The ribosome is a macromolecular complex composed of RNA and proteins that interact through an integrated and interconnected network to preserve its ancient core activities. In this review, we emphasize the pivotal role played by RNA-binding proteins as a driving force in the evolution of the current form of the ribosome, underscoring their importance in ensuring accurate protein synthesis. This category of proteins includes both ribosomal proteins and ribosome biogenesis factors. Impairment of their RNA-binding activity can also lead to ribosomopathies, a group of disorders characterized by defects in ribosome biogenesis that are detrimental to protein synthesis and cellular homeostasis. A comprehensive understanding of these intricate processes is essential for elucidating the mechanisms underlying the resulting diseases and advancing potential therapeutic interventions.

Ornamental kale (Brassica oleracea var. acephala) is an attractive ornamental plant with a range of leaf colors and shapes. Breeding new varieties of ornamental kale has proven challenging due to its lengthy breeding cycle and the limited availability of genetic markers. Microspore culture is an effective approach to generate new materials and genetic maps are a prerequisite for quantitative trait loci analysis, MAS, fine gene mapping, and genome sequence assembly. In this study, a F1DH ornamental kale population comprising 300 DH lines was constructed using microspore culture. A high-density genetic map was developed by conducting whole-genome sequencing on 150 individuals from the F1DH population. The genetic map contained 1,696 bin-markers with 982,642 single-nucleotide polymorphisms (SNPs) spanning a total distance of 775.81 cM on all nine chromosomes with an average distance between markers of 0.46 cM. The ornamental kale genetic map contained substantially more SNP markers compared with published genetic maps for other B. oleracea crops. The F1DH progenies provide an excellent resource for germplasm innovation and breeding new varieties of ornamental kale. The high-density genetic map provides crucial insights for gene mapping and unraveling the molecular mechanisms behind important agronomic traits in ornamental kale.

Demethyleneberberine is an active component extracted from the Chinese herbal drug Cortex Phellodendri. It is also a metabolite of the berberine in animals and humans. However, the pharmacokinetics, tissue distribution and excretion of demethyleneberberine have not been reported. The present study aimed to investigate the pharmacokinetic parameters of demethyleneberberine by developing a method of high-performance liquid chromatography-tandem mass spectrometry (LC-MS/MS). The detection was performed by using positive ion electrospray ionization in multiple reaction monitoring mode. The MS/MS ion transitions were monitored at m/z 324.4→308.3 for demethyleneberberine and 465.5→350.3 for IS. After oral administration of demethyleneberberine in rats and mice, the pharmacokinetics, tissue distribution, and excretion of desmethylberberine in rats and mice were comparatively studied for the first time. The plasma concentration of desmethylberberine reached its peak within 5 min after oral administration in both rats and mice. The bioavailability of rats and mice was comparable, ranging from 4.47% to 5.94%, higher than that of berberine. The total excretion of desmethylberberine in urine, feces and bile is 7.28~9.77%. These findings provide valuable insights into the pharmacological and clinical research on desmethylberberine.

This work demonstrates that microbial fuel cells (MFCs), optimized for energy recovery, can be used as an effective tool to detect the presence of antibiotics in water-based environments. MFCs directly convert chemical energy of organic matter in electrical energy thanks to electroactive biofilms. The efficiency of the conversion process can be significantly affected by the presence of contaminants acting as toxicants for the biofilm. In the present work, we demonstrate that MFCs can successfully detect the presence of antibiotic residues in water and water-based electrolytes associated to the food industry, especially using honey as a new and more complex electron donor. The effectiveness of MFCs to sense antibiotics is here demonstrated for tetracycline that was added to both water and water/honey electrolytes with a minimum concentration close to 3.5 μg⁄kg. MFCs not only efficiently detect the presence of tetracycline in both the electrolytes, but also recover the same performance after each cycle of exposure, showing to a be very robust and reliable technology for both biosensing and energy recovery.

Intergenerational Justice entitles the maximum retention of Earth’s Biodiversity. The United Nations COP 15 committed to the protection of 30% of Earth’s terrestrial environments to provide Biospheric Sustainability. However, proactive amphibian sustainability needs support from amphibian Reproduction Technologies, Biobanking, and Conservation Breeding Programs [RBCs]. These technologies include the reliable practice of stimulation of reproduction and the collection of sperm and oocytes, refrigerated and cryopreserved sperm storage, in vitro fertilization. Emerging technologies promise the perpetuation of species solely from biobanked biomaterials. However, although exemplary national programs for amphibian RBCs are now established in the USA and Australia, these potentials are not fully realised resulting in unacceptable biodiversity loss. To fully realise these potentials an independent and democratic global organisation is proposed to, 1) focus on the bioregions with the highest amphibian biodiversity, 2) maximise regional inclusion in international initiatives, and 3) provide for maximum community engagement and financial resources. We present the first overall multidisciplinary review of amphibian RBCs, including their geopolitical, cultural, and scientific background, along with their development and application to economically, efficiently, and reliably, perpetuate amphibian biodiversity. We provide genetic models, the potential for diploid cell cryopreservation to perpetuate species, along with significant new information on methodologies and techniques, and standardise nomenclature for specificity in publications and media consistency.

The large quantity of information retrieved from communities, public data repositories, web pages, or data mining can be sparsed and poorly classified. This work shows how to employ unsupervised classification algorithms such as K-means proper to classify user reviews into their closest category, forming a balanced data set. Moreover, we found that the text vectorization technique significantly impacts the clustering formation, comparing TF-IDF and Word2Vec. The value for mapping a cluster with movie genre was 81.34% ± 20.48 of the cases when the TF-IDF was applied, whereas Word2Vec only yielded a 53.51% ± 24.1. In addition, we highlight the impact of the removal of stop-words. Thus, we detected that pre-compiled lists are not the best method to remove stop-words before clustering because there is much ambiguity, centroids are poorly separated, and only 57% of clusters could match a movie genre. Thus, our proposed approach achieved a 94% of accuracy. After analyzing the classifiers’ results, we appreciated a similar effect when divided by the stop-words method removal. Statistically significant changes were observed, especially in precision metric and Jaccard scores in both classifiers, using custom-generated stop lists rather than pre-compiled ones. Reclassifying sparse data is strongly recommended as using custom-generated stop lists.

Depression is a complex neuropsychiatric disorder characterized by pervasive feelings of sadness, hopelessness, and cognitive impairments that can profoundly impact an individual's quality of life. Despite extensive research efforts, the precise mechanisms underlying depression remain elusive. Recent studies have highlighted the intricate interplay between the immune system and the central nervous system in the pathophysiology of depression. In this context, CD4+ T cells, a key component of the adaptive immune system, have emerged as potential players in the neuroinflammatory processes associated with depression. Concurrently, Brain-Derived Neurotrophic Factor (BDNF), a multifunctional neurotrophin, has garnered significant attention for its roles in neural plasticity, mood regulation, and cognitive function. This review paper explores the intriguing intersection between CD4+ T cells and BDNF in the context of depression and delves into the exciting prospects it offers for therapeutic interventions. By examining the intricate crosstalk between the immune system and the neurotrophic factors, we aim to shed light on the potential avenues for novel therapeutic strategies in the treatment of depression.

Enteric viruses are the major cause of gastroenteritis and enteric hepatitis worldwide, but in some areas like Saudi Arabia little data is known about their presence in water sources. The available information from clinical samples is not enough to figure their actual prevalence. The aim of this study was to gather information for the first time in Saudi Arabia on the presence of Norovirus (NoV) genogroup GI and GII, hepatitis A virus (HAV) and hepatitis E virus (HEV) in water. For this purpose, thirteen monthly samples were collected in lake Wadi Hanifa and surrounding wells from December 2014 to November 2015. Viruses were detected and quantified by Real-time RT-qPCR. Despite HEV findings were anecdotic, our results highlight interesting behaviors of the other viruses. There was a higher prevalence of noroviruses in Wadi Hanifa samples than in well water samples (46.43% vs12.5% of NoV GI; 66.67% vs8.33% of NoV GII). On the contrary, similar levels of HAV positivity were observed (40.48% in surface water vs 43.06% in well water). Also, a strong influence of flooding events on HAV and NoV GI occurrence was observed in both surface and well water samples, being NoV GII apparently not affected.

Background: Influenza vaccine is a tool for preventing infection and reducing exacerbations in patients with asthma and chronic obstructive pulmonary disease (COPD). Purpose of this study is to investigate dynamics of CRP and serum cytokines (IL-2, IL-6, IL-10, IL-17) in patients with asthma and COPD, as well as to perform a correlation analysis with the clinical parameters of the disease manifestation. Methods: The study included 34 patients with asthma, 20 patients with COPD vaccinated against influenza during a period of remission from 2 to 4 weeks, both groups being under a basic maintenance therapy, and 26 healthy individuals vaccinated with the trivalent polymer-subunit vaccine Grippol® Plus, containing 5 µg of influenza virus strains and 500 µg of azoximer bromide. Results: Observing patients with asthma and COPD, during a year after the vaccination, has revealed a significant reduction in exacerbations frequency (p < 0.05) and duration (p < 0.05) of the bronchial obstructive syndrome (BF). Before the vaccination the IL-6 level in patients with asthma had a direct moderate correlation with duration of exacerbations of the underlying disease (p < 0.05), along with the number of systemic corticosteroids courses during exacerbations (p < 0.05). In 12 months after the vaccination, while assessing cytokine profile of all study groups, a significant reduction in the level of IL-6 was observed, compared to the baseline values (p< 0.05). Conclusion: Conducted analysis of immunological, clinical, and functional parameters of patients with asthma and COPD has proven for influenza vaccine to be effective in BF patients.

Although the effect of thermal modification (TM) on teak wood color is well documented, a few studies were carried out in closed system processes, as well as it remains unclear the effect of different processes on the same material. This work aimed to verify the effect of closed and open system processes of TM on the color of fast-growing teak wood. Thermally modified wood was evaluated in a closed system at 160 °C (CS160) and in an open system at 185 °C and 210 °C (OS185 and OS210). We measured the moisture content (initial and final) of wood, and the corrected mass loss (CML). The chemical analyses encompassed the contents of alpha-cellulose, hemicelluloses, lignin, and extractives (total, in acetone and dichloromethane). Wood color was measured before and after TM according to the CIEL*a*b* color space. It was possible to achieve the same color using different processes of thermal modification (CS160 and OS210). TM reduced wood lightness (L*), red-green chromaticity coordinate (a*), and yellow-blue chromaticity coordinate (b*). L* and a* had the bigger and lower variations, respectively. The color of thermally modified wood was significantly changed, even at the mildest condition tested (OS185, 0.33% CML).

Herpes B virus (BV) is a zoonotic virus which can be transmitted from macaques to humans, which is often associated with high mortality rates. Because macaques often exhibit asymptomatic infections, individuals who come into contact with these animals face unexpected risks of BV infections. Serological test is widely performed to investigate BV infections. However, the assay’s sensitivity and specificity appeared to be inadequate, and it does not necessarily indicate ongoing viral shedding. Here, we developed LAMP and qPCR assays aiming to detect BVs with high sensitivity and specificity in various macaque species and validated them using oral swab samples collected from 97 wild cynomolgus macaques living in Thailand. Our LAMP and qPCR assays detected more than 50 and 10 copies of the target sequences per reaction, respectively. The LAMP assay could detect BV within 25 min, indicating its advantages for the rapid detection of BV. Collectively, our findings indicated that both assays developed in this study exhibit advantages and usefulness for BV surveillance and diagnosis of BV infections in macaques. Furthermore, for the first time, we determined the partial genome sequences of BVs detected in cynomolgus macaques in Thailand. Phylogenetic analysis revealed the species-specific evolution of BV within macaques.

Cardiovascular diseases (CVD) remain the leading cause of death across the globe, hence, establishing strategies to counteract CVD are imperative to reduce mortality and the burden on health systems. Dietary modification is an effective primary prevention strategy against CVD. Research regarding dietary supplementation has become increasingly popular. This review focuses on the current in vivo, in vitro, and epidemiological studies associated with that of omega-3 polyunsaturated fatty acids (n-3 PUFA) and polar lipids (PLs) and how they play a role against CVD. Furthermore, this review focuses on the results of several major clinical trials examining n-3 PUFA regarding both primary and secondary prevention of CVD. Notably, we place a lens on the REDUCE-IT and STRENGTH trials. Finally, supplementation of PLs has recently been suggested as a potential alternative avenue for the reduction of CVD incidence versus neutral forms of n-3 PUFA. However, the clinical evidence for this argument is currently rather limited. Therefore, we draw on the current literature to suggest future clinical trials for PL supplementation. We conclude that despite conflicting evidence, future human trials must be completed to confirm whether PL supplementation may be more effective than n-3 PUFA supplementation to reduce cardiovascular risk.

In this study, we considered the structural stability, electronic properties, and phonon dispersion of the cubic (c-ZrO₂), tetragonal (t-ZrO₂), and monoclinic (m-ZrO₂) phases of ZrO₂. We found that the monoclinic phase of zirconium dioxide is the most stable among the three phases in terms of total energy, lowest enthalpy, highest entropy, and other thermodynamic properties. The smallest negative modes were found for m-ZrO₂. Our analysis of the electronic properties showed that during the m–t phase transformation of ZrO₂, the Fermi level first shifts by 0.125 eV toward higher energies and then decreases by 0.08 eV in the t–c cross-section. The band gaps for c-ZrO₂, t-ZrO₂, and m-ZrO₂ are 5.140 eV, 5.898 eV, and 5.288 eV, respectively. Calculations based on the analysis of the influence of doping 3.23, 6.67, 10.35, and 16.15 mol. %Y₂O₃ onto the m-ZrO₂ structure showed that the enthalpy of m-YSZ decreases linearly, which accompanies further stabilization of monoclinic ZrO₂ and an increase in its defectiveness. A doping-induced and concentration-dependent phase transition in ZrO₂ under the influence of Y₂O₃ was discovered, due to which the position of the Fermi level changes and the energy gap decreases. It has been established that, not only for pure systems but including those doped with Y₂O₃, the main contribution to the formation of the conduction band is made by the p-states of electrons. The t-ZrO₂ (101) and t-YSZ (101) surface models were selected as optimal surfaces for water adsorption based on a comparison of their surface energies. An analysis of the mechanism of water adsorption on the surface of t-ZrO₂ (101) and t-YSZ (101) showed that H₂O on unstabilized t-ZrO₂ (101) is adsorbed dissociatively with an energy of -1.22 eV, as well as by the method of molecular chemisorption with an energy of - 0.69 eV and the formation of a hydrogen bond with a bond length of 1.01 Å. In the case of t-YSZ (101), water is molecularly adsorbed onto the surface with an energy of -1.84 eV. Dissociative adsorption of water occurs at an energy of -1.23 eV, near the yttrium atom. The results show that ab initio approaches are able to describe the mechanism of doping-induced phase transitions in (ZrO₂+Y₂O₃)-like systems, based on which it can be assumed that DFT calculations can also flawlessly evaluate other physical and chemical properties of YSZ, which have not yet been studied quantum chemical research. The obtained results complement the database of research works carried out in the field of the application of biocompatible zirconium dioxide crystals and ceramics in green energy generation and can be used in designing humidity-to-electricity converters and creating solid oxide fuel cells based on ZrO₂.

