Background: Physiological changes of blood amino acids and acylcarnitines during healthy child development are not well studied. The LIFE Child study offers a platform with a large cohort of healthy children to investigate these dynamics. We aimed to assess the intra-person variability of these blood metabolites and associations with anthropometric parameters related to excess body fat and IGF1 serum levels. Methods: Concentrations of 23 amino acids, 5 acylcarnitines and free carnitine of 2213 children aged between 3 months and 19 years were analyzed using liquid chromatography/tandem mass spectrometry. Standard deviation score values were used to account for physiological sex- and age-related differences. The stability of metabolites was assessed through the coefficient of determination. Associations with parameters for body composition and IGF1 serum levels were determined by Pearson correlation and linear regression. Results: Our research reveals substantial fluctuations in metabolite concentrations in the same person during childhood and adolescence. Most metabolites had a positive correlation with parameters of body composition with notable influence of sex, pubertal status and weight group specific differences. Glycine exhibited negative associations with parameters of body fat distribution especially in normal weight girls, overweight/obese boys and during puberty. Conclusions: The observed alterations in metabolite concentrations contribute to our knowledge on the complex interplay between blood amino acid and acylcarnitine levels and metabolic health in children and adolescents.

Wild-caught shrimp and prawns are the single most numerous group of animals directly killed for human food consumption on the planet. Recent scientific developments have led to greater understanding of the probability that at least some species of shrimp are sentient beings and, should that be the case, policies that could improve shrimp welfare. We begin with an overview of global shrimp fisheries and their characteristics. The world's shrimp fisheries can be understood as a spectrum between large, industrial trawlers in developed and developing countries (e.g. Western Europe, the Americas, Russia) and small-scale fisheries for subsistence in developing countries (e.g. South-East Asia, East Africa). Each has different implications for animal welfare, particularly in light of human wellbeing challenges associated with shrimp fisheries. Secondly, we turn to the emerging science of shrimp welfare and examine recent developments in government and industry policy. In large-scale trawl fisheries, animal welfare can be improved by installing electrical stunning equipment; continuing existing work on bycatch reduction; and optimising on-board processes to reduce the stress endured by shrimp during capture and slaughter. In small-scale fisheries, improving government capacity and supply chain practices may bring benefits for communities in the short-term while opening up opportunities for more specific shrimp welfare policies in the long-term. Thirdly, we provide a new dataset of the estimated numbers of individual shrimp caught by country and species. Drawing on this data, we provide a description of the shrimp fishing industry in the world's top 25 countries by estimated catch of individual shrimp. By our estimates, the wild-catch shrimp industry catches 37.4 trillion individual shrimp (36.3 trillion sergestids, 781 billion carideans, and 287 billion penaeids). Finally, we explore the ethical implications of the probability that shrimp and prawns are capable of feeling pain and the welfare policies that could be adopted.

Objective: To analyze the clinical efficacy and safety of monotherapy and dual therapy in patients with early ischemic stroke. Methods: The study was conducted from August 2020 to August 2021, and 80 patients with early ischemic stroke who received treatment at our hospital during this period were selected as the study population. They were randomly divided into a control group and an observation group, with 40 patients in each group. The control group received conventional monotherapy, while the observation group received conventional dual therapy. The efficacy and safety indicators of the two groups were compared.Results: The treatment efficacy, functional recovery, blood indicators, and inflammation markers in the observation group were all superior to those in the control group (all, P<0.05); there was no significant difference in the drug safety profile between the two groups (P>0.05).Conclusion: The dual antiplatelet therapy is more ideal than monotherapy for treating patients with early ischemic stroke. It can further promote the recovery of neurological and cognitive function, improve hematological and inflammatory response indicators in patients, and the safety of this regimen is comparable to monotherapy.

The broad bean plant contains L-DOPA, a compound that is essential for patients with Parkin-son’s disease. However, little has been reported on other broad bean compounds that have bene-ficial effects on health. The objective was to evaluate plants of four Mexican broad bean varieties to determine the content and yield of total phenolic compounds (TPC), total flavonoids (TF), and L-DOPA, as well as to analyze the flavonoid profile and antioxidant (AA) and anti-inflammatory (AANTI) activity in vitro. Broad bean seeds were sown in the field and plants were harvested 20 days after emergence. The analyses were performed with visible UV spectrophotometry and HPLC. The variety José María produced the highest yield of TPC (9.30 g m-2), TF (8.08 g m-2) and L-DOPA (5.64 g m-2) per unit of area. The highest yields per plant were obtained with the Rojita variety: TPC (0.25 g plant-1), TF (0.21 g plant-1) and L-DOPA (0.17 g plant-1). This variety also had the highest antioxidant (CI50= 87.68 µg mL-¹) and anti-inflammatory (CI50= 74.40 mg mL-1) activi-ty, which was attributed to the L-DOPA compounds and to rutin and isoorientins, respectively. The flavonoid profile revealed the presence of rutin and isoorientins, which had not been previ-ously detected in the broad bean plant.

Autosselecionar a intensidade do treinamento aeróbico é uma perspectiva que permite aos praticantes desenvolver autonomia (escolha do ritmo), melhorar a aptidão física e alcançar a perda de peso. Comparar o efeito de quatro protocolos de treinamento aeróbico nas respostas cardiometabólicas e psicofisiológicas em homens e mulheres adultos fisicamente inativos. A amostra foi composta por 11 indivíduos com idade entre 56 ± 10 anos e IMC 29,2 ± 2,4 kg/m2 que realizaram quatro diferentes protocolos de treinamento aeróbio em esteira, sendo: 1-indivíduo com intensidade autosselecionada (ISS), 2-indivíduo com intensidade prescrita (IPI) (64-76% da FC máx), grupo 3 pequeno com autosseleção. intensidade selecionada (SGS) e intensidade prescrita em 4 pequenos grupos (SGP) (64-76% da FC máx). Foram analisados ​​frequência cardíaca, lactato, percepção subjetiva de esforço, resposta afetiva, escala de ativação, prazer, intenção de repetir a sessão, velocidade da esteira e distância total do protocolo. A análise estatística utilizou ANOVA com teste post hoc de Tukey (p<0,05). As análises de frequência cardíaca, lactato, percepção subjetiva de esforço, escala de ativação, prazer, velocidade média e distância total não apresentaram diferenças significativas entre os protocolos. A resposta afetiva apresentou menor declínio no protocolo ISS (p<0,05), e a intenção de repetir a sessão de treinamento foi maior no protocolo ISS (p<0,05). Conclusão: Os dados permitem concluir que o protocolo de treino ISS produziu resultados superiores na resposta afetiva e na intenção de repetir a sessão.

Alzheimer’s disease (AD) and vascular dementia (VaD) together contribute to almost 90% of all dementia cases leading to major health challenges of our time with a substantial global socioeconomic burden. While in Alzheimer’s disease, the improved understanding of Amyloid beta (Aß) mismetabolism and tau hyperphosphorylation as pathophysiological hallmarks has led to significant clinical breakthroughs, similar advances in VaD are lacking. We thus highlight here the importance of shared pathomechanisms found in AD and VaD: Endothelial damage, blood brain barrier (BBB) breakdown and hypoperfusion inducing oxidative stress, inflammation and demyelination and thus trophic uncoupling in the neurovascular unit. A dysfunctional endothelium and BBB lead to the accumulation of neurotoxic molecules and Aß through impaired clearance, which in turn leads to neurodegeneration. In this context we discuss possible neuropathological parameters, which might serve as biomarkers and thus improve diagnostic accuracy or reveal targets for novel therapeutic strategies for both forms of dementia.

Glycated hemoglobin (HbA1c) is used to assess glycemic control in Type 1 diabetes (DM1) patients. Apolipoproteins play an essential role in DM1 pathophysiology and may be associated with complications, as well as HbA1c. This cross-sectional observational study consisting of 81 children and adolescents of both sexes diagnosed with DM1 investigated the relationship between body fat distribution and lean mass with HbA1C and apolipoprotein values analyzing biochemical and body composition measurements. Shapiro-Wilk test with Lilliefors correction, non-parametric Mann-Whitney test, and others were used with a significance level of 5%. The sample had a diagnosis time of 4.32 years and high blood glucose levels (mean 178.19 mg/dL) and HbA1c (mean 8.57%). Subjects also had a moderate level of adiposity, as indicated by arm and thigh fat areas. The study also found significant differences in the distribution of patients concerning levels of apolipoproteins A and B, with a smaller proportion of patients having undesirable levels. Finally, the study found a significant difference in the distribution of patients with estimated cardiovascular risk based on the ApoB/ApoA-1 ratio. Conclusively, visceral fat in children and adolescents with DM1 may increase the risk of DM1 long-term complications owing to its association with elevated HbA1C and apolipoprotein values.

A prospective, observational, multicenter, and exploratory study was conducted in 469 gastrointestinal cancer patients undergoing elective surgery. The Malnutrition Universal Screening Tool (MUST) and the Global Leadership Initiative on Malnutrition (GLIM) criteria were used to assess nutritional risk. On admission, 17.9% and 21.1% of patients were at moderate (MUST score 1) and severe (MUST score ≥ 2) nutritional risk, respectively. GLIM criteria used in patients with MUST score ≥ 2 showed moderate malnutrition in 35.3% of patients and severe in 64.6%. Forty-seven percent of patients with MUST score ≥ 2 on admission had the same score at discharge, and 20.7% with MUST score 0 had moderate/severe risk at discharge. Small bowel, esophageal and gastric cancer, and diabetes were predictors of malnutrition on admission. Complications were significantly higher among patients with MUST score 1 or ≥ 2 either on admission (p = 0.001) or at discharge (p &lt; 0.0001). In patients who received nutritional therapy (n = 231), 43% continued to have moderate/severe nutritional risk on discharge, and 54% of those with MUST ≥ 2 on admission maintained this score at discharge. In gastrointestinal cancer patients undergoing elective surgery, there is an urgent need for improving nutritional risk screening before and after surgery, as well as improving nutritional therapy during hospitalization

In the current study, we assessed the effects of conventional and Ultra High Dose Rate (UHDR) irradiation on behavioral and cognitive performance one month following exposure and assessed whether these effects were associated with alterations in the number of immune cells in the hippocampus using flow cytometry. Conventional- and UHDR-irradiated mice showed impaired novel object recognition. During fear learning, conventional- and UHDR-irradiated mice moved less during the inter-stimulus-interval (ISI) and UHDR-irradiated mice also moved less during the baseline period (prior to the first tone). In irradiated mice, reduced activity levels were also seen in the home cage; conventional- and UHDR-irradiated mice moved less during the light period and UHDR-irradiated mice moved less during the dark period. Following behavioral and cognitive testing, infiltrating immune cells in the hippocampus were analyzed by flow cytometry. The percent Ly6G+ CD45+ cells in the hippocampus was lower in conventional- and UHDR-irradiated than sham-irradiated mice, suggesting that neutrophils might be particularly sensitive to radiation. The percent of Ly6G+ CD45+ cells in the hippocampus was positively correlated with the time spent exploring the novel object in the object recognition test, suggesting that the reduced percent Ly6G+ CD45+ cells in the hippocampus might mediate some of the detrimental radiation-induced cognitive effects.

The Loropetalum chinense and Loropetalum chinense var. rubrum are typical and traditional ornamental and Chinese herbal medicine in Asia. However, more information is needed on the mechanisms underlying its flower coloring. Here, we profiled the flavonoid metabolome, full-length sequencing, and transcriptome analysis to investigate the flavonoid biosynthesis and global transcriptome changes among different petal coloring cultivars of L. chinense and L. chinense var. rubrum. The total anthocyanins and phenotypic of the petal were highly consistent with the petal color. Moreover, a total of 207 flavonoid components were identified. Of these, 12 flavonoid components were considered significantly different expression compounds among the four samples. Meanwhile, the first reference full-length transcriptome of L. chinense var. rubrum was being built, which had 171,783 high-quality non-redundant transcripts with correcting with next-generation sequencing (NGS). Among them, 52,851 transcripts were annotated in the seven database of NR, KOG, GO, NT, Pfam, Swiss-Port and KEGG. Combined with NGS analysis, the DETs involved in flavonoids and anthocyanins contributed greatest to the flower-coloring. Additionally, the different expressed of eight LcDFRs and four LcANS genes were positively correlated with flavonoid biosynthesis, and the four LcBZ1 and one Lc3Mat1 were positively correlated with the content of seven anthocyanins revealed by coupling with metabolomics and transcriptomics analysis. Together these results were used to mine candidate genes by analyzing flower coloring changes in a comprehensive metabolic and transcriptomic level in L. chinense and L. chinense var. rubrum.

Fanconi anemia (FA) patients display an exacerbated risk of oral squamous cell carcinoma (OSCC) and precursor lesions at young ages, mainly at the oral cavity. As patients have defects in DNA repair mechanisms, standard-of-care treatments to OSCC such as radiotherapy and chemotherapy give rise to severe toxicities. New methods for early diagnosis are urgently necessary to allow treatments in early disease stages and achieve better clinical outcomes. We have conducted a prospective, longitudinal study whereby liquid biopsies from sixteen lesion/tumor-free patients were analyzed for the presence of mutations in cancer genes. DNA from saliva and plasma were sequentially collected and deep-sequenced, and the clinical evolution followed during a median time of around 2 years. In 9/16 FA patients we detected mutations in cancer genes (mainly TP53) with molecular allele frequencies (MAF) down to 0.07 %. Importantly, all patients having mutations and clinical follow-up data after mutation detection (n=6) developed oral precursor lesions or OSCC. Lead-time between mutation detection and tumor diagnosis ranged from 23 to 630 days. Strikingly, FA patients without mutations display significantly lower risk of developing precursor lesions or OSCC. Therefore, our diagnostic approach could help to stratify FA patients into risk groups, which would allow closer surveillance for OSCC or precursor lesions.

