Background and objectives: sickle cell disease is the most common hemoglobinopathy in the world. It is considered to be a real public health problem. Sickle cell patients are subjected to several factors causing inflammation such as iron metabolism. The study aimed to look for inflammation in children with sickle cell disease in Cameroon, identify the factors associated with inflammation, and raise the consequences for the patient including the iron profile and the profile of the hemogram. Materials and methods: We conducted an analytical cross-sectional study for 03 months. The sickle cell disease patients coming and/or followed at the Hematology Department of the Regional Hospital of Bafoussam and the Central Hospital of Yaoundé have been recruited. The exploration of inflammation was made by determining CRP, IL6, and ferritin concentrations. The hematological parameters and iron profile were evaluated using standard methods. Statistical analysis of the data was performed; Univariate and multivariate logistic regression analyses allowed to identification of factors associated with inflammation in patients, using the statistical tool R version 4.1.1.. The proportions were compared with the chi-square test when the expected numbers were greater than 5 and the Fisher test when not. Results: The frequency of inflammation in the population was 42.3%. Hyperferritinemia was significantly greater (p<0.001) in patients with inflammation compared to the non-inflammatory patients (96.8% and 76.7% respectively). Patients with inflammation showed a significant elevation of iron parameters (p<0.05). In addition, ferritin and IL6 elevation were associated with inflammation during sickle cell disease respectively (Or = 4.96; 95% CI [1.15-36.42]; p=0.056) and (Or =6.23; 95% CI [1.43-45.96]; p=0.030). Conclusions: The elevated iron in plasma is an effect of inflammation in sickle cell patients. Hence the need of controlling inflammation and iron in the latter is necessary.

The stability issues in the widely known organic inorganic halide perovskite, CH₃NH₃PbI_3, lead to the development of alternative halide double perovskite materials which get great attention in recent times. Although the stability issue seems promising, both materials and device performance of these photovoltaic materials remain inferior and challenging for improvements. Furthermore, the power conversion efficiency of single junction organic inorganic halide perovskite is now 24.2% and 29.15% for textured monolithic perovskite/silicon tandem solar cell, but for all-inorganic halide perovskite solar cell is 7.11% and halide double perovskite solar cells based on Cs₂AgBiBr₆ and Cs₂TiBr₆ is 2.8% and 3.3%, respectively, which is far less than 24.2% and 29.15%, respectively. This creates big question and concern that can both all-inorganic halide perovskite solar cell and halide double perovskites solar cells really be an acceptable alternatives to replace organic inorganic halide perovskite solar cells or lead based perovskite solar cells in the market in order to realize the sustainable practical applications? Not only this concern, but also there are many other big challenges facing by halide double perovskite solar cells. Such big challenges include: a) geometric constraints and limited integration with interfacial materials, b) dynamic disorder and a wide band gap and localized conduction band caused by cubic unit cell which restrains the interactions of orbitals, c) high processing temperature which may limit on the diverse applications, d) low electronic dimensionality making them less appropriate for single junction solar cell purpose and etc. Moreover, origin of electronic and optical properties such as the polarizability, the presence of molecular dipoles and their influence on the dynamics of the photo-excitations in the halide double perovskites remains unlock concern that need to be elucidated. Now, another big question is how to develop overcoming mechanisms for such challenges. Can we really overcome these current limitations faced by halide double perovskites so that we use them for sustainable commercialization? This research roadmap for performance improvement is suggested focusing on: materials surface and bulk engineering, band gap engineering, interfacial engineering, composition engineering, doping engineering, device architectural engineering, polar and domain order engineering. This was the reason that this review was developed in order to forward great contributions to the readers and commercial ventures.

Spherical or hexagonal NaYF4:Yb,Er nanoparticles (UCNPs) with sizes of 25 nm (S-UCNPs) and 120 nm (L-UCNPs) were synthesized by high-temperature coprecipitation and subsequently modified with three kinds of polymers. These included poly(ethylene glycol) (PEG) and poly(N,N-dimethylacrylamide-co-2-aminoethylacrylamide) [P(DMA-AEA)] terminated with an alendronate anchoring group, and poly(methyl vinyl ether-co-maleic acid) (PMVEMA). The internalization of nanoparticles by rat mesenchymal stem cells (rMSCs) and C6 cancer cells was visualized by electron microscopy and the cytotoxicity of the UCNPs and their leaches was measured by the real time proliferation assay. Comet assay was used to determine oxidative damage of UCNPs. In vivo study on mice determined the elimination route and potential accumulation of UCNPs in the body. The results showed that the L- and S-UCNPs were internalized into cells in the lumen of endosomes. Proliferation assay revealed that L-UCNPs were less toxic than S-UCNPs. The viability of rat mesenchymal stem cells (rMSCs) incubated with particles decreased in the order S-UCNP@Ale-(PDMA-AEA) > S-UCNP@Ale-PEG > S-UCNPs > S-UCNP@PMVEMA. Similar results were obtained in C6 cells. Oxidative damage measured by the Comet assay showed that neat L-UCNPs caused oxidative damage to rMSCs more than all coated UCNPs while no difference was observed in C6 cells. An in vivo study indicated that L-UCNPs were eliminated from the body via the hepatobiliary route; L-UCNP@Ale-PEG particles were almost eliminated from the liver 96 h after intravenous application. Pilot fluorescence imaging confirmed the limited in vivo detection capabilities of the nanoparticles.

(1) Background: The proportion of fully mechanized harvesting systems in Austria is constantly increasing especially because of the technological development of the machines, which allows them to drive on increasingly steep terrain. This leads to additional challenges and potential hazards for the operators, which may also cause higher stress levels. The purpose of this study is to develop and debate a new set of methodologies for determining time and space resolved psychophysiology data to analyze stressful and non-stressful work situations for harvester and forwarder operators; (2) Methods: we suggest a study protocol to analyze a) tasks performed by the driver, b) environmental factors, like slope gradient, c) the psychophysiological response of experts during these tasks, and d) evaluate the worker´s subjective stress and fatigue before and after a harvest operation. (3) Results: Within this manuscript we present a study protocol based on quantitative and qualitative methods, like time and space resolved psychophysiology, questionnaires, qualitative interviews, as well as video and sensor-based analysis of environmental and machine data. The first results from real measurements of a forwarder driver are presented; (4) Conclusions: This multimodal research protocol serves to explore the relationship between stress, fatigue, and performed tasks. Through our quantitative and qualitative methodology, researchers can improve the health and safety of forest workers at work, improve their productivity and reduce damage to remaining trees.

The nickel-chromium-molybdenum alloy 625 exhibits an excellent combination of mechanical properties and corrosion resistance. However, the high temperature plastic deformation process and the heat treatment represent critical aspects and the adoption of non-optimal parameters can result in excessive grain coarsening and loss in mechanical strength. This detrimental behavior is worsened by the presence of a narrow region of temperatures and strain rates for complete recrystallization and the absence of phase transformation temperatures. In this alloy, the presence of sufficient amounts of niobium, titanium and aluminum permits slow age-hardening response upon single-aging treatments. Therefore, when the soft- or solution-annealed condition is associated with insufficient mechanical properties, this potentiality can be exploited to improve the mechanical strength and prevent waste of material and resources. Since the precipitation kinetic of the hardening γ^'' phase can be accelerated by prior nucleation treatment, different time-temperature combinations of double aging at 732 °C and 621 °C are investigated to reduce the overall heat treatment time. However, the simultaneous formation of Cr-rich carbides can dramatically affect the intergranular corrosion resistance. For this reason, a performance map is developed to compare all the tested conditions and identify the best compromise in terms of mechanical strength and corrosion rate.

Supramolecular solvent (SUPRAS) has received increasing interest as an innovative, efficient, and green solvent for the effective extraction and separation of bioactive compounds from natural resources. However, studies on the use of SUPRAS for the extraction of phenolic components from plants, which are highly valued in food products due to their excellent antioxidant capacity, are still lacking. The present study developed a green ultrasound-assisted and efficient SU-PRAS method to simultaneously determine three phenolic acids in Prunella vulgaris by high-performance liquid chromatography (HPLC) and the experimental parameters were optimized in detail. The efficiency and antioxidant properties of the phenolic compounds obtained by different extraction methods were also compared. Under the optimal conditions, the extraction efficiency of SUPRAS, prepared with octanoic acid reverse micelles dispersed in ethanol-water, was substantially higher than conventional organic reagents. Moreover, this SUPRAS method also showed more significant antioxidant capacities. The confocal laser scanning microscopy (CLSM) images presented the spherical droplet structure of SUPRAS (A well-defined circle), which coincided with the position of the fluorescence position of phenolic acids. The phenolic acids were encapsulated in the vesicles by the SUPRAS droplets, which indicated the efficient extraction capacities of SUPRAS for the target compounds. Finally, combined with the CLSM method, the mechanism of the proposed method was further clarified, and the superior extraction performance of SUPRAS was theoretically demonstrated through molecular dynamics simulations. In comparison with conventional methods, the higher extraction efficiency of SUPRAS can be illustrated by the larger solvent contact surface area, more types of hydrogen bonds between extractants and supramolecular solvents, and stronger and more stable interaction forces. The results of the theoretical studies are in rational agreement with the experimental outcome.

We presented a fractional order model to capture the transmission dynamics of Anthrax infection with a nonlinear force of infection and its long-term impacts. Analysis by the standard Fabrizio Caputo approach established the model is well-posed and investigation on the stability of the model, Anthrax-free equilibrium as connected to the basic reproduction number R0

With the increasing of China's international status and the acceleration of the process of global economic integration, the internationalization strategy of Chinese enterprises is getting deeper and deeper. This paper analyzes the problems and challenges faced by the international supply chain management of Chinese bamboo weaving and creative products, and puts forward a set of supply chain management model that ADAPTS to the international development. Firstly, the concept, connotation and types of supply chain management are sorted out through literature review. Secondly, this paper analyzes the current situation of international supply chain management of bamboo editing and creative products, and points out the existing problems. Thirdly, based on the theory and practice of international supply chain management, this paper puts forward a set of supply chain management model suitable for the international development of bamboo editing and creative products. Finally, taking a bamboo weaving and creative products enterprise as an example, the application effect of the supply chain management model is empirically analyzed. The results show that the supply chain management model can effectively reduce the cost and improve the efficiency, and is conducive to the international development of bamboo editing and creative products.

A comprehensive investigation was undertaken at Vytautas Magnus University Experimental Station, located at 54°52’50” N latitude and 23°49’41” E longitude on soil (Epieutric Endocalcaric Planosol – PLe-gln-w) since 1999, to understand the impacts of different agrotechnical measures on soil health and crop yield. Two primary factors were assessed. Factor A incorporated practices of straw removal versus straw chopping and spreading, while Factor B evaluated a spectrum of tillage techniques: conventional deep ploughing, shallow ploughing, ploughless tillage, single seedbed discing, and two no-tillage practices, one of which involved cover crops. Findings from this long-term study highlight the significant potential of specific farming systems in enhancing soil organic carbon. It has a positive effect on the release of CO2 emissions from the soil, thus promoting soil resilience and increasing plant productivity. These insights are paramount in devising sustainable agricultural strategies to counter the challenges of climate change on agroecosystems. This research showcases the profound effects of combining residue management and tillage practices, setting a novel standard for sustainable soil management of climatic uncertainties.

Abstract: The venom-containing barb attached to their ‘whip-like’ tail provides stingrays a defensive mechanism for evading predators such as sharks. From human encounters, dermal stingray envenomation is characterized by intense pain often followed by tissue necrosis occurring over several days to several weeks. The bioactive components in stingray venoms (SRV’s) and their molecular targets and mechanisms that mediate these complex responses are not well understood. Given the utility of venom-derived proteins from other venomous species for biomedical and pharmaceutical applications, we set out to characterize the bioactivity of SRV from three local species that belong to the Dasyatoidea ‘whiptail’ superfamily. Multiple cell-based assays were used to quantify and compare the in vitro effects of these SRV’s on different cell lines. All three SRV’s demonstrated concentration-dependent growth inhibitory effects on three different human cell lines tested. In contrast, a mouse fibrosarcoma cell line was markedly resistant to all three SRV’s, indicating the molecular target(s) for mediating the SRV effects are not expressed on these cells. The multifunctional SRV responses were characterized by an acute disruption of cell adhesion leading to apoptosis. These findings aim to guide future investigations of identified SRV proteins and their molecular targets for potential use in biomedical applications.