Despite their anti-icing ability, hydrophobic coatings have the disadvantages of easy falling off and poor wear resistance, resulting in insufficient durability of ice/snow melting. To improve the surface stability and durability of superhydrophobic coatings, nanoparticle/epoxy coatings were prepared with three types of nanoparticles, two types of dispersion methods, three types of application methods and two types of introduction methods of epoxy resin. Water contact angles, ice adhesion force and icing rate of asphalt concrete coated with hydrophobic coatings were tested. The molecular structures of coatings were analyzed by Fourier transform infrared spectroscopy. The surface morphology of hydrophobic coatings was observed using Scanning electron microscopy. Results indicated that nano-ZnO, TiO2 and SiO2 particles can be modified into hydrophobicity by stearic acid. The hydrophobic coating could improve the hydrophobicity of concrete, reduce the adhesion strength of ice and asphalt concrete and delay the beginning icing time. Moreover, The dosages of stearic acid, nanoparticle and epoxy resin need to be in a certain range to ensure the best hydrophobicity and durability of coatings.

Ryegrass is one such cereal that has been underutilized in human nutrition despite its high nutritional and functional value due to the presence of phytochemicals and dietary fibers It is a viable option, especially for countries that do not produce wheat, as it is easily adaptable and overgrows, making it economically viable. This study evaluated the nutritional impact, bioactive compounds, and physicochemical and technological properties of partially substituting maize flour (MF) with sprouted whole ryegrass flour (SR) in developing extrusion-cooked breakfast cereals. A completely randomized design with substitutions ranging from 0 to 20 % of MF with SR was employed as the experimental strategy (P < 0.05). Partial incorporation of SR increased the bioavailability of γ-aminobutyric acid and total soluble phenolic compounds. Using sprouted grains can adversely affect the technological quality of extruded foods, but ryegrass, with its high dietary fiber and low lipid content, mitigates these negative effects. Consequently, breakfast cereals containing 4 and 8 % SR exhibited better physicochemical properties, such as reduced hardness and increased crispness. These results are promising for ryegrass and suggest combining the age-old germination process with extrusion can enhance cereal-based breakfast products' nutritional quality and bioactive compound content.

In this study, we considered the structural stability, electronic properties, and phonon dispersion of the cubic (c-ZrO₂), tetragonal (t-ZrO₂), and monoclinic (m-ZrO₂) phases of ZrO₂. We found that the monoclinic phase of zirconium dioxide is the most stable among the three phases in terms of total energy, lowest enthalpy, highest entropy, and other thermodynamic properties. The smallest negative modes were found for m-ZrO₂. Our analysis of the electronic properties showed that during the m–t phase transformation of ZrO₂, the Fermi level first shifts by 0.125 eV toward higher energies and then decreases by 0.08 eV in the t–c cross-section. The band gaps for c-ZrO₂, t-ZrO₂, and m-ZrO₂ are 5.140 eV, 5.898 eV, and 5.288 eV, respectively. Calculations based on the analysis of the influence of doping 3.23, 6.67, 10.35, and 16.15 mol. %Y₂O₃ onto the m-ZrO₂ structure showed that the enthalpy of m-YSZ decreases linearly, which accompanies further stabilization of monoclinic ZrO₂ and an increase in its defectiveness. In this case, the position of the Fermi level changes abruptly, and the energy gap decreases. It has been established that, not only for pure systems but including those doped with Y₂O₃, the main contribution to the formation of the conduction band is made by the p-states of electrons. The t-ZrO₂ (101) and t-YSZ (101) surface models were selected as optimal surfaces for water adsorption based on a comparison of their surface energies. An analysis of the mechanism of water adsorption on the surface of t-ZrO₂ (101) and t-YSZ (101) showed that H₂O on unstabilized t-ZrO₂ (101) is adsorbed dissociatively with an energy of -1.22 eV, as well as by the method of molecular chemisorption with an energy of - 0.69 eV and the formation of a hydrogen bond with a bond length of 1.01 Å. In the case of t-YSZ (101), water is molecularly adsorbed onto the surface with an energy of -1.84 eV. Dissociative adsorption of water occurs at an energy of -1.23 eV, near the yttrium atom. The obtained results complement the database of research works carried out in the field of the application of biocompatible zirconium dioxide crystals and ceramics in green energy generation and can be used in designing humidity-to-electricity converters and creating solid oxide fuel cells based on ZrO₂.

The complex and interconnected challenges of climate change, water stress, disasters, and health crises have far-reaching implications for sustainable development and global sustainability agendas, such as the Sustainable Development Goals (SDGs). However, one critical issue that has been overlooked is the nexus between climate change impacts and mental health (CCMH). Recognizing and addressing the negative emotions associated with this global phenomenon is essential to fostering a holistic approach to climate action planning and building long-term resilience. In this assessment, we present a set of narratives to argue that CCMH research requires a collaborative, transdisciplinary approach that integrates socio-economic and socio-cultural complexities. For this assessment, we used a case study approach to elucidate that the mental health impacts of climate change are unequally distributed, disproportionately affecting vulnerable groups based on age, gender, race, and socioeconomic status. The assessment presented in this study concluded that adequate mental health support programs are limited due to sociocultural stigmas and limited socioeconomic resources in some regions. Existing climate-related mental health services mechanisms lack coordination and specific action plans, leaving affected populations underserved. Unlike traditional understandings of the climate-health nexus, this research calls for experts from multiple fields to work together and for enhanced attention to and investment in CCMH research to bridge the gap between scientific knowledge and practical solutions. Such solutions will lead to scalable and lasting change as communities can implement research findings to support those in need and enhance disaster resilience. Furthermore, by collectively recognizing the climate and mental health nexus, global commitments such as the SDGs and the Paris Declaration can advance awareness and action in climate-related mental health, ultimately promoting a healthier relationship between humanity and nature.

Climate changes caused by anthropogenic actions can directly and indirectly affect living beings, including parasites and their hosts. Changes such as water temperature, pH, distribution of nutrients in the aquatic environment are some examples that can interfere with the fish community, whether in open water or in production systems. In this review, we will show how climate change can affect the adaptation of hosts and parasites in the aquatic environment and how these parasites can be used for environmental monitoring.

CO2, CH4 and CO are the most critical atmospheric gases in terms of their impact on the radiative system, air quality and health. This work provides information on the direction of source areas and potential sources of emissions and shows many aspects of these gases by a statistical analysis using bivariate polar diagrams and local weather conditions (e.g., temperature, wind speed and wind direction) recorded at the Lamto station (LTO, 6°31N and 5°02W) in Côte d’Ivoire over the 2014-2018 period. The results show that the main regions contributing to the high concentrations of CH4 (> 1925 ppb) and CO2 (> 420 ppm) in the GSS, GSP, PSS and PSP seasons are the North and Northwest sectors of Lamto. In these directions, CH4 and CO2 concentrations are associated with wind speeds less than 6 m.s-1, due to the influences of local sources as emissions resulting from the degradation of organic matter submerged during the impoundment of the Taabo dam, and/nor human activities linked to the practice of intensive agriculture. In addition, the high concentrations of CO (> 350 ppb) are observed in GSS in the North, North-West, North-East and East sectors for wind speeds less than or equal to 9 m.s-1, due to the influences of both local and distant sources. The correlation coefficients between CH4 and CO, and between CH4 and CO2 are positive and significant in all sectors. However, those calculated between CO2 and CO have showed both low and high values in all seasons.

PDMS samples may be used in various microfluidic applications by hydrophilizing their surfaces. This study examines the effects of air plasma jet (APJ) and dielectric barrier discharge (DBD) plasma on the surface hydrophilicity of polydimethylsiloxane. In order to increase the hydrophilicity of PDMS sample surfaces, two plasma sources including APJ and DBD were compared. Both DBD and APJ setups were measured for voltage and current, and their respective power was calculated and compared based on their characteristics. It is important to note that the electrical specifications of APJ and DBD were identical, and the source power rates for APJ and DBD plasma were 306W and 300W respectively. UV-vis spectroscopy was used to characterize the plasma, and an electrical characterization of the plasma's power supply was carried out. The effects of parameters such as the distance from the nozzle tip, the duration of the process, and the source voltage on the hydrophilicity of the surfaces during the treatment by APJ were also examined, and samples were then examined for a period of time to determine whether surface hydrophilicity was preserved. On the PDMS surface, a contact angle of about 5.1° was observed using short-term plasma treatments of 10 seconds. In the same conditions, the effect of DBD treatment was superior to that of APJ treatment.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

In this work, optimal consumption and investment strategies are derived for risk-averse investors under the 4/2 stochastic volatility class of models. We work under an expected utility (EUT) framework and consider a Constant Relative Risk Aversion (CRRA) investor, who might also be ambiguity-averse. The corresponding Hamilton-Jacobi-Bellman (HJB) and HJB-Isaacs (HJBI) equations are solved in closed-form for a subset of the parametric space and under some restrictions on the portfolio setting, for complete markets. Conditions for proper changes of measure and well defined solutions are provided. These are the first analytical solutions for the 4/2 stochastic volatility model and the embedded 3/2 model for the type of excess returns established in .

The availability of multiple sequenced genomes from a single species made it possible to explore intra- and inter-specific genomic comparisons at higher resolution and build clade-specific pangenomes of several crops. The pan-genomes of crops constructed from various cultivars/accessions, landraces, and wild ancestral species represent a compendium of genes and structural variations and allow researchers to search for the novel genes and alleles that were inadvertently lost in domesticated crops during the historical process of crop domestication or in the process of extensive plant breeding. Fortunately, many valuable genes and alleles associated with desirable traits like disease resistance, abiotic stress tolerance, plant architecture, and nutrition qualities exist in landraces, ancestral species, and crop wild relatives. The novels genes from the wild ancestors and landraces can be introduced back to high-yielding varieties of modern crops by implementing classical plant breeding, genomic selection, and transgenic/gene editing approaches. Thus, pan-genomic represents a great leap in plant research and offers new avenues for targeted breeding for mitigating the impact of global climate change. Here we summarize the tools used for pangenome assembly and annotations, web-portals hosting plant pangenomes. Furthermore, we highlight a few discoveries made in crops using the pan-genomic approach and its future potential.

This review provides an overview of the biotransformation of limonene and α-pinene, which are commonly found in wood residues and citrus fruit by-products, to produce high-value-added products. Essential oils derived from various plant parts contain monoterpene hydrocarbons, such as limonene and pinenes which are often considered waste due to their low sensory activity, poor water solubility, and tendency to autoxidize and polymerise. However, these terpene hydrocarbons serve as ideal starting materials for microbial transformations. Moreover, agro-industrial byproducts can be employed as nutrient and substrate sources, reducing fermentation costs, and enhancing industrial viability. Terpenes, being secondary metabolites of plants, are abundant in byproducts generated during fruit and plant processing. Microbial cells offer advantages over enzymes due to their higher stability, rapid growth rates, and genetic engineering potential. Fermentation parameters can be easily manipulated to enhance strain performance in large-scale processes. The economic advantages of biotransformation are highlighted by comparing the prices of substrates and products. For instance, R-limonene, priced at US$34/L, can be transformed into carveol, valued at around US$530/L. This review emphasises the potential of biotransformation to produce high-value products from limonene and α-pinene molecules, particularly present in wood residues and citrus fruit by-products. The utilisation of microbial transformations, along with agro-industrial byproducts, presents a promising approach to extract value from waste materials and enhance the sustainability of the antimicrobial, the fragrance and flavour industry.

Millions of people worldwide are affected by diabetes, a chronic disease that continuously grows due to abnormal glucose concentration levels present in the blood. Monitoring blood glucose concentrations is therefore an essential diabetes indicator to aid in the management of the disease. Enzymatic electrochemical glucose sensors presently account for the bulk of glucose sensors in the market. However, their disadvantages are that they are expensive and are dependent on environmental conditions, hence affecting their performance and sensitivity. To meet the increasing demand, non-enzymatic glucose sensors based on chemically modified electrodes for the direct electrocatalytic oxidation of glucose are a good alternative to the costly enzymatic-based sensors currently on the market, and the research thereof continues to grow. Nanotechnology-based biosensors have been explored for their electronic and mechanical properties, resulting in enhanced biological signalling through the direct oxidation of glucose. Copper oxide and copper sulfide exhibit attractive attributes for sensor application, due to their non-toxic nature, abundance, and their unique properties. Thus, in this review, copper oxide and copper sulfide-based materials, are evaluated based on their chemical structure, morphology, and fast electron mobility as suitable electrode materials for non-enzymatic glucose sensors. The review highlights the present challenges of non-enzymatic glucose sensors that have limited their deployment into the market.

The acetylcholinesterase-inhibitory potential of the oleanane-type triterpenes and their glycosides from the Terminalia arjuna (Combreatceae) bark, i.e. arjunic acid, arjunolic acid, arjungenin, arjunglucoside I, sericic acid, and arjunetin, is presented. The studies are based on the in silico pharmacokinetic and biomimetic studies, the acetylcholinesterase (AChE) inhibitory activity tests, and the molecular docking research. Based on the calculated pharmacokinetic parameters, arjunetin and arjunglucoside I are indicated as able to cross the blood-brain barrier. The compounds of interest exhibit marked acetylcholinesterase inhibitory potential, which was tested in the TLC bioautography test. The longest time to reach brain equilibrium is observed for both the arjunic and arjunolic acids and the shortest one for arjunetin. All compounds exhibit high and relatively similar magnitude of binding energies, varying from ca. -15 to -13 kcal/mol. The superposition of the most favorable positions of all ligands interacting with AChE is analyzed. The correlation between the experimentally determined IC50 values and the steric parameters of the molecules is investigated. The inhibition of the enzyme by the analyzed compounds shows their potential to be used as cognition enhancing agents. For the most potent compound (arjunglucoside I; ARG), the kinetics of AChE inhibition is tested. The Michaelis–Menten constant (Km) for the hydrolysis of the acetylthiocholine iodide substrate was calculated to be 0.011 mM.