Anxiety disorders are among the most common mental disorders worldwide, and often respond incompletely to existing treatments. Selenium, a micronutrient that is a component of several biologically active selenoproteins, is also involved in several aspects of brain functioning, and may exert antidepressant and anxiolytic effects through multiple pathways. The current paper is a scoping review of translational, observational and interventional evidence on the potential role of selenium and its compounds in the management of anxiety and related disorders. Evidence from animal models suggests that this approach may be promising. Though evidence from observational studies in humans is inconsistent and affected by several confounding factors, the available evidence from randomized controlled trials suggests that selenium supplementation may be beneficial in the management of certain anxiety-related conditions, such as anxiety in medically ill patients, prevention of anxiety following exposure to traumatic stress, and obsessive-compulsive disorder. This paper provides a critical evaluation of the existing evidence base, including unanswered questions that could serve as the focus of further research, and outlines the potential benefits and risks associated with the use of selenium in anxiety disorders.

Dirofilaria immitis infection is one of the most severe parasitic diseases of dogs. Prevention is achieved by the administration of drugs containing macrocyclic lactones (MLs). These products are very safe and highly effective, targeting the third and fourth larval stages (L3, L4) of the parasite. Until 2011, claims of ineffectiveness of MLs, reported as “Lack of Efficacy” (LOE), were generally attributed to owners’ non-compliance, or other reason for inadequate preventative coverage. There was solid argumentation that a resistance problem is not likely to occur because of i) the great extent of refugia, ii) the complexity of resistance development to MLs, and iii) the possible big number of genes involved in resistance selection. Nevertheless, today it is unequivocally proven that ML resistant D. immitis strains exist, at least in the Lower Mississippi region, USA. Accordingly, tools have been developed, to evaluate and confirm the susceptibility status of D. immitis strains. A simple, in-clinic, microfilariae suppression test, 14-28 days after ML administration, and a “decision tree” (algorithm), including compliance and preventatives’ purchase history, and testing gaps, may be applied for assessing any resistant nature of the parasite. On the molecular level, specific SNPs may be used as markers of ML resistance, offering a basis for validation of clinically suspected resistant strains. In Europe, no LOE/resistance claims have been reported so far, and the existing conditions (stray dogs, rich wildlife, majority of owned dogs not on preventive MLs treatment) do not favor selection pressure on the parasites. Considering the genetic basis of resistance and the epizootiological characteristics of D. immitis, ML resistance neither establishes easily nor spreads quickly, a fact confirmed by the current known dispersion of the problem, which is limited. Nevertheless, ML resistance may propagate from an initial geographical point, via animal and vector mobility, to other regions, while it can also emerge as an independent evolutionary process in a new area. For these reasons and considering the current chemoprophylaxis recommendations and increasing use of ML endectoparasiticides as a potential selection pressure, it is important to remain vigilant for timely detection of any ML LOE/resistance, in all continents where D. immitis is enzootic.

The Region of Arica and Parinacota is characterized as an agricultural region located in Atacama Desert at the extreme north of Chile. Its agriculture has allow developing the economy of pre- and post-Hispanic communities, which have been settled since colonial times at different locations in the region. This article is focused on how Aymara communities of Lluta Valley and Precordillera of Arica and Parinacota Region have been included as part of Chilean population, particularly, from social and economic point of view. Furthermore, a characterization of agronomic aspects of the main towns of this zone, and commercialization of agricultural and livestock is included. It must be considered that the evolution of this region would have an important impact in the safeguard on endemic flora and fauna so that it is imperative to protect the genetic heritage of local species and to promote new technologies which allow the production of commercial products from Arica and Parinacota Region.

We have investigated the antiferromagnetic phase transition in the frustrated and multiferroic hexagonal manganites $h$-(Y$_{0.98}$ Eu$_{0.02}$)MnO$_3$ (YEMO) and $h$-YMnO$_3$ (YMO). Elastic neutron scattering has been used to study in detail the phase transition in YMO and YEMO in zero pressure and in YMO at a hydrostatic pressure of 1.5~GPa. In zero pressure, we find the critical temperature $T_{\rm N} = 72.11(5)$~K and 71.3(1)~K and the critical exponent $\beta = 0.206(3)$ and 0.22(2), for YEMO and YMO, respectively. This is in agreement with earlier work by Roessli {\em et al.}. In applied hydrostatic pressure of 1.5~GPa, the ordering temperature increases to $T_{\rm N} = 75.2(5)$~K, in agreement with earlier reports, while $\beta$ is unchanged. Inelastic neutron scattering was used to determine the anisotropy spin wave gap at the phase transition, expected from spin wave theory to close with a critical exponent $\beta'$ identical to the one of the order parameter, $\beta' = \beta$. Our results indicate that the gap in YEMO indeed closes at $T_{\rm N}=72.4(3)$~K with $\beta' = 0.24(2)$, while the in-pressure gap in YMO closes at 75.2(5)~K with an exponent of $\beta' =0.19(3)$. In addition, the low-temperature anisotropy gap was found to have a slightly higher absolute value under pressure. The consistent values obtained for $\beta$ in the two systems support the likelihood of a new universality class for triangular, frustrated antiferromagnets.

A multi-tool analytical practice was used for characterization of 16^th century carpet manufactured in Cairo. Mild extraction method with hydrofluoric acid enabled isolation of intact flavonoids and their glycosides, anthraquinones, tannins and indigoids from fibre samples. High-performance liquid chromatography coupled to spectroscopic and mass spectrometric detectors was used for identification of natural dyes present in the historical samples. Weld, young fustic and brazilwood were identified as the dye sources in yellow thread samples. Red fibres have been colored with lac dye, whereas green fibre shades were obtained with indigo and weld. Tannin-containing plant material in combination with indigo and weld were used to obtain brown hue of thread. Four uncommon and thus-far unknown dye components were also found in the historical samples. These compounds probably represent unique fingerprint of dyed threads from this region. Scanning electron microscopy with energy-dispersive X-ray detector (SEM-EDS) and Fourier transformation infrared spectroscopy (FT-IR) were used for identification and characterization of substrates and mordants present in the historical carpet. Carbon and oxygen were detected in large quantities as a part of the wool protein. The presence of aluminum, iron and calcium indicated their usage as mordants. FT-IR analysis showed bands characteristic to woolen fibres and SEM micrographs definite structure of wool.

We conclude that Hbr not only favored growth, but also colonization with R. intraradices and consequently biomass production, and N and P content in plant tissue. The growth response and nutrient exchange suggest interdependence between brassinosteroids and the endomycorrhizal fungus.

In this study, the separation conditions of UHPLC-QTOF-MS and the extraction conditions of QuEChERS were optimized. The analytical process for determining Broflanilide residues in different soil types was successfully established and applied to its adsorption, desorption and leaching in soil. Broflanilide was extracted from soil with acetonitrile as extraction solvent, and purified with 50 mg PSA + 150 mg MgSO4. The modified UHPLC-QTOF-MS method was used for determination. In different types of soil, the average recovery of Broflanilide was 87.7% -94.38%, and the RSD was lower than 7.6%. In the analysis and determination of the adsorption, desorption and leaching properties in four soils, the RSD was less than 9.2%, showing good stability and can be applied to the analysis and determination of the residue of Broflanilide in different soils.

Introduction: Multiple sclerosis (MS) is a long-term inflammatory disease that affects the central nervous system due to an abnormal immune response. Hormonal and enzyme changes in these patients can influence the progression and prognosis of the disease. In this research, the levels of cortisol, adrenocorticotropic hormone (ACTH), melatonin, and lactate dehydrogenase (LDH) in the blood of MS patients were studied.Methods: This study involved 50 MS patients and 50 healthy individuals. The levels of ACTH, melatonin, and cortisol in the blood were measured using specific ELISA kits. The data obtained were then analyzed statistically using SPSS software.Results: The findings revealed a significant increase in the levels of cortisol and LDH in MS patients (P<0.05), while the levels of melatonin and ACTH showed a significant decrease (P<0.05). The elevated cortisol levels may be attributed to chronic stress and inflammation associated with MS. An increase in LDH levels can indicate tissue damage caused by myelin destruction. On the other hand, decreased melatonin levels may lead to sleep disturbances and increased stress in these patients, while decreased ACTH levels may be linked to disruptions in the hypothalamic-pituitary-adrenal (HPA) axis. Conclusion: The hormonal and enzyme changes observed in MS patients illustrate the wide-ranging impact of the disease on various body systems. The increase in cortisol and LDH as well as the decrease in melatonin and ACTH could serve as useful biomarkers for predicting disease progression and managing the condition. These findings align with previous studies and contribute to a deeper understanding of the pathological mechanisms of MS.

Several studies have shown that non-pharmacologic treatments such as photobiomodulation (PBMT) and swimming (SW) have been increasingly used as adjuncts to clinical practice. The aim of this work is to evaluate whether SW associated or not with PBMT has its effects potentialized on different kind of pain and motor aspects in a model of chronic constriction injury and if the treatments have any improvement on morphometry of the skeletal striated muscle. Our results have demonstrated a beneficial effect on pain and motor response for animals treated with the therapies isolated, and an even better response when we associate them. Regarding muscle tissue, we observed an improvement in inflammatory cells quantification and on the collagen expression on the muscle after each isolated treatment or in combination. These findings contribute to enhancing for individuals suffering from neuropathic pain conditions, offering a promising avenue for integrated care approaches that prioritize both symptom alleviation and functional recovery. Such insights are crucial for advancing treatment strategies in pain management since the currently available treatments are not completely effective to treat all the pain and also promotes several side effects on the patients’ health.

Background/Objectives: The disparities in internalizing and externalizing symptoms between individuals with versus without neurofibromatosis type 1 (NF1) are poorly understood, based on mixed evidence in the literature. The current meta-analysis aimed to synthesize existing findings on the topic and explore moderators of the group disparities. Method: Electronic databases were searched from inception to March 26th 2024, which identified 59 eligible studies (N of NF1 = 3,182, mean ages 2.38 to 46.4 years). The primary outcome was differences in internalizing and externalizing symptoms between individuals with and without NF1. Data were analyzed using robust variance estimation and random-effects models. Results: Compared with unaffected controls, individuals with NF1 showed more severe depressive (k = 21; g = 0.43; 95% CI [0.21, 0.65]), anxiety (k = 24; g = 0.27; 95% CI [0.01, 0.54]), somatic (k = 27; g = 0.56; 95% CI [0.30, 0.83]), total internalizing (k = 75; g = 0.50; 95% CI [0.33, 0.67]), aggression (k = 33; g = 0.33; 95% CI [0.08, 0.58]), delinquency, (k = 37; g = 0.43; 95% CI [0.26, 0.60]), and total externalizing symptoms (k = 47; g = 0.24; 95% CI [0.13, 0.35]). Studies that included more participants with NF1 who had ADHD or a lower verbal IQ reported greater group disparities in total internalizing symptoms or aggression. Conclusions: Findings highlight the importance of including psychosocial needs in monitoring and treating NF1. Future research should identify predictors of internalizing and externalizing symptoms within the NF1 population to inform our knowledge and intervention development.

Stevia rebaudiana Bertoni, a perennial herb, has garnered significant attention for its diterpene glycosides, natural sweeteners approximately 250 to 300 times sweeter than sucrose. These glycosides, concentrated in the plant's leaves, not only serve as a low-calorie alternative to traditional sweeteners but also exhibit notable antimicrobial properties, making Stevia a promising candidate for both the food and pharmaceutical industries. In order to study the effect of mycorrhiza fungi on some growth characteristics of the stevia herb under inoculum conditions with Arbuscular mycorrhizal fungi(AMF)Arbuscular mycorrhizal fungi, a factorial experiment based on randomized complete block design with four replications was conducted at University of Mohaghegh Ardabili. The first factor was Imma & Angel and Novella nutrient solutions; the second was planting bed including leaf composts, vermicompost, and biolan (peat & perlite); and third factor involved inoculation with mycorrhiza (Glomus Musea). The control fungi indicated that the highest percentage of stevioside (16.45%) was related to vermicompost planting bed under conditions of invocation with mycorrhizal in harvest for the Imma and Angel nutrient solution. The maximum percentage of Rebaudioside A (7.57%) was related to vermicompost planting bed under conditions of invocation with mycorrhizal in harvest for the Novella nutrient solution. Further, the greatest levels of Rebaudioside C were obtained under the same conditions, with the difference that in the case of this glycoside, the leaf composts planting bed showed a higher percentage. Then, the highest leaf fresh weight, leaf dry weight, and number of main branches were obtained for the Novella nutrient solution in vermicompost planting bed under inoculation with mycorrhiza. Finally, Mycorrhizal inoculation in vermicompost beds with the Novella nutrient solution resulted in the greatest plant height. Conversely, the Imma & Angel nutrient solution in leaf compost beds, when combined with mycorrhizal inoculation, produced the tallest plants. The positive impact of AMF on plant growth was evident in the quantitative and qualitative improvements observed across various measured parameters.

Research in renewable energy sources and micro-grid systems is critical for the evolving power industry. Micro-grids can supply diverse loads while reducing dependency on the utility grid. This paper models both pico-grids and nano-grids in the Singapore Institute of Technology Punggol campus, incorporating solar PV, energy storage systems (ESS), power electronics converters, and both DC and AC loads, along with utility grid connections. The pico-grid includes a battery storage system, a single-phase inverter linked to a single-phase grid, and DC and AC loads. The nano-grid comprises solar PV panels, a boost converter, a battery storage system, a three-phase inverter connected to a three-phase grid, and AC loads. Both the pico-grid and nano-grid are configurable in standalone or grid-connected modes. This configuration flexibility allows for detailed operational analysis under various conditions. The study conducts subsystem-level modeling before integrating all components into the simulation environment. MATLAB/Simulink is utilized to model, simulate, and analyze the power flow in both the pico-grid and nano-grid under different operating conditions.