In many countries, increasing concern for animal welfare is driving retailer commitments and government legislation that aim to improve the lives of farmed fish. One aspect of fish welfare involves stunning fish prior to slaughter. The feasibility of stunning depends on the species of fish and physical farm characteristics. In this article, we provide an overview of stunning before slaughter in European sea bass and sea bream aquaculture, one of the largest finfish farming industries in the developed world that does not yet stun most of its production. Sea bass and sea bream stunning necessitates the use of electrical stunning equipment aboard harvest vessels, often a significant distance from the shoreline; this presents an interesting engineering and policy challenge. Together, Türkiye, Greece, Spain, and Italy produced over 400,000 t of sea bass and sea bream in 2020. In Türkiye and Greece, farms are numerous and located very close to the shoreline. In Spain and Italy, farms are few and located far from the shoreline. The highest average production is found in farms from Türkiye (1,000 t) and Spain (1,300 t, and lower average production is found in Greece (300 t) and Italy (350 t). Producer progress towards the installation of electrical stunning appears comparatively well-developed for Türkiye, Spain, and Greece, though we emphasise that producers and other stakeholders require continued support to realise this opportunity. Producers in Italy appear slower to make progress on this aspect of animal welfare and may require additional support.

In this review, we covered the recent advances in synthesis of gold nanoparticles and their uses in degradation of dyes. This study provides framework to develop a low cost, ecofriendly and highly efficient synthesis of gold nanoparticles. These synthetic methods do not produce any toxic byproduct. The present study is focus on removal of dyes by Au-NPs because gold nanoparticles act as good absorbent for dyes in short time. Synthesis of Au-NPs from plant extract e.g. marine alga, Scutellarin Barbata, A.nigra, Fruit peels, Bacillus marisflavi from raw silk cocoons, amylopectin and poly acrylic acid, L.asparagine, Grephene oxide, IPEI coated Au-NPs. The synthesizes Au-NPs were used further for removal of dyes like methylene blue (MB), Rhodamine B (RB) Degradation, methylene orange, acid red degradation, Congo red.

Certain Trichoderma isolates provide biofertilizer, biocontrol, and other plant-beneficial activities while inhabiting the soil or internal plant issues; and their use in agricultural systems could contribute to sustainable food production. It is thought that this colonization of soil and internal plant tissues is fundamental for biocontrol and biofertilizer applications. Our collective analyses of prior surveys, where the tef1 sequence was almost exclusively used to identify Trichoderma species, showed that isolates from the Harzianum Complex Clade, the T. asperellum/T. asperelloides group, T. virens, T. hamatum, and T. atroviride were prevalent in soil and/or as endophytes. Population structure and genetic diversity of these species were investigated, and new lineages with geo-graphic significance within T. atroviride, T. asperellum, T. hamatum, and T. virens populations were found. The nearest relatives of some species were also revealed. Choosing isolates from among more than 500 known Trichoderma species for use in non-targeted evaluation screens for biocontrol or biofertilizer applications is time-consuming and expensive. Preferentially selecting species from T. atroviride, T. asperellum/T. asperelloides, T. hamatum, species from the T. harzianum Complex Clade, T. virens, and possibly nearest relatives, may speed the identification of candidates for commercialization due to the demonstrated ability of these species to successfully inhabit the soil and endorhizosphere. To our knowledge, this is the first report where dominant soil- and en-dophyte-inhabiting Trichoderma species were identified from past survey data and population structure and genetic diversity analyses conducted.

The soybean yield per unit area and soybean acreage are increased to boost overall soybean production as two effective solutions. There is a large area of saline soils in northeast China, where if soybeans could be grown with the help of isolated saline-tolerant rhizobia, the cultivation area of soybeans in China can be effectively expanded. Several rhizobia with different salt-, acid- and alkali-resistant characteristics were obtained in this research by isolating, identifying, and analyzing the nitrogen-fixing activities of indigenous rhizobia from different soybean planting soils, and further analyzed the host compliance between rhizobia and different soybean germplasm concerning 30 representative germplasm resources in the northeast region. Collectively, the results of the resistance study of HLNEAU2 isolated from the Shaanxi region are great references for guiding the application of rhizobia on soybeans.

Rare ginsenoside compound K (CK), is an intestinal microbial metabolite with a low natural abundance that is primarily produced by physicochemical processing, side chain modification, or metabolic transformation in the gut. Moreover, CK exhibits potent biological activity compared to primary ginsenosides, which has raised concerns in the field of ginseng research and development as well as ginsenosides-related dietary supplements and natural products. Ginsenosides Rb1, Rb2, and Rc are generally used as a substrate to generate CK via several bio-conversion processes. Current research shows that CK has a wide range of pharmacological actions including boosting osteogenesis, lipid and glucose metabolism, lipid oxidation, insulin resistance, anti-inflammatory, and anti-apoptosis properties. Further research on the bioavailability and toxicology of CK can advance its medicinal application. The purpose of this review is to lay the groundwork for future clinical studies and the development of CK as a therapy for metabolic disorders. Furthermore, the toxicology and pharmacology of CK are investigated as well in this review. The findings indicate that CK primarily modulates signal-ing pathways associated with AMPK, SIRT1, PPARs, WNTs, and NF-kB. It also demonstrates a positive therapeutic effect of CK on nonalcoholic fatty liver disease, obesity, hyperlipidemia, diabetes, and its complications, as well as osteoporosis. Additionally, the analogues of CK showed more bioavailability, less toxicity, and more efficacy against disease states. Enhancing bioavailability and regulating hazardous variables are crucial for its use in clinical trials.

Epidemiological and clinical evidence have extensively documented the role of obesity in the develop-ment of endometrial cancer. However, the effect of fatty acids on cell growth in endometrial cancer has not been widely studied. Here we reported that palmitic acid significantly inhibited cell proliferation of endometrial cancer cells and primary cultures of endometrial cancer, and reduced tumor growth in a transgenic mouse model of endometrial cancer, in parallel with increased cellular stress and apoptosis and decreased cellular adhesion and invasion. Inhibition of cellular stress by N-acetyl-L-cysteine effec-tively reversed the effects of palmitic acid on cell proliferation, apoptosis and invasive capacity in the endometrial cancer cells. Palmitic acid increased the intracellular formation of lipid droplets in a time- and dose-dependent manner. Depletion of lipid droplets by blocking DGAT1 and DGAT2 effectively increased the ability of palmitic acid to inhibit cell proliferation and induce cleaved caspase 3 activity. Collectively, this study provides new insight into the effect of palmitic acid on cell proliferation, inva-sion and the formation of lipid droplets that may have potential clinical relevance in the treatment of obesity-driven endometrial cancer

This study sought to improve the nutritional, functional and biochemical properties of pearl millet through malting and fermentation. Moringa oleifera leaf powder (MLP) was used as a fortificant. Mixture design was used to find optimal proportions for each of the components that yield a high protein and or low saturated fat content. Twelve mixtures with varying ratios of fermented, and malted pearl millet flour ranging between 30–65%, and MLP between 5–15% were generated through I-Optimal mixture design. The mixtures were wet-cooked, freeze-dried and analyzed for protein and fat content. The data obtained were fitted to a linear mixture model and the search for the optimum was done using Numerical Optimization for maximising protein and minimising saturated fat. The linear model was suitable for explaining variation for total protein and saturated fat with r2 of 0.50 and 0.51, respectively. Increasing MLP increased protein content. Two final formulations were generated through the optimization process. Pearl millet’s protein content increased by up to 22% while saturated fat decreased by up to 13%. Ash content increased by 75%. Polyphenol content and oxygen radical absorbance capacity increased by 80% and 25%, respectively. Final and peak viscosity were reduced by 90% and 95%, respectively.

Peas are among the most widely consumed legumes and are of great benefit for human nutrition. Sowing and cultivation techniques are known to affect the yield and the quality of the seeds. Existing studies investigating the nutritional properties of the seeds from plants cultivated using different methods are continue to be of significant value. However, changes in the climate in recent years are presumed to have affected the optimum sowing dates for grain yield and quality. This study in-vestigates the effects of sowing peas at different sowing dates on the yield of the seed and on its nutrient content, as determined by certain quality traits (parameters). The experiment was con-ducted at the Aydin Adnan Menderes University Faculty of Agriculture in Turkey during the 2021-2022 and 2022-2023 pea production seasons. Specifically, it examined the yield of the seed (fresh/dry), its saponin and phenolic matter content and its amino acid composition in the case of five pea cultivars (Deren, Misya, Irmak, Karina, Local) sown at three different sowing times (November 15, November 30, December 15). The study found that the effects of sowing date on grain yield and quality characteristics were significant. However, the varieties' reactions to sowing dates were found to be different. The highest fresh seed yield (3.27 t ha-1) was obtained from samples sown at the second sowing date, while the highest dry yield (1.85 t ha-1) came from samples sown at the third sowing date. The cultivars also had a statistically significant effect on the yields. The highest fresh seed yields were obtained from the Misya (2.88 t ha-1) and Local (2.81 t ha-1) varieties, while the highest dry yields were obtained from samples of Local (1.76 t ha-1) and Irmak (1.73 t ha-1). In terms of sowing dates, the highest protein (27.75%) was obtained from the first sowing date, and the protein content decreased in the following dates. Misya was the cultivar from which the highest protein content (28.77%) was obtained. In the study, higher yields were obtained from the second and third sowing dates, while the first sowing time resulted in higher protein and amino acid composition. Similar to the protein content, the composition of almost all amino acids increased on the first sowing date. In addition, it was established that the saponin and phenolic substance contents of seeds varied with the sowing date.

The terrain of Changbai Mountain has great influence on the distribution of atmospheric flows and the occurrence and development of precipitation. This study quantitatively analyzes the regional characteristic of topographic perturbations and the relationship between terrain, wind and precipitation in Changbai Mountain region, by using a spectral analysis of the two-dimensional discrete cosine transform. Three domains with relatively heavy summer precipitation are selected as the study region. The results indicate that the overall terrain of Changbai Mountain region exhibits anisotropic characteristics. The terrain spectra of domain B are less than those of domain A and C across the whole wavelength (λ) bands, indicating that the large-scale topographic perturbations of domain B are relatively weak. The largest topographic spectral peak of domain C shows the most pronounced undulation of terrain among the three domains. The dominant wavelengths of terrain height variance for domain A and C, both close to the respective maximum wavelengths, indicate more prominent large-scale topographic perturbations. For domain A, the variation of the precipitation spectra is consistent with that of the wind spectra at the wavelength bands of λ < 390 km, showing a high correlation between wind field and the occurrence of rainfall. The inverse relationship at larger wavelengths indicates that multiple factors contribute to the occurrence of rainfall. For domain B, there is consistency in the fluctuations of terrain spectra, precipitation spectra, and wind spectra at the wavelength bands of λ < 278.3 km, implying that the smaller-scale terrain has an important effect on the occurrence of summer precipitation. For domain C, the variations of terrain spectra, precipitation spectra, and wind spectra are almost consistent across the whole wavelength bands, indicating that the large-scale terrain and minor terrain both play a crucial role in atmospheric uplift and the occurrence and development of summer rainfall.

In our country, the aging society is rapidly progressing, with an increase in patients with chronic kidney disease (CKD) and those undergoing dialysis, coupled with the aging of the population. As a result, the number of individuals with cognitive impairment (CI) is rising, and addressing this issue has become an urgent problem. One characteristic of dementia in CKD patients is the high frequency of vascular dementia, making the prevention through the management of classical risk factors such as hypertension, diabetes mellitus, dyslipidemia, smoking, etc., associated with atherosclerosis and arteriosclerosis. Other effective measures, including the use of renin-angiotensin system inhibitors, addressing anemia, exercise therapy, and lifestyle improvements, have been reported. Incidence and progression of CI may also be influenced by the type of dialysis or kidney replacement therapy, with reports suggesting that long-duration dialysis, low-temperature hemodialysis, peritoneal dialysis, and kidney transplantation (KTx) can have a possible preferable effect on preserving cognitive function.

Background: Children's environmental health encompasses a wide range of factors that impact the well-being of children, including physical, chemical, biological, and social elements in their immediate environment. Safeguarding children from harmful substances is the crucial role of nursing students. Nursing students play a vital role as valuable resources for individuals, families, communities, and policymakers. This study aims to assess the knowledge and skills of nursing students concerning children's environmental health at academic institutions delivering nursing program in Nekemte town, Ethiopia. Methods: An institutional-based cross-sectional study design was carried out from August 1–30, 2023, among nursing students in Nekemte Town, and 634 study participants were selected through simple random sampling. Data was entered into Epinfo version 6.4 and exported to STATA version 14 for analysis, and multicollinearity was checked. Finally, from the bivariate analysis, variables of < 0.2 were included in the multivariate analysis; an adjusted odd ratio with a 95% CI was computed; and variables with a P-value <0.05 in the multivariable analysis were taken as significant associated factors. Results: The overall nursing students' level of knowledge about children's environmental health was insufficient (56%). More than one-third (34%) demonstrate their skill towards children's environmental health insufficiently, and one-fourth (25%) and 27% of the learners conduct their craft to prevent children from ecological hazards to a good and better level, respectively. While gender of the participant, age of the participant, year of the study, training history of the participants, and field of study of the students were significantly associated variables with their knowledge of children's environmental health. Conclusion: The study reveals that nursing students' knowledge of children's environmental health is limited, with factors such as gender, age, training history, and field of study significantly influencing their understanding. Therefore, female students should be considered for more tutorials to be effectively knowledgeable regarding children’s environmental health.