The outbreak of the COVID-19 pandemic has raised concerns about potential environmental factors that could influence the spread and severity of the SARS-CoV-2 virus. Atmospheric pollution, particularly particulate matter (PM), has been suggested as a contributing factor to viral infections and respiratory complications. This two-year observational study aimed to investigate the relation between air pollution and the spread of COVID-19, focusing on PM2.5. Unlike previous studies limited to specific cities or countries, inevitable to use temporal data. Our research analyzed data from various states across the United States, considering both spatial and temporal correlation. The analysis considered the number and geographic distribution of COVID-19 cases along with daily PM2.5 exposure levels, accounting for monthly average PM2.5 exposure, from March 2020 to December 2021. The observed conflicting results of the temporal and spatial correlation present challenges for researchers in understanding the true nature of the relationship between PM2.5 air pollution and COVID-19 cases. The correlation between various factors, such as population density, PM2.5, temperature, and wind speed, and COVID-19 refers to an association or statistical relationship, not causation. Moreover, the intricate interplay of these variables makes it difficult to establish a clear cause-and-effect relationship.

An increase in Spodoptera species was reported in Bt soybean fields expressing Cry1Ac insecticidal proteins in Brazil, requiring additional management with chemical insecticides. Here, we evaluated the dose effects of flubendiamide and thiodicarb on Spodoptera cosmioides (Walker, 1858), Spodoptera eridania (Stoll, 1782), Spodoptera albula (Walker, 1857) and Spodoptera frugiperda (J. E. Smith, 1797) (Lepidoptera: Noctuidae) that survived on MON 87751 × MON 87708 × MON 87701 × MON 89788, expressing Cry1A.105, Cry2Ab2 and Cry1Ac; MON 87701 × MON 89788 soybean, expressing Cry1Ac; and non-Bt soybean. On unsprayed Cry1A.105/Cry2Ab2/Cry1Ac soybean, only S. frugiperda showed ~60% mortality after 10 d, whereas S. cosmioides, S. eridania and S. albula showed >81% mortality. Surviving larvae of all species on this Bt soybean showed &gt;80% mortality when exposed to the field label dose of flubendiamide (70 mL/ha) or thiodicarb (400 g/ha) or at 50% of these doses. In contrast, all four species had <25% and <19% mortality on Cry1Ac and non-Bt soybean, respectively. Surviving S. cosmioides, S. eridania and S. albula on these soybean types presented >83% mortality post-exposure to both dose levels of flubendiamide and thiodicarb. Some S. frugiperda larvae surviving on Cry1Ac and non-Bt soybean sprayed with a 50% dose of either insecticide developed into adults. However, L1 larvae developing on Cry1Ac soybean leaves sprayed with flubendiamide and L2 larvae on this soybean sprayed with thiodicarb had a prolonged immature stage, and females lower fecundity, which are likely to impact its population growth on soybean.

Introduction: Suicide is the second leading cause of death among 15 to 19-years-olds in Europe. From the beginning of COVID-19 pandemic, literature confirms a significant increase in mental health disease in children and adolescents. At Bambino Gesù Pediatric Hospital emergency department (Rome, Italy) there was a dramatic increase of suicidal attempts, and particularly a rise of suicidal jumpers. Many of these patients presented vertebral fractures. Material and Methods: This retrospective study includes all suicidal jumpers with vertebral fractures treated at our Pediatric Hospital from April 1, 2017 to March 31, 2023. We collected and compared data from three years before to three years after pandemic spreading analyzing vertebral fractures. Results: From April 1 2019 to March 31, 2020 141 cases of suicide attempt arrived at Bambino Gesù Pediatric Hospital emergency department. Five of these patients were suicidal jumpers but none had a vertebral fracture. From April 1, 2020 to March 31, 2023, 362 cases of suicide attempts arrived in the same emergency department and 19 were suicidal jumpers; 12 reported vertebral fractures and were included in this study. Mean age was 14 years. Most common level of fracture was L1. Four patients presented with preoperative neurologic impairment and two cases recovered completely. There was a transforaminal sacral fracture, a spinopelvic dissociation and an Anderson-D’Alonso C2 type II fracture. Two cases with thoracolumbar vertebral fractures were conservatively treated. Seven patients were treated by percutaneous pedicle fixation to achieve an indirect decompression and to restore a better sagittal balance. Only three patients needed an open spinal surgery by posterior approach and in two cases a posterior decompression was performed. One case with cervical fractures was treated by Halo-Vest. Conclusions: Recent literature highlights concern about the consequences of COVID-19 pandemic on pediatric population mental health. This is the first report that shows a significant increase in vertebral body fractures due to suicide jumping attempt. The comparison between three years pre and post pandemic is sufficient to demonstrate a sharp increase of these cases. This could be a new epidemiological phenomenon that could persist or even increase over time because of COVID-19 pandemic.

This article explores the possible ramifications of incorporating ideas from AEC Industry 6.0 into the design and construction of intelligent, environmentally friendly, and long-lasting structures. This statement highlights the need to shift away from the current methods seen in the AEC Industry 5.0 to effectively respond to the increasing requirement for creative and environmentally sustainable infrastructures. The preceding methodology, AEC Industry 6.0, has substantially improved the efficacy and sustainability of construction by using new technology, digitalization, and environmentally conscious methods. Extensive discussions have occurred on the various benefits of AEC Industry 5.0. These merits include heightened stakeholder involvement, increased efficiency via automation and robots, decision-making processes centered around data, and the optimization of resources. Nevertheless, this study also examines the obstacles linked to the complete adoption of AEC Industry 6.0. These challenges require proficient professionals who can effectively utilize contemporary technologies, manage diverse stakeholder technological competencies, establish interoperable systems and standards, and reinforce cybersecurity measures. This study examines the viability of implementing concepts from Industry 6.0 to create intelligent, sustainable, and environmentally friendly structures. The objective is to showcase the potentially revolutionary impact that these principles may have on the construction industry. This study explores the possible applications of AEC Industry 6.0 within the Architecture, Engineering, and Construction (AEC) sector, explicitly highlighting the anticipated industry-wide consequences of the forthcoming paradigm shift. This paper comprehensively examines big data analytics, the Internet of Things (IoT), and collaborative robots as they pertain to the AEC Industry 6.0. This research investigates the interplay between organizational dynamics, human actors, and robotic systems to provide light on the opportunities and obstacles associated with integrating AEC Industry 6.0 concepts into the construction of buildings.

Building on the carbon reduction targets agreed in the Paris Agreements, many nations have renewed their efforts toward achieving carbon neutrality by the year 2050. In line with this ambitious goal, nations are seeking to understand the appropriate combination of technologies which will enable the required reductions in such a way that they are appealing to investors. Around the globe, solar and wind power lead in terms of renewable energy deployment, while carbon capture and storage (CCS) is scaling up toward making a significant contribution to deep carbon cuts. Using Japan as a case study nation, this research proposes a linear optimization modeling approach to identify the potential contributions of renewables and CCS toward maximizing carbon reduction and identifying their economic merits over time. Results identify that the combination of these three technologies could enable a carbon dioxide emission reduction of between 55 and 67 percent in the energy sector by 2050 depending on resilience levels and CCS deployment regimes. Further reductions are likely to emerge with increased carbon pricing over time. The findings provide insights for energy system design, energy policy making and investment in carbon reducing technologies which underpin significant carbon reductions, while identifying potential regional social co-benefits.

The use of the un-indexed web, commonly known as the deep web and dark web, to commit or facilitate criminal activity has drastically increased over the past decade. The dark web is an infamously dangerous place where all kinds of criminal activities take place, despite advances in web forensics techniques, tools, and methodologies, few studies have formally tackled the dark and deep web forensics and the technical differences in terms of investigative techniques and artefacts identification and extraction. This research proposes a novel and comprehensive protocol to guide and assist digital forensics professionals in investigating crimes committed on or via the deep and dark web, the protocol named D2WFP establishes a new sequential approach for performing tasks and subtasks to improve the accuracy and effectiveness of current tools' output. Quantitative and qualitative research has been conducted by testing the protocol following a comprehensive and rigorous process in different scenarios and the obtained results show an apparent increase in the number of artefacts recovered when adopting D2WFP. The second contribution of D2WFP is the artefacts correlation and cross-validation which enables Digital Forensics professionals to better document and structure their analysis of host-based deep and dark web browsing artefacts.

Intra-abdominal pressure (IAP) elevation during capnoperitoneum can cause adverse cardiovascular and respiratory effects. This study aimed to determine if a sequentially increased IAP affects cardiovascular and respiratory variables in anesthetized dogs and evaluate the effects of constant rate infusion of dexmedetomidine (Dex) on cardiovascular and respiratory variables with increased IAP. Five dogs were anesthetized, instrumented, and the Veress needle was equipped to adjust the IAP using a carbonic anhydrase insufflator. Stabilization was conducted for 1 h, and physiological variables were measured in IAPs of 0, 5, 10, 15, and 20 mmHg and after desufflation. After the washout period, the dogs underwent similar procedures along with constant rate infusion of dexmedetomidine. Cardiovascular effects of increased IAP up to 20 mmHg were not significant in healthy beagle dogs and those administered with dexmedetomidine. In the control group, the arterial pressure slightly increased, but not statistically significant, at an IAP of 20 mmHg compared with that at baseline (mean arterial blood pressure, p = 0.399; systolic arterial blood pressure, p = 0.293; diastolic arterial blood pressure, p = 0.141). When comparing the control and dexmedetomidine groups, overall significant effects of dexmedetomidine were noted on heart rate, cardiac output, and systemic vascular resistance during the experiment. Respiratory effects were not affected by abdominal insufflation when compared between different IAPs and between the two groups. Overall, an increased IAP of until 20 mmHg did not significantly affect cardiovascular and respiratory variables in both control and dexmedetomidine groups. This study suggests that dexmedetomidine infusion administration is applicable in laparoscopic procedures in healthy dogs.

Researches are moving to iron and ammonia elimination from ground water. Here, we are using poly acrylic–poly acrylamide hydrogel which grafted with 3-chloroaniline. This copolymer was synthesized by addition polymerization. Effect of agitation time, dosage and adsorbents temperature on the removal process sensitivity has been investigated. The copolymer was described experientially and theoretically. Isothermal, kinetic adsorption models and were discussed. This hydrogel could be regenerated efficiently (98.3%removal of iron and 100% removal of ammonia). Density functional theory DFT method using B3LYP/6-311G(d,p),LANL2DZ level of the theory were managed to investigate stationary states of grafted co-polymer and the complexation energy of the hydrogel with the studied cations. NBO analysis is using DFT to investigate the negative centers on the hydrogel. The complexation energy showed selectively of hydrogel to studied cations.

The perceived poor performance of publicly traded companies on their sustainability commitments and the quality of sustainability reporting has prompted stakeholders to consider the economic, environmental, and social impacts of corporate activities. Economic activities have led to various threats in the form of climate change, pollution, greenhouse gas emissions, natural disasters, and other issues that have negatively impacted the environment and stakeholders. Companies are expected to report to stakeholders on their sustainability performance, but reality proves that present reporting falls below stakeholders’ expectations mainly due to its still voluntary nature. The present study aims to provide a literature review of the relationship between sustainability reporting and the role of companies governance, especially observing if climate change requirements and energy-needed changes are being accounted. Results highlight mixed evidence for the influence of board governance attributes, providing interesting insights for research advancement. The study has practical implications for businesses, regulators, governments, and other stakeholders in their policy deliberations and investment decisions. Further empirical studies are recommended to re-examine sustainability reporting using the variables identified as important factors and gaps in this study and other board characteristics to improve the generalizability of the results.

We have developed additive logistic models for the occurrence of lightning, large (≥ 2 cm), and very large (≥ 5 cm) hail to investigate the evolution of these hazards in the past, in the future, and for forecasting applications. The models, trained with lightning observations, hail reports, and predictors from atmospheric reanalysis, assign an hourly probability to any location and time on a 0.25° × 0.25° × 1-hourly grid as a function of reanalysis-derived predictor parameters, selected following an ingredients- based approach. The resulting hail models outperform the Significant Hail Parameter and the simulated climatological spatial distributions and annual cycles of lightning and hail are consistent with observations from storm report databases, radar, and lightning detection data. As a corollary result, CAPE released above the -10°C isotherm was found to be a more universally skilful predictor for large hail than CAPE. In the period 1950–2021, the models applied to the ERA5 reanalysis indicate significant increases of lightning and hail across most of Europe, primarily due to rising low-level moisture. The strongest modelled hail increases occur in northern Italy with increasing rapidity after 2010. Here, very large hail has become 3 times more likely than it was in the 1950s. Across North America trends are comparatively small, apart from isolated significant increases in the direct lee of the Rocky Mountains and across the Canadian Plains. In the southern Plains, a period of enhanced storm activity occurred in the 1980s and 1990s.

BMAP-27 peptide known to exert cytotoxic effects against cancer cells by membrane integrity disruption. In the current investigation, we aimed to study the role of the BMAP-27 peptide in reducing colon cancer cell proliferation and inducing apoptosis. This study utilized both primary and metastatic colon cancer cell lines (SW480 and SW620). Proliferation was measured using CCK-8, and cellular damage was analyzed by lactate dehydrogenase assay. The study assessed apoptosis, cell cycle, and proliferation by measuring the expression of CASPASE3, BAX, BCL-2, TP53, CDK-6, PCNA, Wnt11, AXIN1, and CTNNB1. Additionally, in-silico studies were conducted to determine the binding affinities of BMAP-27 with APC and β-catenin proteins. BMAP-27 peptide reduced colon cancer cell proliferation, upregulated CASPASE3, BAX, TP53, AXIN1 expression, and downregulated BCL-2, CDK-6, PCNA, WNT11, CTNNB1 in both colon cancer cell lines, however, demonstrated higher activity in primary than metastatic colon cancer cells. The molecular dynamic simulation revealed substantial binding affinity of the peptide to adenomatous polyposis coli and β-catenin proteins.BMAP-27 peptide effectively inhibited the proliferation and enhanced apoptosis in the primary than in metastatic colon cancer cells. In-silico findings suggest that BMAP-27 exhibits a strong binding affinity with APC and β-catenin, highlighting its potential role as an anti-colon cancer agent.