Children and adolescents (C&A) with congenital heart defects (CHD) have decreased functional capacity and executive functioning (EF) due to brain abnormalities and decreased oxygen saturation. Exercise may improve EF via increased cognitive demands and cerebral blood supply. The purpose of this review was to identify current evidence describing the impact of physical activity (PA) interventions on EF in C&A with CHD. The following databases were searched from 2014-present: MEDLINE, EMBASE, CINAHL, Scopus, CENTRAL, and PsycInfo. Article inclusion criteria consisted of participants from birth to 18 years with CHD, interventions related to PA, and EF as an outcome. Articles were excluded if: adults were included, translation to English was impossible, and full access was unavailable. As a result of the review, 431 studies were screened. Three articles underwent full analyzation and only one met all criteria and this study found that with exercise there were significant improvements on self-reported cognitive functioning and parent-reported social functioning. Despite theoretical benefits, only one published study has investigated the role that PA interventions have on EF in C&A with CHD. Further investigation of the effect PA interventions have on EF in C&A with CHD is needed.

Background: Excessive sun exposure is a significant risk factor for various skin conditions, including sunburn, premature aging, and skin cancer. This study aims to assess the awareness, attitudes, and practices regarding sun exposure and sunscreen use among college students in Saudi Arabia. Methodology: A cross-sectional study was conducted with 388 college students from various disciplines. Data were collected using a structured questionnaire covering demographic information, knowledge, and practices related to sun exposure and sunscreen use. Descriptive statistics, chi-square tests, and multivariate logistic regression analysis were employed to analyze the data. Results: The study comprised 53.9% females, with the majority aged 18-23 years. Formal education on sun exposure dangers was lacking for 43.0% of participants. The most recognized consequences of excessive sun exposure were sunburn (80.6%) and skin cancer (74.4%). Intermediate knowledge of sun exposure effects was most common (40.7%). Sunscreen use was inconsistent, with 27.3% never using it during peak sunlight hours. Factors influencing sunscreen use included weather conditions and healthcare provider recommendations. Males were significantly less likely to use sunscreen. First-year students and participants without formal education on sun exposure were less likely to use sunscreen regularly. Conclusion: Despite awareness of the risks associated with excessive sun exposure, sunscreen use among college students in Saudi Arabia is inconsistent and influenced by various factors, including gender and education level. These findings highlight the need for enhanced educational initiatives to promote regular sunscreen use and other sun protection behaviors to mitigate the risk of skin conditions associated with sun exposure.

This small article examines the pivotal roles of redundant and degenerate neural networks in the brain across three critical dimensions: evolutionary development, early childhood neural formation, and their implications in neurological diseases. Redundant networks, characterized by parallel neural pathways with similar functions, provide a foundation for cognitive resilience, ensuring continuity of brain functions despite damage or developmental anomalies. Degenerate networks, comprising structurally varied but functionally equivalent pathways, contribute to cognitive flexibility and adaptability, essential for innovative problem-solving and learning. From an evolutionary perspective, these networks have been instrumental in the brain's adaptation to diverse environmental challenges, facilitating cognitive maximization and the development of complex behaviors. The genetic underpinnings and environmental influences that shaped these networks are explored, highlighting their contribution to the evolutionary success of the human species. In the realm of early childhood development, the formation and reinforcement of these networks are crucial. The brain's plasticity during this period leads to the establishment of robust redundant networks and versatile degenerate networks, shaped significantly by environmental stimuli and learning experiences. This developmental phase lays the groundwork for cognitive abilities and resilience to neurological challenges later in life. Furthermore, the paper delves into the implications of these networks in the context of brain diseases. The disruption of the equilibrium between redundancy and degeneracy is linked to various neurological conditions, including Alzheimer's disease, Parkinson's disease, multiple sclerosis, stroke and Huntington's disease. Understanding the roles and balances of these networks offers insights into the pathophysiology of these diseases and potential therapeutic approaches. This review underscores the significance of redundant and degenerate neural networks in the evolutionary context, their critical formation during early childhood, and their profound impact on brain health and disease. It highlights the need for further research into these networks to enhance our understanding of brain function and to develop targeted interventions for neurological disorders.

Rates of involuntary childness are on the uprise which can bring high medical costs and emotional afflictions. This review explores the emerging roles of CoQ10 - including the ubiquinol form in fertility. PubMed, Science Direct and Google Scholar were searched for RCTs, retrospective or prospective controlled studies published between January 1, 2009, and April 31, 2024. The keywords CoQ10, ubiquinol, fer/sub/infertility, ovarian reserve, oocyte quality, ovulation, amenorrhea, polycystic ovary syndrome, sperm quality, seminal fluid, and IVF were used. A total of 15 publications were identified. From a mechanistic stance CoQ10 appears to improve mitochondrial energetics, attenuate oxidative stress and modifications to DNA, proteins, and lipids. Such mechanisms appear to underpin improvements in oocyte quality/fertilization, markers of sperm quality and more broadly PCOS symptoms and hormone levels which can impact on fertility. The role of the ubiquinol form looks particularly promising, which may be attributed to its bioavailability. Ongoing research is needed but there is scope to raise CoQ10 awareness amongst reproductive health experts.

Previous studies on the water-energy nexus mainly focused on the calculation and comparison of resource consumption at the national or regional level, lacking interprovincial sector-sector transfer analysis. In this study, the intensity of water and energy consumption of various sectors in China were calculated, the key nodes and paths of resource networks were identified, and countermeasures for resource conservation were proposed from the new perspective of the “dual saving” and “bidirectional saving” of water and energy. The results showed that the metallurgical industry (Me) in Jiangsu and the chemical industry (Ch) in Hebei and Jiangsu had high node strength in the water and energy network and were key sectors in China with “dual saving” effects of water and energy. The construction industry, Ch, Me in Jiangsu, electricity and hot water production and supply industry in Beijing, and Me in Hebei had high node strength in the water-related energy network and energy-related water network, significantly supporting the “bidirectional saving” effect of water and energy in China. The electrical equipment industry (El) in Jiangsu→El in Zhejiang, El in Zhejiang→El in Shanghai frequently appeared in key paths, which could effectively reduce the resource consumption of the entire network.

53% of adults in the US acknowledge racial bias as a significant issue, 23% of Asian adults experience cultural and ethnic bias, and more than 60% conceal their cultural heritage after racial abuse. AI models like ChatGPT and Google Bard, trained on historically biased data, inadvertently amplify racial and ethnic bias and stereotypes. This paper addresses the issue of racial bias in AI models using scientific, evidence-based analysis and auditing processes to identify biased responses from AI models and develop a mitigation tool. The methodology involves creating a comprehensive database of racially biased questions, terms, and phrases from thousands of legal cases, Wikipedia, and surveys, and then testing them on AI Models and analyzing the responses through sentiment analysis and human evaluation, and eventually creation of an 'AI-BiasAudit,' tool having a racial-ethnic database for social science researchers and AI developers to identify and prevent racial bias in AI models.

This study explores the impact of multi-user interaction, group work, and simulations within virtual worlds on language learning and the development of intergroup empathy. Two distinct research projects were conducted, involving a total of 241 participants aged 19-45. The language learning study engaged 116 participants in diverse interactive experiences, while the intercultural study had 125 participants collaborating in multicultural groups and participating in perspective-taking simulations. Both studies employed qualitative data collection methods, including surveys, interviews, and observations. The findings suggest that the combination of networking strategies, collaborative learning, and simulations within virtual worlds contributes to improvements in learners' language proficiency, confidence, and empathy towards diverse social groups. Participants reported increased motivation and engagement, attributed to the immersive and interactive nature of the virtual environments. The studies highlight the importance of collaboration and reflection in facilitating language acquisition and intercultural understanding. Technical challenges were identified as potential barriers to implementation. The results demonstrate the potential of virtual worlds to enhance language education and foster empathy in diverse societies, offering valuable insights for educators and researchers. However, the findings may be limited by the specific contexts and sample sizes of the studies, warranting further research to explore the generalizability and long-term impact of virtual world interventions. not exaggerate the main conclusions.

Growth monitoring of crops is a crucial aspect of precision agriculture, essential for optimal yield prediction and resource allocation. Traditional crop growth monitoring methods are labor-intensive and prone to errors. This study introduces an automated segmentation pipeline utilizing multi-date aerial images and ortho-mosaics to monitor the growth of cauliflower crops (Brassica Oleracea var. Botrytis) using an object-based image analysis approach. The methodology employs YOLOv8, Grounding Detection Transformer with Improved Denoising Anchor Boxes (DINO), and the Segment Anything Model (SAM) for automatic annotation and segmentation. The YOLOv8 model was trained using aerial image datasets, which then facilitated the training of the Grounded Segment Anything Model framework. This approach generated automatic annotations and segmentation masks, classifying crop rows for temporal monitoring and growth estimation. The study’s findings utilized a multi-modal monitoring approach to highlight the efficiency of this automated system in providing accurate crop growth analysis, promoting informed decision-making in crop management and sustainable agricultural practices. Results indicate consistent and comparable growth patterns between aerial images and ortho-mosaics, with significant periods of rapid expansion and minor fluctuations over time. The results also indicated a correlation between the both the time and method of observation which paves a future possibility of integration of such techniques aimed at increasing the accuracy in crop growth monitoring based on automatically derived temporal crop row segmentation masks.

Dual-energy CT (DECT) imaging has broadened the potential of CT imaging by offering multiple postprocessing datasets with a single acquisition at more than one energy level. DECT shows profound capabilities to improve diagnosis based on its superior material differentiation and its quantitative value. However, the potential of dual energy imaging remains relatively untapped, possibly due to its intricate workflow and intrinsic technical limitations of DECT. Knowing the clinical advantages of dual-energy imaging and recognizing its limitations and pitfalls is neces-sary for an appropriate clinical use. The aims of this paper are to review physical and technical basis of DECT acquisition and analysis, to discuss advantages and limitations of DECT in dif-ferent clinical scenarios, to review technical constraints in material labeling and quantification, and to evaluate cutting-edge applications of DECT imaging, including artificial intelligence, qualitative and quantitative imaging biomarkers, and DECT-derived radiomics and radioge-nomics

Spatial and temporal variation of the free electron concentration in the ionosphere affects SAR interferograms, in particular at low radar frequencies. In this work the identification, estimation and compensation of ionospheric path delay phases in PALSAR-3 and NISAR-L interferograms is discussed. Both these L-band sensors acquire simultaneously SAR data in a main spectral band and in an additional, spectrally separated, narrower second band to support the mitigation of ionospheric path delays. The methods presented permit separating the dispersive and the non-dispersive phase terms based on the double-difference interferogram between the two available spectral bands and the differential interferogram of the main band. The applicability of the proposed methods is demonstrated using PALSAR-3-like data that was simulated based on PALSAR-2 SM1 mode data.

The integration of artificial intelligence (AI) into academic settings in Sabah, Malaysia, is transforming education and research landscapes. While AI technologies promise to enhance teaching, learning, and scholarly activities, they also pose challenges such as ethical concerns and skill gaps among academic staff. This study addresses the multifaceted impacts of AI adoption on academicians in Sabah, focusing on two key research questions: the impact of AI-based intelligent tutoring systems on student engagement, learning outcomes, and educational equity, and the challenges and opportunities in building academicians' capacity to integrate AI technologies effectively. Through a multidisciplinary approach, incorporating insights from education, computer science, social sciences, and ethics, this research aims to evaluate the effectiveness of AI tools in educational settings and identify strategies for skill development and infrastructure support. The study recommends empirical assessments within Sabah's educational institutions, considering contextual factors and fostering collaborative partnerships with local communities. Professional development programs, collaboration with industry partners, and improved access to AI infrastructure are proposed strategies. Longitudinal studies and interdisciplinary research initiatives are suggested for future research, along with qualitative methods to capture diverse perspectives. Ultimately, by embracing a collaborative and multidisciplinary approach, Sabah's academic community can harness the transformative potential of AI to advance education, research, and scholarship while promoting ethical and inclusive practices.

The spatial segregation is a characteristic of Latin American cities, resulting in distinct dynamics of social inclusion and exclusion at both spatial and identity levels. Then, specific green spaces may convert into appreciated and contested territories, where various actors negotiate their uses and regulations. Considering a case-study in a green icon of the metropolitan city of Santiago de Chile, the main objective of the present study was to describe and comprehend the uses and meanings of the Quebrada Macul park among different social groups over the past two decades. We employed qualitative methods including six in-depth interviews with key informants (social and ecological leaders, historical neighbors, and park workers), five participant observations in the park, and statistical analysis of visitors. Results reveal that (1) the transition of being a popularly used hill to a metropolitan park rises tensions between public and private statuses of place; (2) conflicts emerge regarding who uses the space and how, reflecting power dynamics among different social groups; (3) the park, beyond being a public space, holds significant identity value for its historical residents, both for those who fought for its recovery and those who have lived closely, so processes of forgetfulness might be resentful. We conclude on enduring meanings of the park associated with the struggle for the place among different groups, highlighting the role of memory for the social integration of groups among natural spaces.