Newly designed pentacyclic benzimidazole derivatives, featuring amino or amido side chains, were synthesized to assess their in vitro antiproliferative activity. Additionally, we conducted investigations into their direct interaction with nucleic acids, aiming to uncover potential mechanisms of biological action. These compounds were synthesized using conventional organic synthesis methodologies, alongside photochemical and microwave-assisted reactions. Upon synthesis, the newly derived compounds underwent in vitro testing for their antiproliferative effects on various human cancer cell lines. Notably, derivatives 6 and 9 exhibited significant antiproliferative activity within the submicromolar concentration range. Our biological assessment highlighted that the biological activity was strongly influenced by both the position of the N atom on the quinoline moiety and the position and nature of the side chain on the pentacyclic skeleton. Findings from fluorescence, circular dichroism spectroscopy, and thermal melting assays indicated a mixed binding mode—comprising intercalation and the binding of aggregated compounds along the polynucleotide backbone—of these pentacyclic benzimidazoles with DNA and RNA.

Sleep is of vital necessity for health, it has a restorative and protective function for children and adolescents with chronic conditions and their families. The purpose was to identify the scientific production on sleep patterns in children and adolescents with chronic conditions and their families. This integrative review was developed in March and June 2022, of the MEDLINE, Web of Science, CINAHL and PSYCInfo. The articles included were original papers published be-tween January 2007 and mid-2022. Excluded were review studies that did not evaluate sleep and whose participants did not have chronic conditions or were not children, adolescents and/or their families. The searches returned 814 abstracts. After exclusions, 47 studies were selected to be read in full; of these, 29 were selected and were grouped empirically into four categories: major alterations in sleep patterns of children and adolescents with chronic conditions; the relationship between sleep disorders and symptoms in children and adolescents with chronic conditions; impaired sleep patterns of families of children and adolescents with chronic conditions; sleep alterations and their relationship with other problems in families of children and adolescents with chronic conditions. All studies showed sleep pattern impairment in children and adolescents with chronic conditions and their families.

This comprehensive review is devoted to an under-exploited family of phenolic compounds, the coumarins, and the most relevant strands in which they are involved in some spirit beverages – wine spirit, brandy, whiskey, sugar cane spirits (rum and cachaça) and grape marc spirit – with great importance worldwide in terms of production, trade and consumption. It gathers the key discoveries on the topic considering the production process of each spirit beverage, the related sources of coumarins (different kinds of wood used in the ageing stage) along with the factors that govern them and can influence the sensory properties of the aged beverages. An overview of the analytical methods available for their identification/quantification is also included, as well as the corresponding trends for the advancement of knowledge in this field. Moreover, the remarkable role of coumarins as nutraceuticals, their importance as chemical markers for authenticity purposes, and their relationship with food safety of these spirit beverages are also addressed, highlighting the current gaps and issues, and providing clues for future research.

Fingerhuthia africana Lehm belongs to family Poaceae, is an erect perennial grass used traditionally to cure different diseases. The current study was carried out to find the bioactive compounds by GC-MS, elemental analysis through atomic absorption spectrophotometry, proximate analysis by AOAC, genotoxic activity through comet assay, antioxidant activity through DPPH and antidiarrheal activity through castor oil induce diarrhea followed by charcoal meal on mice model. GC-MS chromatogram represents different compounds detected in the crude extract. Major pharmacological bioactive compounds are 4H-Pyran-4-one, 2,3-dihydro-3,5-dihydroxy-6-methyl-; 4-Methyl itaconate; .alpha.-Terpineol; 1,2,3-Propanetriol, 1-acetate; Benzofuran, 2,3-dihydro-; Caryophyllene oxide; Hinesol; n-Hexadecanoic acid; 9,12-Octadecadienoic acid (Z,Z)-, methyl ester; Hexadecanoic acid and methyl ester. Elemental analysis of stem, leaves and roots of the plant show the presence of (macro and micro) nutrients such as Ca, Mg, K, Na, Cu, Pb, Zn, Mn, Fe, Cd and Co were absent in all parts. Proximate analysis of different parts revealed the presence of moisture contents (8.57%), ash (9.77%), fats contents (5.96%), fibers contents (45.03%), protein (3.62%), carbohydrates (39.71%) and Gross energy (Kcal/100g) (220.10). The ethanolic extract show dose-dependent genoprotective potential (127.38 ± 1.16), (83.28 ± 0.65), and (44.08 ± 1.40) at 50, 75, and 100 mg/100 ml, respectively, as compared to the methanolic extract which show genotoxic activity (85.13 ± 1.23) at high dose. After 90 minutes at a concentration of 300 (g/ml), methanolic extract demonstrated the greatest antioxidant potential (79.5%), followed by aqueous extract (76.5%). The methanolic extract of F. africana demonstrated antidiarrheal efficacy, with the maximum inhibition of charcoal movement (83.78%) occurring at a dosage of 300 mg/kg, followed by doses of 200 and 100 mg/kg, 73.26% and 59.56%, respectively. The current research highlights that the plant contains a substantial quantity of micro and macro nutrients, possesses high nutritional value, and exhibits pharmacological activities. These properties render the plant suitable for developing remedies to treat various therapeutic diseases.

Special machinery engineering is of great importance to the manufacturing industry and makes a comparatively large contribution to many economies. Digital transformation is already well advanced in many producing industries, and modern ICT technologies such as agents, service orientation, digital twins and artificial intelligence are being used with increasing success. In addition to improving specific product characteristics such as reliability or flexibility, the adoption of modern ICT technologies to ensure sustainability is being intensively discussed. So far, however, there has been little uptake of these technologies in the special machinery industry; sustainability receives little attention. This article examines in detail the reasons for and impediments to the adoption of modern ICT technologies based on a study among special machinery manufacturers. Observations of existing challenges were gathered during daily work, described in detail, and used to derive conclusions about causal barriers. From this, detailed requirements are derived to promote the adoption of modern ICT technologies in the special machinery engineering sector and, ultimately, to bring sustainability more into focus.

Trait anxiety, emotion regulation strategies, and metacognitive beliefs influence executive functions (EF) and academic achievement. This study examines their interplay and impact on academic success. In total, 275 adolescents (10-17 years) and parents completed an online questionnaire assessing trait anxiety, emotion regulation strategies, metacognition, parent-reported behaviors related to executive functioning, and overall school average. Preliminary analyses confirmed consistency with existing literature for each variable and their interaction. Furthermore, we conducted a network analysis among the main variables. This analysis supports the need to pay more attention to reflective variables - maladaptive emotion regulation strategies and metacognitive beliefs about worry - when studying trait anxiety. These variables were linked to problematic executive functioning in adolescents. These latter had a negative link to academic achievement. This study offers innovative insights by investigating less-explored relationships in the scientific literature. It reveals high and significant correlations between metacognitive beliefs, maladaptive emotion regulation strategies and trait anxiety (r &gt; .500, p &lt; .001) but also between these variables and both executive functioning and academic achievement. These findings offer new perspectives for research and underscore the importance of holistically examining psychological factors related to academic success.

Due to urban sprawls, the arable land is shifting in the settlement areas and towns, while industrial development is making it more vulnerable. The current study was conducted to see the changes in land use and land cover in Kotri area, Pakistan from 1998 to 2020 to establish trends in recent land use development based on available land use data. In this regard, satellite images in the study area were acquired from USGS and processed using ArcMap 10.5 and Environmental for Visualizing Images (ENVI). Results show that; there was a change in the settlement pattern of Kotri city with 40% between 1998 and 2020, 77% decrease in Bare-land was observed in 2020. Natural vegetation in the study area has decreased significantly with 4.4 Sq/ km in 2020, surface water-bodies in 1998 were 1.3 sq/km and in 2020 there is 1.8 Sq/km indicating 32% increase in surface water bodies. It was further revealed that settlement in Kotri has increased due to its geographical location, nearness of the major city of Hyderabad, and the establishment of the industrial zone and educational city near Kotri. From the foregoing, the study concluded that Kotri City will have more changes in its land use and land cover as the expansion in the city is going on and on. It is therefore recommended that local government and provincial government should pay attention towards this development and put up an action plan towards proper provision for such expansion.

The present study identified the influence of green advertising and eco-labels on the attitude and environmental awareness of millennials who purchase ecological products in shopping centers in Ecuador. The research was quantitative, correlational and with a cross-sectional design. A total of 430 millennials participated in the study. A 20-question survey was applied in person outside the shopping centers of Quito and Guayaquil - Ecuador. The convergent and discriminant validity of the research model was verified using Confirmatory Factor Analysis (CFA) and Structural Equation Models (SEM). SPSS 20 and AMOS 24 programs were used for statistical analysis. The results show that green advertising influences environmental attitudes (β: 0,245) and awareness (β: 0,110) and specifically influences purchasing behaviour (β: 0,154) for green products. Although eco-labels do not directly influence purchasing behaviour (β: 0,128), they influence the attitudes (β: 0,406) and ecological awareness (β: 0,277) of millennials who buy organic products. This article is one of the first studies to identify the relationship between green advertising elements and green product purchasing behaviors among millennials in a developing country, concluding that marketing strategies based on green advertising and eco-labels have an impact on the attitude and environmental awareness of millennials, but only advertising directly affects purchasing behaviour while eco-labels do not. This research has social implications since it corroborates that millennials are concerned about environmental problems and are willing to contribute to sustainability.

The thionamide antithyroid drugs were discovered largely following serendipitous observations by numerous researchers in the 1940s who found that sulfhydryl-containing compounds were goitrogenic in animals. Prof. Edwin B. Astwood was the first to use these compounds to treat hyperthyroidism. In this review, we summarize the history of the development of these drugs and the coordination possibility of 2-thiouracil and its derivatives, as well as the biological activities of some of its complexes. Some of them are used as agents for the treatment of tuberculosis, and arthritis, others have bactericidal and fungicidal activity, the third cytotoxic properties, and could be used to treat various types of cancer.

This study was to designed to develop sorafenib-loaded polymeric nanoparticles, surface-modified with pluronic F-127 for the effective treatment of hepatocellular (HCC) and renal cell carcinomas (RCC). Poly lactic coglycolic acid (PLGA) was used to encapsulate different concentrations of sorafenib by a simple modified solvent evaporation method applying pluronic F-127 as a surfactant and coating agent. The preformulation and characterization studies were conducted to evaluate the incompatibilities among sorafenib, PLGA and pluronic F-127, and physicochemical properties of the formulations, respectively. The sizes of the coated and plain PLGA nanoparticles were ~140 ± 14.7 nm and ~ 120 ± 10.1 nm, respectively. It has been confirmed from the in vitro release studies that PLGA sustained the release of sorafenib, avoiding the initial burst release, while the in vivo studies demonstared that surface-modified nanoparticles have greater affinity in the target aorgans than plain PLGA nanoparticles and free drug keeping the dose constant (20 mg/kg body weight). The delivery of sorafenib-loaded polymeric PLGA nanoparticles into the target tissues and their pharmacokinetic parameters have been improved significantly compared to the reported formulations.

Takotsubo syndrome (TTS) is a cardiomyopathy that presents clinically as a transient and reversible left ventricular wall motion abnormality (LVWMA) that can recover spontaneously within hours to weeks. Studies have shown that it mainly affects older people. Postmenopausal women in particular have an increased prevalence. Physical and emotional stress are widely discussed and generally recognized trigger factors. As age also appears to play a major role in the development of TTS, this review will take a closer look at age- and gender-specific aspects. First and foremost, postmenopausal women and the associated lower oestrogen concentration should be mentioned here. Another important role is played by the hypothalamic-pituitary-adrenal (HPA) axis and the associated glucocorticoid-dependent negative feedback and the resulting immune response. Inflammaging is another term that is increasingly used in connection with TTS. In the following, these risk factors are considered in more detail and linked to the increased sympathetic activity as a possible consequence of chronic stress. Based on the imbalance between the sympathetic and parasympathetic nervous system, we venture an explorative proposal and would like to present a new possible therapeutic approach.

This paper focuses on improving the tracking accuracy for servo systems and increasing the contouring performance of precision machining. The dynamic friction during precision machining is analyzed using the LuGre model. The dynamic and static parameters in the friction model are efficiently and accurately identified using the improved Drosophila Swarm Algorithm based on cross-mutation. The friction tracking error can be deduced by the friction state space and an expression is derived. To compensate for the tracking error caused by friction, a feedforward compensation control is designed to avoid signal lag in traditional friction controllers. Furthermore, the factors of multi-axis parameter mismatching that impact the machining profile accuracy are analyzed for multi-axis control. An adaptive cross-coupled control-based pre-compensation strategy of contour error is designed to reduce both the tracking error and the contour error. The effectiveness of the proposed method is validated through several experiments, which demonstrate a remarkable improvement in tracking performance and contour accuracy.

