polymerization (FP) undoubtedly has become an alternative and efficient reaction model that allows for converting monomers into polymers via a localized and propagating reaction, by exploiting the formation and propagation of a “hot” polymerization front, able to self-sustain and propagate throughout the monomeric mixture. Therefore, the present work aims to summarize the main research outcomes, achieved during the last years, concerning the design, preparation, and application of FP-derived polymeric hydrogels, demonstrating the feasibility of this technique for the obtainment of functional 3D networks, and providing the reader with some perspectives for the forthcoming years.

Bisphenol F (BPF) and bisphenol S (BPS) are increasingly used as substitutes for bisphenol A (BPA) in the plastic industry, driven by concerns over the adverse effects of BPA. However, there is a lack of infor-mation on the extent of exposure to these chemicals in children. This study aims to assess the extent of BPA, BPF, and BPS exposure and determine factors that influence such exposure. A group of Thai children (age 6-13 years, n=358) were recruited between October 2019-2020. Two first morning void was collected one week apart. Demographic and exposure-related information was gathered. Urinary concentrations of bisphenols were analyzed by liquid-chromatography and tandem mass spectrometry. Correlation between bisphenol concentrations and various factors was determined using generalized estimating equations with linear model. BPA, BPF, and BPS were detected at 79.6%, 31.0%, and 16.8%, with geometric mean (GM) concentrations of 1.41, 0.013, and 0.014 ng/mL respectively. Younger children aged < 10 years exhibited 1.3-1.6 times higher GM levels of all bisphenols compared to older children. Exposure to food stored in plas-tic containers were associated with higher levels of BPF and BPS. In conclusion, BPA was the most fre-quently detected bisphenol in urine samples from Thai children, followed by BPF and BPS.

The development and use of selenium and iodine elements in agriculture aim to enrich agricultural food products for humans. This study was carried out as a three-factor factorial experiment in a completely randomized design (CRD). Three concentrations of sodium selenate fertilizer (0, 2, 4 mg/l), three potassium iodate (0, 2, 4 mg/l), and two supplementary radiation levels (blue light and sunlight) were used. The results showed that the highest and the lowest (3.44 & 3.12 mg/g f.w) leaf protein value was related to blue light and sunlight treatments, respectively. In the blue light treatment, the maximum and the minimum (4.77 & 3.39 mg/g f.w) leaf sugar amount was observed at 4 and 0 mg/l of the iodine, respectively. At 0 mg/l of selenium, the highest and the lowest (8.63 & 5.34 mg/g f.w) leaf vitamin C amount was recorded at the 4 and 0 mg/l of iodine, respectively. In blue light + 0 mg/l of the selenium, the highest and the lowest (2.94 & 2.10 mg/g f.w) leaf flavonoid quantity was seen at 2 and 0 mg/l of the iodine, respectively. In the blue light conditions, (5.20%) leaf nitrogen content was achieved in the selenium 4 mg/l group. In the same conditions, the maximum and the minimum (3.09 & 2.18%) leaf potassium amount was attained at selenium 2 and 4 mg/l, respectively. Under blue light conditions, the highest and the lowest (0.58 & 0.24 mg/kg dry matter) leaf selenium level was observed at 4 and 0 mg/l, respectively. In sunlightradiation levels, the maximum and the minimum (0.36 & 0.25 mg/kg dry matter) leaf selenium level were found at 4 and 0 mg/l of selenium, respectively. In the blue light conditions, the most and the lowest (1.65 & 0.72 mg/kg dry matter) seed selenium content was related to 4 and 0 mg/l of the selenium, respectively. In the blue light conditions, the highest and the lowest (8.49 & 4.25 mg/kg dry matter) leaf iodine level was recorded at 4 and 0 mg/l of iodine, respectively. In the blue light conditions, the maximum and the minimum (30.56 & 20.62 mg/kg dry matter) seed iodine value was related to 4 and 0 mg/l of the iodine, respectively. In the sunlight, the most and the lowest (24.96 & 20.29 mg/kg dry matter) seed iodine amount was achieved at 4 and 0 mg/l of the selenium, respectively.

In Burkina Faso, the infant flours produced are intended for weaning-age and malnourished children. This study was to evaluate the management of infant flour production in Ouagadougou. A survey was conducted among the production units to determine the raw materials used in the production of infant flours, the production processes, the methods of conservation of raw materials and infant flours, the types of infant flours produced as well as their packaging. The results showed that 45.45% of the production units surveyed were of the semi-industrial type against 54.54% from the artisanal and CREN types. Among the raw materials, the most used cereals were millet, sorghum and maize. As for legumes, peanuts and soybeans were the most used at respectively 35% and 31%. For the conservation of raw materials, 85.71% of infant flour producers had storage warehouses and 66% used storage pesticides. These flours produced were intended for children of wean age (37.14%) and children in nutritional recovery (62.86%). Flours were stored in an airy (94.29%), dry area/environment (88.57%) and in the presence of light (91.43%). All the results of this survey reflect that efforts are still expected to further improve the nutritional and sanitary quality of the infant flours produced.

Various studies on the physical characteristics of the canopy gaps in tropical and subtropical regions but that in the mangrove swamp forest in Malaysia is little known. The objectives of this study are to assess the canopy gaps physical characteristics (size, form, direction), to assess the changes in soil physical characteristics and microenvionment in and around the canopy gaps. Five canopy gaps were selected formed by lightning strikes, gaps size and shapes were determined using the portable Global Positioning System and photographic images were analysed using ForestCrown. Result shows that canopy gap opening has increased the total light reaching the forest floor, changed the canopy gap microenvironment. Strong correlation between canopy opening percentage and temperature of gaps explains the changes of canopy gaps characteristics. These changes have contributed to new seedling germination, regeneration and maintaining the canopy gap dynamics.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Induction heating (IH) technology is widely recognized and utilized in residential applications due to its high efficiency and safe operating characteristics. Resonant inverter circuits are widely used in IH systems because of their high efficiency and ability to perform soft-switching. Among the various resonant inverters used in IH systems, the single-switch quasi-resonant (SSQR) inverter topology is typically preferred for low-cost and low-output-power applications. Despite its cost advantage, the SSQR topology has a relatively narrow soft-switching range, which can be unstable depending on the electrical parameters of the load and the resonant converter circuit. Accurately determining the capacitance value of the resonant capacitor and the inductance value of the induction coil, which are the key circuit elements of the SSQR induction cooker, is crucial for designing a reliable, efficient, and durable cooking system. In other words, there exists a critical relationship between the resonant converter circuit parameters, load characteristics, and safe operating conditions. Additionally, when considering closed-loop control methods used for power control and safety, selecting appropriate resonant circuit elements becomes vital in ensuring both reliable and efficient operation. This paper focuses on a novel and simplified design method for the SSQR inverter utilized in household appliances. The proposed method and its advantages in terms of the safe operating area of the switch are theoretically investigated and verified through simulations and prototype circuits.

Combined sewer overflow (CSO) is a significant environmental concern and public health (e.g., water contamination, eutrophication, and beach closure). The Environmental Protection Agency (EPA) has introduced the National Pollutant Discharge Elimination System (NPDES) permitting program to regulate and address this matter. This program mandates the control of CSOs for more than 700 municipalities obligated to devise Long-term Control Plans (LTCPs) to curb combined sewer overflows and bring them down to safe levels. LTCP involves diverse strategies, including sewer separation, green infrastructure improvements, and conventional gray infrastructure upgrades. This study investigates several municipalities’ solutions for CSO problems in conventional methods and wireless sensor technology as real-time control. The investigation mainly focuses on a comparative analysis of two cities, Richmond, Virginia, and South Bend, Indiana, such as average rainfall, the frequency of overflows, and the capacity of treatment plants. The findings indicate that integrating sensor technology could significantly enhance modeling endeavors, bolster the capacity of existing structures, and substantially enhance preparedness for storm events. The EPA’s Storm Water Management Modeling (SWMM) software is utilized. Through an analysis of SWMM data, the study suggests the potential for leveraging wireless sensor technology to achieve more robust control over CSOs as a part of LTCPs.

The average sizes \ {\bar{L}}_{i\ } and their dispersion W_i along the i-th axis of crystallites in powders are used to determine the X-ray diffraction sizes, D_{i\ XRD}, averaged over crystallite columns within the BWA method. Numerical calculations have been carried out for an orthorhombic lattice of crystallites, such as LiFePO4, NMC, having Lamé's g-type superellipsoid shape. For Lognormal distributions, the analytical expression for the normalized coefficient Kn is found and includes two constants. The first K_{g,0} is a constant at W→0, the second K_g is a constant depending on the g -type shape. The dependences of D_{i\ XRD} are also calculated for Normal distribution. A fairly simple equation can be obtained as a result of analytical transformations in the framework of experimentally validated approximations. However, a simpler way is to carry out numerical computer calculations with subsequent approximation of the calculated curves. Using the obtained analytical expressions to control technologies from nuclear fuel to cathode materials will improve the efficiency of flexible energy network especially storage in autonomous and standby power plants.

Regenerative endodontic procedures (REPs) aim at recreating dental pulp tissue using biomaterials such as hydrogels. Their bioactivity is mostly linked to the nature of biomolecules or chemical compounds that will compose the endodontic hydrogel. However, many other parameters, such as hydrogel concentration, type, bioactive molecules solubility, of apex size were reported to influence the hydrogel behavior, leading to the inability to predict the clinical outcome. This lack of knowledge and the various parameters that should be considered, suggest that biological activity of endodontic hydrogel is impossible to anticipate and could hinder the bench to bedside transition. We formulated in this article our opinion that most of these parameters could be identified, described, and studied. A second part of the document lists some challenges and perspectives, including development of future mathematical models able to explain and predict the bioactivity of these endodontic hydrogel in clinic.

With the changes in the spatial structure of China's economic development, urban clusters have become the primary carriers of China's regional economy and green growth. The article uses annual data from 2010 to 2021 to study the carbon emission characteristics and carbon reduction pathways of 36 cities in the Yangtze River Delta region. Firstly, cities in the Yangtze River Delta region are divided into six carbon emission types based on decoupling elasticity coefficient and carbon intensity indicators. Then, the STIRPAT model is used to regress the panel data of different carbon emission types for 11 years, analyze the driving factors of carbon emissions, and develop differentiated carbon emission reduction paths for cities with six carbon emission types. According to the results, the city of Type I needs to accelerate low-carbon technology innovation, Type II needs to improve energy efficiency and strengthen low-carbon technology research and development, Type V needs to suppress foreign investment in high energy consumption and high emission projects in the local area, Type VI needs to accelerate the process of new urbanization and optimize industrial structure. Types III and IV have not received effective emission reduction paths, and further research is required on other emission reduction policies and measures.

Globally, bridges fail mostly due to hydrological causes such as scour or flooding. Therefore, under a hydrological approach, this study proposes a methodology that contributes to prioritize the intervention of bridges to prevent their collapse. Through an exhaustive literature review, an evaluation matrix subdivided into 4 dimensions was developed and a total of 18 evaluation parameters were considered, distributed as follows: 4 environmental, 6 technical, 4 social and 4 economic. This matrix was applied to eight bridges with a history of hydrological problems in the same river and validated through semi-structured interviews with specialists. Data were collected through field visits, journalistic information, review of the gauged basin historical hydrological flow rates and consultations with the population. Then, the modeling, which considered the influence of gullies that discharge additional flow, was carried out using HEC-HMS and HEC-RAS and subsequently calibrated. The application of the matrix revealed that five bridges have a high vulnerability, and three bridges have a medium vulnerability. The multidimensional approach can be adapted for studies of other riverine bridges.