Recent interest in preventing the development of osteoporosis has focused on the regulation of redox homeostasis. However, the action of lycopene (LYC), a strong natural antioxidant com-pound, on osteoporotic bone loss remains largely unknown. Here, we show that the administra-tion of LYC to OVX rats reduces body weight gain, improves lipid metabolism and preserves bone quality. In addition, LYC treatment inhibits ROS overgeneration in serum and bone marrow in OVX rats, and in BMSCs upon H2O2 stimulation, leading to inhibiting adipogenesis and pro-moting osteogenesis during bone remodeling. Mechanically, LYC may improve bone quality via an increase in the expressions of FoxO1 and Runx2, and a decrease in the expressions of PPARγ and C/EBPα in OVX rats and BMSCs. Collectively, these findings suggest that LYC attenuates osteoporotic bone loss through promoting osteogenesis and inhibiting adipogenesis via regula-tion of the FoxO1/PPARγ pathway driven by oxidative stress, presenting a novel strategy for os-teoporosis management.

Study of alterations in Osteoarthritis (OA) of Glypicans 1 to 6 (GPCs) and Notum in plasma, bone marrow mesenchymal stromal cells (BM-MSCs) and osteoblasts. Plasma levels of GPCs and Notum were measured of 25 patients and 24 healthy subjects. In addition, BM-MSCs from eight OA patients and eight healthy donors were cultured during 21 days with culture me-dium and osteogenic medium. Protein and gene expression levels of GPCs and Notum were de-termined by ELISA and qPCR at 0, 7 ,14 and 21 days. GPC5 and Notum have been found de-creased in OA patients’ plasma. OA BM-MSCs showed downexpression of GPC6 and upregula-tion of Notum. A decrease in GPC5 and Notum proteins and an increase in GPC3 were found. During osteogenic differentiation, elevated GPC2, 4, 5, 6 and Notum mRNA levels and decreased GPC3 were observed in OA. Furthermore, the protein levels of GPC2, GPC5 and Notum de-creased and GPC3 increased. Glypicans and Notum are altered in BM-MSCs and during osteo-genic differentiation from patients with OA. Furthermore, GPC5 and Notum can be proposed as new biomarkers of the pathology. The alterations found indicate that Notum could be a prom-ising therapeutic strategy for Osteoarthritis.

In many countries, increasing concern for animal welfare is driving retailer commitments and government legislation that aim to improve the lives of farmed fish. One aspect of fish welfare involves stunning fish prior to slaughter. The feasibility of stunning depends on the species of fish and physical farm characteristics. In this article, we provide an overview of stunning before slaughter in European sea bass and sea bream aquaculture, one of the largest finfish farming industries in the developed world that does not yet stun most of its production. Sea bass and sea bream stunning necessitates the use of electrical stunning equipment aboard harvest vessels, often a significant distance from the shoreline; this presents an interesting engineering and policy challenge. Together, Türkiye, Greece, Spain, and Italy produced over 400,000 t of sea bass and sea bream in 2020. In Türkiye and Greece, farms are numerous and located very close to the shoreline. In Spain and Italy, farms are few and located far from the shoreline. The highest average production is found in farms from Türkiye (1,000 t) and Spain (1,300 t, and lower average production is found in Greece (300 t) and Italy (350 t). Producer progress towards the installation of electrical stunning appears comparatively well-developed for Türkiye, Spain, and Greece, though we emphasise that producers and other stakeholders require continued support to realise this opportunity. Producers in Italy appear slower to make progress on this aspect of animal welfare and may require additional support.

In this review, we covered the recent advances in synthesis of gold nanoparticles and their uses in degradation of dyes. This study provides framework to develop a low cost, ecofriendly and highly efficient synthesis of gold nanoparticles. These synthetic methods do not produce any toxic byproduct. The present study is focus on removal of dyes by Au-NPs because gold nanoparticles act as good absorbent for dyes in short time. Synthesis of Au-NPs from plant extract e.g. marine alga, Scutellarin Barbata, A.nigra, Fruit peels, Bacillus marisflavi from raw silk cocoons, amylopectin and poly acrylic acid, L.asparagine, Grephene oxide, IPEI coated Au-NPs. The synthesizes Au-NPs were used further for removal of dyes like methylene blue (MB), Rhodamine B (RB) Degradation, methylene orange, acid red degradation, Congo red.

The soybean yield per unit area and soybean acreage are increased to boost overall soybean production as two effective solutions. There is a large area of saline soils in northeast China, where if soybeans could be grown with the help of isolated saline-tolerant rhizobia, the cultivation area of soybeans in China can be effectively expanded. Several rhizobia with different salt-, acid- and alkali-resistant characteristics were obtained in this research by isolating, identifying, and analyzing the nitrogen-fixing activities of indigenous rhizobia from different soybean planting soils, and further analyzed the host compliance between rhizobia and different soybean germplasm concerning 30 representative germplasm resources in the northeast region. Collectively, the results of the resistance study of HLNEAU2 isolated from the Shaanxi region are great references for guiding the application of rhizobia on soybeans.

In our country, the aging society is rapidly progressing, with an increase in patients with chronic kidney disease (CKD) and those undergoing dialysis, coupled with the aging of the population. As a result, the number of individuals with cognitive impairment (CI) is rising, and addressing this issue has become an urgent problem. One characteristic of dementia in CKD patients is the high frequency of vascular dementia, making the prevention through the management of classical risk factors such as hypertension, diabetes mellitus, dyslipidemia, smoking, etc., associated with atherosclerosis and arteriosclerosis. Other effective measures, including the use of renin-angiotensin system inhibitors, addressing anemia, exercise therapy, and lifestyle improvements, have been reported. Incidence and progression of CI may also be influenced by the type of dialysis or kidney replacement therapy, with reports suggesting that long-duration dialysis, low-temperature hemodialysis, peritoneal dialysis, and kidney transplantation (KTx) can have a possible preferable effect on preserving cognitive function.

Background: Children's environmental health encompasses a wide range of factors that impact the well-being of children, including physical, chemical, biological, and social elements in their immediate environment. Safeguarding children from harmful substances is the crucial role of nursing students. Nursing students play a vital role as valuable resources for individuals, families, communities, and policymakers. This study aims to assess the knowledge and skills of nursing students concerning children's environmental health at academic institutions delivering nursing program in Nekemte town, Ethiopia. Methods: An institutional-based cross-sectional study design was carried out from August 1–30, 2023, among nursing students in Nekemte Town, and 634 study participants were selected through simple random sampling. Data was entered into Epinfo version 6.4 and exported to STATA version 14 for analysis, and multicollinearity was checked. Finally, from the bivariate analysis, variables of < 0.2 were included in the multivariate analysis; an adjusted odd ratio with a 95% CI was computed; and variables with a P-value <0.05 in the multivariable analysis were taken as significant associated factors. Results: The overall nursing students' level of knowledge about children's environmental health was insufficient (56%). More than one-third (34%) demonstrate their skill towards children's environmental health insufficiently, and one-fourth (25%) and 27% of the learners conduct their craft to prevent children from ecological hazards to a good and better level, respectively. While gender of the participant, age of the participant, year of the study, training history of the participants, and field of study of the students were significantly associated variables with their knowledge of children's environmental health. Conclusion: The study reveals that nursing students' knowledge of children's environmental health is limited, with factors such as gender, age, training history, and field of study significantly influencing their understanding. Therefore, female students should be considered for more tutorials to be effectively knowledgeable regarding children’s environmental health.

Special machinery engineering is of great importance to the manufacturing industry and makes a comparatively large contribution to many economies. Digital transformation is already well advanced in many producing industries, and modern ICT technologies such as agents, service orientation, digital twins and artificial intelligence are being used with increasing success. In addition to improving specific product characteristics such as reliability or flexibility, the adoption of modern ICT technologies to ensure sustainability is being intensively discussed. So far, however, there has been little uptake of these technologies in the special machinery industry; sustainability receives little attention. This article examines in detail the reasons for and impediments to the adoption of modern ICT technologies based on a study among special machinery manufacturers. Observations of existing challenges were gathered during daily work, described in detail, and used to derive conclusions about causal barriers. From this, detailed requirements are derived to promote the adoption of modern ICT technologies in the special machinery engineering sector and, ultimately, to bring sustainability more into focus.

Due to urban sprawls, the arable land is shifting in the settlement areas and towns, while industrial development is making it more vulnerable. The current study was conducted to see the changes in land use and land cover in Kotri area, Pakistan from 1998 to 2020 to establish trends in recent land use development based on available land use data. In this regard, satellite images in the study area were acquired from USGS and processed using ArcMap 10.5 and Environmental for Visualizing Images (ENVI). Results show that; there was a change in the settlement pattern of Kotri city with 40% between 1998 and 2020, 77% decrease in Bare-land was observed in 2020. Natural vegetation in the study area has decreased significantly with 4.4 Sq/ km in 2020, surface water-bodies in 1998 were 1.3 sq/km and in 2020 there is 1.8 Sq/km indicating 32% increase in surface water bodies. It was further revealed that settlement in Kotri has increased due to its geographical location, nearness of the major city of Hyderabad, and the establishment of the industrial zone and educational city near Kotri. From the foregoing, the study concluded that Kotri City will have more changes in its land use and land cover as the expansion in the city is going on and on. It is therefore recommended that local government and provincial government should pay attention towards this development and put up an action plan towards proper provision for such expansion.

Cannabis, renowned for its historical medicinal use, harbours various bioactive compounds—cannabinoids, terpenes, and flavonoids. While major cannabinoids like THC and CBD have received extensive scrutiny for their pharmacological properties, emerging evidence underscores the collaborative interactions among these constituents, suggesting a collective therapeutic potential. This comprehensive review explores the intricate relationships and synergies between cannabinoids, terpenes, and flavonoids in cannabis. Cannabinoids, pivotal in cannabis's bioactivity, exhibit well-documented analgesic, anti-inflammatory, and neuroprotective effects. Terpenes, aromatic compounds imbuing distinct flavours, not only contribute to cannabis's sensory profile but also modulate cannabinoid effects through diverse molecular mechanisms. Flavonoids, another cannabis component, demonstrate anti-inflammatory, antioxidant, and neuroprotective properties, particularly relevant to neuroinflammation. The entourage hypothesis posits that combined cannabinoid, terpene, and flavonoid action yields synergistic or additive effects, surpassing individual compound efficacy. Recognizing the nuanced interactions is crucial for unravelling cannabis's complete therapeutic potential. Tailoring treatments based on the holistic composition of cannabis strains allows optimization of therapeutic outcomes while minimizing potential side effects. This review underscores the imperative to delve into the intricate roles of cannabinoids, terpenes, and flavonoids, offering promising prospects for innovative therapeutic interventions and advocating continued research to unlock cannabis's full therapeutic potential within the realm of natural plant-based medicine.

Alternaria alternata is a saprophyte and is also known to cause many opportunistic infections in humans. Alternaria infections are important factors of morbidity and mortality in im-mune-compromised and solid organ transplant (SOT). Sensitivity to the airborne fungus Alter-naria alternata is also believed to be a common cause of allergic asthma. Therapies are limited by the lack of knowledge about the role of individual fungal gene products and symptoms in im-mune-compromised and transplant patients. This review summarizes the published case studies on Alternaria alternata infections in transplant patients.

(1) Background: Emotion regulation is a critical determinant of adaptive functioning during adolescence, exerting profound influence on psychological well-being. This study seeks to deepen our understanding of the intricate interplay between emotion regulation and maladaptive psychological symptoms, examining these dynamics through a cross-countries comparison; (2) Methods: A total of 224 adolescents, aged 13 to 21 years, from both Iran and Belgium, participated in a cross-sectional comparative study. The study aimed to elucidate the relationship between emotion regulation and mental health functioning, assessing internalizing symptoms, externalizing symptoms, and self-injury. A demographic questionnaire, the Emotion Regulation Inventory, Strengths and Difficulties Questionnaire, and Self-Harm Inventory, were administered. Data analysis incorporated correlation assessments, Multivariate Analysis of Variance, and Structured Equation Modeling; (3) Results: The findings revealed a positive association between emotional dysregulation and psychological symptoms across the entire sample. Conversely, emotional suppression, more prevalent in Iran, showed no significant link with maladaptive symptoms but was associated with self-harm in the Belgian sample. Cultural disparities were evident, with internalizing problems more prevalent in Iran and externalizing issues more common in Belgium; (4) Conclusion: Emotional dysregulation emerged as a common factor compromising mental health. It emphasizes the necessity of considering cultural nuances when developing intervention and prevention programs and calls for further research in this field.

Emerging research has revealed a complex bidirectional interaction between the gut microbiome and cannabis. Preclinical studies have demonstrated that the gut microbiota can significantly influence the pharmacological effects of cannabinoids. One notable finding is the ability of the gut microbiota to metabolise cannabinoids, including Δ^9-tetrahydrocannabinol (THC). This metabolic transformation can alter the potency and duration of cannabinoid effects, potentially impacting their efficacy in cancer treatment. Additionally, the capacity of gut microbiota to activate cannabinoid receptors through the production of secondary bile acids underscores its role in directly influencing the pharmacological activity of cannabinoids. While the literature reveals promising avenues for leveraging the gut microbiome-cannabis axis in cancer therapy, several critical considerations must be accounted for. Firstly, the variability in gut microbiota composition among individuals presents a challenge in developing universal treatment strategies. The diversity in gut microbiota may lead to variations in cannabinoid metabolism and treatment responses, emphasising the need for personalised medicine approaches. The growing interest in understanding how the gut microbiome and cannabis may impact cancer has created a demand for up-to-date, comprehensive reviews to inform researchers and healthcare practitioners. This review provides a timely and invaluable resource by synthesizing the most recent research findings and spotlighting emerging trends. A thorough examination of the literature on the interplay between the gut microbiome and cannabis, specifically focusing on their potential implications for cancer, is presented in this review to devise innovative and effective therapeutic strategies for managing cancer.