Cannabis, renowned for its historical medicinal use, harbours various bioactive compounds—cannabinoids, terpenes, and flavonoids. While major cannabinoids like THC and CBD have received extensive scrutiny for their pharmacological properties, emerging evidence underscores the collaborative interactions among these constituents, suggesting a collective therapeutic potential. This comprehensive review explores the intricate relationships and synergies between cannabinoids, terpenes, and flavonoids in cannabis. Cannabinoids, pivotal in cannabis's bioactivity, exhibit well-documented analgesic, anti-inflammatory, and neuroprotective effects. Terpenes, aromatic compounds imbuing distinct flavours, not only contribute to cannabis's sensory profile but also modulate cannabinoid effects through diverse molecular mechanisms. Flavonoids, another cannabis component, demonstrate anti-inflammatory, antioxidant, and neuroprotective properties, particularly relevant to neuroinflammation. The entourage hypothesis posits that combined cannabinoid, terpene, and flavonoid action yields synergistic or additive effects, surpassing individual compound efficacy. Recognizing the nuanced interactions is crucial for unravelling cannabis's complete therapeutic potential. Tailoring treatments based on the holistic composition of cannabis strains allows optimization of therapeutic outcomes while minimizing potential side effects. This review underscores the imperative to delve into the intricate roles of cannabinoids, terpenes, and flavonoids, offering promising prospects for innovative therapeutic interventions and advocating continued research to unlock cannabis's full therapeutic potential within the realm of natural plant-based medicine.

Alternaria alternata is a saprophyte and is also known to cause many opportunistic infections in humans. Alternaria infections are important factors of morbidity and mortality in im-mune-compromised and solid organ transplant (SOT). Sensitivity to the airborne fungus Alter-naria alternata is also believed to be a common cause of allergic asthma. Therapies are limited by the lack of knowledge about the role of individual fungal gene products and symptoms in im-mune-compromised and transplant patients. This review summarizes the published case studies on Alternaria alternata infections in transplant patients.

Studies at the juncture of development economics and public health host considerable responsibility in addressing inequality and related mental health distress. Mental health care in economically marginalized populations requires depicting the linkages between socioeconomic status and psychological distress. In the present work, a sequential mixed-methods design was used to study 190 people in such communities in India. Gender-dependent psychological distress was found according to Kessler Psychological Distress Scale (K-10) with moderate distress in women (M= 26.30, SD= 9.15) and mild distress in men (M= 21.04, SD= 8.35). Regression analysis indicated that gender significantly predicted psychological distress, followed by age, marital status, and education of the head of the family. The Interpretative Phenomenological Analysis of semi-structured interviews to six women who scored the highest on the distress scale unveiled three master themes: (1) Manifestation of Psychological Distress, (2) Contextual Challenges, and (3) Sources of Strength and Resilience. Overall, participants reported lack of resources, community violence, gender discrimination, and widespread substance use as major contributors to the ongoing distress. These findings can pave the way for future studies to expand beyond independent economic indicators and curate clinical interventions for culturally competent mental health care.

(1) Background: Emotion regulation is a critical determinant of adaptive functioning during adolescence, exerting profound influence on psychological well-being. This study seeks to deepen our understanding of the intricate interplay between emotion regulation and maladaptive psychological symptoms, examining these dynamics through a cross-countries comparison; (2) Methods: A total of 224 adolescents, aged 13 to 21 years, from both Iran and Belgium, participated in a cross-sectional comparative study. The study aimed to elucidate the relationship between emotion regulation and mental health functioning, assessing internalizing symptoms, externalizing symptoms, and self-injury. A demographic questionnaire, the Emotion Regulation Inventory, Strengths and Difficulties Questionnaire, and Self-Harm Inventory, were administered. Data analysis incorporated correlation assessments, Multivariate Analysis of Variance, and Structured Equation Modeling; (3) Results: The findings revealed a positive association between emotional dysregulation and psychological symptoms across the entire sample. Conversely, emotional suppression, more prevalent in Iran, showed no significant link with maladaptive symptoms but was associated with self-harm in the Belgian sample. Cultural disparities were evident, with internalizing problems more prevalent in Iran and externalizing issues more common in Belgium; (4) Conclusion: Emotional dysregulation emerged as a common factor compromising mental health. It emphasizes the necessity of considering cultural nuances when developing intervention and prevention programs and calls for further research in this field.

Abstract: Background: chronotype is generally defined as the variability of the phase angle of en-trainment, while the latter reflects the relationship between the timing of a certain rhythm (e.g., sleep-wake cycle) and the timing of an external temporal cue. Individuals can be placed on a spectrum from "morning types" (M types), to "evening types" (E types). E-chronotype has been proposed as a transdiagnostic risk factor for psychiatric conditions and associated with psycho-pathological dimensions. Eveningness seems correlated with both suicidal ideation (SI) and suicidal behavioral (SB), through several possible mediating factors. Immunological alterations also have been linked to later chronotypes and SI/SB. Objective: This narrative review aims to summarize the evidence supporting the possible association between chronotypes and suicide, with the eventual mediating role of neuroinflammation and several psychopathological dimensions. Material and methods: A search of literature (2003-2023) was conducted, using various databases: PUBMED, EMBASE, Scopus, UpToDate, PsycINFO, Cochrane Library. English-language articles were col-lected and screened for eligibility. Results: Despite the apparent absence of a direct correlation between E-chronotype and suicidality, E-chronotype promotes a chain of effects that could be in-volved in an increased risk of SB, in which with neuroinflammation possibly play an intriguing role and some psychopathological dimensions may stand out.

Emerging research has revealed a complex bidirectional interaction between the gut microbiome and cannabis. Preclinical studies have demonstrated that the gut microbiota can significantly influence the pharmacological effects of cannabinoids. One notable finding is the ability of the gut microbiota to metabolise cannabinoids, including Δ^9-tetrahydrocannabinol (THC). This metabolic transformation can alter the potency and duration of cannabinoid effects, potentially impacting their efficacy in cancer treatment. Additionally, the capacity of gut microbiota to activate cannabinoid receptors through the production of secondary bile acids underscores its role in directly influencing the pharmacological activity of cannabinoids. While the literature reveals promising avenues for leveraging the gut microbiome-cannabis axis in cancer therapy, several critical considerations must be accounted for. Firstly, the variability in gut microbiota composition among individuals presents a challenge in developing universal treatment strategies. The diversity in gut microbiota may lead to variations in cannabinoid metabolism and treatment responses, emphasising the need for personalised medicine approaches. The growing interest in understanding how the gut microbiome and cannabis may impact cancer has created a demand for up-to-date, comprehensive reviews to inform researchers and healthcare practitioners. This review provides a timely and invaluable resource by synthesizing the most recent research findings and spotlighting emerging trends. A thorough examination of the literature on the interplay between the gut microbiome and cannabis, specifically focusing on their potential implications for cancer, is presented in this review to devise innovative and effective therapeutic strategies for managing cancer.

The expedited development of drugs targeting gene products associated with insulin resistance holds the potential to enhance our comprehension of type 2 diabetes mellitus (T2DM). The virtual screening based on a three-dimensional (3D) protein structure has been expected as potential technique to accelerate a development of molecular target drugs. Among the targets implicated in insulin resistance, genetic characterization and protein function of Grb14 have been clarified without contradiction. The Grb14 gene displays notable variations in T2DM, and its gene product known to inhibit the function of the insulin receptor (IR) by directly binding to the tyrosine kinase domain. In the present study, a virtual screening, based on 3D structure of IR tyrosine kinase domain (IRβ) in complex with part of Grb14, was conducted to find compounds that can disrupt the complex formation between Grb14 and IRβ. First, ten compounds were selected from 154,118 compounds via hierarchical in silico structure-based drug screening, composed of grid docking-based and genetic algorithm-based programs. The experimental validations suggested that the one compound can affect blood glucose level. The molecular dynamics simulations and co-immunoprecipitation analysis showed that the compound did not completely suppress the protein–protein interaction between Grb14 and IR, though competitively bound to IR with the tyrosine kinase pseudosubstrate region in Grb14.

In the southeastern coast of Brazil, the bays of Ilha Grande and Sepetiba are linked by the Ilha Grande Channel, where remarkably vigorous currents have been consistently observed. The sheer intensity of these currents defies a simple explanation through tidal forcing alone, prompting researchers to delve into potential influences such as basin resonance and the baroclinic effect. This study aims to elucidate the role of remote meteorological effects within this complex hydrodynamic system. A numerical approach with a coastal model nested within an ocean model was employed, enabling an in-depth examination of the intricate interplay between meteorological and tidal forcings. The study revealed a significant finding: the lag in signal propagation plays a pivotal role in determining how these signals impact the dynamics of the bays. The astronomical signal exhibits a minimal lag along the coast (1 minute), and leads to water level differences between the sea and the coastline, resulting in the generation of tidal currents at the bay entrances. On the other hand, the remote meteorological signal, with a stronger signal lag along the coast (4.92 hours), leads to the creation of water level difference between the bay’s entrances, inducing significant fluxes along the narrow Ilha Grande Channel.

Green synthesis using plant extracts has emerged as an eco-friendly, clean, and viable strategy alternative to chemical and physical approaches. The leaf, stem, and root extracts of Lannea discolor was utilized as a reducing and stabilizing agent in the synthesis of gold (AuNPs) and copper (CuNPs) nanoparticles. The formation of AuNPs and CuNPs confirmed by their color change, was characterised by UV–Vis Spectroscopy (UV- Vis), Scanning electron microscopy analysis and energy dispersive x-ray (SEM-EDX), Transmission Electron Microscopy (TEM), and Fourier Transform Infrared Spectroscopy (FTIR), coupled with minimum concentration inhibitory (MIC) antibacterial assays. AuNFs, NPs and CuNPs peaked at wavelengths in the ranges of 316, 544 and 564 nm respectively. TEM showed unexpected nanoflowers (30 – 97 nm) in the leaf extracts and spherical NPs (10 -33 nm; 9.3 – 37.5) from stem and root extracts, while spherical CuNPs (20 – 104 nm), were observed from all the extracts. EDX was able to confirm the presence of metal salts and FTIR revealed stable capping agents. AuNPs and NFs from L. discolor extracts showed appreciable antibacterial activity against Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae and Bacillus subtilis, when compared to the plant extracts, while none was observed from the CuNPs. These AuNPs and CuNPs are particularly appealing in a variety of applications in the biomedical as well as conductivity manufacturing, due to their shapes and sizes and economical and environmentally friendly production.

Global degradation of coral reefs is reflected in the destruction of shelters in various environments and threatens the stability of marine ecosystems. Artificial shelters offer an alternative, but their design is challenging due to limited knowledge regarding the shelter characteristics preferences of desired inhabitants. Investigating these preferences is resource-intensive, particularly regarding small shelters that mimic natural reef condition. Further, fish abundance may be too low for statistical analysis in small shelters. We propose a method to characterize the species-specific shelter preferences using low-volume data. During a study conducted from January 2021 to April 2022, round clay artificial shelters (RAS) were deployed on an abandoned oil pier to examine a coral reef fish community. We recorded 92 species from 30 families; grouped them to systematically (families) and functionally (dietary group) classes. Grouping enabled examining each group’s preference while crossing these group preferences revealed species- specific preferences, that matched field observations. This approach proved effective in profiling the shelter preferences of 17 species while having limited resources. These profiles may latter allow the establishment of ecological-oriented artificial reefs.

Radiotheranostics refers to pairing of radioactive imaging biomarkers with radioactive therapeutic compounds that deliver ionizing radiation. Given the introduction of very promising radio-pharmaceuticals, the radiotheranostics approach is creating a novel paradigm in personalized, targeted radionuclide therapies (TRTs), also known as radiopharmaceuticals (RPTs). Radiother-apeutic pairs targeting somatostatin receptors (SSTR) and prostate-specific membrane antigens (PSMA) are increasingly used to diagnose and treat patients with metastatic neuroendocrine tumors (NETs) and prostate cancer. In parallel, radiomics and artificial intelligence (AI) as important areas in quantitative image analysis are paving the way for significantly enhanced workflows in diagnostic and theranostic fields, from data and image processing to clinical decision support, improving patient selection, personalized treatment strategies, response prediction, and prognostication. Furthermore, AI has the potential for tremendous effectiveness in patient dosimetry which copes with complex and time-consuming tasks in the RPT workflow. The present work provides a comprehensive overview of radiomics and AI application in radio-theranostics, focusing on pairs of SSTR- or PSMA‑targeting radioligands, describing the funda-mental concepts and specific imaging/treatment features. Our review includes ligands radio-labeled by 68Ga, 18F, 177Lu, 64Cu, 90Y, and 225Ac. Specifically, contributions by radiomics and AI towards improved image acquisition, reconstruction, treatment response, segmentation, restag-ing, lesion classification, dose prediction, and estimation as well as ongoing developments and future directions are discussed.