Quality control is a critical component in industrial manufacturing, directly influencing efficiency, product reliability, and ultimately, customer satisfaction. In the dynamic environment of industrial manufacturing, traditional methods of inspection may not adequately meet the evolving complexity, necessitating innovative approaches to bolster precision and productivity. In this study, we explore the application of mixed reality (MR) technology for real-time quality control in the assembly process. Our methodology involved the integration of smart glasses with a server-based image recognition system, designed to conduct real-time component analysis. The innovative aspect of our study lies in the harmonization of MR and computer vision algorithms, providing immediate visual feedback to inspectors and thereby improving the speed and accuracy of defect detection. YOLOv8 have been adopted in this study for detection object model. The project implementation occurred in a controlled environment to enable a comprehensive evaluation of the system functionality, the identification of possible problems and improvements in the system performance. The results indicated the viability of mixed reality as a powerful tool for enhancing traditional inspection processes. The fusion of MR and computer vision offers possibilities for future advancements in industrial quality control, paving the way for more efficient and reliable manufacturing ecosystems.

Due to increasing concerns about global warming and energy crisis, intensive efforts have been made to explore renewable and clean energy sources. Single-atom metals and two-dimensional (2D) nanomaterials have attracted extensive attention in the fields of energy and environment because of their unique electronic structures and excellent properties. In this review, we sum-marize the state-of-art progress on the single-atom metal supported at 2D MoS2 (single-atom metal/2D MoS2) for electrochemical CO2 reduction and water splitting. First, we introduce the advantages of single-atom metal/2D MoS2 catalysts in the fields of electrocatalytic CO2 reduction and water splitting, followed by the strategies for improving electrocatalytic performances of single-atom metal/2D MoS2 hybrid nanomaterials and the typical preparation methods. Further, we discuss the important applications of the nanocomposites in electrocatalytic CO2 reduction and water splitting via some typical examples, particularly focusing on their synthesis routes, modification approaches, and physiochemical mechanisms for improving their electrocatalytic performances. Finally, our perspectives on the key challenges and future directions of exploring high-performance metal single-atom catalysts are presented based on recent achievements in the development of single-atom metal/2D MoS2 hybrid nanomaterials.

In potato, high levels of nitrogen (N) can lead to excessive vegetative growth at the expense of tuber development, resulting in lower yield and poor quality tubers. We found that Solanum tuberosum CLE4 (StCLE4) is expressed most strongly in the roots on N-rich media and positively regulates root growth of potato in N-deficient conditions. We noted that StCLE4 functions as a negative regulator of normal shoot apex development similar to CLV3 in Arabidopsis. Transcriptomic analysis revealed that overexpression of StCLE4 results in repression of the StIT1 gene, a regulator of potato tuber initiation. Overexpressing StCLE4 stolons were transformed into branches that were similar to milder it1 phenotype. We also found that NIN-like proteins, key regulators of nitrate signaling, bind to the regulatory sequence of StIT1 in yeast one-hybrid assay. Taken together, our findings suggest that StCLE4 regulates shoot, root and stolon growth in potato.

The Canadian Prairies are associated with high natural hydroclimatic variability including the frequent periodic occurrence of droughts and pluvials. These extremes carry various risks in-cluding significant damage to the economy, environment and society. The well-documented level of damage necessitates further risk assessment and planned reductions to vulnerability, particu-larly in light of a warming climate. A logical starting point involves awareness and information about the changing characteristics of such climate extremes. We focus on the compound occurrence of droughts and pluvials as the risks from this type of event are magnified compared to the hy-droclimatic extremes in isolation. Also, research on compound droughts and pluvials is limited. Therefore, the purpose of this paper is to synthesize recent literature concerning the risks of com-pound droughts and pluvials, including examples of past occurrences, with a focus on the Cana-dian Prairies. Since literature from the Prairies is limited, global work is also reviewed. Rela-tionships between drought and pluvials are characterized using the SPEI Global Monitor for the Prairies, emphasizing the recent past, and through synthesis from the Prairie literature. That re-search mostly considers drought and pluvials as separate events, but is integrated here to charac-terize the relationships of these extremes. Examples of periods of compound droughts and exces-sive rainfall provide insights into the regional hydroclimatic variability. Furthermore, most lit-erature on future projections strongly suggests that this variability is likely to increase, mainly driven by anthropogenic climate change. These findings suggest means of decreasing vulnerabil-ity and associated damages. Although the study area is the Canadian Prairies, the work is rele-vant to other regions that are becoming more vulnerable to increasing risks of and vulnerabilities to such compound extremes.

In this article, we discuss problems that exist in modern SCADA systems and present a Controls-kt (formerly DataForge-controls) software development kit, that allows both to create a control system from scratch and provide integration with existing systems via Magix specification and connector.

The surging electricity demand driven by a growing global population, coupled with the increasing electrification of industries, transportation, and power-intensive appliances, poses a substantial challenge to electricity systems worldwide. This challenge is further compounded by the pressing issue of climate change. To address climate change and mitigate the environmental consequences of fossil fuel use, renewable energy sources are expected to play a pivotal role. However, certain renewable sources, such as wind and solar, exhibit stochastic behavior, resulting in unpredictable power output and significant fluctuations. This intermittency presents a challenge in maintaining a stable and reliable power supply. To overcome this challenge and ensure a balanced electricity grid, the strategic deployment of energy storage devices throughout the power system becomes critically important. Energy storage technologies play a vital role in mitigating the mismatch between renewable power generation and consumption. Additionally, they enable the storage of surplus energy generated from renewable sources during periods of high production for later use during periods of low or no generation. Each technology possesses unique characteristics and applications, providing flexibility and diversity in energy storage solutions. This work provides an overview of different energy storage technologies and explores their role in establishing a sustainable power system.

Aminoacyl-tRNA synthetases (aaRSs) originated from an ancestral bidirectional gene (mirror symmetry) and through the evolution of the genetic code the twenty aaRSs exhibit a symmetrical distribution in a 6-dimensional hypercube of the Standard Genetic Code. In this work, we assume a primeval RNY code, and the Extended Genetic RNA code type II which includes codons of the type YNY, YNR and RNR. Each of the 4 subsets of codons can be represented in a 4-dimensional hypercube. Altogether these 4 subcodes constitute the 6-dimensional representation of the SGC. We identify the aaRSs' symmetry groups in each of these hypercubes. We show that each of the four hypercubes contains the following sets of symmetries for the two known Classes of synthetases: RNY: dihedral group D2; YNY: binary group Z2; YNR: amplified octahedral group Oh; and RNR: binary group Z2. We demonstrate that for each hypercube, the group of symmetries of Class 1 is the same as the group of symmetries of Class 2. The biological implications of these findings are discussed.

Nanoparticles are of great importance for various scientific and technological applications, drug discovery, ecology, molecular biology, etc. Size is a basic characteristic of any particle, and dynamic light scattering is beyond competition when measuring particle size in dispersions ranging from nanometers to micrometers. Unfortunately, this method has a serious problem in processing and interpreting experimental data. Instrument noise and polydispersity of the sample lead to the situation when one initial autocorrelation function corresponds to several different particle size distributions. Sometimes these different solutions of the inverse task can be found by changing parameters in the software. Sometimes the scientist cannot be suspicious of possible other solutions, having one result from the program. In this article I demonstrate the problem on model and experimental data using three known programs: CONTIN, the Malvern Zetasizer and DynaLS. I also present my own free program Autocor, which allows to test our own hypotheses about the modality and shape of the particle size distribution by optimizing the parameters of our own models with a small number of degrees of freedom.

By using the Black-Derman-Toy (BDT) model, we predict the future trend of the riskless rate, and then we build an equation that relates the market price of zero-coupon bonds and the theoretical price of zero-coupon bonds calculated using a binomial option pricing model. Based on this, we can find the implied daily return μ, implied natural upturn probability p, and implied daily volatility σ with respect to different time-to-maturity values of zero-coupon bonds. With these results, we can give some suggestions to bond traders.

Developing low-cost and stable materials for converting solar energy into electricity is vital in meeting the world's energy demand. Metal-organic frameworks (MOFs) have gained attention for solar cells due to their natural porous architectures and tunable chemical structures. This review commences with an exploration of the synthetic methods of MOFs. Moreover, we discuss the various roles of MOFs, including photoanodes and counter electrodes in dye-sensitized solar cells and interfacial layers and charge carriers in perovskite solar cells. Ultimately, burdensome tasks and possible directions for advancing MOFs-based nanomaterials are provided for solar cells.

This study analyzes the influence of CEO types on corporate governance, focusing on de facto (substantial) CEOs. We examine how substantial CEOs impact ESG activities (Hypothesis 1) and corporate value (Hypothesis 2). Data were collected from KIS-VALUE and DART (Electronic Disclosure System) of the Financial Supervisory Service, defining substantial CEOs as highest remuneration recipients exceeding the representative director of the company pay. Results sup-port Hypothesis 1, showing companies with substantial CEOs are more engaged in ESG activities, potentially to improve public image while concealing self-serving behaviors. Hypothesis 2 is validated, indicating lower corporate value in companies with substantial CEOs due to prioritizing personal interests over long-term profit maximization. Despite limitations in exploring governance relationships beyond remuneration data, the study offers key contributions. It expands research on corporate governance and ESG activities by identifying substantial CEOs through objective remuneration data. It highlights the importance of an independent board for transparent governance and positive corporate value. Lastly, empirical evidence shows the negative impact of misdirected ESG activities on corporate value. By using remuneration as an indicator, this study illuminates substantial CEOs' influence on corporate value and ESG activities, providing insights for future research in corporate governance and ESG.

This paper presents a design and performance analysis of a 10-element 5G massive MIMO antenna array for sub-6GHz mobile handsets, specifically for LTE bands 42 (3400-3600 MHz), 43 (3600-3800 MHz), 48/49 (3550-3700 MHz) applications. The proposed antenna array consists of 10 closely spaced linearly polarized inverted-F antennas with a compact size of 20 × 9 mm2 of a single element. The proposed antenna array provides high gain, high efficiency, and low correlation between the antenna elements, which results in improved channel capacity, increased data rate, and enhanced signal quality. The performance of the antenna array is evaluated in terms of the radiation pattern, gain, efficiency, and correlation coefficient. The simulation and measured results show that the proposed antenna array achieves an approximate peak gain of 3.1 dBi at the resonance frequency, a total efficiency of 65 %, and a low correlation coefficient of 0.06 between the antenna elements. Therefore, the proposed 5G massive MIMO antenna array is a promising candidate for sub-6 GHz mobile handsets, particularly for LTE bands 42/43/48/49 applications.

Broad-spectrum antifungal drug deployed for topical therapy, specific for onychomycosis, Itraconazole was used as the active pharmaceutical ingredient in a nail lacquer formulation¹. The objective of the study was to optimize an antifungal nail lacquer, which when applied topically onto the dorsal surface of the nail plate would facilitate the transungual penetration of the drug. Itraconazole hydrochloride was synthesized to aid the formulation of the lacquers. The optimization involved comparing four different formulations of 1%w/w Itraconazole nail lacquers containing combinations of penetration enhancers (Papain, Salicylic acid, Urea) based on their ability to facilitate diffusion of the drug through the nail plate over five days. The drug uptake was quantified by extracting the drug from the nail clippings and analyzing it. The tests conducted to account for the quality of the optimized formulation were drug content, spread ability, check for precipitation, and accelerated stability. The results demonstrated that the optimized 1%w/w Itraconazole nail lacquer contained 5%w/w Papain, 5 %w/w Salicylic Acid, and 2.8% w/w Urea. The drug uptake from nail clippings was higher than the literature derived reference MIC90 value for T. Rubrum strain, and the quality of the optimized lacquer was not compromised throughout three weeks [2]. The hypothesis stated that the inclusion of Salicylic acid, Papain, and Urea in an Itraconazole (1%w/w) nail lacquer would have the highest transungual penetration on application to the nail plate. In conclusion, the hypothesis was accepted, and the optimized lacquer passed the drug uptake evaluation and all quality control tests.