In the southeastern coast of Brazil, the bays of Ilha Grande and Sepetiba are linked by the Ilha Grande Channel, where remarkably vigorous currents have been consistently observed. The sheer intensity of these currents defies a simple explanation through tidal forcing alone, prompting researchers to delve into potential influences such as basin resonance and the baroclinic effect. This study aims to elucidate the role of remote meteorological effects within this complex hydrodynamic system. A numerical approach with a coastal model nested within an ocean model was employed, enabling an in-depth examination of the intricate interplay between meteorological and tidal forcings. The study revealed a significant finding: the lag in signal propagation plays a pivotal role in determining how these signals impact the dynamics of the bays. The astronomical signal exhibits a minimal lag along the coast (1 minute), and leads to water level differences between the sea and the coastline, resulting in the generation of tidal currents at the bay entrances. On the other hand, the remote meteorological signal, with a stronger signal lag along the coast (4.92 hours), leads to the creation of water level difference between the bay’s entrances, inducing significant fluxes along the narrow Ilha Grande Channel.

Radiotheranostics refers to pairing of radioactive imaging biomarkers with radioactive therapeutic compounds that deliver ionizing radiation. Given the introduction of very promising radio-pharmaceuticals, the radiotheranostics approach is creating a novel paradigm in personalized, targeted radionuclide therapies (TRTs), also known as radiopharmaceuticals (RPTs). Radiother-apeutic pairs targeting somatostatin receptors (SSTR) and prostate-specific membrane antigens (PSMA) are increasingly used to diagnose and treat patients with metastatic neuroendocrine tumors (NETs) and prostate cancer. In parallel, radiomics and artificial intelligence (AI) as important areas in quantitative image analysis are paving the way for significantly enhanced workflows in diagnostic and theranostic fields, from data and image processing to clinical decision support, improving patient selection, personalized treatment strategies, response prediction, and prognostication. Furthermore, AI has the potential for tremendous effectiveness in patient dosimetry which copes with complex and time-consuming tasks in the RPT workflow. The present work provides a comprehensive overview of radiomics and AI application in radio-theranostics, focusing on pairs of SSTR- or PSMA‑targeting radioligands, describing the funda-mental concepts and specific imaging/treatment features. Our review includes ligands radio-labeled by 68Ga, 18F, 177Lu, 64Cu, 90Y, and 225Ac. Specifically, contributions by radiomics and AI towards improved image acquisition, reconstruction, treatment response, segmentation, restag-ing, lesion classification, dose prediction, and estimation as well as ongoing developments and future directions are discussed.

Background: Chronic post-surgical pain is a condition persisting at least three months after surgery. It is estimated that 25-60% of patients who underwent breast cancer removal surgery suffer from post-mastectomy pain syndrome and occurred anxiety, depression, sleep disturbance and catastrophizing. Physical activity can reduce the risk of chronic diseases and has a good impact on mood and cognitive function. Aim of this study was to evaluate the effects of physical activity on the intensity of pain, depression and anxiety in women underwent mastectomy for breast cancer removal. Methods: A prospective observational unicentric cohort study was performed. Patients were female underwent unilateral or bilateral mastectomy. Numerical Rating Scale (NRS), was used to assess pain intensity, Beck’s Depression Inventory (BDI) for depression and Generalized Anxiety Disorders-7 (GAD-7), for anxiety evaluation. Physical activity was assessed by International Physical activity questionnaire (IPAQ). Interleukin (IL)-17, IL-1β, cortisol, adrenocorticotropic hormone (ACTH) and brain-derived neurotrophic factor (BDNF) were also evaluated in the blood of patients. All the evaluation was assessed 3 and 6 months after the surgery. Results: Adequate physical activity reduced intensity of pain, depression and anxiety symptoms in women affected by post-mastectomy pain syndrome. Moreover, adequate active women, showed a reduction of biomarkers of inflammation, cortisol, ACTH and an increase of BDNF. Conclusions: Our results suggest that physical activity can improve quality of life, reducing intensity of pain, inflammatory markers and it can be useful in the reduction of associated anxiety and depression.

Circadian rhythm disruptions are a hallmark feature of mood disorders. Patients experiencing acute depressive episodes report noticeable changes in their sleep-wake cycles. This research explains the association between depression and various circadian rhythm metrics, explicitly focusing on adolescents diagnosed with depressive disorders. Adolescence is a critical period marked by significant physiological and psychological changes, making it imperative to understand how mood disorders manifest during this phase. However, there have been minimal specific studies in pediatric populations to determine whether circadian rhythm changes differ between adolescents with first- and multiple-recurrent depressive episodes. Our study involved a group of 61 adolescents aged between 13 and 18. We performed a cross-sectional study of a clinical popu-lation of patients presenting to a child and adolescent psychiatry clinic diagnosed with depression. Participants were asked to complete self-report evaluations using several tools: The Korean ver-sion of the Biological Rhythms Interview of Assessment in Neuropsychiatry (K-BRIAN), the Korean Translation of Composite Scale to Measure Morningness-Eveningness (KtCS), and the Seasonal Pattern Assessment Questionnaire (SPAQ). Tools such as the Children's Depression In-ventory (CDI), State-Trait Anxiety Inventory (STAI), and K-Mood Disorder Questionnaire (K-MDQ) were employed for the assessment of clinical characteristics of depression. Based on the frequency of their depressive episodes, participants were bifurcated into two distinct groups: those experi-encing their first episode (n=22, mean age: 15.09±1.44 years) and those with recurrent episodes (n=39, mean age: 15.95±1.26 years). At first, the two groups' data revealed no significant differences regarding mood or circadian rhythm metrics (CDI: first-episode 26.18±10.54 and recurrent episode 25.90±10.59, STAI-S: first-episode 56.91±12.12 and recurrent episode 57.49±11.93, STAI-T: first-episode 60.36±11.63 and recurrent episode 59.09±12.10, SPAQ-total: first-episode 6.59±4.86 and recurrent episode 6.77±5.23, KtCS: first-episode 30.32±5.83 and recurrent episode 28.13±7.36). However, we observed significant correlations between circadian rhythm disruptions and depression scales (CDI with SPAQ-weight (r=0.26), KtCS (r=-0.48), K-BRIAN-sleep (r=0.58), K-BRIAN-activity (r=0.64), K-BRIAN-social (r=0.71) and K-BRIAN-eating (r=0.40)). These correlations were especially pronounced in the recurrent episode group, suggesting that with the progression and chronicity of depression, the relationship between circadian rhythms and depression becomes more intertwined and evident. In conclusion, especially in adolescents, as the severity and chronicity of depression increase, the interplay between circadian rhythms and mood disorders becomes more pronounced, warranting further research and clinical attention.

This study assessed the impact of mineral fertilization on tuber yield and food quality of yam genotypes, specifically Dioscorea alata and Dioscorea rotundata. Four genotypes, each from D. alata and D. rotundata, were used in field experiments conducted in Ibadan, Nigeria, in the 2017 and 2018 cropping seasons. Experiments were conducted under low soil NPK fertility conditions with and without fertiliser treatments. A recommended NPK rate for the area (90, 50, and 75 Kg N, P, K ha-1) was applied to plots with fertiliser treatment. Tuber yield, functional and pasting properties of yam flour, and sensory attributes of pounded yams were collected. The results showed differential responses of the genotypes to tuber yield and food quality with fertiliser application. Fertiliser application has generally increased fresh tuber yield, but it has affected some genotypes' flour quality and textural attributes of the pounded yams. As regards genotypes Danacha and TDa0200012, fertiliser application has increased tuber yield without causing a decrease in tuber quality hence, suggesting Danacha and TDa0200012 as suitable genotypes for maximizing fertiliser productivity. However, in another genotype Ojuiyawo, fertiliser application effectively increased tuber yield but deteriorated tuber quality. Our results suggested that it is crucial to determine the impact of fertilisation on tuber yield and quality for each genotype and select the appropriate genotype to improve productivity through mineral fertilisation. The results of this study can be widely applied to enhance yam productivity in sub-Saharan Africa and useful for sustainable agriculture in yam-growing areas.

Rail, as the cleanest and greenest high-volume transport, has a central role in the decarbonizing, and it is expected to become the backbone of future mobility in the world. It is worthy to highlight that rail generates the lowest CO2 emissions and energy consumption in operation with respect to the other transportation modes but during construction and maintenance phases CO2 emission, energy consumption and other environmental impacts are significant and need to be carefully assessed and properly mitigated. This paper, based on an extensive literature review, provides a comprehensive framework of trends and challenge in railway sustainability. Attention is focused on track and related materials, maintenance strategies, and methods of assessment of the sustainability. Results show that improvement of materials and practices used in construction and appropriate strategies in maintenance, supported by effective monitoring of the state of the track, can reduce the negative effects on the environment and society and contributes to make this transportation mode greener. Proper methods for the assessment of the sustainability, (LCA, Circularity Index) help to quantify the potential of environmental enhancement of different solutions and constitute effective and indispensable tools in the decision-making process.

Introduction. This retrospective study aimed to compare the risk factors for vascular calcification (VC) between pre-hemodialysis (HD) and prevalent HD adult patients while investigating associations with calcification biomarkers. Methods. Baseline data from 30 pre-HD and 85 HD patients were analyzed, including iPTH, vitamin D, FGF23, fetuinA, sclerostin, and VC scores (Adragao method). Multivariable linear regression identified VC predictors. Results: The prevalence of VC was similar in both groups, but HD patients had more pronounced VC scores ≥6. Pre-HD patients were older, with higher prevalence of Balkan endemic nephropathy, hypertension, and less frequent use of calcium phosphate binders. Both groups exhibited similar patterns of hyperphosphatemia, low vitamin D, and iPTH levels. In HD group normal phosphate was significantly common in patients with VC, whereas hyperphosphatemia was significantly common in patients without VC. Fetuin-A levels were higher in pre-HD patients, while FGF23 was elevated in HD patients. In pre-HD patients, male gender was associated with reduced VC risk, while in HD patients, malignancies and serum phosphate levels were negative VC predictors. Conclusion: Effective monitoring and tailored treatment of VC in CKD are still focused on phosphate regulation. Besides, mineral disturbances, hormones and biomarkers regulation, and patient-specific variables need to be considered.

Abstract: This article explores the intricate relationship between environmental degradation, specifically air pollution, and economic growth in the Sultanate of Oman spanning the period from 1990 to 2022. We employ cointegration and vector error correction models to uncover both short- and long-term dynamics in the association between air pollution and economic growth. Fur-thermore, Granger causality analysis is utilized to investigate the causal links between these crucial variables. This data encompasses factors related to environmental quality and various control variables. The empirical results unveil a sustained long-term cointegration connection between the variables. Additionally, our findings highlight a statistically significant positive impact of economic growth and energy consumption on CO2 emissions. Furthermore, the short-term analysis reveals an annual adjustment of approximately 14.1% in N2O emissions dis-equilibrium. The Granger causality study indicates unidirectional causal relationships involving N2O emissions, economic growth, and CO2 emissions. The implications of these findings for Oman's policy landscape are substantial. To effectively reduce greenhouse gas emissions, it is imperative for Oman to establish robust climate change policies. Additionally, the government can play a pivotal role in encouraging and endorsing the use of renewable energy sources, such as green hydrogen, as a promising alternative to traditional oil and gas resources.

(Background) Phytotoxicity refers to the capacity of chemical substances or environmental factors to have a negative impact on plants. This is a crucial issue in both the context of crop cultivation and environmental protection. (Material and Methods) The research results were based on a 3-year field experiment conducted at the experimental station in Jadwisin (52°28′ N, 21°02′ E) on loamy soil. The experiment was set up using a randomized sub-block design in a split-split-plot arrangement, with three replications. The first-order factor consisted of potato cultivars, while the second-order factors were weed control methods: 1) Control – without protection; 2) mechanical weed control, extensive mechanical treatments to close rows; 3) Sencor 70 WG – pre-emergence (PRE) of potatoes; 4) Sencor 70 WG + Titus 25 WG + Trend 90 EC – PRE of potatoes; 5) Sencor 70 WG – post-emergence (POST) of potatoes; 6) Sencor 70 WG + Titus 25 WG + Trend 90 EC – POST of potatoes; 7) Sencor 70 WG + Fusilade Forte 150 EC – POST of potatoes; 8) Sencor 70 WG + Apyros 75 WG + Atpolan 80 SC – POST of potatoes. The phytotoxic effects of herbicides on potato plants and weeds were assessed every 7 days, starting from the date when the first signs of damage appeared, until they stabilized or disappeared. (Results:) Phytotoxic damage to potato and weed plants were caused by the chemical weed control methods used. The response of potato plants to herbicides was significantly related to the genetic traits of the cultivars and meteorological conditions in the years of research. (Conclusion:) Phytotoxicity is an important aspect in both agriculture and environmental protection. Research on its mechanisms and impact will enable the development of effective plant protection strategies and the preservation of ecosystem balance.

This academic paper explores the synergistic potential of Agroforestry systems and Climate-Smart Agriculture (CSA) in enhancing climate change adaptation strategies. Focusing on Australia and Pacific Island Countries, the study delves into the pivotal role of these approaches in mitigating the impacts of changing climate variables on agricultural production. By analysing important climate variables, their potential alterations, and their subsequent effects on crop production, the paper advocates for a holistic and forward-thinking approach to sustainable agriculture in the face of climate change.

The ribosome is a macromolecular complex composed of RNA and proteins that interact through an integrated and interconnected network to preserve its ancient core activities. In this review, we emphasize the pivotal role played by RNA-binding proteins as a driving force in the evolution of the current form of the ribosome, underscoring their importance in ensuring accurate protein synthesis. This category of proteins includes both ribosomal proteins and ribosome biogenesis factors. Impairment of their RNA-binding activity can also lead to ribosomopathies, a group of disorders characterized by defects in ribosome biogenesis that are detrimental to protein synthesis and cellular homeostasis. A comprehensive understanding of these intricate processes is essential for elucidating the mechanisms underlying the resulting diseases and advancing potential therapeutic interventions.