A three-year survey was conducted to estimate the incidence of grapevine trunk diseases (GTDs) in Greece and identify fungi associated with the disease complex. In total, 310 vineyards in different geographical regions in northern, central, and southern Greece were surveyed, and 533 fungal strains were isolated from diseased vines. Morphological, physiological and molecular (5.8S rRNA gene-ITS sequencing) analyses revealed that isolates belonged to 35 distinct fungal genera, including well-known (e.g. Botryosphaeria sp, Diaporthe spp., Eutypa sp., Diplodia sp., Fomitiporia sp., Phaeoacremonium spp., Phaeomoniella sp.) and lesser-known (e.g. Neosetophoma sp., Seimatosporium sp., Didymosphaeria sp., Kalmusia sp.) grapevine wood inhabitants. GTDs-inducing population structure differed significantly among the discrete geographical zones. Phaeomoniella chlamydospora (26.62%, n=70), Diaporthe spp. (18.25%, n=48) and F. mediterranea (10.27%, n=27) were the most prevalent in Heraklion, whereas D. seriata, Alternaria spp., P. chlamydospora and Fusarium spp. were predominant in Nemea (central Greece). In Amyntaio and Kavala (northern Greece), D. seriata was the most frequently isolated species (&gt;50% frequency). Multi-genes (rDNA-ITS, LSU, tef1-α, tub2, act) sequencing of selected isolates, followed by pathogenicity tests revealed that Neosetophoma italica, Seimatosporium vitis, Didymosphaeria variabile and Kalmusia variispora caused wood infection with the former being the most virulent. To the best of our knowledge, this is the first report of N. italica associated with GTDs worldwide. This is also the first record of K. variispora, S. vitis and D. variabile associated with wood infection of grapevine in Greece. The potential associations of disease indices with vine age, cultivar, GTD-associated population structure and the prevailed meteorological conditions in different viticultural zones in Greece are presented and discussed.

Background: Chronic post-surgical pain is a condition persisting at least three months after surgery. It is estimated that 25-60% of patients who underwent breast cancer removal surgery suffer from post-mastectomy pain syndrome and occurred anxiety, depression, sleep disturbance and catastrophizing. Physical activity can reduce the risk of chronic diseases and has a good impact on mood and cognitive function. Aim of this study was to evaluate the effects of physical activity on the intensity of pain, depression and anxiety in women underwent mastectomy for breast cancer removal. Methods: A prospective observational unicentric cohort study was performed. Patients were female underwent unilateral or bilateral mastectomy. Numerical Rating Scale (NRS), was used to assess pain intensity, Beck’s Depression Inventory (BDI) for depression and Generalized Anxiety Disorders-7 (GAD-7), for anxiety evaluation. Physical activity was assessed by International Physical activity questionnaire (IPAQ). Interleukin (IL)-17, IL-1β, cortisol, adrenocorticotropic hormone (ACTH) and brain-derived neurotrophic factor (BDNF) were also evaluated in the blood of patients. All the evaluation was assessed 3 and 6 months after the surgery. Results: Adequate physical activity reduced intensity of pain, depression and anxiety symptoms in women affected by post-mastectomy pain syndrome. Moreover, adequate active women, showed a reduction of biomarkers of inflammation, cortisol, ACTH and an increase of BDNF. Conclusions: Our results suggest that physical activity can improve quality of life, reducing intensity of pain, inflammatory markers and it can be useful in the reduction of associated anxiety and depression.

In this study, the efficiency of coating (alginate and carrageenan) and osmotic dehydration pre-treatment (NaCl and sucrose) on decreasing oil uptake of potato strips was assessed. It was examined how various pre-treatments affected the sample’s texture, morphology, color and density properties as well as their moisture content and effective moisture diffusion coefficient (Deff). Results showed that NaCl osmotic dehydration pre-treatment and sucrose solution decreased oil uptake by 30.76% and 41.75%. This is attributed to moisture removal increasing caused by improving dielectric properties. Osmotic dehydration and coating pre-treatment frequently enhanced product shrinkage, browning index, a* and ∆E. Conversely, density, lightness, breaking force, Deff and b* decreased. In control samples, SEM revealed a severely damaged internal structure in comparison to a tissue homogenous layer produced by coating. For moisture loss and oil uptake, the coefficient of determination (R2) and root mean square error (RMSE) of eight empirical models were compared. Finally, the Dehghannya and Krokida model (moisture loss) and the Movahhed and Naghavi model (oil uptake) were found the best fit to the experimental data. Although coating pre-treatment and osmotic dehydration can be used as an alternate de-oiling approach for potato chips, the mechanism of oil uptake reduction differ.

Circadian rhythm disruptions are a hallmark feature of mood disorders. Patients experiencing acute depressive episodes report noticeable changes in their sleep-wake cycles. This research explains the association between depression and various circadian rhythm metrics, explicitly focusing on adolescents diagnosed with depressive disorders. Adolescence is a critical period marked by significant physiological and psychological changes, making it imperative to understand how mood disorders manifest during this phase. However, there have been minimal specific studies in pediatric populations to determine whether circadian rhythm changes differ between adolescents with first- and multiple-recurrent depressive episodes. Our study involved a group of 61 adolescents aged between 13 and 18. We performed a cross-sectional study of a clinical popu-lation of patients presenting to a child and adolescent psychiatry clinic diagnosed with depression. Participants were asked to complete self-report evaluations using several tools: The Korean ver-sion of the Biological Rhythms Interview of Assessment in Neuropsychiatry (K-BRIAN), the Korean Translation of Composite Scale to Measure Morningness-Eveningness (KtCS), and the Seasonal Pattern Assessment Questionnaire (SPAQ). Tools such as the Children's Depression In-ventory (CDI), State-Trait Anxiety Inventory (STAI), and K-Mood Disorder Questionnaire (K-MDQ) were employed for the assessment of clinical characteristics of depression. Based on the frequency of their depressive episodes, participants were bifurcated into two distinct groups: those experi-encing their first episode (n=22, mean age: 15.09±1.44 years) and those with recurrent episodes (n=39, mean age: 15.95±1.26 years). At first, the two groups' data revealed no significant differences regarding mood or circadian rhythm metrics (CDI: first-episode 26.18±10.54 and recurrent episode 25.90±10.59, STAI-S: first-episode 56.91±12.12 and recurrent episode 57.49±11.93, STAI-T: first-episode 60.36±11.63 and recurrent episode 59.09±12.10, SPAQ-total: first-episode 6.59±4.86 and recurrent episode 6.77±5.23, KtCS: first-episode 30.32±5.83 and recurrent episode 28.13±7.36). However, we observed significant correlations between circadian rhythm disruptions and depression scales (CDI with SPAQ-weight (r=0.26), KtCS (r=-0.48), K-BRIAN-sleep (r=0.58), K-BRIAN-activity (r=0.64), K-BRIAN-social (r=0.71) and K-BRIAN-eating (r=0.40)). These correlations were especially pronounced in the recurrent episode group, suggesting that with the progression and chronicity of depression, the relationship between circadian rhythms and depression becomes more intertwined and evident. In conclusion, especially in adolescents, as the severity and chronicity of depression increase, the interplay between circadian rhythms and mood disorders becomes more pronounced, warranting further research and clinical attention.

This study assessed the impact of mineral fertilization on tuber yield and food quality of yam genotypes, specifically Dioscorea alata and Dioscorea rotundata. Four genotypes, each from D. alata and D. rotundata, were used in field experiments conducted in Ibadan, Nigeria, in the 2017 and 2018 cropping seasons. Experiments were conducted under low soil NPK fertility conditions with and without fertiliser treatments. A recommended NPK rate for the area (90, 50, and 75 Kg N, P, K ha-1) was applied to plots with fertiliser treatment. Tuber yield, functional and pasting properties of yam flour, and sensory attributes of pounded yams were collected. The results showed differential responses of the genotypes to tuber yield and food quality with fertiliser application. Fertiliser application has generally increased fresh tuber yield, but it has affected some genotypes' flour quality and textural attributes of the pounded yams. As regards genotypes Danacha and TDa0200012, fertiliser application has increased tuber yield without causing a decrease in tuber quality hence, suggesting Danacha and TDa0200012 as suitable genotypes for maximizing fertiliser productivity. However, in another genotype Ojuiyawo, fertiliser application effectively increased tuber yield but deteriorated tuber quality. Our results suggested that it is crucial to determine the impact of fertilisation on tuber yield and quality for each genotype and select the appropriate genotype to improve productivity through mineral fertilisation. The results of this study can be widely applied to enhance yam productivity in sub-Saharan Africa and useful for sustainable agriculture in yam-growing areas.

Adding zinc (II) and formate anions improves the thermal phase-stability of alpha-FAPbI3 materials and the spin-coated thin films of such doped FAPbI¬3 show an increased emission lifetime of up to 3.7 microsecond on quartz. This work investigates the effects of zinc and formate on the stability and time resolved photoluminescence of FAPbI3 perovskites for solar cell applications. Perovskite samples with varying concentrations of zinc and formate were made by incorporating different amounts of zinc formate and zinc iodide and characterized with XRD. Doping levels of 1.7% Zn(II) and 1.0% formate (relative to Pb) seem optimal. The thermal stability of the perovskite powders and thin films were assessed. XRD was virtually unchanged after 6 months. The time-resolved photo-luminescence spectroscopy of the doped spin-coated perovskite samples is reported. The results show that synergy between an anionic and a cationic dopant can take place, making the perovskite thermally more stable with a longer charge carrier lifetime.

Rail, as the cleanest and greenest high-volume transport, has a central role in the decarbonizing, and it is expected to become the backbone of future mobility in the world. It is worthy to highlight that rail generates the lowest CO2 emissions and energy consumption in operation with respect to the other transportation modes but during construction and maintenance phases CO2 emission, energy consumption and other environmental impacts are significant and need to be carefully assessed and properly mitigated. This paper, based on an extensive literature review, provides a comprehensive framework of trends and challenge in railway sustainability. Attention is focused on track and related materials, maintenance strategies, and methods of assessment of the sustainability. Results show that improvement of materials and practices used in construction and appropriate strategies in maintenance, supported by effective monitoring of the state of the track, can reduce the negative effects on the environment and society and contributes to make this transportation mode greener. Proper methods for the assessment of the sustainability, (LCA, Circularity Index) help to quantify the potential of environmental enhancement of different solutions and constitute effective and indispensable tools in the decision-making process.

Introduction. This retrospective study aimed to compare the risk factors for vascular calcification (VC) between pre-hemodialysis (HD) and prevalent HD adult patients while investigating associations with calcification biomarkers. Methods. Baseline data from 30 pre-HD and 85 HD patients were analyzed, including iPTH, vitamin D, FGF23, fetuinA, sclerostin, and VC scores (Adragao method). Multivariable linear regression identified VC predictors. Results: The prevalence of VC was similar in both groups, but HD patients had more pronounced VC scores ≥6. Pre-HD patients were older, with higher prevalence of Balkan endemic nephropathy, hypertension, and less frequent use of calcium phosphate binders. Both groups exhibited similar patterns of hyperphosphatemia, low vitamin D, and iPTH levels. In HD group normal phosphate was significantly common in patients with VC, whereas hyperphosphatemia was significantly common in patients without VC. Fetuin-A levels were higher in pre-HD patients, while FGF23 was elevated in HD patients. In pre-HD patients, male gender was associated with reduced VC risk, while in HD patients, malignancies and serum phosphate levels were negative VC predictors. Conclusion: Effective monitoring and tailored treatment of VC in CKD are still focused on phosphate regulation. Besides, mineral disturbances, hormones and biomarkers regulation, and patient-specific variables need to be considered.

This research paper presents a deep learning approach to early detection of skin cancer using image augmentation techniques. The authors propose a two-stage image augmentation technique that involves the use of geometric augmentation and generative adversarial network (GAN) to classify skin lesions as either benign or malignant. This research utilized the public HAM10000 dataset to test the proposed model. Several pre-trained models of CNN were employed, namely Xception, Inceptionv3, Resnet152v2, EfficientnetB7, InceptionresnetV2, and VGG19. Our approach achieved accuracy, precision, recall, and F1-score of 96.90%, 97.07%, 96.87%, 96.97%, respectively, which is higher than the performance achieved by other state-of-the-art methods. The paper also discusses the use of SHapley Additive exPlanations (SHAP), an interpretable technique for skin cancer diagnosis, which can help clinicians understand the reasoning behind the diagnosis and improve trust in the system. Overall, the proposed method presents a promising approach to automated skin cancer detection that could improve patient outcomes and reduce healthcare costs.

The negative impact of drought on plant growth may be modified by different availability of mineral nutrients and by their adaptation to different local habitat conditions. In this study, we examine the impact of drought, fertilization with phosphorus and provenance, as well as their interactions, on the growth and allometric growth relationships between belowground and aboveground organs of common beech (Fagus sylvatica) and sessile oak (Quercus petraea). The research was conducted on saplings originating from two mature mixed stands (dry and wet provenances) dominated by these species. In the common garden experiment, saplings were exposed to regular watering and drought in interaction with moderate and high phosphorus concentrations in the growing substrate (achieved by phosphorus fertilization). Obtained results indicate negative impact of drought and phosphorus fertilization on the growth of both species. In common beech, phosphorus fertilization had a negative impact on its adaptive capacity to drought, because of the unfavourable ratios between fine root mass and mass of other organs. The sessile oak provenances under the impact of drought showed a different root collar diameter/stem height increment ratio, which indicates its different phenotypic plasticity as a consequence of adaptation to different frequencies of dry periods in their natural habitats.