Aim: Streptococcus pneumoniae and influenza H1N1 virus are common organisms associated with human infections. These infections could play a significant role in immune regulation. The study was performed to analyse the genome sequences of these organisms with human genome and study its functional significance. Methods: The study was performed to analyse the overlapping of genome sequences in Streptococcus pneumoniae and Influenza (H1N1) virus against human genome sequences by BLASTn sequence analysis. The alignments are studied against the corresponding genes for their functional significance with DAVID and NDEx software.Results: Several hits or overlapping nucleotide segments were identified. Between streptococcus and homo sapiens 287 overlaps were identified, and among influenza and homo sapiens 124 hits were identified. A wide range of functional significance of these genes were identified, and the results are presented in this study. The results show insights into functional pathways and biological activities associated with the respective vaccinations or infections by these microorganisms. Conclusion: The common organisms like Streptococcus pneumoniae and Influenza H1N1 virus actively interact with the immune system and result in a wide range of immune regulations.

Wearable exoskeleton solutions for upper limb rehabilitation or assistance, particularly for the hand area, have become increasingly attractive to researchers, proving to be effective over time in treating hand movement impairments following various neurological diseases. In the present work, the development of a wearable exoskeleton-type device for active hand rehabilitation has been addressed, based on fluid actuators made of elastomeric material and on myoelectric control by capturing myoelectric signals from the forearm area. The flexion movement of the fingers (phalanges) is actively assisted by pneumatic actuation of the built-in actuators and the extension movement is assisted by a depressurization control of the actuator. The device has been designed to be as easy to use as possible, light in weight, and to provide a high degree of comfort when used by the patient for rehabilitation training or daily life activities (ADL), which can be performed in the comfort of one's own home.

Nanoporous films of Eu-doped organosilicate glass (OSG) have been synthesized using sol-gel technology and spin-coating, employing evaporation-induced self-assembly (EISA), on silicon wafers. The Eu doping is achieved by dissolution of Eu(NO3)3·6H2O in the precursor solution. The deposited films are characterized by using Fourier transform infrared (FTIR) spectroscopy, ellipsometric porosimetry (EP), X-ray photoelectron spectroscopy (XPS) and photoluminescence spectroscopy. It is observed that Eu doping makes the films more hydrophilic and reduces the pore size and open porosity. The reduction Eu3+ → Eu2+ occurs in the pores of OSG films, which is confirmed by depth profiling XPS. However, Eu3+ still presents on the film’s top surface. Presence of Eu3+ and Eu2+ gives characteristic luminescence emission in the range of 600‒630 nm (Eu3+) and 290‒400 nm (Eu2+). The Eu2+/Eu3+ concentrations ratio depends on CH3 groups concentration in the films. Moreover, concentration of Eu2+ ions in the pores can be reduced by exposure in inductively coupled (ICP) oxygen plasma. The observed shift of the luminescence spectra towards the UV region, in comparison to previously reported Eu-doped organosilicate films, can be attributed to the energy transfer occurring between the host material and Eu2+ ions.

In the light of current justified international concerns about pollution caused by both greenhouse gases and by current agricultural practices, as well as the management of livestock manure, zeolite rocks with a prevalent zeolite content (a mineral endowed with peculiar chemical-physical properties), are widely used worldwide. They have a high extraction potential and represent an effective and scientifically proven means of pollution control. Moreover, based on the results of countless laboratory and field experiments, zeolitites (in particular Italian chabazite) rich in potassium (K) but low in sodium (Na) and with high drainage and water retention properties, have an effective potential for environmental protection, reduction of fertilizers and irrigation water, and increase of agronomic production. In agriculture and horticulture, in particular, the permanent correction of agricultural soils and growing media with appropriate amounts of zeolitites makes it possible to reduce the input of synthetic fertilizers and water as well, in order to substantially increase yields in quantity and quality. However, there are few scientific articles describing the use of zeolite in agriculture and its benefits for farmers. This review is aimed at gaining a better insight into the application of zeolitites in agriculture, particularly in difficult climatic situations, and to provide more information on how these minerals can ensure both the reduction of the use of fertilizers and the increase of plant protection. In addition, details and explanations are provided on the term 'zeolitite' used in order to ensure higher quality agricultural products.

Persistent Organic Pollutants (POP) such as dichlorodimethyltrichloroethane (DDT) are present and ubiquitous in the environment due to their resilient nature. DDT is a prevalent endocrine disruptor still found in detectable amounts in organisms and the environment even after its use was banned in the 1970s. Studies show that exposure to DDT can cause adverse health effects in humans and animals, impairing fertility and increasing the risk of developing cancer. The aim of this work is to provide a comprehensive overview of the available literature on the effect of DDT and its metabolites on female reproductive tract, leading to infertility and cancer. Medline and Google Scholar were systematically searched to detect all relevant animal and human studies published in the last 20 years (January 2003 to February 2023) in accordance with the Preferred Reporting Items for Systematic Reviews and Meta-analyses (PRISMA) statement. In total, 38 studies were included for qualitative synthesis. This systematic search and review indicated that exposure to DDT is associated with female reproductive health decline and that DDT acts as a sufficient carcinogen instigating reproductive cancers.

Papain-like lysosomal cysteine proteases include 11 human cysteine cathepsins which act as endopeptidases and/or exopeptidases. They are involved in numerous physiological and pathological processes. Among them, only cathepsins B, H, C, and X/Z exhibit exopeptidase activity. Their activities are tightly regulated in various ways to prevent potentially hazardous effects on the cell. In this review, we focus on the structural and functional aspects of these four cysteine cathepsins and their role in neurodegeneration and cancer. Neurodegenerative disorders of aging share an endolysosomal dysfunction and accumulation and spread of oligomeric forms of neurotoxic proteins. The accumulation of various protein aggregates activates the microglia, thus inducing the activation and release of cysteine cathepsins and proinflammatory cytokines, leading to neurodegeneration. In cancer, cysteine cathepsins participate in tumor progression and metastasis. Tumor–stromal crosstalk leads to activation of the stroma and overexpression and secretion of proteolytic enzymes, triggering extracellular matrix degradation and the release of soluble factors. Activated stromal cells (i.e., macrophages, fibroblasts, mast cells) secrete additional growth factors, cytokines, and chemokines that are responsible for the regulation of processes leading to tumor progression and metastasis. Therefore, a better understanding of the role of cysteine cathepsins in neurodegeneration and cancer could lead to novel targeted therapeutic approaches.

Background/Aims: Conflicting results have been reported regarding the interaction between proton pump inhibitors (PPIs) and clopidogrel. We investigated whether concomitant PPI use influenced the risk of recurrence in patients with stroke and myocardial infarction (MI). Methods: This study used two databases for different designs, the Korean National Health Insurance Service (NHIS) database for a self-controlled case series design, and the national sample cohort of the NHIS database converted to the Observational Medical Outcomes Partnership-Common Data Model version for a cohort study. Results: In the PPI co-prescription group, recurrent hospitalization with stroke occurred in 17.6% of the 8,201 patients with history of stroke, and recurrent MI occurred in 17.1% of the 1,216 patients with history of MI during 1 year. According to the self-controlled case series, the overall relative risk (RR) of recurrent stroke was 2.09 [95% confidence interval (CI); 1.83-2.38], and the RR showed an increasing trend with PPI duration. In the cohort study, there was a higher incidence of recurrent stroke in the PPI co-prescription group [Hazard ratio (HR): 1.34, 95% CI: 1.01-1.76, P=0.04]. The overall RR of recurrent MI was 1.47 (95% CI; 1.02-2.11) in the self-controlled case series; however, there was no statistically significant difference in recurrent MI in the cohort study (HR:1.42, 95% CI:0.79-2.49, P=0.23). The impact of individual PPIs on stroke and MI showed different patterns. Conclusions: PPI co-prescription with clopidogrel was associated with recurrent stroke; however, its association with recurrent MI remains inconclusive. The influence of individual PPIs should be clarified in the future.

Among all Brazilian economic sectors, the livestock sector stands out due to its large production and high export volume. However, beef production is associated to significant environmental impacts, such as deforestation and greenhouse gas (GHG) emission. The Paris Agreement was settled to avoid that global mean temperature rise up to 1.5 – 2º C by 2100. In 2020, Brazil committed in its nationally determined contribution (NDC) to reduce its GHG emission by 43% until 2030. This study aims to identify the association of beef production and beef cattle emissions, as well as assess predictive GHG emission scenarios for 2030 and value these emissions. To translate the environmental impacts of beef production into economic impacts, and thus amplify the discussion, we valued GHG emissions using the social cost of carbon (SCC). The results showed that the business as usual (BAU) GHG emission derived from beef production would range between 0.423 and 0.634 GtCO₂e in 2030, whereas the maximum emission estimated to meet the NDC should be 0.257 GtCO₂e. The SCC revealed the opportunity to reduce between US $18.8 and $42.6 billion in the cost of BAU emissions from beef production in 2030 if the NDC is met. Lastly, assessing a scenario where climate targets and beef exports are prioritized, between 2-10 kg of beef per capita would be available in the domestic market in 2030. Our results reveal the need and urgency of changes in livestock production to emit less GHG per kg of beef produced, and the avoided monetary cost of reducing emissions.

Development of agriculture in Russia and Belarus is based on the practical implementation of "smart" systems in agriculture based on the use of modern wireless, intelligent technologies and Internet of Things. This review presents research articles (mainly, in Russian) published in the period of 2013 – 2022 on the use of cloud technologies and Internet of Things for the development of agriculture in Russia and Belarus. An analysis of the use of cloud technologies and Internet of Things in the modern world is given on the basis of research articles and reviews published in English in the period of 2017 – 2022. The main directions of digitalization of modern agriculture are listed. The uses of cloud technologies and Internet of Things in agriculture are described along with promising directions for further research and applications.

The quality and safety of fermented milk products, which make up a sizeable portion of human nutrition, are greatly influenced by both the milk itself and the starting cultures employed to ferment it. Lactic acid bacteria (LAB) create a variety of metabolites throughout the fermentation process, altering the organoleptic properties of the substrates. The final product’s nutritional value and digestibility are enhanced by fermentation of the raw materials, which also adds vitamins, vital amino acids, and fatty acids. The quality and safety of fermented milk products, which make up a sizeable portion of human nutrition, are greatly influenced by both the milk itself and the starting cultures employed to ferment it. The inhibition of the growth of pathogenic microbes, which lowers the likelihood of the emergence of foodborne diseases, is another crucial function of LAB. A variety of pathogenic bacteria are frequently present in raw (unpasteurized) milk, and other raw materials; these pathogenic bacteria should be removed during the fermentation process. As a result, a variety of LAB metabolites, such as hydrogen peroxide, organic acids, and bacteriocins, function as bio preservative agents, enhancing food safety and lengthening the shelf life of the finished products.

Diverse development models, including waterfall development, iterative development, and agile development, have been put forth and implemented across real-world contexts. When engaging in discussions on project management, the examination and exploration of development models assume paramount importance and are integral. This paper embarks upon an investigation and scrutiny of these development models, culminating in the proposition of "Quasi" Development Models: Quasi-Waterfall and Quasi-Agile.

Angiotensin II (Ang II) plays a role in several inflammatory diseases and is capable of inducing the release of inflammatory mediators in several cell types. The objective was to investigate the potential of Ang II to induce mRNA expression of inflammatory mediators by cultured primary human periodontal cells. A synergistic effect of a co-treatment with Ang II and IL1β on mRNA expression of inflammatory mediators was also explored. Primary cultures of human fibroblast-like cells isolated from gingival and periodontal ligament tissues from 3 subjects were established using explant techniques. Immunophenotyping of STRO-1, Ang II type 1 receptor (AT1R) and Ang II type 2 receptor (AT2R) was performed by flow cytometry analysis. Cell cultures were challenged with Ang II (1M) for 3, 6 and 24h with or without a co-treatment with IL1β (0.1ng/mL) for 24h. mRNA expression of inflammatory mediators was performed by real time quantitative polymerase chain reaction (RT-qPCR). We present, for the first time, a precise quantification for AT1R and AT2R on human gingival and periodontal fibroblast-like cell types; the percentage of positive immunostaining compared to the total population of cells varied from 3.35% through 5.29% for AT1R and 2.97% through 4.57% for AT2R. Ang II slightly upregulated mRNA expression of IL6 and CCL2/MCP1 in gingival cells and IL8 and PTGS2/COX2 in periodontal ligament cells. IL1β induced upregulation of IL8, IL6 CCL2/MCP1, PTGS2/COX2 and IL1β mRNA in both cell types. Co-treatment with Ang II and IL1β did not show a synergistic effect under these experimental conditions. Ang II shows a low potential to induce mRNA upregulation of inflammatory mediators in cultured primary human gingival and periodontal ligament cells, most likely due to the low percentage of Ang II receptors in such cells, and no synergistic effect with the co-treatment with IL1β.

A nation's vitality, dynamism and economic strength will always be related to its demographic component, and a healthy and vigorous population will ensure its long-term future. However, the current realities demonstrate the existence of an obvious population decrement at the level of the entire country particularly triggered by the birth rate decrease and the high demographic aging to which other factors add ap specific to local communities, which in their turn determined a particular type of demographic behaviour. Therefore we aim to analyze those elements with a major population dynamics impact such as family stability and demographic potential that can generate a specific demographic behaviour, as a result of the major changes that have occurred in the last period of time. These elements are translated through several demographic indicators that characterize the family, such as the nuptiality index and the divorce index whose evolution was registered and analyzed for the period 1992-2021. Their evolution indicates the demographic potential of Romania, as well as of Bihor county.

Multimodal traveling is expected to enhance mobility for users, reduce inequalities of car ownership and reduce emissions. In the same context, ride-sharing aims to minimize negative impacts related to emissions, reduce travelling costs and congestion, and increase passenger vehicle occupancy, and public transit ridership when planned for first/last mile trips. The goal of this study is to present the planning of a multimodal pilot demonstration and the challenges that emerged during and after its implementation in Athens, Greece. The demo aims to enhance the connection of low-density Attica Region areas to public transport (PT) modes, and specifically to the metro, through the provision of demand responsive ride-sharing services. During the demo period two different applications were utilized: the “Travel Companion” app and the “Driver Companion” app, which refer to passengers and drivers of the ride-sharing service. Identification of demo participants is performed through a Stated Preference (SP) experiment. Results of the demo implementation, as well as challenges that were faced show that although participants are willing to try new mobility solutions, the readiness and reliability of the new service are essential attributes towards maintaining existing users and engaging new ones.