Demethyleneberberine is an active component extracted from the Chinese herbal drug Cortex Phellodendri. It is also a metabolite of the berberine in animals and humans. However, the pharmacokinetics, tissue distribution and excretion of demethyleneberberine have not been reported. The present study aimed to investigate the pharmacokinetic parameters of demethyleneberberine by developing a method of high-performance liquid chromatography-tandem mass spectrometry (LC-MS/MS). The detection was performed by using positive ion electrospray ionization in multiple reaction monitoring mode. The MS/MS ion transitions were monitored at m/z 324.4→308.3 for demethyleneberberine and 465.5→350.3 for IS. After oral administration of demethyleneberberine in rats and mice, the pharmacokinetics, tissue distribution, and excretion of desmethylberberine in rats and mice were comparatively studied for the first time. The plasma concentration of desmethylberberine reached its peak within 5 min after oral administration in both rats and mice. The bioavailability of rats and mice was comparable, ranging from 4.47% to 5.94%, higher than that of berberine. The total excretion of desmethylberberine in urine, feces and bile is 7.28~9.77%. These findings provide valuable insights into the pharmacological and clinical research on desmethylberberine.

This work demonstrates that microbial fuel cells (MFCs), optimized for energy recovery, can be used as an effective tool to detect the presence of antibiotics in water-based environments. MFCs directly convert chemical energy of organic matter in electrical energy thanks to electroactive biofilms. The efficiency of the conversion process can be significantly affected by the presence of contaminants acting as toxicants for the biofilm. In the present work, we demonstrate that MFCs can successfully detect the presence of antibiotic residues in water and water-based electrolytes associated to the food industry, especially using honey as a new and more complex electron donor. The effectiveness of MFCs to sense antibiotics is here demonstrated for tetracycline that was added to both water and water/honey electrolytes with a minimum concentration close to 3.5 μg⁄kg. MFCs not only efficiently detect the presence of tetracycline in both the electrolytes, but also recover the same performance after each cycle of exposure, showing to a be very robust and reliable technology for both biosensing and energy recovery.

Depression is a complex neuropsychiatric disorder characterized by pervasive feelings of sadness, hopelessness, and cognitive impairments that can profoundly impact an individual's quality of life. Despite extensive research efforts, the precise mechanisms underlying depression remain elusive. Recent studies have highlighted the intricate interplay between the immune system and the central nervous system in the pathophysiology of depression. In this context, CD4+ T cells, a key component of the adaptive immune system, have emerged as potential players in the neuroinflammatory processes associated with depression. Concurrently, Brain-Derived Neurotrophic Factor (BDNF), a multifunctional neurotrophin, has garnered significant attention for its roles in neural plasticity, mood regulation, and cognitive function. This review paper explores the intriguing intersection between CD4+ T cells and BDNF in the context of depression and delves into the exciting prospects it offers for therapeutic interventions. By examining the intricate crosstalk between the immune system and the neurotrophic factors, we aim to shed light on the potential avenues for novel therapeutic strategies in the treatment of depression.

Climate changes caused by anthropogenic actions can directly and indirectly affect living beings, including parasites and their hosts. Changes such as water temperature, pH, distribution of nutrients in the aquatic environment are some examples that can interfere with the fish community, whether in open water or in production systems. In this review, we will show how climate change can affect the adaptation of hosts and parasites in the aquatic environment and how these parasites can be used for environmental monitoring.

CO2, CH4 and CO are the most critical atmospheric gases in terms of their impact on the radiative system, air quality and health. This work provides information on the direction of source areas and potential sources of emissions and shows many aspects of these gases by a statistical analysis using bivariate polar diagrams and local weather conditions (e.g., temperature, wind speed and wind direction) recorded at the Lamto station (LTO, 6°31N and 5°02W) in Côte d’Ivoire over the 2014-2018 period. The results show that the main regions contributing to the high concentrations of CH4 (> 1925 ppb) and CO2 (> 420 ppm) in the GSS, GSP, PSS and PSP seasons are the North and Northwest sectors of Lamto. In these directions, CH4 and CO2 concentrations are associated with wind speeds less than 6 m.s-1, due to the influences of local sources as emissions resulting from the degradation of organic matter submerged during the impoundment of the Taabo dam, and/nor human activities linked to the practice of intensive agriculture. In addition, the high concentrations of CO (> 350 ppb) are observed in GSS in the North, North-West, North-East and East sectors for wind speeds less than or equal to 9 m.s-1, due to the influences of both local and distant sources. The correlation coefficients between CH4 and CO, and between CH4 and CO2 are positive and significant in all sectors. However, those calculated between CO2 and CO have showed both low and high values in all seasons.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Intra-abdominal pressure (IAP) elevation during capnoperitoneum can cause adverse cardiovascular and respiratory effects. This study aimed to determine if a sequentially increased IAP affects cardiovascular and respiratory variables in anesthetized dogs and evaluate the effects of constant rate infusion of dexmedetomidine (Dex) on cardiovascular and respiratory variables with increased IAP. Five dogs were anesthetized, instrumented, and the Veress needle was equipped to adjust the IAP using a carbonic anhydrase insufflator. Stabilization was conducted for 1 h, and physiological variables were measured in IAPs of 0, 5, 10, 15, and 20 mmHg and after desufflation. After the washout period, the dogs underwent similar procedures along with constant rate infusion of dexmedetomidine. Cardiovascular effects of increased IAP up to 20 mmHg were not significant in healthy beagle dogs and those administered with dexmedetomidine. In the control group, the arterial pressure slightly increased, but not statistically significant, at an IAP of 20 mmHg compared with that at baseline (mean arterial blood pressure, p = 0.399; systolic arterial blood pressure, p = 0.293; diastolic arterial blood pressure, p = 0.141). When comparing the control and dexmedetomidine groups, overall significant effects of dexmedetomidine were noted on heart rate, cardiac output, and systemic vascular resistance during the experiment. Respiratory effects were not affected by abdominal insufflation when compared between different IAPs and between the two groups. Overall, an increased IAP of until 20 mmHg did not significantly affect cardiovascular and respiratory variables in both control and dexmedetomidine groups. This study suggests that dexmedetomidine infusion administration is applicable in laparoscopic procedures in healthy dogs.

We have developed additive logistic models for the occurrence of lightning, large (≥ 2 cm), and very large (≥ 5 cm) hail to investigate the evolution of these hazards in the past, in the future, and for forecasting applications. The models, trained with lightning observations, hail reports, and predictors from atmospheric reanalysis, assign an hourly probability to any location and time on a 0.25° × 0.25° × 1-hourly grid as a function of reanalysis-derived predictor parameters, selected following an ingredients- based approach. The resulting hail models outperform the Significant Hail Parameter and the simulated climatological spatial distributions and annual cycles of lightning and hail are consistent with observations from storm report databases, radar, and lightning detection data. As a corollary result, CAPE released above the -10°C isotherm was found to be a more universally skilful predictor for large hail than CAPE. In the period 1950–2021, the models applied to the ERA5 reanalysis indicate significant increases of lightning and hail across most of Europe, primarily due to rising low-level moisture. The strongest modelled hail increases occur in northern Italy with increasing rapidity after 2010. Here, very large hail has become 3 times more likely than it was in the 1950s. Across North America trends are comparatively small, apart from isolated significant increases in the direct lee of the Rocky Mountains and across the Canadian Plains. In the southern Plains, a period of enhanced storm activity occurred in the 1980s and 1990s.

BMAP-27 peptide known to exert cytotoxic effects against cancer cells by membrane integrity disruption. In the current investigation, we aimed to study the role of the BMAP-27 peptide in reducing colon cancer cell proliferation and inducing apoptosis. This study utilized both primary and metastatic colon cancer cell lines (SW480 and SW620). Proliferation was measured using CCK-8, and cellular damage was analyzed by lactate dehydrogenase assay. The study assessed apoptosis, cell cycle, and proliferation by measuring the expression of CASPASE3, BAX, BCL-2, TP53, CDK-6, PCNA, Wnt11, AXIN1, and CTNNB1. Additionally, in-silico studies were conducted to determine the binding affinities of BMAP-27 with APC and β-catenin proteins. BMAP-27 peptide reduced colon cancer cell proliferation, upregulated CASPASE3, BAX, TP53, AXIN1 expression, and downregulated BCL-2, CDK-6, PCNA, WNT11, CTNNB1 in both colon cancer cell lines, however, demonstrated higher activity in primary than metastatic colon cancer cells. The molecular dynamic simulation revealed substantial binding affinity of the peptide to adenomatous polyposis coli and β-catenin proteins.BMAP-27 peptide effectively inhibited the proliferation and enhanced apoptosis in the primary than in metastatic colon cancer cells. In-silico findings suggest that BMAP-27 exhibits a strong binding affinity with APC and β-catenin, highlighting its potential role as an anti-colon cancer agent.

Papain-like lysosomal cysteine proteases include 11 human cysteine cathepsins which act as endopeptidases and/or exopeptidases. They are involved in numerous physiological and pathological processes. Among them, only cathepsins B, H, C, and X/Z exhibit exopeptidase activity. Their activities are tightly regulated in various ways to prevent potentially hazardous effects on the cell. In this review, we focus on the structural and functional aspects of these four cysteine cathepsins and their role in neurodegeneration and cancer. Neurodegenerative disorders of aging share an endolysosomal dysfunction and accumulation and spread of oligomeric forms of neurotoxic proteins. The accumulation of various protein aggregates activates the microglia, thus inducing the activation and release of cysteine cathepsins and proinflammatory cytokines, leading to neurodegeneration. In cancer, cysteine cathepsins participate in tumor progression and metastasis. Tumor–stromal crosstalk leads to activation of the stroma and overexpression and secretion of proteolytic enzymes, triggering extracellular matrix degradation and the release of soluble factors. Activated stromal cells (i.e., macrophages, fibroblasts, mast cells) secrete additional growth factors, cytokines, and chemokines that are responsible for the regulation of processes leading to tumor progression and metastasis. Therefore, a better understanding of the role of cysteine cathepsins in neurodegeneration and cancer could lead to novel targeted therapeutic approaches.

Diverse development models, including waterfall development, iterative development, and agile development, have been put forth and implemented across real-world contexts. When engaging in discussions on project management, the examination and exploration of development models assume paramount importance and are integral. This paper embarks upon an investigation and scrutiny of these development models, culminating in the proposition of "Quasi" Development Models: Quasi-Waterfall and Quasi-Agile.

A nation's vitality, dynamism and economic strength will always be related to its demographic component, and a healthy and vigorous population will ensure its long-term future. However, the current realities demonstrate the existence of an obvious population decrement at the level of the entire country particularly triggered by the birth rate decrease and the high demographic aging to which other factors add ap specific to local communities, which in their turn determined a particular type of demographic behaviour. Therefore we aim to analyze those elements with a major population dynamics impact such as family stability and demographic potential that can generate a specific demographic behaviour, as a result of the major changes that have occurred in the last period of time. These elements are translated through several demographic indicators that characterize the family, such as the nuptiality index and the divorce index whose evolution was registered and analyzed for the period 1992-2021. Their evolution indicates the demographic potential of Romania, as well as of Bihor county.

This qualitative study unveils the intricate interplay between blended learning, language and literature learning, internationalization, and the development of 21st century skills within the realm of higher education. Set against the backdrop of the environment of St. Michael's College in Iligan City, this exploration seeks to unravel the profound significance and transformative implications of these educational dimensions. By delving into the rich perspectives and experiences of 30 college students, this study addresses critical gaps in the literature and sheds light on the potential of these integrated elements. Guided by a robust theoretical framework that amalgamates renowned scholars' insights on blended learning, language acquisition, internationalization, and 21st century skills, the study employs a qualitative research design, employing interviews, observations, and document analysis. The findings illuminate the dynamic nature of blended learning, empowering students with enhanced engagement, flexibility, and accessibility in language and literature education. The incorporation of diverse literary texts and cultural perspectives fosters intercultural competence and global awareness. Moreover, the study underscores the cultivation of critical 21st century skills through immersive learning experiences. Drawing upon the insights gained, the study provides practical recommendations for educators and curriculum designers to harness the potential of blended learning, foster diversity in literary texts, and facilitate the application of 21st century skills. Recognizing the inherent limitations, including the specific context of St. Michael's College and the modest sample size, this study encourages future research to explore broader contexts and diverse participant cohorts. Overall, this illuminating study contributes to the scholarly discourse on integrating blended learning, language and literature learning, internationalization, and 21st century skills in college education. It beckons educators and policymakers to embark on a transformative journey, nurturing an enlightened future where students are equipped with the competencies to navigate the complexities of the 21st century.

In this paper, a distinction is first made between environmental, sustainable and green chemistry; the last two are then examined in relation to the more general problem of the environmental education. A brief historical digression on the STS (Science, Technology and Society) movement tries to dissect the reasons why chemistry is seen by the general public as a problem, not as a decisive resource for the realization of the ecological transition. Although sustainable and green chemistry can be decisive in overcoming the insularity of chemical disciplines in the high school, it fails to effectively embed itself in educational practices. Specific operational goals, supporting a real scientifical and technological literacy in sustainable and green chemistry, can help chemical educators. They are provided at the end of an examination of the founding axes of sustainable and green chemistry, according to the criteria of scientific and technological literacy.