Skeletal muscle is a specialized tissue consisting of nondividing and multinucleated muscle fibers. Skeletal muscle-specific myostatin (MSTN) is a secreted protein that acts as a negative regulator of muscle mass by inhibiting proliferation and differentiation of myoblasts. In this study, we established a screening platform to monitor myostatin promoter activity in rat L8 myoblasts. Extract of Glycyrrhiza uralensis (GUE), an oriental herbal medicine, was identified through this screening platform and, the active fractions of GUE were identified by process-scale liquid column chromatography system. For in vivo study, the GUE as a feed additive was investigated in growth-finishing pigs. The results showed that GUE significantly increased body weight, carcass weight and lean content in pigs. Microbiota analysis indicated that GUE did not affect the composition of gut microbiota in pigs. In summary, this established rodent myoblast screening platform was used to identify a myogenesis-related phytogenic, GUE, and further demonstrated that the active fractions inhibited MSTN expression. These finding suggest a novel application for GUE in growth performance enhancement through modulation of MSTN expression. Furthermore, this established screening platform has great potential for identification and evaluation of a wide variety of phytogenics involving in myogenesis.

Youth is the essential entrepreneurial force for every country's social, political, and economic development. Urban youth make up about 34.27 percent of the population in Ethiopia. The youth unemployment crisis is one of the serious challenges that Ethiopia is facing nowadays, and it should be mentioned in the nation's public discourse. Therefore, the main objective of this study is to specify the socioeconomic and demographic factors that influence urban youth unemployment in the Somali Regional State, specifically in Jigjiga, Degahbour, Kebridahar, Gode, and Dollo Ado towns. Both primary and secondary data sources were employed. A multi-stage sampling technique has been used to select 385 sample respondents from the total population of the study. This study found that almost 63% of youth in the study area were unemployed, and a large number of unemployed youths live in Jigjiga and Dollo Ado Towns as compared to other city administrations. The econometric model's findings indicate that factors like gender, education level, work experience, access to credit, access to information, time applied for job vacancy, active job seeker, social network (network with clan elders, government officials, businessmen, and other friends), and residence in Jigjiga and Gode town have a significant association with the likelihood of youth unemployment in the Somali regional state. Therefore, this study recommends that the regional government and local city administration should develop effective policies and strategies to address the underlying causes of gender inequality, improving access and quality of education, supporting freshman graduates to find jobs, providing access to credit and job vacancies, ensuring fair and free job competition, and managing youth migration for job seeking.

Tyrosinases (TYR) play an important role in oxidizing phenols and catechols, leading to the formation of catechols and ortho-quinones, respectively. In mammals, TYR catalyzes the conversion of L-Tyrosine to quinone, a pivotal step in melanogenesis, which generates melanin pigments responsible for protecting against UV radiation and oxidative stress. Given TYR's importance in melanin-related disorders and cosmetic applications, the inhibition of TYR has garnered attention for controlling melanin production. However, current inhibitors like hydroquinone, arbutin, and kojic acid (KA) have limitations in terms of side effects and effectiveness. A novel class of TYR inhibitors featuring arylpiperidine and arylpiperazine components has demonstrated potent inhibitory activity. This study presents a computational analysis of these inhibitors using molecular docking, molecular dynamics (MD) simulations, and the Linear Interaction Energy (LIE) method was used to estimate binding free energies. The arylpiperidine and arylpiperazine inhibitors exhibit remarkable stability within the TYR active site during simulations. The van der Waals interactions are notably sustained, indicating effective inhibition mechanisms. The results from LIE calculations closely align with experimental binding affinities. In summary, these results contribute to the understanding of TYR inhibition and underscore the potential of arylpiperidine and arylpiperazine derivatives as effective agents for modulating melanin production in both cosmetic and pharmaceutical applications. Overall, this study sheds light on the intricate interactions between inhibitors and TYR, opening avenues for the development of novel therapies and interventions.

The overexploitation of fossil fuels and their negative environmental impact has attracted the attention of researchers worldwide to propose alternatives to produce bioenergy. Microbial fuel cells (MFCs) systems are sustainable biotechnologies that use bacterial activity to break down organic matter while generating bioelectricity. MFCs have bioelectricity from domestic wastewater (DWW), municipal wastewater (MWW), and potato and fruit waste, reducing environmental contamination and decreasing energy consumption and treatment cost. This review focuses on the recent advancements regarding the designs and configurations, the operation mode of MFCs, and their capacity to produce bioelectricity (e.g., 2203 mW/m2) and fuels (i.e., H2: 438.7 mL/g and CH4: 358.7 mL/g, respectively). Besides, this review highlights practical applications, challenges, techno-economic, and life cycle assessments (LCA) of MFCs. Despite MFC's promising biotechnology, great efforts should be made to implement it in real-time and commercialization.

Maxillary sinus augmentation with a lateral approach (MSA) is a well-established treatment. In this prospective study, we evaluated risk factors for postoperative bone-graft displacement and report the clinical application of long-term resorbable GMEM-B-2 (L-lactic acid/-caprolactone [P(LA/CL)]) as a barrier membrane to cover the open window in the lateral wall in MSA. Twenty-four patients underwent MSA according to the relevant criteria; CT data obtained before and 1 week (1W) and 5–6 months (5M) post-MSA, bone height changes, bone height reduction rates at 1W and 5M post-MSA, bone-graft displacement measurements, and risk factors were examined. All patients showed bone height increments (p &lt; 0.005). However, no difference was observed between 1W and 5M post-MSA. Bone-graft displacement was observed in eight patients; the reduction rate from 1W to 5M post-MSA was 8.38% ± 4.88%. Sex, septa, maxillary sinus floor–palatal bone distance, and maxillary sinus floor–natural mouth distance were associated with bone-graft displacement (p &lt; 0.05). Height from the maxillary sinus floor to the palatal bone and the sinus angle influenced the augmentation amount (p &lt; 0.05). The L-lactic acid/ε-caprolactone [P(LA/CL)] membrane compared favourably with other membranes and may be useful as a barrier membrane for the MSA open window.

Numerical simulations and experiments on evaporative condensers in air conditioning systems using R744 were performed. Two configurations were given to study the feasibility of operating the subcritical R744 cycle. It indicated the capable of evaporative cooling condensing R744 to liquify by analyzing the outlet temperature at the end of the condenser reached from 28.7oC to 30.3oC with the operating pressure from 72.6 bar to 68.5 bar. The mass flow rate in the study increases from 14.34 kg/h to 46.08 kg/h, the pressure drop also increases from 0.23 bar to 0.47 bar for the simulation and 0.4 bar to 0.5 bar for the experiment, respectively. This study indicates that a 5-layers of copper tubes configuration causes a higher pressure drop and lower COP when compared to an 8-layers of copper tubes that split into 2 sets for smaller pressure drop. In this study, the evaporative condensers using mini tubes that are flooded in the cooling water tank are suitable for the subcritical R744 air conditioning system. The results obtained from the experimental data are in good agreement with those obtained from the numerical results, with the deviation less than 5%.

Recycled asphalt mixture is a material remixed with old asphalt recycled material (RAP) and new aggregate, and its application is of great significance in environmental protection.Due to the wear and tear of the old asphalt mixture, the road performance of the recycled asphalt mixture will decrease. This paper uses IPP software to obtain the shape characteristics of the old and new aggregates, and found that the roundness of the old aggregate of 9.5mm-16mm is the most serious wear. Therefore, the 30% RAP, and the influence of the roundness of the recycled asphalt mixture on the road performance is studied.

The purpose of this study was to determine the effects of aerobic exercise on carotid to femoral pulse wave velocity (cf-PWV), cell adhesion molecules (intracellular adhesion molecules (ICAM-1), vascular cell adhesion molecules (VCAM-1), and endothelial selectin (E-selectin), and oxidized-LDL in elderly women aged 70–85 years, and to identify the effect of and correlation with vascular stiffness. Forty participants were recruited and divided into three groups; vascular stiffness (VSG, n=14), obesity (OG, n=14), and normal (NG, n=12). All groups were given a 16-week intervention of aerobic exercise, and the data collected before and after exercise were analyzed using SPSS Ver. 23.0. Two-way repeated-measures ANOVA was used to evaluate between-group and time-dependent interaction effects. One-way ANOVA was used to evaluate between-group variations. In addition, the significance was tested using a post-hoc test (Scheffe). The within-group variations by time before and after exercise were examined using a paired t-test, and correlation analysis was performed using Pearson correlation coefficients. Simple regression analysis was performed for variables showing significant differences. The results indicated interaction effects for cf-PWV (p<.001), VCAM-1 (p<.01), E-selectin (p<.05) and oxidized LDL (p<.001). The rate of change of cf-PWV was positively correlated with that of VCAM-1 (r=.352, p<.05) and that of oxidized-LDL (r=.325, p<.05) with statistical significance. To determine the effect of the rate of change of cf-PWV on the rate of change of VCAM-1, the variables were tested, and the coefficient of determination in the regression analysis was .124, indicating that 12.4% of the tested variables fit the standard regression line. The variables for the effect of the rate of change of cf-PWV on the rate of change of oxidized LDL were also tested, and the coefficient of determination in the regression analysis was .106, indicating that 10.6% of the tested variables fit the standard regression line. Thus, the 16-week regular and consistent aerobic exercise program had significant effects on the cf-PWV, ICAM-1, VCAM-1, E-selectin, and oxidized-LDL in elderly Korean women with vascular stiffness, suggesting improvements in vascular stiffness, based on which the intervention is predicted to contribute to the prevention of vascular dysfunction by lowering the risk of cardiovascular disease due to atherosclerosis, as well as having a positive effect in the prevention of impairment of vascular endothelial cells.

The purpose of this article is to present a multi-criteria model designed to evaluate the potential of Sincelejo's cultural identity for tourism development. A descriptive quantitative methodology was used, which included a survey of 211 participants. A decision support method was applied, using the Weighted Additive Sum approach, following the multi-attribute method. Based on the information gathered, the elements of cultural identity shared by most of the criteria were identi-fied, highlighting the gastronomic, social, and cultural traditions and customs of the region, the results of which made it possible to design a composite indicator to evaluate the tourism potential of cultural identity in the area.

The conventional phytopathogen Pseudomonas syringae has been identified several significant virulence determinants against Caenorhabditis elegans, but their mechanisms of action remain elusive. Here, we report the nematicidal activity and action receptor of a methyl-accepting chemotaxis protein (MCP03) of a wild-type P. syringae MB03 against C. elegans. Purified MCP03 exhibited significant nematicidal toxicity against C. elegans, with a half-lethal concentration of 124.4 μg mL1, and detrimental effects on the growth and brood size of C. elegans. Additionally, MCP03-treated worms showed severe pathological destruction of the intestine and ovary, and depressed wrinkles of the cuticle. Through yeast two-hybrid assays, we identified a subunit of a COP9 signalosome, namely CSN-5, functionated as an action receptor of MCP03. In vitro pull-down and in vivo co-localization assays verified the binding interaction between MCP03 and CSN-5. RNA interference assays confirmed that MCP03 acts on CSN-5 to adversely affect the brood size, growth, and cuticle integrity of C. elegans. Following MCP03 infection, the expression of several genes relative to reproduction, growth, and cuticle formation, such as kgb-1, unc-98, and col-117, were significantly downregulated, which implicated the pathological changes of MCP03-treated nematodes. Thus, this study demonstrates that MCP03 acted on the receptor protein CSN-5 causing lethality and detrimental effects on the fertility, growth, and morphogenesis of C. elegans, which will provide new insights into the signaling pathways and mechanism underlying the nematicidal action of MCP03 towards C. elegans.