Inhibition of quorum sensing (QS)-dependent biofilm formation and virulence is extensively investigated as a novel approach to combat bacterial pathogens by impeding their ability to cause antibiotic-tolerant diseases. Such strategies are considered a promising alternative to conventional antibacterial therapy since interrupting the central cell-to-cell communication system imposes less selective pressure on the target pathogen. In this study, novel hybrid compounds composed of anthranilic acids substituted with halogens at different positions of the phenyl ring, and 4-(2-aminoethyl/4-aminobuthyl)amino-7-chloroquinoline linked via 1,3,4-oxadiazole were synthesized using standard procedures. Their anti-QS activities were evaluated using Chromobacterium violaceum ATCC31532 (anti-biofilm and bactericidal activities) and Pseudomonas aeruginosa PAO1 (anti-biofilm/-virulence activities). The results showed that compounds 15–19 and 23 inhibited the production of violacein, the QS-inducible pigment, in C. violaceum to a similar extent as the model QS inhibitor - quercetin (83.5–90%). Compound 15 exhibited the strongest effect on P. aeruginosa in the anti-biofilm screening, reducing its ability to form biofilm by almost 50%, while compounds 16 and 19 were able to reduce the biofilm formation by approximately 30%. However, compound 23 did not demonstrate significant anti-biofilm activity and only inhibited pyocyanin production in P. aeruginosa. In conclusion, this study suggests that 1,3,4-oxadiazoles 15, 16, and 19 are the most promising compounds for future research as novel QS inhibitors against Gram-negative bacteria equipped with different QS signaling pathways.

This study investigated the mechanical properties and fatigue behavior of FH36 steel plate rolled in different directions. By adopting a sequential rolling process in the rolling direction (RD) and transverse direction (TD), the differences in properties between RD and TD were eliminated, resulting in nearly identical tensile properties. The steel plate exhibited a yield strength of approximately 420 MPa, a tensile strength of approximately 506 MPa, and an elongation of approximately 25%. Fatigue tests conducted at room temperature and -60℃ showed a fatigue limit of the maximum stress of 488 MPa at room temperature and 500 MPa at -60℃, indicating improved low-temperature fatigue performance. The fracture surfaces displayed distinct characteristics, such as oblique shearing fractures for high-cycle fatigue and cup-cone shape fractures for low-cycle fatigue. The fatigue source zone were both on the surface of the specimens. As the maximum stress increased, the area of the crack propagation zone for high-cycle fatigue decreased, while the area of the final fracture zone, the number of dimples and the proportion of the LAGBs increased.

Although numerous citrus varieties have recently been developed to enhance their quality, information on their quality characteristics is limited. We assessed the quality characteristics of Yellowball, a novel citrus variety, by evaluating its appearance, storability, sensory properties, functionality, and metabolite profiles and comparing these characteristics with those of its parent varieties: Haruka and Kiyomi. The metabolite profiles between the citrus varieties differed significantly, resulting in distinct physicochemical and functional qualities. The storability of Yellowball was significantly increased compared with that of its parent varieties owing to its strong antifungal activity and unique peel morphology, including the stoma and albedo layers. While we did not investigate the volatile compounds, overall functional activities, and detailed characteristics of each metabolite, our data provide valuable insights into the relationship between citrus metabolites, peel morphology, physicochemical properties, and storability and demonstrate the potential of Yellowball as a promising variety in the citrus industry.

The concept of artisanal products has been largely discussed mainly due to concerns about the inappropriate use of the term that may cause confusion for the consumers. Cheeses are important food models to evaluate consumers’ and producers’ perception about artisanal foods worldwide. Thus, the objective of the present study was to evaluate the perception of consumers and cheesemakers towards artisan foods, focusing on artisanal cheeses. For this purpose, two focus group were performed either with cheese producers and with consumers to discuss the topic. Colonial and Serrano cheeses, traditional and cultural dairy products in Brazil, were used as food model for the discussion. Producers and consumers related artisan foods to small scale of production, handicraft and freshness. Affective memories were also an important issue related to artisanal cheeses. For cheesemakers, artisan cheeses must be produced with unpasteurized milk, which was not cited by consumers. Consumers disclosed the intention of pay a premium price for food products that present artisan seals on front-package-label, mainly due to the guarantee of acquiring a quality product. The confusion about artisanal and traditional food concepts were observed, which is a subject to be deeply evaluated further. The findings provide useful implications to policy makers and institutions that can influence citizens’ attitudes and consumption patterns of artisanal products.

The present work was performed to evaluate the levels of phytochemical constituents and the antioxidant and antibacterial properties of marine red seaweed (Kappaphycus alvarezii) and seagrass (Cymodocea serrulata). Quantitative phytochemical analysis, antioxidant activity and antimicrobial activity against 5 potential pathogenic bacteria was investigated. In both cases were found presence of flavonoids, tannins, phenolic compounds, glycosides, steroids, carbohydrates and ashes. Alkaloids were only found in K. alvarezii, buy not in C. serrulata. The antimicrobial properties of both K. alvarezii and C. serrulata chloroform extracts were found to be antagonis-tically effective against the gram-positive bacterium Bacillus subtilis and the gram-negative bacterium Vibrio parahaemolyticus, Vibrio alginolyticus, Vibrio harveyi and Klebsiella pneu-moniae. GC‒MS analysis revealed the presence of 94 bioactive compounds in K. alvarezii and 104 C. serrulata, including phenol, decane, dodecane, hexadecane, vanillin, heptadecane, diphenyla-mine, benzophenone, octadecanoic acid, dotriaconate, benzene, phytol, butanoic acid, and 2-hydroxyl-ethyl ether, which played a vital role in antioxidant and antibacterial activities. Thus, in view of the results, both K. alvarezii and C. serrulata could be considered as sources of ingre-dients with appreciable nutritional and medicinal value.

We aimed to determine if infection-associated urine biomarkers can differentiate true urinary tract infection (UTI) from non-UTI controls. Midstream clean-catch urine samples were collected from asymptomatic volunteers and symptomatic subjects > 60 years old diagnosed with presumptive UTI in a specialty setting. Microbial identification and density were assessed using multiplex PCR/pooled antibiotic susceptibility test (M-PCR/P-AST) and standard urine culture (SUC). Three biomarkers (NGAL, IL-8, and IL-1β) were measured in the same urine specimens. Definitive UTI cases were symptomatic and had positive microorganism detection by SUC and M-PCR, while definitive non-UTI cases were asymptomatic volunteers regardless of microbial detection. We observed a strong positive correlation (R2 ≈ 1) between microbial density and the biomarkers NGAL, IL-8, and IL-1β. Biomarker consensus criteria of two or more positive biomarkers had sensitivity 90.2%, specificity 91.2%, positive predictive value (PPV) 91.7%, negative predictive value (NPV) 89.7%, accuracy 90.7%, positive likelihood ratio of 10.28, and negative likelihood ratio of 0.11 in differentiating definitive UTI from non-UTI cases, regardless of microbial density. NGAL, IL-8, and IL-1β showed a significant elevation in symptomatic cases with positive microbe identification compared to asymptomatic cases with or without microbe identification. Biomarker consensus exhibited high accuracy in distinguishing UTI from non-UTI cases.

This qualitative study unveils the intricate interplay between blended learning, language and literature learning, internationalization, and the development of 21st century skills within the realm of higher education. Set against the backdrop of the environment of St. Michael's College in Iligan City, this exploration seeks to unravel the profound significance and transformative implications of these educational dimensions. By delving into the rich perspectives and experiences of 30 college students, this study addresses critical gaps in the literature and sheds light on the potential of these integrated elements. Guided by a robust theoretical framework that amalgamates renowned scholars' insights on blended learning, language acquisition, internationalization, and 21st century skills, the study employs a qualitative research design, employing interviews, observations, and document analysis. The findings illuminate the dynamic nature of blended learning, empowering students with enhanced engagement, flexibility, and accessibility in language and literature education. The incorporation of diverse literary texts and cultural perspectives fosters intercultural competence and global awareness. Moreover, the study underscores the cultivation of critical 21st century skills through immersive learning experiences. Drawing upon the insights gained, the study provides practical recommendations for educators and curriculum designers to harness the potential of blended learning, foster diversity in literary texts, and facilitate the application of 21st century skills. Recognizing the inherent limitations, including the specific context of St. Michael's College and the modest sample size, this study encourages future research to explore broader contexts and diverse participant cohorts. Overall, this illuminating study contributes to the scholarly discourse on integrating blended learning, language and literature learning, internationalization, and 21st century skills in college education. It beckons educators and policymakers to embark on a transformative journey, nurturing an enlightened future where students are equipped with the competencies to navigate the complexities of the 21st century.

The biological synthesis of nanoparticles has been emerging as an environmentally benign and eco-friendly method owing to its cost-effectiveness and high efficiency. Recently, the biological synthesis of semiconductor and metal-doped semiconductor nanoparticles with enhanced photocatalytic degradation efficiency and anticancer and antibacterial properties have gained tremendous attention. In pursuit of this purpose, for the first time, we biosynthesized zinc oxide (ZnO) and silver/ZnO nanocomposites (NCs) as semiconductor and metal-doped semiconductor nanoparticles, respectively, using the cell-free filtrate (CFF) of Lysinibacillus sphaericus bacterium. The biosynthesized ZnO and Ag/ZnO were characterized by various techniques such as ultraviolet-visible spectroscopy, X-ray diffraction, Fourier-transform Infrared spectroscopy, Field-emission scanning electron microscopy, transmission electron microscopy, and photoluminescence spectroscopy. The photocatalytic degradation potential of these semiconductor/metal-semiconductor nanoparticles was evaluated against the degradation of azo dye methylene blue (MB) under simulated solar irradiation. Ag/ZnO showed 90.7 ± 0.91% photocatalytic degradation of MB, compared to 50.7 ± 0.53% by ZnO in 120 min. The cytotoxicity of ZnO and Ag/ZnO on human cervical HeLa cancer cells was determined using an MTT assay. Both nanomaterials exhibited cytotoxicity in a concentration-dependent and time-dependent manner on HeLa cells. The antibacterial activity was also determined against Gram-negative (Escherichia coli) and Gram-positive (Staphylococcus aureus). Compared to ZnO, Ag/ZnO NPs showed higher antibacterial activity. Hence, the biosynthesis of semiconductor nanoparticles could be a promising strategy for developing hybrid metal/semiconductor nanomaterials for different biomedical and environmental applications.

Significant attribute selection in machine learning is one of the key aspects aimed at simplifying the problem and reducing its dimensionality, and consequently speeding up computation. This paper proposes new algorithms for selecting not only relevant features but also for evaluating and selecting a subset of relevant objects in a dataset. Both algorithms are mainly based on the use of a fuzzy approach. The research presented here yielded preliminary results of a new approach to the problem of selecting relevant attributes and objects, and, in fact, to selecting appropriate ranges of their values. Detailed results obtained on the Sonar dataset show the positive effects of this approach. Moreover, the observed results may suggest the effectiveness of the proposed method in terms of identifying a subset of truly relevant attributes from among those identified by traditional feature selection methods.

In this paper, a distinction is first made between environmental, sustainable and green chemistry; the last two are then examined in relation to the more general problem of the environmental education. A brief historical digression on the STS (Science, Technology and Society) movement tries to dissect the reasons why chemistry is seen by the general public as a problem, not as a decisive resource for the realization of the ecological transition. Although sustainable and green chemistry can be decisive in overcoming the insularity of chemical disciplines in the high school, it fails to effectively embed itself in educational practices. Specific operational goals, supporting a real scientifical and technological literacy in sustainable and green chemistry, can help chemical educators. They are provided at the end of an examination of the founding axes of sustainable and green chemistry, according to the criteria of scientific and technological literacy.

Grain shape and chalkiness are important appearance quality traits of rice, which also affect the yield and milling quality. In this study, 190 F2 families derived from the cross between Hua 5178S and Hua 611 were sequenced to construct a genetic linkage map. Combined with F2 and F2:3 generations grain shape and chalkiness phenotype, a total of 15 QTL were detected. There are 8 grain shape QTL distributed on chromosomes 2, 5, 6, 8, and 10; 7 chalkiness QTL distributed on chromosomes 2, 3, and 6. A QTL cluster affecting multiple chalkiness traits was found on chromosome 6, qWBR6.1, qWCR6 and qCR6 were selected for genetic effect verification. It was found that qWBR6.1, qWCR6 and qCR6 explained 13% and 24%, and 29% of the phenotypic variations respectively, and qWCR6 and qCR6 were co-mapped. This study laid a foundation for further cloning of rice appearance quality genes.

Bacterial Extracellular Vesicles (BEVs) generated from the bacteria has high feasibility of intracellular interactions with other cells, can be used as a cargo to deliver any therapeutic substances like monoclonal antibodies, proteins, plasmids, siRNA and small molecules for the treatment of neurodegenerative diseases (NDs). BEVs have a high ability for delivering therapeutic molecules across the blood-brain barrier to treat Alzheimer's Disease (AD) via various mechanisms. In this review, we have sum up in-depth research details of the role and advancement of BEVs in NDs, AD and its Therapeutics. Moreover, details about offensive and defensive functions of BEVs in ND pathogenesis and examine the critical BEV networks in the microbiome-gut-brain axis and their role in neurodegenerative disorders. Additionally determining the roles of BEVs in the neuroimmune system and their interaction with neurodegenerative disorders and exploring the risk factors of BEVs in the autophagy-lysosomal pathway and their possible effects on neurodegenerative disorders are summarised in detail. In conclusion, this review seeks to contribute to a better understanding of the potential function of BEVs in NDs and to identify new therapeutic intervention strategies.

Sleep timing is one of the dimensions of sleep that refers to the time of day when sleep occurs. It was included in sleep-related research because of the potential associations between overweight and consumption of meals and snacks. This cross-sectional study aimed to investigate associations between sleep timing, meal and snack consumption, and weight status in 1333 schoolchildren aged 7-14 years. The midpoint of sleep was used as a sleep timing measure obtained by the midpoint between bedtime and wake-up time and classify as Early, intermediate, and Late. Schoolchildren in the Early group were less likely to be overweight (OR: 0.83, 95% CI 0.69; 0.99), had higher odds of mid-morning snack consumption (OR: 1.95, 95%CI 1.56; 2.44) and lower probability to consume the evening snack (OR: 0.75, 95%CI 0.59; 0.94) compared with the Intermediate group. The Late group had lower odds of mid-morning snack consumption (OR: 0.67, 95%CI 0.55, 0.80) than the Intermediate group. The consumption of mid-morning and evening snacks was associated with the Early and the Late midpoint of sleep. These results suggest that bedtime and wake-up time are relevant to consuming meals and snacks and may also be related to a greater probability of being overweight in children and adolescents.