In this work we present a versatile, rapid, and low-cost manufacturing technique to develop bioceramic scaffolds that could enhance bone tissue regeneration via microwave preparation using a commercial microwave oven. The scaffolds were prepared combining hydroxyapatite and water glass (sodium trisilicate solution), foamed by using a microwaves oven and then characterized by means of SEM-EDS, mechanical properties, infrared spectroscopy (ATR-FTIR), density and stability test in water. Furthermore, in vitro tests were performed to verify the affinity of osteoclast cells versus the so prepared scaffold. The morphology of the samples showed interconnected pores suitable for promoting tissue regeneration and vascularization while specific mechanical properties were preserved. The physicochemical characterization and the in vitro tests presented promising results for bone regenerative applications.

The increased cultivation of Cannabis sativa L. in North America, represented by high Δ9-tetrahydrocannabinol-containing (high-THC) cannabis genotypes and low THC-containing hemp genotypes, has been impacted by an increasing number of plant pathogens. These include fungi which destroy roots, stems and leaves, in some cases causing a build-up of populations and mycotoxins in the inflorescences that can negatively impact quality. Viroids and viruses have also increased in prevalence and severity and can reduce plant growth and product quality. Rapid diagnosis of the occurrence and spread of these pathogens is critical. Techniques in the area of molecular diagnostics have been applied to study these pathogens in both cannabis and hemp. These include polymerase chain reaction (PCR)-based technologies, including RT-PCR, multiplex RT-PCR, RT-qPCR, and ddPCR, as well as whole genome sequencing (NGS) and bioinformatics. In this study, examples of how these technologies have enhanced the rapidity and sensitivity of pathogen diagnosis on cannabis and hemp will be illustrated. These molecular tools have also enabled studies on the diversity and origins of specific pathogens, specifically viruses and viroids, and these will be illustrated. Comparative studies on the genomics and metabolomics of healthy and diseased plants are urgently needed to provide insight into their impact on quality and composition of cannabis and hemp-derived products. Management of these pathogens will require monitoring of their spread and survival using the appropriate technologies to allow accurate detection, followed by appropriate implementation of disease control measures.

Background: The effect of rice bran arabinoxylan compound (RBAC), a plant-based immunomodulator, on the quality of life (QoL) in cancer patients and underlying physiological pathways remains unclear. Trial design: The RBAC-QoL study is a double-blind, randomised, controlled pilot feasibility study. The aim is to determine RBAC’s effects on QoL and the associated action mechanisms. Primary outcomes are the EORTC QLQ-C30 functional, symptom, and global QoL scores with inflammatory, nutritional, and cytokine parameters as secondary and exploratory outcomes. Methods: Recruitment targets adults diagnosed with solid organ tumours (≥ stage II) undergoing active treatment in several outpatient centres in New South Wales, Australia. Interventions are RBAC or matched placebo at 3g/day for 24 weeks allocated through stratified randomisation with participants, oncologists, and data collectors blinded. Data is collected from five study visits six weeks apart. The trial is ongoing. An interim intention-to-treat analysis was performed using repeated measure ANOVA with pairwise comparisons where statistical significance is observed and adjusted with covariates. Results: Global QoL scores from currently available data (n = 16; RBAC = 7, placebo = 9) were statistically different between groups (F[1,8] = 8.6, p = 0.019, eta2[g] = 0.267). Pairwise comparisons found significant differences at week 6 (p = 0.032, Cohen’s d = 1.454) and marginally at week 12 (p = 0.069, d = 1.427). Age-adjusted analysis showed a continuous upward trend in QoL improvement over time with RBAC, while the placebo group did not deviate from baseline QoL. Significant elevations of serum white blood cell count (week 18) and total protein (weeks 12 and 18) were detected in the RBAC group compared to placebo. The total protein levels correlated highly with white blood cell count (Pearson’s r = 0.539, p < 0.001) and moderately with the global QoL scores (r = 0.338, p = 0.01). No intervention-related adverse events were reported in both groups. Conclusions: RBAC improves QoL beyond placebo during active cancer treatment, possibly through the immuno-nutritional pathway. These findings are preliminary but valuable for future research. Funding and registration: Daiwa Pharmaceutical Co., Ltd, Japan; BioMedica Nutraceuticals Pty Ltd., Australia. ANZCTR Reg No: ACTRN12619000562178p.

Drug-target affinity (DTA) prediction is crucial for understanding molecular interactions and aiding drug discovery and development. While various computational methods have been proposed for DTA prediction, their predictive accuracy remains limited, failing to delve into the structural nuances of interactions. With increasingly accurate and accessible structure prediction of targets, we developed a novel deep learning model, named S2DTA, to accurately predict DTA by fusing sequence and structural knowledge of drugs, targets, and pockets using heterogeneous models based on graph and semantic networks. Experimental findings underscored that complex feature representations imparted negligible enhancements to the model’s performance. However, the integration of heterogeneous models demonstrably bolstered predictive accuracy. In comparison to three state-of-the-art methodologies, the supremacy of S2DTA became strikingly apparent. It showcased a noteworthy 25.2% reduction in Mean Absolute Error (MAE) and an impressive 20.1% decrease in Root Mean Square Error (RMSE). Furthermore, S2DTA exhibited substantial advancements in other pivotal metrics, including Pearson Correlation Coefficient (PCC), Spearman, Concordance Index (CI), and R2. These metrics experienced remarkable increments of at least 19.6%, 17.5%, 8.1%, and a remarkable 49.4%, respectively. Finally, we conducted interpretability analysis on the effectiveness of S2DTA by bidirectional self-attention mechanism, fully proving that S2DTA is a valuable and accurate tool for predicting DTA. For further exploration, the source data and code repository can be accessed at https://github.com/dldxzx/S2DTA.

Abstract: This article explores the intricate relationship between environmental degradation, specifically air pollution, and economic growth in the Sultanate of Oman spanning the period from 1990 to 2022. We employ cointegration and vector error correction models to uncover both short- and long-term dynamics in the association between air pollution and economic growth. Fur-thermore, Granger causality analysis is utilized to investigate the causal links between these crucial variables. This data encompasses factors related to environmental quality and various control variables. The empirical results unveil a sustained long-term cointegration connection between the variables. Additionally, our findings highlight a statistically significant positive impact of economic growth and energy consumption on CO2 emissions. Furthermore, the short-term analysis reveals an annual adjustment of approximately 14.1% in N2O emissions dis-equilibrium. The Granger causality study indicates unidirectional causal relationships involving N2O emissions, economic growth, and CO2 emissions. The implications of these findings for Oman's policy landscape are substantial. To effectively reduce greenhouse gas emissions, it is imperative for Oman to establish robust climate change policies. Additionally, the government can play a pivotal role in encouraging and endorsing the use of renewable energy sources, such as green hydrogen, as a promising alternative to traditional oil and gas resources.

(Background) Phytotoxicity refers to the capacity of chemical substances or environmental factors to have a negative impact on plants. This is a crucial issue in both the context of crop cultivation and environmental protection. (Material and Methods) The research results were based on a 3-year field experiment conducted at the experimental station in Jadwisin (52°28′ N, 21°02′ E) on loamy soil. The experiment was set up using a randomized sub-block design in a split-split-plot arrangement, with three replications. The first-order factor consisted of potato cultivars, while the second-order factors were weed control methods: 1) Control – without protection; 2) mechanical weed control, extensive mechanical treatments to close rows; 3) Sencor 70 WG – pre-emergence (PRE) of potatoes; 4) Sencor 70 WG + Titus 25 WG + Trend 90 EC – PRE of potatoes; 5) Sencor 70 WG – post-emergence (POST) of potatoes; 6) Sencor 70 WG + Titus 25 WG + Trend 90 EC – POST of potatoes; 7) Sencor 70 WG + Fusilade Forte 150 EC – POST of potatoes; 8) Sencor 70 WG + Apyros 75 WG + Atpolan 80 SC – POST of potatoes. The phytotoxic effects of herbicides on potato plants and weeds were assessed every 7 days, starting from the date when the first signs of damage appeared, until they stabilized or disappeared. (Results:) Phytotoxic damage to potato and weed plants were caused by the chemical weed control methods used. The response of potato plants to herbicides was significantly related to the genetic traits of the cultivars and meteorological conditions in the years of research. (Conclusion:) Phytotoxicity is an important aspect in both agriculture and environmental protection. Research on its mechanisms and impact will enable the development of effective plant protection strategies and the preservation of ecosystem balance.

Coasts are characterized by high biological and ecological productivities, and are theatre of strategic economic activities, including tourism, fishing and aquaculture. Both anthropic and natural hazards can thus affect coasts, causing their deterioration. The monitoring of coasts in terms of evolution, adaptation, contamination and resilience, is a pivotal point composed of both classic measurement approaches, and innovative approaches as remote sensing and the use of unmanned aerial vehicles. In the last years, climate change is increasing its effects all over the world and coasts are a delicate system suffering these effects particularly. Climate change has important impacts on coasts, with a serious consequence represented by sea level rise. The latter causes coastal erosion, leading to ecological and economic issues and with consequences for human health. The Mediterranean Basin, which has always represented an important crossroads of different civilizations and economic and cultural exchanges, is now threatened by the consequences of climate change. This area is decribed as an example of coastal system of strategic importance and subjected to serious challenges. Engineering interventions are countermeasures to cope with coastal erosion and coastal degradation. These countermeasures are aimed at protecting the coasts and the populations living on the coasts. The types of intervention can be defined of hard engineering, as in the case of fixed structures in concrete, and of soft engineering, with structures of protection builted according to the principles of nature. Engineering procedures provide coastal benefits, although they can cause further coastal damage. It is thus necessary to protect the coasts and the same time actions aimed at mitigating climate change must be implemented, according to the rules of sustainability.

This academic paper explores the synergistic potential of Agroforestry systems and Climate-Smart Agriculture (CSA) in enhancing climate change adaptation strategies. Focusing on Australia and Pacific Island Countries, the study delves into the pivotal role of these approaches in mitigating the impacts of changing climate variables on agricultural production. By analysing important climate variables, their potential alterations, and their subsequent effects on crop production, the paper advocates for a holistic and forward-thinking approach to sustainable agriculture in the face of climate change.

The ribosome is a macromolecular complex composed of RNA and proteins that interact through an integrated and interconnected network to preserve its ancient core activities. In this review, we emphasize the pivotal role played by RNA-binding proteins as a driving force in the evolution of the current form of the ribosome, underscoring their importance in ensuring accurate protein synthesis. This category of proteins includes both ribosomal proteins and ribosome biogenesis factors. Impairment of their RNA-binding activity can also lead to ribosomopathies, a group of disorders characterized by defects in ribosome biogenesis that are detrimental to protein synthesis and cellular homeostasis. A comprehensive understanding of these intricate processes is essential for elucidating the mechanisms underlying the resulting diseases and advancing potential therapeutic interventions.

Ornamental kale (Brassica oleracea var. acephala) is an attractive ornamental plant with a range of leaf colors and shapes. Breeding new varieties of ornamental kale has proven challenging due to its lengthy breeding cycle and the limited availability of genetic markers. Microspore culture is an effective approach to generate new materials and genetic maps are a prerequisite for quantitative trait loci analysis, MAS, fine gene mapping, and genome sequence assembly. In this study, a F1DH ornamental kale population comprising 300 DH lines was constructed using microspore culture. A high-density genetic map was developed by conducting whole-genome sequencing on 150 individuals from the F1DH population. The genetic map contained 1,696 bin-markers with 982,642 single-nucleotide polymorphisms (SNPs) spanning a total distance of 775.81 cM on all nine chromosomes with an average distance between markers of 0.46 cM. The ornamental kale genetic map contained substantially more SNP markers compared with published genetic maps for other B. oleracea crops. The F1DH progenies provide an excellent resource for germplasm innovation and breeding new varieties of ornamental kale. The high-density genetic map provides crucial insights for gene mapping and unraveling the molecular mechanisms behind important agronomic traits in ornamental kale.

Demethyleneberberine is an active component extracted from the Chinese herbal drug Cortex Phellodendri. It is also a metabolite of the berberine in animals and humans. However, the pharmacokinetics, tissue distribution and excretion of demethyleneberberine have not been reported. The present study aimed to investigate the pharmacokinetic parameters of demethyleneberberine by developing a method of high-performance liquid chromatography-tandem mass spectrometry (LC-MS/MS). The detection was performed by using positive ion electrospray ionization in multiple reaction monitoring mode. The MS/MS ion transitions were monitored at m/z 324.4→308.3 for demethyleneberberine and 465.5→350.3 for IS. After oral administration of demethyleneberberine in rats and mice, the pharmacokinetics, tissue distribution, and excretion of desmethylberberine in rats and mice were comparatively studied for the first time. The plasma concentration of desmethylberberine reached its peak within 5 min after oral administration in both rats and mice. The bioavailability of rats and mice was comparable, ranging from 4.47% to 5.94%, higher than that of berberine. The total excretion of desmethylberberine in urine, feces and bile is 7.28~9.77%. These findings provide valuable insights into the pharmacological and clinical research on desmethylberberine.