The treatment of petroleum refinery wastewater (PRWW) is of great interest in the field of industrial wastewater management. The wastewater contains a diverse concentration of contaminants such as oil and grease, petroleum hydrocarbons, phenol, ammonia, sulfides, as well as other organic and inorganic composites etc. The treatment of refinery wastewater has been treated through various processes including; physical, biological, chemical or hybrid methods which combine two or more techniques. Hence, the objective of this review is to summarize the recent research studies applied in the treatment of petroleum refinery wastewater using conventional, advanced as well as integrated treatment techniques. Furthermore, critically highlight the efficiencies and major limitations of each technique as well as prospects for improvement. Several conventional treatment techniques (basically, the physicochemical and biological processes) were discussed. In this context, advanced oxidation processes (AoPs) especially electrochemical oxidation and photocatalysis as well as the integrated/hybrid processes are found effective to remove the recalcitrant fraction of organic pollutants because of their various inherent mechanisms. These techniques could effectively remove COD and phenols concentration with an average removal efficiency exceeding 90%. Hence, the review also presented an elaborate discussion of the photocatalytic process as one of the advanced techniques and highlighted some basic concepts to optimize the degradation efficiency of a photocatalyst. Finally, a brief recommendation for research prospects is also presented.

This article presents an analysis of monthly precipitation totals based on the Global Precipitation Climatology Centre database and monthly mean temperatures based on National Oceanic and Atmospheric Administration data for 377 catchments located around the world. Data sequences covering 110 years from 1901 to 2010 were analysed. The long-term sequences of precipitation and temperature were used to assess the variability of climate extremes, referred to here as polarisation. Measures of polarisation used in the natural sciences are discussed. A simple measure of polarisation was presented and applied to long-term sequences of monthly precipitation totals and monthly mean temperatures. Due to the nature of the proposed polarisation measure, other characteristics of precipitation and temperature sequences are also presented as a background for the discussion of the polarisation index. The study showed the existence of trends related to the polarisation of temperature and precipitation phenomena. As a result of the analysis, trends of polarisation factors in the area of precipitation and temperature were identified in 11 catchments out of the 377 analysed catchments. The trend analysis used Mann-Kendall tests at a level of significance of 5%. The Pettitt test was used to determine the point of trend change for precipitation and temperature data. The whole investigation is supported by rich graphical analyses, and the results are presented in tabular form.

In the struggle for survival, all organisms have evolved adaptations for protection from predation. Angiosperms are among the most abundant producers on the planet, but they are trapped in a precarious symbiosis with animals for pollination and fruit dispersal, while also having to deter herbivory. About 10% of all angiosperms produce the deterrent latex from ubiquitous isoprene precursors. Latex is an aqueous suspension of rubber particles and other compounds which works as an antifeedant by clogging chewing mouthparts and by coagulating into a solid in stomach acid. A survey of stomach pHs from various animals supports the hypothesis that foregut-fermenting ruminants have evolved the capacity to evade latex coagulation due to the presence of anterior digestive chambers with near-neutral to alkaline pH before it enters the acidic abomasum. Hindgut-fermenting animals lack this adaptation and have to eat forage which is low in latex, such as grasses. The latex-adaptive foregut browsers vs. latex-maladapted hindgut grazer hypothesis has implications for both livestock and zoo animals which may be provided with forage that is not optimal for their gut health. Further, ruminants and herbivorous tadpoles are at risk for damage by popular bioinsecticides such as Bt which are activated by alkaline gut pH.

Low-cost personal exposure monitors (PEMs) to measure personal exposure to air pollution are potentially promising tools for health research. However, their adoption requires robust validation. This study evaluated the performance of twenty-one Plume Lab Flow2 (PLF) by comparing its air pollutant measurements, particulate matter with a diameter of 2.5 μm or less (PM2.5), 10 μm or less (PM10), and nitrogen dioxide (NO2), against several high-quality air pollution monitors under field conditions (at indoor, outdoor, and roadside locations). Correlation and regression analysis were used to evaluate measurements obtained by different PLFs against reference instrumentation. For all measured pollutants, the overall correlation coefficient between the PLFs and the reference instruments was often weak (r<0.4). Moderate correlation was observed for one PLF unit at indoor location and two units at roadside location, when measuring PM2.5, but not for PM10 and NO2 concentration. During periods of particularly higher pollution, 11 PLF tools showed stronger regression results (R2 values > 0.5) with one-hour and 9 PLF units with one-minute time interval. Results show that the PLF cannot be used robustly to determine high and low exposure to poor air. Therefore, the use of PLFs in research studies should be approached with caution if data quality is important to the research outputs.

The physicochemical treatment/recovery techniques, including precipitation, membrane technology, solvent extraction, foam fractionation, adsorption, and aqueous two-phase systems, will be reviewed. The bio-treatment processes, based on microorganisms and/or enzymes consuming nutrients available in food-processing wastewater as low-cost substrates to produce valuable products, will be discussed in detail, including the production of microalga biomass in wastewater treatment systems. Finally, future research direction will be proposed to integrate the circular economy and develop integrated food processing wastewater management systems.

We compare photoaligning properties of polymer layers fabricated from the same constituents: polymethyl-methacrylate (PMMA) and azo-dye Disperse Red 1 (DR1), either chemically attached to the PMMA main-chain, or physically mixed with it. Photoaligning properties depend on the preparation method drastically. This finding is supported by atomic force microscope (AFM) scans monitoring the light-induced changes at the polymer−air interface, and revealing a photoinduced mass transfer.

Due to its economic benefits and the ability to reduce carbon emissions on a large scale, the CCUS-EOR project has been widely promoted and implemented globally. By using carbon dioxide flooding, oil water transition zone reservoirs that were once considered worthless may have new potential for development because of its rich geological reserves and high quality carbon sequestration conditions. Unlike water flooded layer, the oil in the TZ is unsaturated rather than residual oil after water flooding, which would lead to special oil-water seepage law of initial oil saturation. It is necessary to clarify special oil-water seepage law of oil-water transition zone to evaluate its production & storage potential. In this paper, we present a series of experiments to characterize the relationship between residual oil saturation and initial oil saturation. Cores in four different permeability and oil in four different viscosity are used to simulate different reservoir conditions, and that CO2 immiscible flooding experiments for each cores permeability and oil viscosity are performed with four different initial oil saturation. A total of 36 sets of CO2 flooding experiment data are used to draw the initial oil saturation & residual oil saturation chart. The results show that the residual oil saturation depends on the initial oil saturation rather than constant under certain conditions of core and oil. Under the condition of low permeability and high oil viscosity, the influence of initial oil saturation on residual oil saturation is relatively strong. The initial oil saturation & residual oil saturation chart can accurately calculate the residual oil saturation, initial water cut and final recovery based on the core permeability, oil viscosity and the initial oil saturation which is the first time to put forward this kind of chart and of the great significance to evaluate the recovery potential of the TZ.

A Savonius wind turbine is one of the simplest vertical-axis turbines. Several researchers have been attracted to it because of its simple structure, low noise, appropriate torque, and independence from wind direction. SR3345 and SR5050 blade profiles will be investigated for their effects on the performance of Savonius wind turbines. First, the fabricated wind turbine is placed in front of an open circuit wind tunnel with a velocity of 6 m/s. Furthermore, governing relationships are used to calculate power and torque coefficients as well as tip speed. In this study, the power and torque coefficients of the turbine are compared with the two profiles considered based on overlap ratios between 0 and 0.3. Despite its increased stability, the central shaft reduced the power coefficient of the turbine. For blade SR3345, the best performance occurs at tip speed ratios of less than 1, while for blade SR5050, the best performance occurs at higher tip speed ratios. Both blades SR3345 and SR5050 achieve the highest power coefficients at overlap ratios of 0 and 0.18 when a central shaft is present.

Introduction: The goals of this retrospective cohort study of 129,443 persons admitted to Calgary acute care hospitals 2013-2021 were to ascertain correlations of “potentially inappropriate medi-cations” (PIMs), “potential prescribing omissions” (PPOs) and other risk factors with readmissions and mortality. Methods: Processing and analysis codes were built in Oracle Database 19c (PL/SQL), R and Excel. Results: The percentage dying during their hospital stay rose from 3.03% during the first to 7.2% during the 6th admission. The percentage dying within 6 months of discharge rose from 9.4% after the first to 24.9 after the sixth admission. Odds ratios (adjusted for age, gender and comorbidities) for readmission were the post-admission number of medications (1.16; 1.12-1.12), STOPP PIMs (1.16; 1.15-1.16); AGS Beers PIMs (1.11; 1.11-1.11) and START omissions not corrected with a prescription (1.39 (1.35-1.42). Odds ratios for mortality were post-admission number of medications (1.04; 1.04-1.05), STOPP PIMs (0.99; 0.96-1.00); AGS Beers PIMs (1.08; 1.07-1.08) and START omissions not corrected with a prescription (1.56 (1.50-1.63). START omissions corrected with a prescription correlated with a dramatic reduction in mortality (0.51; 0.49-0.53). Odds ratios for readmissions for the second through 39th admission were consistently higher if START PPOs were not corrected for the second admission (1.41; 1.36-1.46), third (1.41;1.35-1.48); fourth 1.35;1.28-1.44); fifth 1.38; 1.28-1.49); sixth (1.47;1.34-1.62) and 7th through 39th admission (1.23; 1.14-1.34). For all admissions when a pre-scription was given to correct START PPOs ORs for mortality within six months of discharge were dramatically improved (0.51; 0.49-0.53). This was also true for the second (0.52; 0.50-0.55; fourth (0.56; 0.52-0.61; fifth (0.63; 0.57-0.68); sixth (0.68; 0.61-0.76); and 7th through 39th admissions (0.71; 0.65-0.78). Conclusions: PPOs should be corrected by prescriptions and teams of family physicians, pharmacists and nurses should focus on patients’ understanding of their illnesses, medications and ability for self-care.

Background: This systematic review aimed to provide a comprehensive overview of the effects of Functional Electrical Stimulation (FES) on gait characteristics in healthy individuals. Methods: Six electronic databases (PubMed, Embase, Epistemonikos, PEDro, COCHRANE Library, Scopus) were searched for studies evaluating the effects of FES on spatiotemporal, kinematic and kinetic gait parameters in healthy individuals. Two examiners evaluated the eligibility and quality of included studies using the PEDro scale. Results: A total of 15 studies met the inclusion criteria. Findings from the literature reveal that FES can be used to modify lower-limb joint kinematics, i.e., to increase or reduce the range of motion of hip, knee and ankle joints. In addition, FES can be used to alter kinetics parameters, including ground reaction forces, center of pressure trajectory, or knee joint reaction force. As a consequence of these kinetics and kinematics changes, FES can lead to changes in spatiotemporal gait parameters, such as gait speed, step cadence, and stance duration. Conclusion: The findings of this review improve our understanding of the effects of FES on gait biomechanics in healthy individuals, and highlight the potential of this technology as a training or assistive solution for improving gait performance in this population.

The BNT162b2 vaccine is globally used for preventing morbidity and mortality related to COVID-19. Cancer patients have had priority for receiving the vaccine due to their diminished immunity. This study reports the response of administering the 3rd and 4th vaccine doses to can-cer patients receiving active anti-neoplastic treatment. 142 patients have received two doses of the mRNA-based BNT162b2 COVID-19 vaccine, while 76 and 25 patients have received three and four doses, respectively. The efficacy of the humoral response following two vaccine doses was diminished in cancer patients, especially in the group of patients receiving chemotherapy. In a multivariate analysis, patients after three and four BNT162b2 vaccine doses were more likely to have antibody titers in the upper tertile compared to patients after two doses of the vaccine (odds ratio (OR) 7.62 (95% CI 1.38-42.12), p=0.02 and 17.15 (95% CI 5.01-58.7), p<0.01, respective-ly). Unlike the response after two doses, the 3rd and 4th BNT162b2 vaccine booster doses, had an increased efficacy of 95-100% in cancer patients while on active treatment. This result could be explained by different mechanisms including the development of memory B cells.