In the depths of inquiry, where thoughts unfurl like tendrils of smoke, this qualitative study ventures into the enigmatic realms of diaspora, migration, and the elusive brain drain within the tapestry of the Philippines. It is a journey guided by a sturdy theoretical framework, traversing the multifaceted dimensions of society, culture, and psyche. Here, the lens expands beyond the confines of economics, delving into the essence of these phenomena, seeking profound insights that dance beneath the surface. Through meticulous analysis of empirical data, hidden truths emerge, illuminating the intricate dynamics of diaspora, the intricate patterns of migration, and the intricate threads that shape migration decisions. Moreover, it peers into the intricate tapestry of impacts that diaspora and migration have on both sending and receiving societies, casting a beam of understanding upon their social, economic, and cultural implications. The study, in its wisdom, extends its reach to offer valuable policy recommendations, serving as a compass for stakeholders and decision-makers. It emphasizes the pivotal importance of harnessing the vast potential held within diaspora, fostering social integration, and bridging the gaps in knowledge that lie in wait. In its entirety, this research harmonizes with the existing body of knowledge, blending seamlessly with the symphony of understanding, and ignites the path towards evidence-based strategies that pave the way for sustainable development and the well-being of societies near and far.

NAD⁺ is known classically as a metabolite that participates in catabolic and anabolic pathways throughout the metabolism that is taught to students in introductory biochemistry courses. However, non-classical studies starting over a decade ago found that NAD⁺ is also involved in higher order functions, in part because of its involvement in the activation of SIRTs and the support of the mitochondrial unfolded protein response. Many studies since have suggested that NAD⁺ is involved in an extensive spectrum of human pathologies, including neurodegenerative disorders, cardiomyopathy, obesity, and diabetes, Further, healthy aging and longevity appear to be closely related to NAD⁺ and its related metabolites, including NAR and NMN. Together, these studies show that this system has value as a dietary supplement to improve general health overall, as well as mitigating specific disease conditions. Accordingly, many are now recommending the consumption of materials in this system as dietary supplements. Nicotinamide riboside (NAR) appears to have special value in this regard. It appears to be better tolerated than other molecules in this system, as well as better pharmacodynamics and greater potency. Unfortunately, NAR is a reactive molecule, often unstable during its manufacturing, transport, and storage. Indeed, HPLC analyses of many commercial samples of NAR shows that they contain substantial amounts of material that are not, in fact, NAR. In some of these commercial preparations, NAR is a minority component. Therefore, more stable derivatives of NAR that are easily converted upon consumption into NAR are therefore desired. Recently work related to prebiotic chemistry provided the borate derivative of NAR. NARB is considerably more stable than NAR itself. However, immediately upon consumption, the borate dissociates from NARB, and is lost in the body through dilution and binding to other species, notably carbohydrates such as fructose and glucose. The NAR left behind is expected to behave pharmacologically in ways identical to NAR itself. This review provides a comprehensive summary (through Q1 of 2023) of literature that makes the case for the consumption of NAR as a dietary supplement. It then summarizes the challenges of delivering quality NAR to consumers using standard synthesis, manufacture, shipping, and storage approaches. It concludes by outlining the advantages of NAR-borate in these processes.

In order to better understand the extent to which global climate variability is linked to the frequency and intensity of heat waves and overall changes in temperature throughout the United States (US), correlations between long-term monthly mean, minimum, and maximum temperatures measured at sites throughout the contiguous US and low-frequency variability of multiple climate indices (CIs) are analyzed over the period 1948 to 2018 using correlation analysis. The Pearson’s correlation coefficient is used to assess correlation strength, while Leave-One-Out Cross-Validation and a bootstrapping technique (p-value) are used to address potential serial and spurious correlation and assess the significance of each correlation. Three parameters defined the sliding windows over which surface temperature and CI values were averaged: window size, lag time between the temperature and CI windows, and the beginning month of the temperature window. A 60-month sliding window size and 0 lag time resulted in the strongest correlations overall; beginning months were optimized on an individual site basis. Strong (r &gt;= 0.60) and significant (p-value &lt;= 0.05) correlations were identified. The Western Hemisphere Warm Pool (WHWP) and El Niño/Southern Oscillation (ENSO) exhibited the strongest links to temperatures in the western US, tropical Atlantic sea surface temperatures to temperatures in the central US, the WHWP to temperatures throughout much of the eastern US, and atmospheric patterns over the northern Atlantic to temperatures in the Northeast and Southeast. The final results were compared to results from previous studies focused on precipitation and coastal sea levels. Regional consistency was found regarding links between the northern Atlantic and overall weather and coastal sea levels in the Northeast and Southeast as well as on weather in the upper Midwest. Though the MJO and WHWP revealed dominant links with precipitation and temperature, respectively, throughout the West, ENSO revealed consistent links to sea levels and surface temperatures along the West Coast. These results help focus future research regarding specific mechanisms of climate variability that appear the exhibit strong links to US regional weather and sea level variability and prediction.

In the present study we tested the effect of small molecular weight redox molecules on collagen-induced platelet aggregation. We used N-acetylcysteine amide (AD4), the amide form of N-acetylcysteine (NAC), a thiol antioxidant with improved lipophilicity and bio-availability compared to NAC, and the thioredoxin mimetics (TXM) peptides, TXM-CB3, TXM-CB13, and TXM-CB30. All compounds significantly inhibited platelet aggregation induced by collagen, with TXM-peptides and AD4 being more effective than NAC. The levels of TxB2 and 12-HETE, the main metabolites derived from the cyclooxygenase and lipoxygenase pathways following platelet activation, were significantly reduced in the presence of AD4, TXM-peptides, or NAC, when tested at the highest concentration (0.6 mM). The effect of AD4, TXM-peptides, and NAC was tested also on the clotting time (CT) of whole blood. TXM-CB3 and TXM-CB30 showed the highest increase of CT. Furthermore, two representative compounds, TXM-CB3, and NAC, showed an increase in the an-ti-oxidant free sulfhydryl groups of plasma detected by Ellman’s method, suggesting a contribution of plasma factors to the antiaggregating effects. Our results suggest that these small molecular weight redox peptides might become useful for the prevention and/or treatment of oxidative stress conditions associated with platelet activation.

Living with a chronic disease involves a variety of daily life limitations that severely affect people in their daily life. Identifying and promoting self-management strategies may improve health outcomes and increase patients’ autonomy. The purpose of the present study was to explore the perceived limitations and self-management strategies of elder patients suffering from chronic diseases. An inductive content analysis was applied, with a purposive sampling of 21 patients living with chronic conditions. Data was collected through semi-structured interviews. Two main-categories were emerged from content analysis, namely “Limitations of daily life” and “Disease Management”. Physical restrictions and negative feelings were referred to as daily burdens, while scheduling and self-care, supporting environment and technology were related to disease management. Information, training and provision of digital literacy may increase patients' self-efficacy in managing their chronic condition.

Dietary inclusion of trace minerals (TM), such as copper (Cu), manganese (Mn) and zinc (Zn) is of importance to cover the ever-evolving requirements for growth, production, and reproduction in ruminants. Various sources of TM are commercially available, such as inorganic (ITM), organic (OTM) or hydroxy (HTM) forms, however their bioavailability and efficiency to improve ruminant zootechnical parameters may be highly influenced by ruminal solubility and effects on the rumen environment. The objective of this review was to compile the most up-to-date information on the ruminal solubility of ITM, OTM and HTM, and their effects on fermentation parameters and rumen microbiota, aiming to support specialists from the animal feed industry when choosing TM products for ruminant supplementation. Some commonly used ITM sources, like sulfates, have a high ruminal solubility, while oxides are less soluble. The ruminal solubility of OTM is mostly found to be high, however data on these TM forms are still lacking. Regarding HTM, ruminal solubility is reported to be low, nevertheless results are inconsistent. Considering rumen fermentation, ITM show a negative effect, OTM might improve, while HTM do not affect parameters like dry matter degradability, volatile fatty acid production, pH, or microbial protein synthesis. As to rumen microbiota, ITM do not affect microbial populations; OTM could decrease abundance of some specific bacteria, like fibrolytic microorganisms, while studies with HTM are missing or inconclusive. Further research is necessary to better understand the ruminal solubility kinetics of TM sources and the different interactions with fermentation parameters and rumen microbiota to successfully apply precision TM supplementation of ruminants, tackling deficiency occurrences.

Since the global request for freight transportation is continuously increasing to face the requirements of the modern economy, 5G infrastructures and companion technologies are becoming essential to support the digital transformation in logistics and transportation, in particular for their capability to allow data collection through a multitude of different sources across the supply chain, improving the connectivity and making more effective the secure and reliable data sharing. The objective of this work is to assess the penetration and implementation levels of innovative technologies to optimize port operations, by interviewing a set of actors and stakeholders directly involved in the logistics chain of ports.

Smart Living, an increasingly prominent concept, entails incorporating sophisticated technologies in homes and urban environments to elevate the quality of life for citizens. A critical success factor for Smart Living services and applications, from energy management to healthcare and transportation, is the efficacy of human action recognition (HAR). HAR, rooted in computer vision, seeks to identify human actions and activities using visual data and various sensor modalities. This paper extensively reviews the literature on HAR in Smart Living services and applications, amalgamating key contributions and challenges while providing insights into future research directions. The review delves into the essential aspects of Smart Living, the state of the art in HAR, and the potential societal implications of this technology. Moreover, the paper meticulously examines the primary application sectors in Smart Living that stand to gain from HAR, such as smart homes, smart healthcare, and smart cities. By underscoring the significance of the four dimensions of Context Awareness, Data Availability, Personalization, and Privacy in HAR, this paper serves as a valuable resource for researchers and practitioners striving to advance Smart Living services and applications.

With the introduction of more and more monoclonal antibodies selectively targeting various mediators of the immune-system, together with Janus-Kinase (JAK)-inhibitors with variable affinities towards different JAK subtypes, the available therapeutic options for the treatment of inflammatory bowel diseases (IBD) have undergone an acceleration in the last five years. On the other hand, the prevalence of IBD patients over 65-years of age is steadily increasing and, with this, there is a large population of patients that presents more comorbidities, polypharmacy, and, more frequently, frailty compared to younger patients, exposing them to potentially major risks for adverse events deriving from newer therapies, e.g. infections, cardiovascular risks, and malignancies. Unfortunately, pivotal trials for the commercialization of new therapies rarely include older IBD patients and those with serious comorbidities are virtually excluded. In the present review, we focus on existing literature from pivotal trials and real-world studies, analyzing data on efficacy/effectiveness and safety of newer therapies in older IBD patients with special emphasis on comorbidities and frailty, two distinct but intercorrelated aspects of the older population since age by itself seems to be of minor importance.

Cancer cells show an increased glutamine consumption. The glutaminase (GLS) enzyme controls a limiting step in the glutamine catabolism. Breast tumors, especially the triple negative subtype, have a high expression of GLS. Our recent study demonstrated that GLS activity and ammonia production are inhibited by Sirtuin 5 (SIRT5). We have developed MC3138, a selective SIRT5 activator. Treatment with MC3138 mimicked the deacetylation effect mediated by SIRT5 overexpression. Moreover, GLS activity is regulated by inorganic phosphate (Pi). Considering the interconnected role of GLS, SIRT5 and Pi for cancer growth, our hypothesis is that activation of SIRT5 and reduction of Pi could represent a valid anti-tumoral strategy. Treating cells with MC3138 and lanthanum acetate, a Pi chelator, decreased cell viability and clonogenicity. We also observed a modulation of LC3 and ULK1 with MC3138 and lanthanum acetate. Interestingly, inhibition of mitophagy marker BNIP3 was observed only in the presence of MC3138. Such autophagy and mitophagy modulation was accompanied by an increase of cytosolic and mitochondrial reactive oxygen species (ROS). In conclusion, our results show how SIRT5 activation and/or Pi binding can represent a valid strategy to inhibit cell proliferation by reducing glutamine metabolism and mitophagy leading to a deleterious accumulation of ROS.

Proactivity is a particularly important attribute of knowledge-intensive organizations, where the work required to increase the potential of knowledge-intensive employees is crucial. A priority challenge for these firms is also to understand the increasing importance of the functioning of cognitive mechanisms leading to increased knowledge workers' well-being following the implementation of the psychological contract. The aim of this article is to identify the relationship between inclusive leadership, the fulfillment of the psychological contract, two dimensions of well-being: workplace and life well-being and knowledge workers' proactivity. Based on survey data collected through the CAWI method from 1.000 knowledge workers employed in Polish companies in the business services sector, the research hypotheses were tested using a stepwise equation modelling (SEM) technique, leading to a model containing all the main constructs. The results obtained indicate that inclusive leadership positively impacts the fulfillment of the psychological contract. Furthermore, the fulfillment of the psychological contract positively affects proactive working behavior with and the wellbeing of knowledge workers. Along with proactive work behavior, two dimensions of well-being, were examined as outcome variables. The analysis also shows that knowledge-intensive organizations, intending to build the proactivity of their employees and nurture a high level of well-being in their lives and in the workplace, should take care to fulfil the expectations and obligations of the psychological contract. However, one way to achieve this is for managers to use an inclusive management style, which supports an atmosphere of a safe working environment in a diverse setting and leads to employees feeling comfortable sharing their opinions and ideas. The study of inclusive leadership in the context of knowledge-intensive organizations provides human resource professionals and employee man-agers with important insights into how inclusive leadership can effectively contribute to the psychological contract, which will consequently lead to proactive work behavior and also improve employees' workplace and life well-being.