This work demonstrates that microbial fuel cells (MFCs), optimized for energy recovery, can be used as an effective tool to detect the presence of antibiotics in water-based environments. MFCs directly convert chemical energy of organic matter in electrical energy thanks to electroactive biofilms. The efficiency of the conversion process can be significantly affected by the presence of contaminants acting as toxicants for the biofilm. In the present work, we demonstrate that MFCs can successfully detect the presence of antibiotic residues in water and water-based electrolytes associated to the food industry, especially using honey as a new and more complex electron donor. The effectiveness of MFCs to sense antibiotics is here demonstrated for tetracycline that was added to both water and water/honey electrolytes with a minimum concentration close to 3.5 μg⁄kg. MFCs not only efficiently detect the presence of tetracycline in both the electrolytes, but also recover the same performance after each cycle of exposure, showing to a be very robust and reliable technology for both biosensing and energy recovery.

Intergenerational Justice entitles the maximum retention of Earth’s Biodiversity. The United Nations COP 15 committed to the protection of 30% of Earth’s terrestrial environments to provide Biospheric Sustainability. However, proactive amphibian sustainability needs support from amphibian Reproduction Technologies, Biobanking, and Conservation Breeding Programs [RBCs]. These technologies include the reliable practice of stimulation of reproduction and the collection of sperm and oocytes, refrigerated and cryopreserved sperm storage, in vitro fertilization. Emerging technologies promise the perpetuation of species solely from biobanked biomaterials. However, although exemplary national programs for amphibian RBCs are now established in the USA and Australia, these potentials are not fully realised resulting in unacceptable biodiversity loss. To fully realise these potentials an independent and democratic global organisation is proposed to, 1) focus on the bioregions with the highest amphibian biodiversity, 2) maximise regional inclusion in international initiatives, and 3) provide for maximum community engagement and financial resources. We present the first overall multidisciplinary review of amphibian RBCs, including their geopolitical, cultural, and scientific background, along with their development and application to economically, efficiently, and reliably, perpetuate amphibian biodiversity. We provide genetic models, the potential for diploid cell cryopreservation to perpetuate species, along with significant new information on methodologies and techniques, and standardise nomenclature for specificity in publications and media consistency.

The large quantity of information retrieved from communities, public data repositories, web pages, or data mining can be sparsed and poorly classified. This work shows how to employ unsupervised classification algorithms such as K-means proper to classify user reviews into their closest category, forming a balanced data set. Moreover, we found that the text vectorization technique significantly impacts the clustering formation, comparing TF-IDF and Word2Vec. The value for mapping a cluster with movie genre was 81.34% ± 20.48 of the cases when the TF-IDF was applied, whereas Word2Vec only yielded a 53.51% ± 24.1. In addition, we highlight the impact of the removal of stop-words. Thus, we detected that pre-compiled lists are not the best method to remove stop-words before clustering because there is much ambiguity, centroids are poorly separated, and only 57% of clusters could match a movie genre. Thus, our proposed approach achieved a 94% of accuracy. After analyzing the classifiers’ results, we appreciated a similar effect when divided by the stop-words method removal. Statistically significant changes were observed, especially in precision metric and Jaccard scores in both classifiers, using custom-generated stop lists rather than pre-compiled ones. Reclassifying sparse data is strongly recommended as using custom-generated stop lists.

Depression is a complex neuropsychiatric disorder characterized by pervasive feelings of sadness, hopelessness, and cognitive impairments that can profoundly impact an individual's quality of life. Despite extensive research efforts, the precise mechanisms underlying depression remain elusive. Recent studies have highlighted the intricate interplay between the immune system and the central nervous system in the pathophysiology of depression. In this context, CD4+ T cells, a key component of the adaptive immune system, have emerged as potential players in the neuroinflammatory processes associated with depression. Concurrently, Brain-Derived Neurotrophic Factor (BDNF), a multifunctional neurotrophin, has garnered significant attention for its roles in neural plasticity, mood regulation, and cognitive function. This review paper explores the intriguing intersection between CD4+ T cells and BDNF in the context of depression and delves into the exciting prospects it offers for therapeutic interventions. By examining the intricate crosstalk between the immune system and the neurotrophic factors, we aim to shed light on the potential avenues for novel therapeutic strategies in the treatment of depression.

Enteric viruses are the major cause of gastroenteritis and enteric hepatitis worldwide, but in some areas like Saudi Arabia little data is known about their presence in water sources. The available information from clinical samples is not enough to figure their actual prevalence. The aim of this study was to gather information for the first time in Saudi Arabia on the presence of Norovirus (NoV) genogroup GI and GII, hepatitis A virus (HAV) and hepatitis E virus (HEV) in water. For this purpose, thirteen monthly samples were collected in lake Wadi Hanifa and surrounding wells from December 2014 to November 2015. Viruses were detected and quantified by Real-time RT-qPCR. Despite HEV findings were anecdotic, our results highlight interesting behaviors of the other viruses. There was a higher prevalence of noroviruses in Wadi Hanifa samples than in well water samples (46.43% vs12.5% of NoV GI; 66.67% vs8.33% of NoV GII). On the contrary, similar levels of HAV positivity were observed (40.48% in surface water vs 43.06% in well water). Also, a strong influence of flooding events on HAV and NoV GI occurrence was observed in both surface and well water samples, being NoV GII apparently not affected.

Background: Influenza vaccine is a tool for preventing infection and reducing exacerbations in patients with asthma and chronic obstructive pulmonary disease (COPD). Purpose of this study is to investigate dynamics of CRP and serum cytokines (IL-2, IL-6, IL-10, IL-17) in patients with asthma and COPD, as well as to perform a correlation analysis with the clinical parameters of the disease manifestation. Methods: The study included 34 patients with asthma, 20 patients with COPD vaccinated against influenza during a period of remission from 2 to 4 weeks, both groups being under a basic maintenance therapy, and 26 healthy individuals vaccinated with the trivalent polymer-subunit vaccine Grippol® Plus, containing 5 µg of influenza virus strains and 500 µg of azoximer bromide. Results: Observing patients with asthma and COPD, during a year after the vaccination, has revealed a significant reduction in exacerbations frequency (p < 0.05) and duration (p < 0.05) of the bronchial obstructive syndrome (BF). Before the vaccination the IL-6 level in patients with asthma had a direct moderate correlation with duration of exacerbations of the underlying disease (p < 0.05), along with the number of systemic corticosteroids courses during exacerbations (p < 0.05). In 12 months after the vaccination, while assessing cytokine profile of all study groups, a significant reduction in the level of IL-6 was observed, compared to the baseline values (p< 0.05). Conclusion: Conducted analysis of immunological, clinical, and functional parameters of patients with asthma and COPD has proven for influenza vaccine to be effective in BF patients.

Although the effect of thermal modification (TM) on teak wood color is well documented, a few studies were carried out in closed system processes, as well as it remains unclear the effect of different processes on the same material. This work aimed to verify the effect of closed and open system processes of TM on the color of fast-growing teak wood. Thermally modified wood was evaluated in a closed system at 160 °C (CS160) and in an open system at 185 °C and 210 °C (OS185 and OS210). We measured the moisture content (initial and final) of wood, and the corrected mass loss (CML). The chemical analyses encompassed the contents of alpha-cellulose, hemicelluloses, lignin, and extractives (total, in acetone and dichloromethane). Wood color was measured before and after TM according to the CIEL*a*b* color space. It was possible to achieve the same color using different processes of thermal modification (CS160 and OS210). TM reduced wood lightness (L*), red-green chromaticity coordinate (a*), and yellow-blue chromaticity coordinate (b*). L* and a* had the bigger and lower variations, respectively. The color of thermally modified wood was significantly changed, even at the mildest condition tested (OS185, 0.33% CML).

Herpes B virus (BV) is a zoonotic virus which can be transmitted from macaques to humans, which is often associated with high mortality rates. Because macaques often exhibit asymptomatic infections, individuals who come into contact with these animals face unexpected risks of BV infections. Serological test is widely performed to investigate BV infections. However, the assay’s sensitivity and specificity appeared to be inadequate, and it does not necessarily indicate ongoing viral shedding. Here, we developed LAMP and qPCR assays aiming to detect BVs with high sensitivity and specificity in various macaque species and validated them using oral swab samples collected from 97 wild cynomolgus macaques living in Thailand. Our LAMP and qPCR assays detected more than 50 and 10 copies of the target sequences per reaction, respectively. The LAMP assay could detect BV within 25 min, indicating its advantages for the rapid detection of BV. Collectively, our findings indicated that both assays developed in this study exhibit advantages and usefulness for BV surveillance and diagnosis of BV infections in macaques. Furthermore, for the first time, we determined the partial genome sequences of BVs detected in cynomolgus macaques in Thailand. Phylogenetic analysis revealed the species-specific evolution of BV within macaques.

Cardiovascular diseases (CVD) remain the leading cause of death across the globe, hence, establishing strategies to counteract CVD are imperative to reduce mortality and the burden on health systems. Dietary modification is an effective primary prevention strategy against CVD. Research regarding dietary supplementation has become increasingly popular. This review focuses on the current in vivo, in vitro, and epidemiological studies associated with that of omega-3 polyunsaturated fatty acids (n-3 PUFA) and polar lipids (PLs) and how they play a role against CVD. Furthermore, this review focuses on the results of several major clinical trials examining n-3 PUFA regarding both primary and secondary prevention of CVD. Notably, we place a lens on the REDUCE-IT and STRENGTH trials. Finally, supplementation of PLs has recently been suggested as a potential alternative avenue for the reduction of CVD incidence versus neutral forms of n-3 PUFA. However, the clinical evidence for this argument is currently rather limited. Therefore, we draw on the current literature to suggest future clinical trials for PL supplementation. We conclude that despite conflicting evidence, future human trials must be completed to confirm whether PL supplementation may be more effective than n-3 PUFA supplementation to reduce cardiovascular risk.

In this study, we considered the structural stability, electronic properties, and phonon dispersion of the cubic (c-ZrO₂), tetragonal (t-ZrO₂), and monoclinic (m-ZrO₂) phases of ZrO₂. We found that the monoclinic phase of zirconium dioxide is the most stable among the three phases in terms of total energy, lowest enthalpy, highest entropy, and other thermodynamic properties. The smallest negative modes were found for m-ZrO₂. Our analysis of the electronic properties showed that during the m–t phase transformation of ZrO₂, the Fermi level first shifts by 0.125 eV toward higher energies and then decreases by 0.08 eV in the t–c cross-section. The band gaps for c-ZrO₂, t-ZrO₂, and m-ZrO₂ are 5.140 eV, 5.898 eV, and 5.288 eV, respectively. Calculations based on the analysis of the influence of doping 3.23, 6.67, 10.35, and 16.15 mol. %Y₂O₃ onto the m-ZrO₂ structure showed that the enthalpy of m-YSZ decreases linearly, which accompanies further stabilization of monoclinic ZrO₂ and an increase in its defectiveness. A doping-induced and concentration-dependent phase transition in ZrO₂ under the influence of Y₂O₃ was discovered, due to which the position of the Fermi level changes and the energy gap decreases. It has been established that, not only for pure systems but including those doped with Y₂O₃, the main contribution to the formation of the conduction band is made by the p-states of electrons. The t-ZrO₂ (101) and t-YSZ (101) surface models were selected as optimal surfaces for water adsorption based on a comparison of their surface energies. An analysis of the mechanism of water adsorption on the surface of t-ZrO₂ (101) and t-YSZ (101) showed that H₂O on unstabilized t-ZrO₂ (101) is adsorbed dissociatively with an energy of -1.22 eV, as well as by the method of molecular chemisorption with an energy of - 0.69 eV and the formation of a hydrogen bond with a bond length of 1.01 Å. In the case of t-YSZ (101), water is molecularly adsorbed onto the surface with an energy of -1.84 eV. Dissociative adsorption of water occurs at an energy of -1.23 eV, near the yttrium atom. The results show that ab initio approaches are able to describe the mechanism of doping-induced phase transitions in (ZrO₂+Y₂O₃)-like systems, based on which it can be assumed that DFT calculations can also flawlessly evaluate other physical and chemical properties of YSZ, which have not yet been studied quantum chemical research. The obtained results complement the database of research works carried out in the field of the application of biocompatible zirconium dioxide crystals and ceramics in green energy generation and can be used in designing humidity-to-electricity converters and creating solid oxide fuel cells based on ZrO₂.