The study of velocimetry is important for characterizing and comprehending the effects of fluid flow, and the Particle Image Velocimetry (PIV) technique is one of the primary approaches for understanding the velocity vector field in a test section. Commercial PIV systems are expensive, with one of the main cost factors being high-speed camera equipment capable of capturing images at high frames per second (fps), rendering them impractical for many applications. This study proposes an evaluation of utilizing smartphones as image acquisition systems for PIV technique application. An experimental setup inspired by the known angular displacement of synthetic particles is proposed. A stepper motor rotates a plate containing an image of synthetic particles on its surface. The motion of the plate is captured by the smartphone camera, and the images are processed using PIVlab-MatLab® software. The use of two smartphones is assessed, with acquisition rates of either 240 fps or 960 fps and varying angular velocities. The results were satisfactory for velocities up to 0.7 m/s at an acquisition rate of 240 fps and up to 1.8 m/s at 960 fps, validating the use of smartphones as a cost-effective alternative for the PIV technique.

There has been considerable progress in implicit neural representation to upscale an image to any arbitrary resolution. However, existing methods are based on defining a function to predict the RGB value from just four specific loci. Relying on just four loci is insufficient as it leads to losing fine details from the neighboring region(s). We show that by taking into account the semi-local region leads to an improvement in performance. In this paper, we propose applying a new technique called Overlapping Windows on Semi-Local Region (OW-SLR) to an image to obtain any arbitrary resolution by taking the coordinates of the semi-local region around a point in the latent space. This extracted detail is used to predict the RGB value of a point. We illustrate the technique by applying the algorithm to the Optical Coherence Tomography-Angiography (OCT-A) images and show that it can upscale them to random resolution. This technique outperforms the existing state-of-the-art methods when applied to the OCT500 dataset. OW-SLR provides better results for classifying healthy and diseased retinal images such as diabetic retinopathy and normals from the given set of OCT-A images. The project page is available at https://rishavbb.github.io/ow-slr/index.html

A recent study demonstrated that noninvasive measurements of cortical hemodynamics and metabolism in the resting human prefrontal cortex can facilitate quantitative metrics of unilateral mitochondrial-hemodynamic coupling and bilateral connectivity in infraslow oscillation (ISO) frequencies in young adults (YA). The ISO includes three distinct vasomotions with endogenic (E), neurogenic (N), and myogenic (M) frequency bands. The goal of this study was to prove the hypothesis that there are significant differences between young and older adults (OA) in the unilateral coupling (uCOP) and bilateral connectivity (bCON) in the prefrontal cortex. Accordingly, we performed measurements from 24 OA (67.2 ± 5.9 years of age) using the same 2-channel broadband near-infrared spectroscopy (bbNIRS) setup and resting-state experimental protocol as those in the recent study (Shahdadian et al, Cerebral Cortex Communications, 2022). After quantification of uCOP and bCON in three E/N/M frequencies and statistical analysis, we demonstrated that OA had significantly weaker bilateral hemodynamic connectivity but significantly stronger bilateral metabolic connectivity than YA in the M band. Furthermore, OA exhibited significantly stronger unilateral coupling on both prefrontal sides in all E/N/M bands, particularly with a very large effect size in the M band (&gt; 1.9). These age-related results clearly support our hypothesis and were well interpreted following neurophysiological principles. The key finding of this paper is that the neurophysiological metrics of uCOP and bCON are highly associated with age and may have the potential to become meaningful features for human brain health and be translatable for future clinical applications, such as early detection of Alzheimer’s disease.

In the work the enhanced security of unmanned aerial vehicles (UAVs) electronics in RF environment was investigated. UAVs are commonly used in many areas and the cellular networks as the parallel helping networks for systems: LTE, 5G or especially for future 6G are very perspective and needed. For effective communications in channels: “air-to-ground” as well as “drone-to-drone” the important task is undisturbed work of transportation platforms, ie. UAV. However, high level of outside electromagnetic radiation can affect the correct electronics work. The problem is due to non-conformity of RF environment regulations. The electromagnetic compatibility (EMC) standards guarantee correct electronics work when the radiation level is not higher than established EMC levels. In case of commercially available devices, like UAVs, this level is 3 V/m. On the other hand, permissive exposure level, treated as RF environment emitted by cellular base stations, can reach the level of 61 V/m. Such level of electromagnetic wave pollution, can damage unprotected electronics with fatal consequences. This can cause the unchecked drone flight or unchecked fall down. As a result, due to unchecked flight, the UAV can cause the sudden communication interruption with operator or other drones. To reduce the level of damaging RF field we propose to cover the UAV housing with microwave absorber. In this case absorber must ensure good electromagnetic protection as well as lightweight and resistant on weather conditions. The shielding property of reduced graphene oxide (RGO) as an absorber was investigated. For proposed material the shielding effectiveness (SE) was investigated in the frequency range from 100 MHz to 10 GHz. It has been proved that such material can be a good candidate as an absorber for UAV having low reflection coefficient and high absorption ability. In this work the shielding effectiveness of RGO was analyzed for two layers of 3 and 5 mm at typical frequencies as RF environment, ie. 3.6 GHz (5G system) and 5.8 GHz (LTE). Investigated absorber guarantees the value of SE of 25 dB and 30 dB for 3 mm layer at 3.6 GHz and 5.8 GHz respectively and of 29 dB and 39.5 dB for 5 mm layer at these frequencies respectively.

By slowly evaporating 4-bromo-2-methylbenzonitrile at room temperature, it was possible to make a single organic nonlinear optical crystal. The grown crystal's crystalline nature was verified, and the unit cell characteristics are provided as a = 4.08Å, b = 6.61 Å, c = 28.93Å, α = 90º, β = 90º, γ = 90º. The functional groups of the crystal produced were identified using the FTIR and FT-Raman spectra. The UV cutoff wavelength is found at 221.6 nm, and the transparency nature of the crystal was analyzed in the optical studies.  The band gap of the grown crystal was estimated using the Taucs’ plot. The violet and red emissions of photoluminescence are discussed. A high dielectric constant was received at a low frequency. The TG/DTA curve shows that the grown crystal was stable up to 125.59 ºC.  The Kurtz-Perry powder technique was applied to confirm the Second Harmonic Generation's (SHG) nature. By using the agar diffusion method, the antibacterial property of the grown 4B2MBN crystal was determined.

Acute myocardial infarction (AMI) is a leading cause of morbidity and mortality worldwide. This study aimed to test the efficacy of a newly-developed symptom self-management program on health outcomes among inpatients post-AMI. A pilot randomised, controlled trial was utilised. A convenience sample of 90 was recruited from a tertiary hospital in Singapore. Adult inpatients with post-AMI were randomly assigned to the three groups: IManage-HSet, IManage-FF or control group. Sample size was computed using power analysis. Data were collected through self-reported questionnaires and physiological instruments. Data analyses included univariate statistics, analysis of variance and repeated measure analysis of variance. Ninety participants were recruited with 30 in each group. Participants in the IManage-HSet and IManage-FF group had significantly greater relaxation (ηp2 = 0.11), lower objective stress (ηp2 =0.14), and greater knowledge (ηp2 = 0.62) than those of the control group. The two intervention groups had lower subjective stress (ηp2 = 0.04), depression (ηp2 = 0.01), and anxiety (ηp2 = 0.03) than the control but such differences did not achieve statistical significance. Furthermore, most participants reported that they were satisfied with the programs and they provided positive comments on the contents, educational materials and relaxation practice. This pilot study supports the potential benefits and feasibility of the IManage-VR and IManage-FF interventions on stress, perceived relaxation, knowledge and patient satisfaction. Contents of the symptom management interventions could be added into current cardiac rehabilitation programs. Future RCTs with multi-centered sites and larger sample size are required to further test the intervention. This study was prospectively registered with the International Standard Randomised Controlled Trial on the 5th August 2014 with registration number ISRCTN61027816.

The dependence on Unmanned Aerial Vehicles (UAVs) has dramatically increased in many sectors around the globe. UAVs are in high demand, and their technology is developing quickly due to their sophisticated ability to handle various issues. UAVs are capable of replacing labor-intensive tasks with conducive and safe regulation. Additional tools or sensors need to be added to the UAVs system to ensure the implementation of UAVs able to serve into industrial level. The paper aims to consolidate and present a thorough understanding of the various stages of image processing pipelines deployed in UAV applications, including image acquisition, preprocessing, feature extraction, object detection and tracking, and decision-making processes. Throughout this paper, several aspects were deliberate such as strengths, limitations, and performance metrics of existing approaches, this paper seeks to provide researchers, engineers, and practitioners with valuable insights into the challenges and opportunities of image processing systems for UAVs. Ultimately, the synthesis of this knowledge will contribute to enhancing the effective-ness, autonomy, and applicability of UAVs in diverse fields such as surveillance, agriculture, disaster management, and environmental monitoring.

Tesso Nilo National Park is one of the protected areas designated as KPA by the Decree of the Minister of Forestry No.225/Menhut-II/2004 dated July 19, 2004 covering an area of ​​38,576 ha, then expanded again through the Decree of the Minister of Forestry No.663/Menhut/2009 dated 19 October 2009 with an area of ​​± 83,068 ha. The Tesso Nilo National Park area is experiencing the dynamics of land cover changes, namely the conversion of forest land which causes the forest area to become increasingly narrow in this area. With the reduction in forest area in this area, it causes a decrease in ecosystem network connectivity due to forest fragmentation that occurs, so that forests are separated and further apart. This study aims to analyze changes in land cover in the Tesso Nilo National Park area to find out information on changes in habitat ecosystems in the last 20 years. the observations were made using satellite images in 1999, 2010 and 2019. so that it can be seen the effect of forest fragmentation on ecosystems in the Tesso Nilo National Park area. From the results of the analysis, it was found that the area of ​​forest cover in the Tesso Nilo National Park decreased from 1999 to 2019 and caused changes in the connectivity network of forest ecosystems, which was found in the study, the weakest connectivity separated forest fragments as far as 17394.47 meters due to forest cover fragmentation.

The metabolism of lipoproteins, which regulates the transit of the lipid to and from tissues, is crucial to maintaining cholesterol homeostasis. Cardiac remodeling is referred to as a set of molecular, cellular, and interstitial changes that, following injury, affect the size, shape, function, mass, and geometry of the heart. Acetyl coenzyme A (acetyl CoA), which can be made from glucose, amino acids, or fatty acids, is the precursor for the synthesis of cholesterol. In this article, authors explain concepts behind cardiac remodeling, its clinical ramifications, and the pathophysiological roles played by numerous various components, such as cell death, neurohormonal activation, oxidative stress, contractile proteins, energy metabolism, collagen, calcium transport, inflammation, and geometry. The levels of cholesterol are traditionally regulated by two biological mechanisms at the transcriptional stage. First, the SREBP transcription factor family regulates the transcription of crucial rate-limiting cholesterogenic and lipogenic proteins, which in turn limits cholesterol production. Immune cells become activated, differentiated, and divided, during an immune response with the objective of eradicating the danger signal. In addition to creating ATP, which is used as energy, this process relies on metabolic reprogramming of both catabolic and anabolic pathways to create metabolites that play a crucial role in regulating the response. Because of changes in signal transduction, malfunction of the sarcoplasmic reticulum and sarcolemma, impairment of calcium handling, increases in cardiac fibrosis, and progressive loss of cardiomyocytes, oxidative stress appears to be the primary mechanism that causes the transition from cardiac hypertrophy to heart failure. De novo cholesterol production, intestinal cholesterol absorption, and biliary cholesterol output are consequently crucial processes in cholesterol homeostasis. In the article's final section, the pharmacological management of cardiac remodeling is explored. The route of treatment is explained into different steps: including, promising, and potential strategies. This chapter offers a brief overview of the history of the study of cholesterol absorption as well as the different potential therapeutic targets.