Grain shape and chalkiness are important appearance quality traits of rice, which also affect the yield and milling quality. In this study, 190 F2 families derived from the cross between Hua 5178S and Hua 611 were sequenced to construct a genetic linkage map. Combined with F2 and F2:3 generations grain shape and chalkiness phenotype, a total of 15 QTL were detected. There are 8 grain shape QTL distributed on chromosomes 2, 5, 6, 8, and 10; 7 chalkiness QTL distributed on chromosomes 2, 3, and 6. A QTL cluster affecting multiple chalkiness traits was found on chromosome 6, qWBR6.1, qWCR6 and qCR6 were selected for genetic effect verification. It was found that qWBR6.1, qWCR6 and qCR6 explained 13% and 24%, and 29% of the phenotypic variations respectively, and qWCR6 and qCR6 were co-mapped. This study laid a foundation for further cloning of rice appearance quality genes.

In the depths of inquiry, where thoughts unfurl like tendrils of smoke, this qualitative study ventures into the enigmatic realms of diaspora, migration, and the elusive brain drain within the tapestry of the Philippines. It is a journey guided by a sturdy theoretical framework, traversing the multifaceted dimensions of society, culture, and psyche. Here, the lens expands beyond the confines of economics, delving into the essence of these phenomena, seeking profound insights that dance beneath the surface. Through meticulous analysis of empirical data, hidden truths emerge, illuminating the intricate dynamics of diaspora, the intricate patterns of migration, and the intricate threads that shape migration decisions. Moreover, it peers into the intricate tapestry of impacts that diaspora and migration have on both sending and receiving societies, casting a beam of understanding upon their social, economic, and cultural implications. The study, in its wisdom, extends its reach to offer valuable policy recommendations, serving as a compass for stakeholders and decision-makers. It emphasizes the pivotal importance of harnessing the vast potential held within diaspora, fostering social integration, and bridging the gaps in knowledge that lie in wait. In its entirety, this research harmonizes with the existing body of knowledge, blending seamlessly with the symphony of understanding, and ignites the path towards evidence-based strategies that pave the way for sustainable development and the well-being of societies near and far.

Since the global request for freight transportation is continuously increasing to face the requirements of the modern economy, 5G infrastructures and companion technologies are becoming essential to support the digital transformation in logistics and transportation, in particular for their capability to allow data collection through a multitude of different sources across the supply chain, improving the connectivity and making more effective the secure and reliable data sharing. The objective of this work is to assess the penetration and implementation levels of innovative technologies to optimize port operations, by interviewing a set of actors and stakeholders directly involved in the logistics chain of ports.

Smart Living, an increasingly prominent concept, entails incorporating sophisticated technologies in homes and urban environments to elevate the quality of life for citizens. A critical success factor for Smart Living services and applications, from energy management to healthcare and transportation, is the efficacy of human action recognition (HAR). HAR, rooted in computer vision, seeks to identify human actions and activities using visual data and various sensor modalities. This paper extensively reviews the literature on HAR in Smart Living services and applications, amalgamating key contributions and challenges while providing insights into future research directions. The review delves into the essential aspects of Smart Living, the state of the art in HAR, and the potential societal implications of this technology. Moreover, the paper meticulously examines the primary application sectors in Smart Living that stand to gain from HAR, such as smart homes, smart healthcare, and smart cities. By underscoring the significance of the four dimensions of Context Awareness, Data Availability, Personalization, and Privacy in HAR, this paper serves as a valuable resource for researchers and practitioners striving to advance Smart Living services and applications.

With the introduction of more and more monoclonal antibodies selectively targeting various mediators of the immune-system, together with Janus-Kinase (JAK)-inhibitors with variable affinities towards different JAK subtypes, the available therapeutic options for the treatment of inflammatory bowel diseases (IBD) have undergone an acceleration in the last five years. On the other hand, the prevalence of IBD patients over 65-years of age is steadily increasing and, with this, there is a large population of patients that presents more comorbidities, polypharmacy, and, more frequently, frailty compared to younger patients, exposing them to potentially major risks for adverse events deriving from newer therapies, e.g. infections, cardiovascular risks, and malignancies. Unfortunately, pivotal trials for the commercialization of new therapies rarely include older IBD patients and those with serious comorbidities are virtually excluded. In the present review, we focus on existing literature from pivotal trials and real-world studies, analyzing data on efficacy/effectiveness and safety of newer therapies in older IBD patients with special emphasis on comorbidities and frailty, two distinct but intercorrelated aspects of the older population since age by itself seems to be of minor importance.

Delve into the ebb and flow of human ingenuity as the researcher traces the evolution of writing from papyrus to pixels. Discover how humble instruments like quill pens and typewriters have propelled human into the digital frontier, forever reshaping the art of expression in the modern age. This article examines the evolution of writing tools from traditional pen and paper to digital writing in the modern age. It explores the development of writing materials such as papyrus, parchment, and paper, as well as the invention of writing tools including quill pens, fountain pens, and typewriters. The rise of digital writing tools, including word processing software and smartphones, is also discussed, along with their benefits such as increased efficiency and productivity, enhanced collaboration and sharing capabilities, and greater accessibility and flexibility. However, the article also highlights the challenges of writing in the digital age, including the impact of digital distractions on writing focus and quality, the issue of online plagiarism and copyright infringement, and the potential loss of traditional writing skills. The article concludes with recommendations for educators, school administrators, students, and researchers to strike a balance between digital and traditional writing practices, to embrace digital writing tools while preserving traditional writing skills, and to understand the importance of the evolution of writing. The theoretical frameworks of Social Construction of Technology (SCOT) Theory, Media Ecology Theory, and Activity Theory are also discussed in relation to the evolution of writing tools. Overall, this article provides valuable insights into the history, benefits, and challenges of writing in the digital age, as well as suggestions for navigating the future of writing and its tools.

In the current socio-economic context, pension systems have become a crucial topic in the agenda of governments and international bodies. In this paper, an empirical study regarding the economic and social sustainability of pension systems in Central and Eastern European Countries was performed. The goal of the research is to establish the sustainability of pension systems with econometric modeling techniques on three dimensions as the research hypotheses are revealed: first, by strengthening the financial soundness of pension systems; second, consolidating the economic environment of pension systems; third, increasing the degree of social security systems with a direct effect of reducing poverty. The results led to relevant insights emphasizing the need for more inclusive economic, financial, and social reforms. From a policy perspective, these findings could be a starting point for the enhancement of the financial adequacy and economic and social sustainability of pension systems in Central and Eastern European Countries. The econometric techniques in this study highlight those modern pensions systems that need to be addressed in a more complex and empirical context that must encompass the main technical aspects. The conclusions suggest that in the future it needs judicial, economic, and social adjustments for the enhancement of the financial soundness of the pension systems.

Due to the impacts from climate change, the allocation of water resources must urgently be optimized worldwide to ensure that the needs of both water managers and farmers are balanced. In this study, manager-oriented and farmer-oriented assessment models were developed for irrigation water optimization and allocation. The distance from water sources and hydraulic head were the main factors in the manager-oriented assessment model; crop value, water demand of crops, and soil type were additional factors in the farmer-oriented assessment model. The developed assessment models were used to assess irrigation water allocation in five villages in Neimen District. Cadasters at high elevation were discovered to not be suitable for cultivation of crops because of the difficulties in constructing irrigation facilities and the loss of irrigation water during transportation. The result obtained from the manager-oriented assessment system was related to the costs involved in the construction and maintenance of irrigation facilities, which indicated that cadasters located at long distances from water sources and at high elevation are unsuitable for cultivation. By contrast, the result obtained from the farmer-oriented assessment system was related to the profits of farmers and revealed that more cadasters would be suitable for cultivation if suitable crops were chosen.

Ultraviolet (UV) radiation has both harmful and beneficial effects on human health. It can cause skin damage and cancer, but also provides the primary source of vitamin D. Additionally, UV radiation affects energy metabolism in mice with metabolic diseases and has protective effects on hypertension and cardiovascular diseases.Metabolic Syndrome is a collection of metabolic dysfunctions such as dyslipidemia, hypertension, hyperglycemia, abdominal/central obesity, and insulin resistance. Chronic UVR exposure suppressed obesity and type 2 diabetes in high-fat diet-fed mice, while vitamin D supplementation did not replicate these effects. On the other hand, topical application of nitric oxide (NO) donors replicated UV effects on mice, and NO scavengers prevented the positive impact of UV. UVR may prevent the development of obesity and metabolic syndrome through mechanisms that depend on UVR-induced NO, not vitamin D. Exposure to sunshine has a protective impact on blood pressure and cardiovascular disease. Although lower vitamin D concentration is linked to increased hypertension and the incidence of CVD, oral vitamin D supplementation does not decrease blood pressure or the risk of CVD, indicating that vitamin D may not mediate the beneficial effects of sun exposure. Instead, NO plays a crucial role as an endogenous vasodilator, produced by the vascular endothelium. Solar UVA may release nitrogen oxides from skin storage into the bloodstream, lowering blood pressure and cardiovascular mortality.In conclusion, UVR exposure could be a promising non-pharmacological intervention for metabolic syndrome, hypertension, and CVD prevention, and NO may play a crucial role in mediating these effects. Further research is needed to explore the precise mechanisms and identify the optimal doses and exposure times of UVR.

Polyacetylene phytochemicals are emerging as potentially responsible for the chemoprotective effects of consuming apiaceous vegetables. There is some evidence suggesting that polyacetylenes impact carcinogenesis by influencing a wide variety of signalling pathways, which are important in regulating inflammation, apoptosis, cell cycle regulation, etc. Studies have shown a correlation between human dietary intake of polyacetylene-rich vegetables with reduced risk of inflammation and cancer. Polyacetylene supplementation can influence cell growth, gene expression, and immunological responses, and reduce tumour number in rat and mouse models. Cancer chemoprevention by dietary polyacetylenes involves several mechanisms, including effects on inflammatory cytokines, the NF-κB pathway, antioxidant response elements, UPR pathway, growth factor signalling, cell cycle progression, and apoptosis. This review summarises the published research on falcarinol-type polyacetylene compounds and their mechanisms of action regarding cancer chemoprevention and treatment, and also identifies some gaps in our current understanding of the health benefits of these polyacetylenes.

Transcription factors are diverse intracellular proteins facilitating cellular responses to inducing factors via gene expression. Regulatory signalling cascades from the membrane proteins (sensors) to transcription factors (effectors) are paramount to accurate phenotypic display against external factors. This review examines several transcription factors germane to Cryptococcus (C.) neoformans adaptation and survival for human infection. These opportunistic pathogenic single-cell yeasts (fungi) possess several gene duplications and peculiar membrane proteins due to adaptive phenotypes and morphological plasticity. Consequently, hundreds of responsible pleiotropic genes have been studied to understand how these genes are induced, regulated, and coordinated. However, these findings are sparsely converged and interlinked, making it cumbersome to relate one gene to the other or group them by their functions. We reviewed several wide-ranging transcriptional analysis works associated with C. neoformans into comparable phenotypic traits that necessitate adaptation, survival, and human infection. We present a robust work that addresses several transcription factors and their inducing factors. Lastly, we converge, link, and group several of these factors according to their multifunctional expression pattern. We also provide adequate information on certain genes critical to this fungus, which could be explored pharmaceutically in drug targeting for more effective antifungal management.

QTc interval measurement is a widely used screening tool to assess the risk of cardiac diseases, arrhythmias, and is a useful biomarker for pharmacovigilance. However, interpretation of QTc is difficult in neonates due to hemodynamic maturational changes and uncertainties on reference values. To describe trends in QTc values throughout infancy (1 year of life), and to explore the impact of (non)-maturational changes and medicines exposure, a structured systematic review (PROSPERO CRD42022302296) was performed. In term neonates, a decrease was observed over the first week of life, whereafter values increased until two months of age, followed by a progressive decrease until six months. A similar pattern, with longer QTc values was observed in preterms. QTc is influenced by cord clamping, hemodynamic changes, therapeutic hypothermia, illnesses and sleep, not by sex. Cisapride, domperidone and doxapram result in QTc prolongation in neo-nates. Further research in this age category is needed to improve primary screening practices, earlier detection of risk factors and precision pharmacovigilance.

Antimicrobial resistance is on the rise, and there aren't enough new treatments to combat it. This might send the modern world back to the pre-antibiotic age. The molecular hybrids of pyrazolo[3,4-b]pyridine and triazole have been designed, synthesized, and analyzed for their drug-like molecule nature and in vitro analyses for their inhibition potentials against S. Aureus and K. Pneumoniae. The compounds CY-R2-25 and CY-R2-28 have been identified as the high potential molecules in this series based on in vitro experiments. CY-R2-25 has zone of inhibition values of 15 0.82 and 14 0.7, whilst CY-R2-28 has the zone of inhibition values of 18 0.95 and 16 0.82 against S. Aureus and K. Pneumoniae, respectively. MIC and MIB values for CY-R2-25 and CY-R2-28 against S. Aureus and K. Pneumoniae are 0.25 and 0.5, respectively.

Contamination with Arsenic, a toxic metalloid, is increasing in the marine environment. Additionally, global warming can alter metalloids toxicity. Polychaetes are key species in marine environments. By mobilizing sediments, they play vital roles in nutrient and element (including contaminants) cycles. Most studies with marine invertebrates focused on the effects of metalloids on either adults or larvae. Here we bring information on the effects of temperature increase and arsenic contamination on the polychaete Hediste diversicolor in different growth stages and water temperatures. Feeding activity and biochemical responses – neurotransmission, indicators of cell damage, antioxidant and biotransformation enzymes and metabolic capacity - were evaluated. Temperature rise combined with As imposed alterations on feeding activity and biochemical endpoints at different growth stages. Small organisms have their antioxidant enzymes increased, avoiding lipid damage. However, larger organisms are the most affected class due to inhibition of superoxide dismutase, which resulted in protein damage. Oxidative damage was observed on smaller and larger organisms exposed to As and 21 °C, demonstrating higher sensibility to the combination of temperature rise and As. The observed alterations may have ecological consequences, affecting the cycle of nutrients, sediment oxygenation and the food chain that depend on the bioturbation of this polychaete.