Abstract: Background: Adolescents frequently self-report pain, according to epidemiological research. The knee is one of the sites where the pain is most common. One of the main factors contributing to the number of years people spend disabled and having substantial personal, societal, and economic burdens globally is musculoskeletal disorders. Insidious, slowly building onset that neither the adolescent nor the parent is aware of [5]. Patellofemoral Pain (PFP) is a clinical knee pain commonly affecting adolescents. In the present study, the authors aimed to estimate the frequency of knee pain in Saudi adolescents. Methods: This cross-sectional survey carried out from June to November 2022 included 676 adolescents, ages 10 to 18. The data are presented as frequencies and percentages for categorical variables. Analysis of variance (ANOVA) was used to compare means between groups, while the chi-square test was used for the comparison of categorical variables. Statistical significance was set at p < 0.05. Results: Adolescents were invited to take part in the study; 57.5% were female and 42.5% were male, and 68.8% were aged between 15 and 18. The prevalence of knee pain was considerably high among females (26%), while it was 19.2% among males. Moreover, age was a significant predictor for knee pain, and BMI was as well. We also found a significant difference between BMI classification and stiffness of the knee (p = 0.008). There is a difference between adolescents who do physical activities in leisure and difficulty bending (p = 0.03). Conclusion: Our study noted a high rate of knee pain among adolescents, so we need to raise awareness about risk factors. Adolescent knee pain can be prevented with conservative methods and some minor lifestyle/activity modifications.

Delve into the ebb and flow of human ingenuity as the researcher traces the evolution of writing from papyrus to pixels. Discover how humble instruments like quill pens and typewriters have propelled human into the digital frontier, forever reshaping the art of expression in the modern age. This article examines the evolution of writing tools from traditional pen and paper to digital writing in the modern age. It explores the development of writing materials such as papyrus, parchment, and paper, as well as the invention of writing tools including quill pens, fountain pens, and typewriters. The rise of digital writing tools, including word processing software and smartphones, is also discussed, along with their benefits such as increased efficiency and productivity, enhanced collaboration and sharing capabilities, and greater accessibility and flexibility. However, the article also highlights the challenges of writing in the digital age, including the impact of digital distractions on writing focus and quality, the issue of online plagiarism and copyright infringement, and the potential loss of traditional writing skills. The article concludes with recommendations for educators, school administrators, students, and researchers to strike a balance between digital and traditional writing practices, to embrace digital writing tools while preserving traditional writing skills, and to understand the importance of the evolution of writing. The theoretical frameworks of Social Construction of Technology (SCOT) Theory, Media Ecology Theory, and Activity Theory are also discussed in relation to the evolution of writing tools. Overall, this article provides valuable insights into the history, benefits, and challenges of writing in the digital age, as well as suggestions for navigating the future of writing and its tools.

The identification and quantitative determination of wool and fine animal fibers are of great interest in the textile field because of significant price differences between them and common adulterations in raw and processed textiles. Since animal fibers have remarkable similarities in their chemical and physical characteristics, specific identification methods have been studied and proposed following advances in analytical technologies. The identification methods of wool and fine animal fibers are reviewed in this paper and the results of relevant studies are listed and summarized, starting from classical microscopy methods which are still used today not only in Small to Medium Enterprises but also in large industries, research studies and quality control laboratories. Particular attention has been paid to image analysis, Nir spectroscopy and proteomics which constitute the most promising technologies of quality control in the manufacturing and trading of luxury textiles and can find application in forensic science and archeology.

In the current socio-economic context, pension systems have become a crucial topic in the agenda of governments and international bodies. In this paper, an empirical study regarding the economic and social sustainability of pension systems in Central and Eastern European Countries was performed. The goal of the research is to establish the sustainability of pension systems with econometric modeling techniques on three dimensions as the research hypotheses are revealed: first, by strengthening the financial soundness of pension systems; second, consolidating the economic environment of pension systems; third, increasing the degree of social security systems with a direct effect of reducing poverty. The results led to relevant insights emphasizing the need for more inclusive economic, financial, and social reforms. From a policy perspective, these findings could be a starting point for the enhancement of the financial adequacy and economic and social sustainability of pension systems in Central and Eastern European Countries. The econometric techniques in this study highlight those modern pensions systems that need to be addressed in a more complex and empirical context that must encompass the main technical aspects. The conclusions suggest that in the future it needs judicial, economic, and social adjustments for the enhancement of the financial soundness of the pension systems.

The positive impact of nature on human health has been explored by researchers. Although studies have indicated that olfaction and odors have an impact on both memory and health, re-search on the odor perception in relation to perceived health is scarce. A recent study found that the naturenatural scent from stem cuttings and potted plants of a specific rose-scented geranium Pelargonium graveolens, ‘Dr. Westerlund,’Westerlund’ had positive effects on stress-related mental disorders. reduction. Essential oils from many Pelargonium species, in particular ‘Dr. Westerlund’, are known to have phytochemical properties and pharmacological activities. No study has, so far, explored and identified the chemical com-pounds and the sensory perception of these compounds in stem cuttings and the potted ´Dr. Westerlund´ plantplants. Such knowledge would be an important contribution forto an increased understanding of the effects of plants’ chemical odor properties on human well-being and link this to the expressed perceived scents. Resulting sensory profiles of P.This study aimed to identify the sensory profile and suggest responsible chemical compounds of Pelargonium graveolens ´Dr. Westerlund´ as a potted plant and as stem cuttings were reported, as well as´. The sensory and chemical analysis results revealed sensory profiles of Pelargonium graveolens ´Dr. Westerlund´s, and suggestions for the chemical compounds that are attributed to the sensory profiles. Further studies are recommended to investigate the odor experience of scented pelargonium species in relation to various levels ofcorrelation between volatile com-pounds and possible stress hormones. reduction in humans.

In the last two decades many detailed full transcriptomic studies on complex biological samples have been published and included in large gene expression repositories. These studies primarily provide bulk expression signal for each sample, including multiple cell-types mixed within the global signal. The cellular heterogeneity in these mixtures does not allow the activity of specific genes in specific cell types to be identified. Therefore, inferring relative cellular composition is a very powerful tool to achieve a more accurate molecular profiling of complex biological samples. In recent decades, computational techniques have been developed to solve this problem by applying cell deconvolution methods, designed to decompose cell mixtures into their cellular components and calculate the relative proportions of these elements. Some of them, only calculate the cell proportions (supervised methods), while other deconvolution algorithms can also identify the gene signatures specific for each cell type (unsupervised methods). In these work, five deconvolution methods (CIBERSORT, FARDEEP, DECONICA, LINSEED and ABIS) were implemented and used to analyze blood and immune cells, and also cancer cells, in complex mixture samples (using three bulk expression datasets). Our study provides three analytical tools (corrplots, cell-signature plots and bar-mixture plots) that allow a thorough comparative analysis of the cell mixture data. The work indicates that CIBERSORT is a robust method optimized for the identification of immune cell-types, but not as efficient in the identification of cancer cells. We also observed that LINSEED is a very powerful unsupervised method that provides precise and specific gene signatures for each of the five main immune cell-types analyzed: neutrophils and monocytes (in the myeloid lineage), B-cells, NK cells and T-cells (in the lymphoid lineage).

Angiotensin II (Ang II) plays a role in several inflammatory diseases and is capable of inducing the release of inflammatory mediators in several cell types. The objective was to investigate the potential of Ang II to induce mRNA expression of inflammatory mediators by cultured primary human periodontal cells. A synergistic effect of a co-treatment with Ang II and IL1β on mRNA expression of inflammatory mediators was also explored. Primary cultures of human fibroblast-like cells isolated from gingival and periodontal ligament tissues from 3 subjects were established using explant techniques. Immunophenotyping of STRO-1, AT1 and AT2 receptors was performed by flow cytometry analysis. Cell cultures were challenged with Ang II (1M) for 3, 6 and 24h with or without a co-treatment with IL1β (0.1ng/mL) for 24h. mRNA expression of inflammatory mediators was performed by real time quantitative polymerase chain reaction (RT-qPCR). We present, for the first time, a precise quantification for AT1 and AT2 receptors on human gingival and periodontal fibroblast-like cell types; the percentage of positive immunostaining compared to the total population of cells varied from 3.35% through 5.29% for AT1 and 2.97% through 4.57% for AT2. Ang II slightly upregulated mRNA expression of IL6 and CCL2/MCP1 in gingival cells and IL8 and PTGS2/COX2 in periodontal ligament cells. IL1β induced upregulation of IL8, IL6 CCL2/MCP1, PTGS2/COX2 and IL1β mRNA in both cell types. Co-treatment with Ang II and IL1β did not show a synergistic effect under these experimental conditions. Ang II shows a low potential to induce mRNA upregulation of inflammatory mediators in cultured primary human gingival and periodontal ligament cells, most likely due to the low percentage of Ang II receptors in such cells, and no synergistic effect with the co-treatment with IL1β.

Background: This literature review investigates qualitative and quantitative uses of indocyanine green (ICG) in surgical treatment, as this novel technique has become increasingly popular in ORs (operating rooms) worldwide due to its many advantages. Method: An extensive literature review was performed by searching for relevant terms in 5 international databases (www.pubmed.gov, www.sciencedirect.com, www.scopus.com, www.Oxfordjournals.com, www.reaxys.com). The results of this search were summarized into the main advantages of employing ICG in colorectal surgery as follows: a) intraoperative fluorescence angiography capability; b) fluorescence-guided identification of lymph node involvement in colorectal cancer and the sentinel lymph node method; c) positive fluorescence flagging of a liver tumour as small as "only" 200 tumour cells; d) facilitation of fistula diagnosis; and e) tumour tattooing. Moreover, in addition to qualitative intraoperative ICG use, this technique can be combined with quantitative methods and parameters, such as maximum intensity, relative maximum intensity, and different inflow parameters (time-to-peak, slope, and t1/2max). The conclusion of this article is that fluorescence surgery with ICG aided by near-infrared (NIR) light is a relatively recent technology, an advantage of which is improving the specific anatomic and functional information provided, thus allowing more comprehensive and safer tumour removal as well as preservation of important structures.

Due to the impacts from climate change, the allocation of water resources must urgently be optimized worldwide to ensure that the needs of both water managers and farmers are balanced. In this study, manager-oriented and farmer-oriented assessment models were developed for irrigation water optimization and allocation. The distance from water sources and hydraulic head were the main factors in the manager-oriented assessment model; crop value, water demand of crops, and soil type were additional factors in the farmer-oriented assessment model. The developed assessment models were used to assess irrigation water allocation in five villages in Neimen District. Cadasters at high elevation were discovered to not be suitable for cultivation of crops because of the difficulties in constructing irrigation facilities and the loss of irrigation water during transportation. The result obtained from the manager-oriented assessment system was related to the costs involved in the construction and maintenance of irrigation facilities, which indicated that cadasters located at long distances from water sources and at high elevation are unsuitable for cultivation. By contrast, the result obtained from the farmer-oriented assessment system was related to the profits of farmers and revealed that more cadasters would be suitable for cultivation if suitable crops were chosen.

The article presents the results of the γ-ray and fast neutrons impact on various rice species, in order to obtain mutant forms resistant to salinity (NaCl) and drought factors (sorbite). They are going to be used as initial forms in synthetic selection when creating varieties, adapted to the stressful conditions of, both, soil and climate in the Kazakhstan Aral Sea. The average lethal doses (LD50) of γ-rays and fast neutrons, as well as, the average NaCl and sorbite lethal concentrations were established. A distinct dependence on the effect of ionizing radiation and stress factors on the number of induced resistant mutant forms has been related to the initial rice variety. The largest number of mutant forms was obtained from the local variety Syr Suluy, followed by Leader and Aikerim varieties. Out of all varieties, only 1% of the initially irradiated by γ-rays seeds survived, while after fast neutron irradiation – 4,3%. M1 mutant plants significantly differ from the initial forms in terms of morphological features – plant height, panicle length, and grain size. They are tolerant to lodging, and have short and highly sterile panicles, indicating that they are mutants.

The genus Allium L. attracts the attention of researchers due to the presence of valuable medicinal, nutritional and decorative properties, adaptive capabilities, resistance to pests and diseases, ecological plasticity in its representatives, which contributes to the competitiveness of species and the manifestation of a high degree of adaptation outside natural areas and wide geographical distribution. Allium resources in Russia are a potential source of genes for expanding the genetic base of agricultural crops. The leaves of Allium crops have a short freshness period and quickly deteriorate due to spoilage and loss of water. Spoilage and loss of water affect their freshness and properties. The aim of the work was to establish the yield and change in the quality of green leaves of Allium species introduced into the Moscow region during short-term storage, depending on the type of packaging, storage period and temperature. 4-5-year-old plants of 4 species (A. altyncolicum, A. chyatophorum, A. nutans and A. turkestanicum) were grown on the collection plot of perennial onions of VNIIO, a branch of the FGBNU FNTSO. In the conditions of the Moscow region, the yield per leaf generation varied from 2.7 kg/m2 (A. altyncolicum) to 4.9 kg/m2 (A. cyathophorum). The maximum yield of marketable products was noted in hermetically sealed plastic bags when stored for 10 days at a temperature of +6 ... + 80С in a refrigerator with controlled conditions: A. turke-stanicum - 70.0%, A. cyathophorum - 75.5%, A. altyncolicum - 84.9%, A. nutans - 92.9%. However, an increase in the dry matter content (10.1-15.5%) was found during storage in an open polymer box in all tested species. The maximum content of vitamin C during storage in hermetically sealed bags with a density of 100 μm was found in A. altyncolicum (37.1 mg%) and A. nutans (42 mg%). In other species, the maximum value of this indicator was noted before storage. A slight increase in the amount of sugars after storage for 10 days was noted in species with a linear leaf shape when stored in a polymer box. Temperature control is the most effective approach to extend the shelf life of fresh green leaves by measuring its weight loss and vitamin C. Packaging cannot prevent spoilage of vegetables but can protect it against contamination, damage and excessive moisture loss.

Background: Hepatic erythrophagocytosis is augmented in NASH and amplifies inflammation and fibrosis. Although various pro-phagocytic signals have been identified on erythrocytes of NASH patients, the role of bound thrombospondin-1 (TSP-1), which acts as an “eat-me” signal, arginase-1, which regulates the levels of nitric oxide in erythrocytes, and phosphatidylethano-lamine (PE) which can amplify erythrophagocytosis and hepatic inflammation have not been explored. Hence, we sought to investigate the levels of arginase-1 and TSP-1 in erythrocyte lysate and PE in erythrocyte membranes of NASH patients. Methods: Twenty-four patients and 14 healthy controls participated in our study. The levels of TSP-1 and arginase were quantified by ELISA in erythrocyte lysates, and the levels of PE in erythrocyte membranes by thin layer chro-matography. Results: Erythrocytes of NAFLD patients exhibit lower levels of arginase-1 and TSP-1 (p<0.01). Erythrocyte-bound TSP-1 levels correlated with the levels of erythrocyte surface CD47. Phosphatidylethanolamine was increased in erythrocytes of NASH patients and was accompanied by increased release, indicating exposure. Conclusion: Our results imply reduced TSP-1 binding by erythrocytes which could allow free TSP-1 molecules to act on macrophages, enhancing erythrophagocytosis. Increased PE which could amplify inflammation after efferocytosis, while downregulation of arginase-1 could lead to defective efferocytosis.