Abstract: Medication overuse headaches is a frequent phenomenon observed in individuals suf-fering from chronic headaches. It arises due to the excessive consumption of pain-relief medica-tions, resulting in the escalation and continuous persistence of headache symptoms. Nevertheless, the prevalence and distinctive characteristics of medication overuse headaches in the pediatric population have not been comprehensively explored. The primary objective of this research is to delineate the features of medication overuse headaches in children, particularly emphasizing the investigation of its epidemiology and the diagnostic patterns for headaches. We conducted a ret-rospective study by and analyzed the medical records of children and adolescents who were evaluated at outpatient pediatric headache clinic at the Bnai Zion medical center for headache during the period spanning 2007 to 2017. Our study encompassed a cohort of 1008 patients expe-riencing headaches. Among these participants, 268 individuals (26.6%) were diagnosed with mi-graine, 250 (24.8%) exhibited tension-type headaches (TTH), and 490 (48.6%) were classified as having undifferentiated headaches. Out of the whole group, 65 had chronic headaches: 35 (54%) with migraine, 20 (30%) with tension-type headaches (TTH), and 10 (15%) with undifferentiated headache of childhood, with the majority (73%) being female.In summary, medication overuse headaches are a prevalent issue among children grappling with chronic headaches. Intriguingly, they appear to be more pronounced within the tension-type headache (TTH) group compared to migraine sufferers, and exhibit a higher prevalence among females. This study underscores the significance of early detection and careful management of medication overuse headaches in pedi-atric cases, shedding light on its distinct characteristics in the realm of childhood headache disor-ders. Further research is warranted to elucidate the underlying factors contributing to the ob-served gender disparity and the distinct prevalence rates among different headache subtypes.

Background: Down Syndrome is the most well-studied aneuploidy condition in humans. It is associated with multiple disease phenotypes including cardiovascular, neurological, haemato-logical, and immunological disease processes. In this review paper we aim to discuss the research into gene expression studies performed at the fetal stage of development. Methods: A descriptive review was performed including all papers published on the PubMed database between Septem-ber 1960- September 2022. Results: In the amniotic fluid, genes such as COL6A1 and DSCR1 are affected, causing the phenotypical craniofacial changes. Other genes affected in amniotic fluid in-cluding: GSTT1, CLIC6, ITGB2, C21orf67, C21orf86 and RUNX1. In the placenta, MEST, SNF1LK and LOX were dysregulated, affecting nervous system development. In the brain DYRK1A, DNMT3L, DNMT3B, TBX1, olig2 and AQP4 were found to be dysregulated, affecting the nervous system and intellectual disability. In the cardiac tissues GART, EST2 and ERG found to be dysregulated causing secondary heart field abnormalities. XIST, RUNX1, SON, ERG and STAT1 dysregulated causing myeloproliferative disorders. Conclusions: Differential expression of genes provides clues to the genetic consequences of DS. A better understanding of these processes could eventually to lead to the development of genetic and pharmacological therapies.

African swine fever (ASF) is a lethal and highly contagious transboundary animal disease with the potential for rapid international spread. Currently, there is no ASF vaccine commercially available. All infected animals must be isolated and culled immediately upon confirmation of the presence of the virus. Works leading to the rational development of protective ASF vaccines are urgently needed. Here, we generated a safe and efficacious live-attenuated vaccine (LAV) VNUA-ASFV-LAVL2 by serial passaging of a field isolate (VNUA-ASFV-05L1, genotype II) in porcine alveolar macrophage (PAMs, 65 passages) and an immortalized porcine alveolar macrophage cell line (3D4/21, 55 passages). VNUA-ASFV-LAVL2 can efficiently replicate in both PAMs and 3D4/21 cells. It provides 100% protection, even with the low dose of 10^2 HAD50, for the vaccinated pigs against the challenge of contemporary pandemic ASFV field isolate. Pigs vaccinated with this LAV at a dose range of 10^2 to 10^5 HAD50 remained clinically healthy during both the 28-day observation period of immunization and the 28-day observation period of challenge. VNUA-ASFV-LAVL2 was completely eliminated from blood by 28 days post inoculation (DPI), and from feces or oral fluids by 17 DPI. It remained a safe, stable, and attenuated phenotype after five passages in pigs. Consistently high levels of ASFV-specific IgG antibodies and significant cellular immunity were detected in vaccinated pigs before the ASFV challenge. These results indicate that the VNUA-ASFV-LAVL2 strain is a safe and efficacious LAV against the genotype II ASFV strain responsible for current ASF outbreaks in Asia.

In order to study the acoustic emission characteristics of sandstone under the action of the high temperature-water cooling cycle, the RMT-150B electro-hydraulic servo rock test system and the DS-5 acoustic emission detection and analysis system were used to conduct a single analysis of the sandstone after the high temperature-water cooling cycle. Experimental study on acoustic emission characteristics under axial compression, analyzing the deformation, strength and acoustic emission characteristics of sandstone under different temperatures and cycles. The results of the study show that the high temperature-water cooling action causes changes in the physical properties of the sandstone. The expansion rate of the rock sample decreases first and then increases when the temperature rises, and the strength first increases and then decreases. The number of cycles has little effect on the physical properties of the rock sample; sandstone acoustic emission ringing count increases with the increase of temperature and cycle times, acoustic emission activities become more frequent with the loading process; with the increase of cycle times and temperature, acoustic emission ringing counts and accumulative acoustic emission energy appear earlier The rock sample enters the elastic deformation stage ahead of schedule, the yielding period increases, and the rock sample presents a trend of transition from brittle failure to ductile failure; the ringing count and cumulative energy increase with the increase in temperature and cycle times, and the high-energy ringing count and cumulative energy increase. The simultaneous sharp increase of the rock sample is the harbinger of the failure and instability of the rock sample.

The rapid urbanization growth of Dubai has resulted in connectivity issues, considered tre-mendous development pressure. That leads the local authorities to set a vision for Dubai as a 15-20 minute city by 2040. The 15-minute city, where all services can be reached with minimum travel time using sustainable mobility means (walking, cycling, or electric bik-ing). This paper aims to assess the current walkability situation within 15 minutes in the most significant parts of Dubai. This study considered 13 communities; Bur-Dubai and Business Bay were selected to represent the ungated communities, and eleven major gated communities were considered to indicate the gated ones. Those neighborhoods are selected based on the developments' socio-economic status and population density. The assessment considered 14 essential services, categorized into five categories: educational, health, social, entertainment, and religious. The research methodology conducted desktop research, site visits, interviewing random residents to collect data, and then using ArcGIS to assess walk-ability. The results show (64.5%) of the ungated neighborhoods population which access essential services within 15 minutes, while most of the gated communities residents must use cars to access many services. Furthermore, services distribution patterns and walkability infrastructures outside these developments should be developed to obtain higher walkability indicators.

Multidrug-resistant tuberculosis emerged as a serious challenge to tuberculosis management and control. In the Eastern Cape, the Beijing variants are prevalent and a driving force of multidrug-resistant tuberculosis; hence, we investigated the distribution of gene mutations in Beijing strains compared to non-Beijing strains. Multidrug-resistant tuberculosis and heteroresistant isolates were identified in 412 sputum cultures by drug susceptibility testing. The isolates were analyzed for mutations in three genes associated with resistance to antituberculosis first-line drugs: katG and inhA promoters for isoniazid and rpoB for rifampicin. All isolates were genotyped by spoligotyping. There were more males than females and a more economically active age group in the study. The most prevalent mutations in rpoB resistance were in S531L, katG in S315Tb, and inhA in c-15tb. Heteroresistance was found in 18 isolates. Beijing variants were predominant. Most of the heteroresistant isolates were INH, with heteroresistance occurring more in the inhA gene mutation region c-15tb. Beijing and LAM variants were found more frequently in INH heteroresistant isolates. Mutations in katG S315Tb and rpoB S531L were higher in Beijing variants. The Beijing family is a major contributor to the epidemiological picture and accounts for most of the multidrug-resistant tuberculosis in the study area.

Abstract: Autophagy has a dual role in gliomagenesis in a microRNA-modulated environment. We investigated the potential relevance of autophagy in glioma development and survival by exploring the association of autophagy-associated genes and microRNAs in low- and high-grade gliomas. Real-time PCR (qPCR) was used to determine the expression of genes and microRNAs in 50 fresh glioma tissues while Formalin-fixed paraf-fin-embedded tissues of the same patients were used for immunohistochemistry. The Mann-Whitney U-test test, Spearman correlation test, and Kaplan-Meier survival analysis were performed to evaluate the expression, association, and overall survival in patients respectively. The expression of LC3, AKT, and miR-21 was increased in high-grade glioma compared to low-grade glioma while ULK2 expression was decreased in high-grade glioma. A strong positive correlation was observed for ULK2 with UVRAG, PTEN, miR-7, and miR-100, while the moderate correlation with mTOR, Beclin1, miR-30, miR-204, miR-374, miR-21 and miR-126 in low-grade glioma, while a moderate positive correlation between ULK2 and PI3K, PTEN, ULK1, VPS34, mTOR, Beclin1, UVRAG, AKT and miR-374, and between AKT and ULK1, VPS34, UVRAG, and miR-7 in high-grade gliomas. The low ULK2 and LC3 expression group was significantly associated with better overall survival in gliomas while miR-21 overexpression showed a poor prognosis in glioma patients. Therefore, miR-21, ULK2, and LC3 may serve as prognostic biomarkers for survival outcomes in glioblastoma.

Nasal nitric oxide (nNO) is a gas synthesized by the inducible and constitutive NO synthase enzyme in the airway cells of the nasal mucosa. Like lung nitric oxide, it is thought to be associated with airway inflammation in various respiratory diseases in children. The aim of our review was to investigate the current state of use of nasal nitric oxide measurement in children. A comprehensive search was conducted using the Web of Science and PubMed databases specifically targeting publications in the English language, with the following keywords: nasal NO, children, allergic rhinitis, chronic rhinosinusitis, acute rhinosinusitis, primary ciliary dyskinesia (PCD) and cystic fibrosis (CF). We describe the use of nNO in pediatric allergic rhinitis, chronic rhinosinusitis, acute rhinosinusitis, primary ciliary dyskinesia (PCD), and cystic fibrosis (CF) based on the latest literature. CONCLUSION: nNO is a noninvasive, clinically applicable test for use in pediatric allergic rhinitis, chronic rhinosinusitis, acute rhinosinusitis, PCD and CF. It can be used as a complementary method in the diagnosis of these respiratory diseases and as a monitoring method for the treatment of allergic rhinitis, acute and chronic rhinosinusitis.

Introduction: Chronic Obstructive Pulmonary Disease (COPD) is a common, preventable and treatable disease. The first PREM (Patient Reported Outcome Measure) type questionnaire that has been dedicated to asses experience of care in COPD is the PREM-C9. Aim: To create a Polish version of the PREM-C9 and determine its the psychometric characteristics. Methods: The validation procedure involved forward and back translation and included 42 COPD patients. The psychometric properties were assessed using Cronbach's alpha, Bartlett's test, Kaiser-Meyer-Olkin and Spearman correlation coefficient. The validity of the questionnaire was assessed using Principal Component Analysis for the extracted principal components. The validity of the factor analysis was demonstrated by the Bartlett's sphericity test and the Kaiser-Meyer-Olkin (KMO). Factor analysis was performed using the Oblimin and Varimax rotation. The reliability of the questionnaire was assessed using the Cronbach's alpha. Results: The Polish version of the PREM-C9 questionnaire met all validation criteria: face, translation, psychometric, functional and reconstruction equivalence. The Spearman correlation results between Polish PREM-C9&amp;CAT: rho= 0,44, p=0,003539; HADS-Anxiety: rho= 0.370864, p=0,015612, HADS-Depression: rho= 0,387405, p=0,011253. Conclusion: The developed Polish PREM-C9 questionnaire is a reliable and valid tool that assesses Polish COPD patients' experiences of their disease and the care they receive.