Physical roots, exemplifications and consequences of periodic and aperiodic ordering (represented by Fibonacci series) in biological systems are discussed. The role and physical and biological roots of symmetry and asymmetry appearing in biological patterns is addressed. Generalization of the Curie-Neumann Principle as applied to biological objects is presented, briefly summarized as: “asymmetry is what creates a biological phenomenon”. The “up-bottom approach” and “bottom up” approaches to the explanation of symmetry in organisms are presented in detail. The “up-bottom approach”, implies that the symmetry of the biological structure follows the symmetry of media in which this structure is functioning; the “bottom-up” approach, in turn, adopt that the symmetry of biological structures emerges from the symmetry of molecules constituting the structure. A diversity of mathematical measures applicable for quantification of ordering in biological patterns is introduced. The continuous, Shannon and Voronoi measures of symmetry/ordering and their application to biology objects are addressed. The fine structure of the notion of “ordering” is discussed. Informational/algorithmic roots of ordering inherent for the biological systems are considered. Ordered/symmetrical patterns provide economy of biological information, necessary for algorithmic description of a biological entity. Application of the Landauer principle bridging physics and theory of information to the biological systems is discussed.

Hilbert arithmetic in a wide sense, including Hilbert arithmetic in a narrow sense consisting by two dual and anti-isometric Peano arithmetics, on the one hand, and the qubit Hilbert space (originating for the standard separable complex Hilbert space of quantum mechanics), on the other hand, allows for an arithmetic version of Gentzen’s cut elimination and quantum measurement to be described uniformy as two processes occurring accordingly in those two branches. A philosophical reflection also justifying that unity by quantum neo-Pythagoreanism links it to the opposition of propositional logic, to which Gentzen’s cut rule refers immediately, on the one hand, and the linguistic and mathematical theory of metaphor therefore sharing the same structure borrowed from Hilbert arithmetic in a wide sense. An example by hermeneutical circle modeled as a dual pair of a syllogism (accomplishable also by a Turing machine) and a relevant metaphor (being a formal and logical mistake and thus fundamentally inaccessible to any Turing machine) visualizes human understanding corresponding also to Gentzen’s cut elimination and the Gödel dichotomy about the relation of arithmetic to set theory: either incompleteness or contradiction. The metaphor as the complementing “half” of any understanding of hermeneutical circle is what allows for that Gödel-like incompleteness to be overcome in human thought.

Chronic Hepatitis B (CHB) Virus infection is major etiological factor for liver cirrhosis and/ or liver cancer. The viral protein, major contributor in predisposition of chronicity and Hepatocellular Carcinoma (HCC) is Hepatitis B x (HBx) protein. Its dynamic subcellular distribution to an extent determines its multifactorial role. It is a regulatory protein which modulates viral as well as host machinery in favours to HBV persistence. An insight on HBx stabilising factors is critical for therapeutic purpose. The precise role of HBx in the pathogenesis of Chronicity of HBV is not known. Summary: This review comprehensively summarizing different mechanisms and their regulation by HBx protein with respect to chronicity and HCC emphasising viral persistence. Key Messages 1. HBx is a key protein for viral persistence. 2. Dynamic subcellular distribution of HBx determines its function. 3. HBx modulates cellular machinery to favours HBV survival. 4. HBx affects various intermediary mechanisms contributing to disease progression. 5. HBx may be a potent target to prevent the disease progression towards HCC.

Pathologies of the blood brain barrier (BBB) have been linked to a multitude of CNS disorders whose pathology is poorly understood. Cortical spreading depression (CSD) has long been postulated to be involved in the underlying mechanisms of these disease states, yet full understanding remains elusive. This study utilized an in vitro model of the BBB with b.End3 murine endothelial cells to investigate the role of CSD in BBB pathology by characterizing effects of the release of major pronociceptive substances on BBB functional integrity using TEER screening, transcellular uptake, and immunoreactive methods in concert with global proteome and phospho-proteomic approaches. Findings demonstrated relocalization and functional alteration to proteins associated with the cytoskeleton and endothelial tight junctions. Pathologic mechanisms induced by individual substances released during CSD were found to have unique phosphorylation signatures in phospho-proteome analysis, identifying Zona Occludens 1 as a possible pathologic “checkpoint” of the BBB. Utilizing these phosphorylation signatures, possible novel diagnostic methods may be developed for neurological diseases and warrants further investigation.

About 70% of children and adolescents with cerebral palsy experience gait impairments which affect their autonomy and well-being. Robotic-assisted gait training using the Lokomat is particu-larly promising for rehabilitation as it provides a standardized environment favoring the massive repetition of the movement, in which physical demands are low on the therapist and high training loads can be achieved. As no guidelines exist regarding training protocols and Lokomat settings, the goal of this study was to review the literature on Lokomat-assisted gait therapy and possibly make training recommendations. The twelve studies reviewed reported both positive and null effects of Lokomat training on gait. Half of the studies combined Lokomat with other types of training and only five used a control intervention to assess its benefit. Overall, training was administered 1-5 times per week for 20-60 minutes, over 1-12 weeks. Although Lokomat settings were not always described, progressively decreasing body-weight support and guidance, while increasing treadmill speed appear to be prioritized. The variety of training protocols and settings used did not allow pooling of the studies to assess effects of interventions on gait parameters in children and adoles-cents with cerebral palsy. This review highlights the need for homogenization of interventions so that clear guidelines can emerge and be applied in rehabilitation centers.

Bacterial vaginosis (BV), the most common cause of vaginal discharge, is characterized by a shift in the vaginal microbiota from lactobacillus dominance to a diverse array of facultative and strict anaerobic bacteria which form a multi-species biofilm on vaginal epithelial cells. The rate of recurrence after therapy is high, often >60%. While the BV biofilm itself likely contributes to recurrent and/or refractory disease after treatment by reducing antimicrobial penetration, antimicrobial resistance in BV-associated bacteria including those, both within the biofilm and the vaginal canal, may be the result of independent, unrelated bacterial properties which are discussed in this paper. Our current recommendations for the treatment of refractory and recurrent BV are also provided.

In this paper, we study the weak deflection angle using Gauss-Bonnet theorem and bounding greybody factor for electric and magnetic black holes in the background of nonlinear electrodynamics. Using Gibbons and Werner's approach, first we acquire the Gaussian optical curvature to use in Gauss-Bonnet theorem and calculate the bending angle for spherically symmetric electric and magnetic black holes in both non-plasma and plasma mediums in the weak field limits. Later, we calculate the rigorous bounds of the greybody factor for the given black holes. Furthermore, we look into the graphical behaviour of bending angles and greybody bounds at some specific values of multiple parameters as well as black holes charges. It is to be mention here that all the results for the electric and magnetic charged black holes solutions reduce into the Schwarzschild black hole solution in the absence of the black holes charges.

Background: Different drugs damage the frontal cortices, particularly the prefrontal areas involved in both emotional and cognitive functions, with a consequence of decoding emotion deficits for people with substance abuse. The present study aims to explore the cognitive impairments in drug abusers through facial, body and disgust emotion recognition, expanding the investigation of emotions, processing, measuring accuracy and response velocity. Method: We enrolled 13 addicted to cocaine and 12 alcohol patients attending treatment services in Italy, comparing them with 33 matched controls. Facial emotion and body posture recognition tasks, a disgust rating task, and the Barrat Impulsivity Scale were included in the experimental assessment. Results: We found that emotional processes are differently influenced by cocaine and alcohol, suggesting that these substances impact diverse cerebral systems. Conclusion: The contribution made by the duration of consumption on emotional processing seems far less important than for cognitive processes. Drug abusers seem to be slower on elaboration of emotions and, in particular, of disgust emotion. Considering that the participants were not impaired in cognition, our data support the hypothesis that emotional impairments emerge independently from damage to cognitive functions.

Cancer is a prevalent disease worldwide and treatments such as radiotherapy and chemotherapy sometimes lead to adverse events. Oral mucositis is one of the most disabling and clinical guidelines do not take into account nutritional interventions. The primary endpoint was to gather the evidence about the efficacy of nutritional interventions in the prevention and/or treatment of antineoplastic induced oral mucositis in oncological patients. It was carried out a bibliographic review in PubMed data base by combining MesH terms with boolean operators. Articles were selected based on inclusion and exclusion criteria; 50 final articles were found. Although further evidence is needed, glutamine, honey and vitamins appear to be a good therapeutic option. The rest of the compounds presented controversial or insufficient results to draw conclusions over their utilization as prevention or treatment options. Low evidence is reported about oral mucositis nutritional interventions in spite of being attainable and affordable compounds. Scarce evidence is shown in paediatric patients compared to adults. Developing higher quality studies and combinations with the compounds researched is necessary to create stronger evidence.

The increasing amount of municipal sludge in China requires safe and effective management to protect human health and ensure environmental sustainability. Pyrolysis is a thermochemical process that that decompose organic matter at elevated temperature and under anaerobic conditions, and it has attracted an increasing attention in sludge treatment in the recent years. However, comprehensive environmental and economic assessment of sludge pyrolysis in China's context is rare, due to the small quantities of full-scale sludge pyrolysis plant. In this paper, we applied our design and operation parameters of full-scale sludge pyrolysis plants to generate the material and energy consumptions of the pyrolysis system under various of conditions, including sludge organic content and moisture content, system size, system energy distribution, and whether or not heat substitution is applied. Life cycle assessment and techno-economic assessment were then applied to investigate the environmental and economic performance of the system Our results demonstrate the significant environmental and economic impacts associated with sludge properties and system size. Generally, sludge with higher organic content and lower moisture content requires less natural gas consumption, which leads to a simultaneous improvement of the system environmental and economic performance. The system economic performance is more sensitive to the system size, and centralized sludge handling using a larger pyrolysis is more economic favorable. In the most ideal case, the average global warming potential and minimum sludge handling price of sludge pyrolysis could be as low as -32.5 kg CO₂-Eq/t DS and 188.8 $/t DS, respectively. Based on these results, we discussed the pathways that could be taken to further optimize the environmental and economic performances of the pyrolysis system.

Microglia are resident immune cells of the central nervous system such as brain-specific macrophages and also known to regulate the innate immune functions of astrocytes through secretory molecules. This conversation plays an important role in brain functions and homeostasis as well as in neuropathologic disease. In this study, we aimed to elucidate whether astrocytes and microglia can cross-talk to induce microglial polarization and proliferation, which can be further regulated under the brain stroke-mimic microenvironment. Microglia in mixed glial culture increased their survival and proliferation and altered to the M2 microglia, whose role was provided by CD11b-GFAP+ astrocytes by showing approximately tenfold increase in microglia cell proliferation after the astrocyte reconstitution. Furthermore, GM-CSF stimulated microglial proliferation approximately tenfold and induced to CCR7+ M1 microglia, whose phenotype could be suppressed by anti-inflammatory cytokines such as IL-4, IL-10, and Substance-P. Also, astrocyte in the microglia co-culture revealed A2 phenotype, which could be activated to A1 astrocyte by TNFα and IFNγ under the stroke-mimic condition. Altogether, astrocyte in the mixed glial culture stimulated the microglia proliferation and M2 polarization possibly through its acquisition of A2 phenotype, both of which could be converted to M1 microglia and A1 astrocytes under the inflammatory stroke-mimic environment. This study demonstrated that microglia and astrocyte can be polarized to M2 microglia and A2 astrocytes respectively through the cross-talk in vitro and provided a system to explore how microglia and astrocyte may behave in the inflammatory disease milieu after in vivo transplantation.

Climate change is one of the biggest challenges of our times. Its impact on human populations is not yet completely understood. Many studies have focused on single aspects with contradictory observations. However, climate change is a complex phoenomenon that cannot be adequately addressed from a single discipline's perspective. Hence, we propose a comprehensive conceptual framework on the relationships between climate change and human responses. This framework includes biological, psychological and behavioural aspects, and provides a multidisciplinary overview and critical information for focused interventions. The role of tipping points and regime shifts is explored, and a historical perspective is presented to describe the relationship between climate evolution and socio-cultural crisis. Vulnerability, resilience and adaptation are analyzed from an individual and a community point of view. Finally, emergent behaviours and mass effect phenomena are examined that account for mental maladjustment and conflicts.

The development of dosimetry and studies in peptide receptor radionuclide therapy (PRRT) over these two last decades are reviewed. Differences in kidney and bone marrow toxicity reported between ⁹⁰Y, ¹⁷⁷Lu and external beam radiotherapy (EBRT) are discussed with regards to the physical properties of these beta emitter radionuclides. The impact of these properties on the response to small and large tumors is also considered. Capacities of the imaging modalities to assess the dosimetry to target tissues are evaluated. Studies published in the last two years that confirm a red marrow uptake in ¹⁷⁷Lu-DOTATATE therapy, as already observed 20 years ago in ⁸⁶Y-DOTATOC PET studies, are commented and analyzed in the light of the recent knowledges in transferrin transport mechanism. The review enlightens the importance i) of using state of the art imaging modalities, ii) of individualizing the activity to be injected with regards to the huge tissue uptake variability observed between patients, iii) of challenging the currently used but inappropriate blood based red marrow dosimetry and iv) of considering individually tandem therapy. Last, a smart individually optimized tandem therapy taking benefit of the bi-orthogonal toxicity-response pattern of ¹⁷⁷Lu-DOTATATE and of ⁹⁰Y-DOTATOC is proposed.