Background: The electroretinogram is a clinical test used to assess the function of the photoreceptors and retinal circuits of various cells in the eye, with the recorded waveform being the result of the summated response of neural generators across the retina. Methods: The present investigation involved an analysis of the electroretinogram waveform in both the time and time-frequency domain through the utilization of the discrete wavelet transform and continuous wavelet transform techniques. The primary aim of this study was to monitor and evaluate the effects of treatment in a New Zealand rabbit model of endophthalmitis via electroretinogram waveform analysis and to compare these with normal human electroretinograms Results: The wavelet scalograms were analyzed using various mother wavelets, including the Daubechies, Ricker, Wavelet Biorthogonal 3.1 (bior3.1), Morlet, Haar, and Gaussian wavelets. Distinctive variances were identified in the wavelet scalograms between rabbit and human electroretinograms. The wavelet scalograms in the rabbit model of endophthalmitis showed recovery with treatment in parallel with the time -domain features. Conclusions: The study compared Adult, Child, and Rabbit electroretinogram responses using DWT and CWT, finding that Adult signals had higher power than Child signals, and Rabbit signals showed differences in a-wave and b-wave depending on the type of response tested, while Haar Wavelet was found to be superior in visualizing frequency components in electrophysiological signals in following the treatment of endophthalmitis and may give additional outcome measures for the management of retinal disease.

Breast and Cervical cancer are significant causes of morbidity and mortality among women worldwide. Usually, conventional therapies and early detection has shown success in metastasis and relapse rates and improved overall survival of the patients. The elimination of the efficacy of chemotherapies and target therapies because cancer stem cells create resistance against chemotherapy, metastasis, and relapse. Studies reveal that cancer stem cell markers are important for improving efficiencies of targeted therapies. Our study aims to analyze the stem cell markers and target the most significant stem cell marker by phytochemicals and their derivates. Through the analysis, it was observed that CXCR4 and SOX-2, mir-1, mir-125, and mir-429 may have a crucial role in stemness of breast and cervical cancer respectively, while BPMD & MD simulations revealed Di-valinoyl curcumin as a potential compound for CXCR4 targeting.

Solid oxide cells are capable of efficiently converting various chemical energy carriers to electricity and vice versa. The urgent challenge nowadays is the faster degradation rate compared with other fuel cell/electrolyzer technologies. To understand the degradation mechanisms, simulation of a solid oxide cell is helpful. Since most previous research developed models using commercial software, such as COMSOL and ANSYS Fluent, a gap for knowledge transfer is being gradually formed between academia and industry due to licensing issues. This paper introduces a multiphysics model, developed by a computational code, openFuelCell2. The code is implemented with an open-source library, OpenFOAM. It accounts for momentum transfer, mass transfer, electrochemical reactions and metal interconnect oxidation. The model can precisely predict I-V curves under different temperatures, fuel humidity and operation modes. Comparison between OpenFOAM and COMSOL simulations shows good agreement. The metal interconnect oxidation is modelled, which can predict the thickness of the oxide scale under different protective coatings. Simulations are conducted by assuming an ultra-thin film resistance on the rib surface. It is revealed that coatings fabricated by atmospheric plasma spraying can efficiently prevent metal interconnect oxidation, with a contribution of only 0.53 \% to the total degradation rate.

Voids in face-centered cubic (fcc) metals are commonly assumed to form by the aggregation of vacancies; however, the mechanisms of vacancy clustering and diffusion are not fully understood. In this study, we use computational modeling to provide a detailed insight into the structures and formation energies of primary vacancy clusters, mechanisms and barriers for their migration in bulk copper, and how these properties are affected at simple grain boundaries. The calculations were carried out using Embedded Atom Method (EAM) potentials and Density Functional Theory (DFT) and employed the Site-Occupation Disorder code (SOD), the Activation Relaxation Technique nouveau (ARTn) and the Knowledge Led Master Code (KLMC). We investigate stable structures and migration paths and barriers for clusters of up to six vacancies. Migration of vacancy clusters occurs via hops of individual constituent vacancies with di-vacancies having a significantly smaller migration barrier than mono-vacancies and other clusters. This barrier is further reduced when di-vacancies interact with grain boundaries. This interaction leads to the formation of self-interstitial atoms and introduces significant changes into the boundary structure. Tetra-, penta-, and hexa-vacancy clusters exhibit increasingly complex migration paths and higher barriers than smaller clusters. Finally, the direct comparison with the DFT results shows that EAM can accurately describe the vacancy-induced relaxation effects in the Cu bulk and in grain boundaries. Significant discrepancies between the two methods were found in structures with a higher number of low-coordinated atoms, such as penta-vacancies and di-vacancy absortion by grain boundary. These results will be useful for modeling the mechanisms of diffusion of complex defect structures and provide further insights into the structural evolution of metal films under thermal and mechanical stress.

The exceptional Jordan algebra is the algebra of $3 \times 3$ Hermitian matrices with octonionic entries. It is the only one from Jordan’s algebraic formulation of quantum mechanics which is not equivalent to the conventional formulation of quantum theory. It has often been suggested that this exceptional algebra could explain physical phenomena not currently explained by the conventional approach, such as values of the fundamental constants of the standard model of particle physics, and their relation to gravitation. We show that this is indeed the case; and this also unravels the connection between general relativity and the weak force. The exceptional Jordan algebra also predicts a new U(1) gravitational interaction which modifies general relativity, and which provides a theoretical basis for understanding the Modified Newtonian Dynamics (MOND).

Document deskewing is a fundamental problem in document image processing. While existing methods have limitations, such as Hough Line Transformation that can deskew images upside down, and Deep Learning models that require huge amounts of human labour and computational resources and still fail to deskew while taking care of orientation, OCR-based methods also struggle to read text when it is tilted. In this paper, we propose a novel, simple, cost-effective deep learning method for fixing the skew and orientation of documents. Our approach reduces the search space for the machine learning model to predict whether an image is upside down or not, avoiding the huge search space of predicting an angle between 0 and 360. We finetuned a MobileNetV2 model, which was pre-trained on imagenet, using only 200 images and achieve good results. This method is useful for automation-based tasks, such as data extraction using OCR technology, and can greatly reduce manual labour.

(1) Background: This paper investigates the epidemiological risk related to temperature before and during COVID-19 in Italy; (2) Methods: Deaths in 2015-2019 and temperatures were correlated. Excess and COVID-19 deaths were examined to estimate the relationships with temperatures; (3) Results: Annual deaths were higher during the cold months (+45,000, SD = 4,700, S = 21). The scenario worsened during COVID-19. Mortality was higher during minimum temperature periods, although the curve moderately rose in the warmest months (r = -0.75, 95% CI = [-0.87; -0.56], S = 23). COVID-19 deaths showed a decreasing seasonality. Monthly excess deaths during COVID-19 were high (+4,200, IQR = [2,800; 8,000], S = 28) with a doubt of seasonality. COVID-19 mortality was correlated with regional latitude (r = 0.86, 95% CI = [0.68; 0.94], S = 20). Discrepancies between COVID-19 and excess deaths were found. The exposed population was subject to aging; (4) Conclusions: The epidemiological risk in Italy is seasonal and geographically dependent. Low and very high temperatures can lead to mortality peaks. Therefore, COVID-19 and any other epidemiological risk must be evaluated in light of this evidence. Health systems need to be strengthened during cold and extremely hot periods. Future research should investigate these phenomena at the causal level.

The effects of 0.4wt.% Sc addition on a typical Al-Si10-Mg alloy were systematically investigated in the present research. Samples with and without Sc produced refined dendritic arranged microstructures with sensitivity to the aging treatment after solidification, particularly in the case of the alloy without Sc. After being exposed to 300°C for 90 minutes, the dendritic spacing nearly doubled in the Al-10wt.%Si-0.45wt.%Mg samples. The rapidly solidified microstructures were constituted by the -Al dendritic phase surrounded by eutectic phases/intermetallics such as Si, Mg2Si and Al3Sc (in the case of the alloy containing Sc). 255°C and 300°C were deemed most appropriate temperatures for aging treatments, with four exposure times of up to 120 minutes tested for each alloy. The heat treatments allowed the Vickers hardness profiles to be plotted and compared. Moreover, in order to detect both Sc- and Mg- precipitates after aging, specific samples have been prepared for either SEM or TEM analyses. At first, the results pointed to a strong precipitate-related hardening effect formed as a result of the Sc addition to the alloy. All samples containing Sc showed a higher hardness value when compared to their respective treated samples without Sc. Secondly, when comparing the Al-10Si-Mg-Sc alloy samples among themselves after being treated at different conditions, high temperatures and excessive treatment times can become detrimental to the hardness. This was due to the growth of larger Sc-bearing precipitates of approximately 1 µm in size under such conditions, having less pronounced hardening effect. The best condition (255°C for 60 min) for as centrifuged samples in Cu-mold produced very fine dispersion of Mg- and Sc- intermetallics (~200 nm in size) with a peak hardness of 110 HV.

Ultraviolet (UV) radiation has both harmful and beneficial effects on human health. It can cause skin damage and cancer, but also provides the primary source of vitamin D. Additionally, UV radiation affects energy metabolism in mice with metabolic diseases and has protective effects on hypertension and cardiovascular diseases.Metabolic Syndrome is a collection of metabolic dysfunctions such as dyslipidemia, hypertension, hyperglycemia, abdominal/central obesity, and insulin resistance. Chronic UVR exposure suppressed obesity and type 2 diabetes in high-fat diet-fed mice, while vitamin D supplementation did not replicate these effects. On the other hand, topical application of nitric oxide (NO) donors replicated UV effects on mice, and NO scavengers prevented the positive impact of UV. UVR may prevent the development of obesity and metabolic syndrome through mechanisms that depend on UVR-induced NO, not vitamin D. Exposure to sunshine has a protective impact on blood pressure and cardiovascular disease. Although lower vitamin D concentration is linked to increased hypertension and the incidence of CVD, oral vitamin D supplementation does not decrease blood pressure or the risk of CVD, indicating that vitamin D may not mediate the beneficial effects of sun exposure. Instead, NO plays a crucial role as an endogenous vasodilator, produced by the vascular endothelium. Solar UVA may release nitrogen oxides from skin storage into the bloodstream, lowering blood pressure and cardiovascular mortality.In conclusion, UVR exposure could be a promising non-pharmacological intervention for metabolic syndrome, hypertension, and CVD prevention, and NO may play a crucial role in mediating these effects. Further research is needed to explore the precise mechanisms and identify the optimal doses and exposure times of UVR.

Fruits are commonly used, fresh or processed, to prepare different industrial products with superior nutritional and health-promoting properties. Currently, the demand for processed fruit products has motivated the rapid growth of the fruit processing industries, persuading them to produce an enormous amount of by-products with less utilization. Furthermore, people's shifting dietary habits and lack of awareness of nutritional properties result in an avoidable load of fruit by-products. The knowledge of the value of by-products urges exploration with proper documentation, emphasizing the health benefits of some such products. Hence, this review is prepared by carefully analyzing the recent literature on industrial applications of fruit by-products and their nutritional and health-promoting properties. The use of fruit by-products in food industries for various purposes has been reported in the past and has been reviewed and described here. Fruit by-products are a good source of nutrients and bioactive components, including polyphenols, dietary fibers, and vitamins, implying that they could have an important role for novel, value-added functional food properties. Furthermore, fruit by-products are used as the substrate for the production of organic acids, essential oils, enzymes, fuel, biodegradable packaging materials, and preservatives.

Polyacetylene phytochemicals are emerging as potentially responsible for the chemoprotective effects of consuming apiaceous vegetables. There is some evidence suggesting that polyacetylenes impact carcinogenesis by influencing a wide variety of signalling pathways, which are important in regulating inflammation, apoptosis, cell cycle regulation, etc. Studies have shown a correlation between human dietary intake of polyacetylene-rich vegetables with reduced risk of inflammation and cancer. Polyacetylene supplementation can influence cell growth, gene expression, and immunological responses, and reduce tumour number in rat and mouse models. Cancer chemoprevention by dietary polyacetylenes involves several mechanisms, including effects on inflammatory cytokines, the NF-κB pathway, antioxidant response elements, UPR pathway, growth factor signalling, cell cycle progression, and apoptosis. This review summarises the published research on falcarinol-type polyacetylene compounds and their mechanisms of action regarding cancer chemoprevention and treatment, and also identifies some gaps in our current understanding of the health benefits of these polyacetylenes.

Transcription factors are diverse intracellular proteins facilitating cellular responses to inducing factors via gene expression. Regulatory signalling cascades from the membrane proteins (sensors) to transcription factors (effectors) are paramount to accurate phenotypic display against external factors. This review examines several transcription factors germane to Cryptococcus (C.) neoformans adaptation and survival for human infection. These opportunistic pathogenic single-cell yeasts (fungi) possess several gene duplications and peculiar membrane proteins due to adaptive phenotypes and morphological plasticity. Consequently, hundreds of responsible pleiotropic genes have been studied to understand how these genes are induced, regulated, and coordinated. However, these findings are sparsely converged and interlinked, making it cumbersome to relate one gene to the other or group them by their functions. We reviewed several wide-ranging transcriptional analysis works associated with C. neoformans into comparable phenotypic traits that necessitate adaptation, survival, and human infection. We present a robust work that addresses several transcription factors and their inducing factors. Lastly, we converge, link, and group several of these factors according to their multifunctional expression pattern. We also provide adequate information on certain genes critical to this fungus, which could be explored pharmaceutically in drug targeting for more effective antifungal management.

This research is completed in development of researches devoted to relations between elastic modulus (MoE) and thermal expansivity (CTe) of different materials. This study experimentally confirmed the relation of MoE and CTe for thermosetting polymers and FRPs both under normal and heating temperatures. As the thermosetting polymers, the epoxy compositions were used and glass fiber and mineral additives for FRP. The experiment was based on dilatometric and elastic deformations’ testing. Also, the relaxation model of MoE/CTe was proposed, that is based on physical properties of polymers’ supramolecular structures. The comparative analyzing of MoE/CTes’ different models is done. The most accurate models are determined, and the relaxation model has demonstrated the high accuracy.