Maxillofacial defects, arising from trauma, oncological disease or congenital differences, detrimentally affect everyday life. Prosthetic repair offers the aesthetic and functional reconstruction with the help of materials mimicking natural tissues, among which polymers take unprecedented role. The three-dimensional (3D) printing techniques based on the computer-aided design, where polymers are essential, provide a rapid and cost-effective workflow protocol to perfectly restore patient-specific anatomy for prosthetics. This review discusses the main 3D printing approaches to maxillofacial prostheses fabrication: extrusion and lithography, which are radically preferable to the traditional methods. The main assessment criteria, affording the polymer implementation in 3D printing of prostheses, as well as the characteristics of the key advanced polymers, are considered. The success of the prosthesis is shown to be largely dependent on the retention system, predominantly using polymers in the form of adhesives and osseointegrated implants as a support for the prosthesis. The approaches and technological prospects are also discussed in the context of specific aesthetic restoration on the example of the nasal, auricle and ocular prostheses. 3D printing techniques determine the development of personalized approaches to improve aesthetic and functional effect of prosthetics in patients with maxillofacial defects.

Abstract Purpose: To analyze the correspondence between refractive astigmatism and corneal astigmatism in pseudophakic eyes with non-toric intraocular lenses. Setting: Yeouido St. Mary hospital, Seoul, South Korea Design: Evaluation of a diagnostic test instrument. Methods: This retrospective study included 95 eyes of 95 patients. Corneal astigmatism was measured with an automated keratometer (RK-5, Canon) and Scheimpflug tomography (Pentacam HR, Oculus). Refractive astigmatism was compared to keratometric astigmatism (based on anterior corneal measurements only), Equivalent K Reading and total corneal astigmatism (both based on anterior and posterior corneal measurements). Vector analysis was carried out by Næser’s polar value method. The accuracy was defined as the average magnitude of the vectorial difference in astigmatism (DA). Each corneal measurement was optimized in retrospect by a multiple linear regression equation between refractive and corneal astigmatism. Results: Keratometric astigmatism overestimated with-the-rule (WTR) refractive astigmatism and underestimated against-the-rule (ATR) refractive astigmatism. Several measurements based on both corneal surfaces values did not show any statistically significant difference with respect to refractive astigmatism. The mean corneal astigmatism by total corneal refractive power (TCRP) at 4.0 mm (zone/pupil) produced the lowest mean arithmetic DA and the highest percentage of eyes with a DA ≤0.50 diopter. After optimization, the accuracies of automated KA and TCRP 4.0 mm (zone/pupil) were similar. Conclusions: Total corneal astigmatism measured by the Scheimpflug tomography at 4.0 mm zone centered on pupil, accurately reflects the refractive astigmatism in pseudophakic eyes. However, the accuracy of total corneal astigmatism is not different from automated KA after optimization.

Ribotoxin-like proteins (RL-Ps) are specific ribonucleases found in mushrooms that are able to cleave a single phosphodiester bond located in the Sarcin-Ricin Loop (SRL) of the large rRNA. The cleaved SRL interacts differently with some ribosomal proteins (P-stalk). This action blocks protein synthesis because the damaged ribosomes are unable to interact with elongation factors. Here, the amino acid sequence of eryngitin 3 and 4, RL-Ps isolated from Pleurotus eryngii fruiting bodies, was determined to: i) obtain structural information on this specific ribonuclease family from edible mushrooms; and ii) explore the structural determinants which justify their different biological and antipathogenic activities. Indeed, eryngitin 3 (exhibited higher toxicity with respect to eryngitin 4 against tumoral cell lines and model fungi. Structurally, eryngitin 3 and 4 consist of 132 amino acids, most of them identical and exhibit a single free cysteinyl residue. The amino acidic differences between the two toxins are: i) an additional phenylalanyl residue at the N-terminus of eryngitin 3, not retrieved in eryngitin 4; and ii) an additional arginyl residue at C-terminus of eryngitin 4, not retrieved in eryngitin 3. The 3D-models of eryngitins show slight differences at the N- and C-terminal regions. In particular, the positive electrostatic surface at C-terminal of eryngitin 4 is due to the additional arginyl residue not retrieved in eryngitin 3. This additional positive charge could interfere with the binding to the SRL (substrate) or with some ribosomal proteins (P-stalk structure), during substrate recognition.

Non-systemic oral drugs, which do not get absorbed through the gastrointestinal membrane, are an important group of compounds for targeting diseases residing within the gastrointestinal lumen. However, they require a set of design principles not sufficiently covered by traditional druglikeness metrics, such as Lipinski’s Rule of 5. These druglikeness metrics fail to accurately identify true negative outcomes; such is the requirement for novel cheminformatic based approaches for the discovery of non-systemic small molecules. One such example of these newer metrics is the fraction of SP3-hybridised carbon atoms (fSP3) which has shown promising application as an identifier of poor oral-bioavailability. Herein, we discuss the application of fSP3 in the drug discovery process in a number of case studies, including our own work discovering non-systemic fructose scavengers for the treatment of fructose malabsorption.

Recent digital transformations have significantly impacted the current society, economy, and culture. This includes adoption of rapidly emerging technologies, such as artificial intelligence (AI), immersive technology (e.g., virtual, augmented, mixed and extended reality (VR/AR/MR/XR)), cloud services, and internet of things, in our day-to-day life. `Metaverse’ has emerged as a technology that incorporates many of these transforming technologies to deliver personalised immersive experience related to specific application areas. A potential major beneficiary of Metaverse is the educational ecosystem, where highly immersive learning experiences can be delivered to students, catering to their personal learning needs and train them on life skills such as empathy, ethical qualities, and communication skills. The present-day Metaverse allows physical engagement, enabling users to utilise limb movements to interact with the presented materials. However, ethical concerns and technical limitations impede the widespread implementation of the Metaverse in the real-world. This paper provides a comprehensive survey of the existing literature covering the architecture, type and components of Metaverse, followed by practical aspects of metaverse implementation. The paper is concluded by discussing on the open challenges and issues along with their mitigation strategies and future research directions after the detailed usecase of Metaverse in Education.

Pancreatic ductal adenocarcinoma (PDAC) a highly malignant neoplasm, is classified as one of the most severe and devastating types of cancer. PDAC is a notable malignancy that exhibits a discouraging prognosis and a rising occurrence. The interplay between diabetes and pancreatic cancer exhibits a reciprocal causation. The identified metabolic disorder has been observed to possess noteworthy consequences on health outcomes, resulting in elevated rates of morbidity. The principal mechanisms involve the suppression of the immune system, the activation of pancreatic stellate cells (PSCs), and the onset of systemic metabolic disease caused by dysfunction of the islets. From this point forward, it is important to recognize that pancreatic cancer-related diabetes (PCRD) has the ability to increase the likelihood of developing pancreatic cancer. This highlights the complex relationship that exists between these two physiological states. Therefore, we investigate into the complex domain of PSCs, elucidating their intricate signaling pathways and the profound influence of chemokines on their behavior and final outcome. In order to surmount the obstacle of drug resistance and eliminate PDAC, researchers have undertaken extensive efforts to explore and cultivate novel natural compounds of the next generation. Additional investigation is necessary in order to comprehensively comprehend the effect of PCRD-mediated apoptosis on the progression and onset of PDAC through the utilization of natural compound. This study aims to examine the potential anticancer properties of natural compound in individuals with diabetes who are undergoing chemotherapy, targeted therapy, or immunotherapy. It is anticipated that these compounds will exhibit increased potency and possess enhanced pharmacological benefits. According to our research findings, it is indicated that naturally derived chemical compounds hold potential in the development of PDAC therapies that are both safe and efficacious.

(1) Importance of problem: Breast cancer accounted for 685.000 deaths globally in 2020, and half of all cases occur in women with no specific risk factor beside gender and age-group. During last 4 decades we see a reduction by 40% of age-standardized breast cancer [1], which in turn means that the number of mastectomies performed for younger women increased, raising the need for adequate breast reconstructive surgery. Advances in oncological treatment have made it possible to limit the extent of what represents radical surgery for breast cancer, yet in the past decade, we see a marked trend toward mastectomy in breast conserving surgery eligible patients [2]. Prophylactic mastectomy has also registered an upward trend [3,4]. This trend together with new indication for breast reconstruction like chest feminization in transgender patients [5] have increased the need for breast reconstruction surgery. (2) Purpose: The purpose of this study is to analyze the types of reconstructive procedures, their indications, their limitations, their functional results and the safety profiles when used during the integrated treatment plan of the oncologic patient; (3) Methods: We conducted an extensive literature review of the main reconstructive techniques, especially the autologous procedures, summarized the findings and presented a few cases from our own experience for exemplification of the usage of breast reconstruction in oncologic patients. (4) Conclusions: Breast reconstruction has become a necessary step in the treatment of most breast cancers and many reconstructive techniques are now routinely practiced. Microsurgical techniques are considered the "gold standard", but they are not accessible to all services, from a technical or financial point of view, so pediculated flaps remain the safe and reliable option, along with alloplastic procedures, to improve the quality of life of these patients.

In the aftermath of the COVID pandemic, post-COVID-19 syndrome (PCS) remains a challenge and may continue to represent a major health problem in the future. Moreover, the influence of type 2 diabetes and being overweight on PCS remains unclear. This study aimed to assess this influence. We performed an observational study from October 2020 to July 2022, which included 466 patients (269 males and 197 females) with a median age of 65. They were hospitalized due to COVID-19 pneumonia and had persistent symptoms after 1 month of COVID-19 infection. The patients were divided into four groups according to the study objectives: patients with type 2 diabetes, overweight patients, overweight patients with type 2 diabetes, and normal-weight patients without type 2 diabetes. The clinical and demographic data collected during hospitalization and regular visits at the Community Healthcare Center dr. Adolf Drolc Maribor were analyzed. Our results showed that type 2 diabetes patients had a more difficult course of treatment and longer hospitalization. Moreover, more type 2 diabetes patients underwent rehabilitation than the other study groups. The prevailing symptoms in our patients with PCS were dyspnea and fatigue, mostly in female patients with type 2 diabetes. Our study also showed that more women with type 2 diabetes and more overweight women with type 2 diabetes suffered from secondary infections. Further, more overweight patients were treated in the intensive care unit compared to the other groups. However, our study showed an interesting result that patients with type 2 diabetes had the shortest PCS durations. Type 2 diabetes and being overweight are risk factors for PCS onset and prolonged duration. Therefore, our data that revealed a shorter duration of PCS in type 2 diabetes patients compared to the other investigated groups was unexpected. We believe that answering this question regarding the results will enable us to improve PCS treatment in general.

We discuss the optimal control formulation for enhancement and denoising of satellite multiband images and propose to take it in the form of an L1-control problem for quasi-linear parabolic equation with non-local p[u]-Laplacian and with a cost functional of a tracking type. The main characteristic feature of the considered class of parabolic problems is the fact that the variable exponent p(t,x) and the anisotropic diffusion tensor D(t,x) are not well predefined a priori, but instead these characteristic non-locally depend on a solution of this problem, i.e., pu=p(t,x,u) and Du=D(t,x,u). We prove the existence of optimal pairs with sparse L1-controls using for that the indirect approach and a special family of approximation problems.

This study evaluates the accessibility of primary care physicians (PCPs) in Eastern Quebec using an enhanced two-step floating catchment area (E2SFCA) methodology. The E2SFCA methodology considers both the population supply of PCPs and the travel time between PCPs and dissemination areas, and was found to be effective in identifying possibly underserved areas. The availability of primary care services is contingent upon the presence of adequate road infrastructure, and populations residing in areas with limited access to main road networks may experience compromised access to primary care. The study concludes that the E2SFCA methodology can facilitate the identification of areas experiencing a shortage of PCPs, and this information can be used to inform the development of regional medical workforce programs and support the establishment of rural residency initiatives.

Multiple sclerosis (MS) is a chronic inflammatory autoimmune disease of the central nervous system. According to recent studies, cellular senescence caused by telomere shortening may contribute to the development of MS. Aim of the study: to determine the associations of TEP1 rs1760904, rs1713418, TERC rs12696304, rs35073794 gene polymorphisms with the occurrence of MS. Methods: The study included 200 patients with MS and 230 healthy controls. Genotyping of TEP1 rs1760904, rs1713418 and TERC rs12696304, rs35073794 was performed using RT-PCR. Statistical analysis of the obtained data was performed using the program "IBM SPSS Statistics 29.0". Haplotype analysis was performed using the online program "SNPStats". Results: The TERC rs12696304 G allele of this SNP is associated with a 1.4-fold lower odds of developing MS (p=0.035). TERC rs35073794 is associated with an approximately 2.4-fold reduced odds of MS occurrence in the codominant, dominant, overdominant, and additive models (p < 0.001; p < 0.001; p < 0.001; p < 0.001, respectively). Haplotype analysis shows that the rs1760904-G - rs1713418-A haplotype is statistically significantly associated with a 1.75-fold increased odds of developing MS (p=0.006). The rs12696304-C - rs35073794-A haplotype is statistically significantly associated with a 2-fold decreased odds of developing MS (p=0.008). In addition, the rs12696304-G - rs35073794-A haplotype was found to be statistically significantly associated with a 5.3-fold decreased odds of developing MS (p&lt;0.001). Conclusion: Current evidence may suggest a protective role of TERC SNP in the occurrence of MS, while TEP1 has the opposite effect.

This study identified, analysed, and prioritised significant factors for standardising the Korean smart city project evaluation system. We analysed the efficiency and productivity of companies currently providing smart city services to consider both policy and practical aspects. The prioritisation of smart city planning reflects the latest trends in South Korea, where urban planning is moving towards smart city planning. Furthermore, the capacity building of public-private/private-private partnerships indicate the importance of business scalability. This indicates that smart city services are only stabilised when the private sector is involved and leads the project, rather than focusing on public development. The feasibility of building intelligent facilities indicates that smart city projects should be implemented after securing cost-benefit feasibility. The results were used as the basis for building an evaluation system, showing that in smart city convergence alliances, small- and medium-sized enterprises achieved the highest efficiency by reducing inputs to 81% and 86%, under the assumptions of constant and variable returns to scales, respectively. As the operational aspect is more problematic than the technical aspect, policy alternatives are necessary for smooth business progress, including increased flexibility of laws and institutions and the activation of policies that temporarily relieve regulations to demonstrate smart city projects.

This study analyzes the evolution of Corporate and Social Responsibility (CSR) and Environmental, Social, and Governance (ESG) concepts in social media, specifically on Twitter, from 2007 to 2022. The research aims to understand how society perceives organizational practices related to these aspects. Twitter provides an authentic environment for capturing user perceptions. The methodology involved collecting Tweets using Python and analyzing them in English, Spanish, and Portuguese with RStudio. The study's main findings highlight significant contributions and concerns within the CSR and ESG debates. While CSR's popularity showed a downward trend from 2010 to 2019, ESG grew exponentially during the pandemic and post-pandemic periods. Word analysis revealed the impact of specific hashtags: RSC in Spanish, #CSR in English, and #ESG in Portuguese. Society's increasing concerns concern environmental issues for combating global warming and ensuring a better quality of life, alongside financial transparency and ethical practices in companies. However, the social aspect of ESG, represented by the letter "S," didn't garner the same attention as environmental and governance matters. This discrepancy might stem from a lack of awareness or lower priority in public discussions on social media, overshadowing the social dimension in the ESG framework.

Taste determination in small molecules is critical in food chemistry, but traditional experimental methods can be time-consuming. Consequently, computational techniques have emerged as val-uable tools for this task. In this study, we explore taste prediction using various molecular feature representations and assess the performance of different machine learning algorithms on a dataset comprising 2,601 molecules. The results reveal that GNN-based models outperform other ap-proaches in taste prediction. Moreover, consensus models that combine diverse molecular repre-sentations demonstrate improved performance. Among these, molecular fingerprints + GNN con-sensus model emerges as the top performer, highlighting the complementary strengths of GNNs and molecular fingerprints. These findings have significant implications for food chemistry research and related fields. By leveraging these computational approaches, taste prediction can be expedited, leading to advancements in understanding the relationship between molecular structure and taste perception in various food components and related compounds.

This study aims to explore predictors of the foreign investment from China coming into Rwanda. One of the components of Rwanda’s economy is the investment it receives from other countries. In order to achieve these objectives, the study gathers econometric secondary data from 2007 to 2020 quarterly which were availably provided by National Statistics of China, World Bank, UNCTAD, National Institute of Statistics of Rwanda, and the National bank of Rwanda. From literature and based on the availability of data, market size, trade openness, infrastructure, and human capital were measured as predictors of Chinese FDI. The data is analyzed using linear regression in Stata. The finding of the study showed that variables have a positive effect on FDI from China, and it found that though FDI had an effect on overall economy of Rwanda, the effect was not statistically significant. The study suggested that Rwanda’s policy on foreign investment should aim to attract and encourage Chinese investment to increase the economy of Rwanda. To encourage more FDI, the Rwandan government can offer Chinese investors greater ownership, locational, and internalization benefits. It also should continue to strengthen economic policy transparency since it lowers transaction costs and hence improves incentives for foreign investment.

The natural flavonoid epigallocatechin gallate (EGCG) has a wide range of biological activities including binding to nucleic acids; however, mechanisms of interaction of EGCG with DNA organized in chromatin have not been systematically studied. In this work, interaction of EGCG with chromatin in cells, and with nucleosomes and chromatosomes in vitro was studied using fluorescent microscopy and single particle Förster resonance energy transfer approaches, respectively. EGCG effectively penetrates into the nuclei of living cells and binds to DNA there. Interaction of EGCG with nucleosomes in vitro induces large-scale, reversible uncoiling of nucleosomal DNA that occurs without dissociation of DNA or core histones at sub- and low-micromolar concentrations of EGCG. EGCG does not reduce the catalytic activity of poly(ADP-ribose) polymerase 1 (PARP1), but causes modulation of the structure of the PARP1-nucleosome complex. EGCG significantly changes the structure of chromatosomes, but does not cause dissociation of the linker histone. Reorganization of nucleosomes and chromatosomes by EGCG might facilitate access of protein factors involved in DNA repair, replication and transcription to DNA and thus might contribute to the modulation of gene expression by EGCG that was reported earlier.

Offshore Wind Turbines (OWT) with increasingly higher energy output are being developed to meet energy demand, posing challenges for their foundation design. Several foundation types are used to support these turbines with monopiles (MP) accounting for 80% of the installed capacity. In this study, three-dimensional (3D) nonlinear finite element models (FEM) were employed to investigate the behaviour of monopile foundation supporting a 5MW wind turbine when subjected to lateral loading. Results indicate that the MP behavior depending on the pile length to diameter (L/D) ratio and the soil shear strength. Inspection of bending moment profiles at the lateral ultimate capacity indicated the monopiles can behave in flexible manner even with low L/D ratio. The L/D ratio affected the MP normalized lateral ultimate capacity at varying degrees and the biggest effect was for soft clays, amounting to around 5 folds increase for L/D values of 3.33 to 13.33. Lesser effects were found for stiff clays.

Interactions between proteins and ions are essential for various biological functions like structural stability, metabolism, and signal transport. Given that more than half of all proteins bind to ions, it becomes crucial to identify ion-binding sites. Accurate identification of protein-ion binding sites helps us to understand proteins’ biological functions and plays a significant role in drug discovery. While several computational approaches have been proposed, this remains a challenging problem due to the small size and high versatility of metals and acid radicals. In this study, we propose IonPred, a sequence-based approach that employs ELECTRA (Efficiently Learning an Encoder that Classifies Token Replacements Accurately) to predict ion binding sites using only raw protein sequences. We successfully fine-tuned our pretrained model to predict the binding sites for nine metal ions (Zn2+, Cu2+, Fe2+, Fe3+, Ca2+, Mg2+, Mn2+, Na+, and K+) and four acid radical ion ligands (CO32−, SO42−, PO43−, NO2−). IonPred surpassed six current state-of-the-art tools by over 44.65% and 28.46% respectively in F1 score and MCC when compared on an independent test dataset. Our method is more computationally efficient than existing tools producing prediction results for a hundred sequences for a specific ion in under ten minutes.

Massification in higher education has made the satisfaction of students’ needs a difficult conundrum among university lecturers. In contrast, the use of innovative design for collaborative learning enhances student engagement in the populous student’s context. Moreover, this paper aims to extensively explore innovative designs for fostering student engagement and collaborative learning among first-year students at the University of Venda. The study employed a qualitative research method with the purposive sampling technique. Subsequently, a group of 200 students was the population of this study. Participant Observation and narrative inquiry were used as data collection instruments. The students in their respective groups were assigned topics from the module content to use their talents to demonstrate their understanding of certain content in the module. The non-surprising findings of this paper elucidated that collaborative learning expedites students’ mastery of key concepts and subject content. The module lecturers introduced students to these innovative designs to ensure collaborative learning and effective student engagement. The key findings elucidated these aspects namely, role-playing exercises, group projects, peer-to-peer learning, use of talents, and peer feedback. The implication of this study is that students learn to work together, delegate responsibilities and communicate effectively to attain a common goal. Using these strategies, the lecturers promote collaboration among students and foster a more engaging and interactive learning experience. This paper further recommends efficient and effective techniques and strategies to foster student engagement and collaboration to track and monitor at-risk students timeously.

The hawthorn fruit, a member of the Rosaceae family, is a medicinal plant with numerous therapeutic properties. It exhibits a wide range of variants, with Crataegus tanacetifolia being Turkey's most widely recognized species. The hawthorn fruit has various biological activities, including anti-inflammatory, antibacterial, antioxidant, immune-modulating, and anti-carcinogenic properties. Vinegar was produced from the hawthorn fruit and the techniques of pasteurization and ultrasound were employed to enhance the antioxidant capabilities and extend the shelf life. A total of 56 mature Wistar-Albino rats were allocated into seven groups and administered hawthorn fruit vinegar via oral gavage on a daily basis. The experimental groups were classified as pasteurized (HVP) and ultrasound (HVU) treated, with two different dosage levels (0.5 and 1 mg/kg), and a control group consisting of regular vinegar. The SOD, MDA, and CAT antioxidant levels were measured using the ELISA method in plasma and liver tissue samples. The total cholesterol, triglyceride, HDL, LDL, AST, and ALT values were quantified in commercially available kits. The levels of SOD and CAT in the plasma and liver were found to be significantly higher in the HVU1 group. In a manner akin to those mentioned, the HVU1 cohort exhibited the highest HDL value. The levels of LDL were comparably low in both the thermal pasteurized and ultrasound treatment groups. This finding agrees with HDL levels and is statistically significant (p≤0.05). There were significant expressions of both CAT and SOD in HVU groups in liver tissues immunohistochemically. The possible therapeutic effects of hawthorn vinegar may boost its antioxidant capabilities and contribute to an overall improvement in quality of life.

This prospective study aimed to evaluate the ability of point-of-care Doppler ultrasound measurements of carotid-corrected flow time and changes in corrected carotid flow time (FTc) induced by volume expansion to predict fluid responsiveness in patients undergoing robot-assisted gynecological surgery in a modified head-down lithotomy position. FTc was measured using Doppler images of the common carotid artery before and after volume expansion. The stroke volume index at each time point was recorded using the MostCare instrument. Fluid responsiveness was defined as a stroke volume index ≥10% increase after volume expansion. Half (50%) of the 52 patients responded positively. The areas under the receiver operating characteristic curves measured to predict fluid responsiveness for the corrected carotid flow time and changes in the FTc were 0.82 [95% confidence interval:0.705–0.937; P &lt; 0.0001] and 0.67 (95% confidence interval:0.520–0.815; P &lt; 0.05), respectively. The optimal cut-off value for the FTc and the change in FTc were 356.5 ms and 19.5 ms, respectively. FTc is a more reliable predictor of fluid responsiveness than FTc induced by volume expansion in gynecological patients undergoing robot-assisted laparoscopic surgery in the modified head-down lithotomy position.