Despite their anti-icing ability, hydrophobic coatings have the disadvantages of easy falling off and poor wear resistance, resulting in insufficient durability of ice/snow melting. To improve the surface stability and durability of superhydrophobic coatings, nanoparticle/epoxy coatings were prepared with three types of nanoparticles, two types of dispersion methods, three types of application methods and two types of introduction methods of epoxy resin. Water contact angles, ice adhesion force and icing rate of asphalt concrete coated with hydrophobic coatings were tested. The molecular structures of coatings were analyzed by Fourier transform infrared spectroscopy. The surface morphology of hydrophobic coatings was observed using Scanning electron microscopy. Results indicated that nano-ZnO, TiO2 and SiO2 particles can be modified into hydrophobicity by stearic acid. The hydrophobic coating could improve the hydrophobicity of concrete, reduce the adhesion strength of ice and asphalt concrete and delay the beginning icing time. Moreover, The dosages of stearic acid, nanoparticle and epoxy resin need to be in a certain range to ensure the best hydrophobicity and durability of coatings.

Ryegrass is one such cereal that has been underutilized in human nutrition despite its high nutritional and functional value due to the presence of phytochemicals and dietary fibers It is a viable option, especially for countries that do not produce wheat, as it is easily adaptable and overgrows, making it economically viable. This study evaluated the nutritional impact, bioactive compounds, and physicochemical and technological properties of partially substituting maize flour (MF) with sprouted whole ryegrass flour (SR) in developing extrusion-cooked breakfast cereals. A completely randomized design with substitutions ranging from 0 to 20 % of MF with SR was employed as the experimental strategy (P < 0.05). Partial incorporation of SR increased the bioavailability of γ-aminobutyric acid and total soluble phenolic compounds. Using sprouted grains can adversely affect the technological quality of extruded foods, but ryegrass, with its high dietary fiber and low lipid content, mitigates these negative effects. Consequently, breakfast cereals containing 4 and 8 % SR exhibited better physicochemical properties, such as reduced hardness and increased crispness. These results are promising for ryegrass and suggest combining the age-old germination process with extrusion can enhance cereal-based breakfast products' nutritional quality and bioactive compound content.

In this study, we considered the structural stability, electronic properties, and phonon dispersion of the cubic (c-ZrO₂), tetragonal (t-ZrO₂), and monoclinic (m-ZrO₂) phases of ZrO₂. We found that the monoclinic phase of zirconium dioxide is the most stable among the three phases in terms of total energy, lowest enthalpy, highest entropy, and other thermodynamic properties. The smallest negative modes were found for m-ZrO₂. Our analysis of the electronic properties showed that during the m–t phase transformation of ZrO₂, the Fermi level first shifts by 0.125 eV toward higher energies and then decreases by 0.08 eV in the t–c cross-section. The band gaps for c-ZrO₂, t-ZrO₂, and m-ZrO₂ are 5.140 eV, 5.898 eV, and 5.288 eV, respectively. Calculations based on the analysis of the influence of doping 3.23, 6.67, 10.35, and 16.15 mol. %Y₂O₃ onto the m-ZrO₂ structure showed that the enthalpy of m-YSZ decreases linearly, which accompanies further stabilization of monoclinic ZrO₂ and an increase in its defectiveness. In this case, the position of the Fermi level changes abruptly, and the energy gap decreases. It has been established that, not only for pure systems but including those doped with Y₂O₃, the main contribution to the formation of the conduction band is made by the p-states of electrons. The t-ZrO₂ (101) and t-YSZ (101) surface models were selected as optimal surfaces for water adsorption based on a comparison of their surface energies. An analysis of the mechanism of water adsorption on the surface of t-ZrO₂ (101) and t-YSZ (101) showed that H₂O on unstabilized t-ZrO₂ (101) is adsorbed dissociatively with an energy of -1.22 eV, as well as by the method of molecular chemisorption with an energy of - 0.69 eV and the formation of a hydrogen bond with a bond length of 1.01 Å. In the case of t-YSZ (101), water is molecularly adsorbed onto the surface with an energy of -1.84 eV. Dissociative adsorption of water occurs at an energy of -1.23 eV, near the yttrium atom. The obtained results complement the database of research works carried out in the field of the application of biocompatible zirconium dioxide crystals and ceramics in green energy generation and can be used in designing humidity-to-electricity converters and creating solid oxide fuel cells based on ZrO₂.

The complex and interconnected challenges of climate change, water stress, disasters, and health crises have far-reaching implications for sustainable development and global sustainability agendas, such as the Sustainable Development Goals (SDGs). However, one critical issue that has been overlooked is the nexus between climate change impacts and mental health (CCMH). Recognizing and addressing the negative emotions associated with this global phenomenon is essential to fostering a holistic approach to climate action planning and building long-term resilience. In this assessment, we present a set of narratives to argue that CCMH research requires a collaborative, transdisciplinary approach that integrates socio-economic and socio-cultural complexities. For this assessment, we used a case study approach to elucidate that the mental health impacts of climate change are unequally distributed, disproportionately affecting vulnerable groups based on age, gender, race, and socioeconomic status. The assessment presented in this study concluded that adequate mental health support programs are limited due to sociocultural stigmas and limited socioeconomic resources in some regions. Existing climate-related mental health services mechanisms lack coordination and specific action plans, leaving affected populations underserved. Unlike traditional understandings of the climate-health nexus, this research calls for experts from multiple fields to work together and for enhanced attention to and investment in CCMH research to bridge the gap between scientific knowledge and practical solutions. Such solutions will lead to scalable and lasting change as communities can implement research findings to support those in need and enhance disaster resilience. Furthermore, by collectively recognizing the climate and mental health nexus, global commitments such as the SDGs and the Paris Declaration can advance awareness and action in climate-related mental health, ultimately promoting a healthier relationship between humanity and nature.

Climate changes caused by anthropogenic actions can directly and indirectly affect living beings, including parasites and their hosts. Changes such as water temperature, pH, distribution of nutrients in the aquatic environment are some examples that can interfere with the fish community, whether in open water or in production systems. In this review, we will show how climate change can affect the adaptation of hosts and parasites in the aquatic environment and how these parasites can be used for environmental monitoring.

CO2, CH4 and CO are the most critical atmospheric gases in terms of their impact on the radiative system, air quality and health. This work provides information on the direction of source areas and potential sources of emissions and shows many aspects of these gases by a statistical analysis using bivariate polar diagrams and local weather conditions (e.g., temperature, wind speed and wind direction) recorded at the Lamto station (LTO, 6°31N and 5°02W) in Côte d’Ivoire over the 2014-2018 period. The results show that the main regions contributing to the high concentrations of CH4 (> 1925 ppb) and CO2 (> 420 ppm) in the GSS, GSP, PSS and PSP seasons are the North and Northwest sectors of Lamto. In these directions, CH4 and CO2 concentrations are associated with wind speeds less than 6 m.s-1, due to the influences of local sources as emissions resulting from the degradation of organic matter submerged during the impoundment of the Taabo dam, and/nor human activities linked to the practice of intensive agriculture. In addition, the high concentrations of CO (> 350 ppb) are observed in GSS in the North, North-West, North-East and East sectors for wind speeds less than or equal to 9 m.s-1, due to the influences of both local and distant sources. The correlation coefficients between CH4 and CO, and between CH4 and CO2 are positive and significant in all sectors. However, those calculated between CO2 and CO have showed both low and high values in all seasons.

PDMS samples may be used in various microfluidic applications by hydrophilizing their surfaces. This study examines the effects of air plasma jet (APJ) and dielectric barrier discharge (DBD) plasma on the surface hydrophilicity of polydimethylsiloxane. In order to increase the hydrophilicity of PDMS sample surfaces, two plasma sources including APJ and DBD were compared. Both DBD and APJ setups were measured for voltage and current, and their respective power was calculated and compared based on their characteristics. It is important to note that the electrical specifications of APJ and DBD were identical, and the source power rates for APJ and DBD plasma were 306W and 300W respectively. UV-vis spectroscopy was used to characterize the plasma, and an electrical characterization of the plasma's power supply was carried out. The effects of parameters such as the distance from the nozzle tip, the duration of the process, and the source voltage on the hydrophilicity of the surfaces during the treatment by APJ were also examined, and samples were then examined for a period of time to determine whether surface hydrophilicity was preserved. On the PDMS surface, a contact angle of about 5.1° was observed using short-term plasma treatments of 10 seconds. In the same conditions, the effect of DBD treatment was superior to that of APJ treatment.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

In this work, optimal consumption and investment strategies are derived for risk-averse investors under the 4/2 stochastic volatility class of models. We work under an expected utility (EUT) framework and consider a Constant Relative Risk Aversion (CRRA) investor, who might also be ambiguity-averse. The corresponding Hamilton-Jacobi-Bellman (HJB) and HJB-Isaacs (HJBI) equations are solved in closed-form for a subset of the parametric space and under some restrictions on the portfolio setting, for complete markets. Conditions for proper changes of measure and well defined solutions are provided. These are the first analytical solutions for the 4/2 stochastic volatility model and the embedded 3/2 model for the type of excess returns established in .

The availability of multiple sequenced genomes from a single species made it possible to explore intra- and inter-specific genomic comparisons at higher resolution and build clade-specific pangenomes of several crops. The pan-genomes of crops constructed from various cultivars/accessions, landraces, and wild ancestral species represent a compendium of genes and structural variations and allow researchers to search for the novel genes and alleles that were inadvertently lost in domesticated crops during the historical process of crop domestication or in the process of extensive plant breeding. Fortunately, many valuable genes and alleles associated with desirable traits like disease resistance, abiotic stress tolerance, plant architecture, and nutrition qualities exist in landraces, ancestral species, and crop wild relatives. The novels genes from the wild ancestors and landraces can be introduced back to high-yielding varieties of modern crops by implementing classical plant breeding, genomic selection, and transgenic/gene editing approaches. Thus, pan-genomic represents a great leap in plant research and offers new avenues for targeted breeding for mitigating the impact of global climate change. Here we summarize the tools used for pangenome assembly and annotations, web-portals hosting plant pangenomes. Furthermore, we highlight a few discoveries made in crops using the pan-genomic approach and its future potential.

This review provides an overview of the biotransformation of limonene and α-pinene, which are commonly found in wood residues and citrus fruit by-products, to produce high-value-added products. Essential oils derived from various plant parts contain monoterpene hydrocarbons, such as limonene and pinenes which are often considered waste due to their low sensory activity, poor water solubility, and tendency to autoxidize and polymerise. However, these terpene hydrocarbons serve as ideal starting materials for microbial transformations. Moreover, agro-industrial byproducts can be employed as nutrient and substrate sources, reducing fermentation costs, and enhancing industrial viability. Terpenes, being secondary metabolites of plants, are abundant in byproducts generated during fruit and plant processing. Microbial cells offer advantages over enzymes due to their higher stability, rapid growth rates, and genetic engineering potential. Fermentation parameters can be easily manipulated to enhance strain performance in large-scale processes. The economic advantages of biotransformation are highlighted by comparing the prices of substrates and products. For instance, R-limonene, priced at US$34/L, can be transformed into carveol, valued at around US$530/L. This review emphasises the potential of biotransformation to produce high-value products from limonene and α-pinene molecules, particularly present in wood residues and citrus fruit by-products. The utilisation of microbial transformations, along with agro-industrial byproducts, presents a promising approach to extract value from waste materials and enhance the sustainability of the antimicrobial, the fragrance and flavour industry.

Millions of people worldwide are affected by diabetes, a chronic disease that continuously grows due to abnormal glucose concentration levels present in the blood. Monitoring blood glucose concentrations is therefore an essential diabetes indicator to aid in the management of the disease. Enzymatic electrochemical glucose sensors presently account for the bulk of glucose sensors in the market. However, their disadvantages are that they are expensive and are dependent on environmental conditions, hence affecting their performance and sensitivity. To meet the increasing demand, non-enzymatic glucose sensors based on chemically modified electrodes for the direct electrocatalytic oxidation of glucose are a good alternative to the costly enzymatic-based sensors currently on the market, and the research thereof continues to grow. Nanotechnology-based biosensors have been explored for their electronic and mechanical properties, resulting in enhanced biological signalling through the direct oxidation of glucose. Copper oxide and copper sulfide exhibit attractive attributes for sensor application, due to their non-toxic nature, abundance, and their unique properties. Thus, in this review, copper oxide and copper sulfide-based materials, are evaluated based on their chemical structure, morphology, and fast electron mobility as suitable electrode materials for non-enzymatic glucose sensors. The review highlights the present challenges of non-enzymatic glucose sensors that have limited their deployment into the market.

The acetylcholinesterase-inhibitory potential of the oleanane-type triterpenes and their glycosides from the Terminalia arjuna (Combreatceae) bark, i.e. arjunic acid, arjunolic acid, arjungenin, arjunglucoside I, sericic acid, and arjunetin, is presented. The studies are based on the in silico pharmacokinetic and biomimetic studies, the acetylcholinesterase (AChE) inhibitory activity tests, and the molecular docking research. Based on the calculated pharmacokinetic parameters, arjunetin and arjunglucoside I are indicated as able to cross the blood-brain barrier. The compounds of interest exhibit marked acetylcholinesterase inhibitory potential, which was tested in the TLC bioautography test. The longest time to reach brain equilibrium is observed for both the arjunic and arjunolic acids and the shortest one for arjunetin. All compounds exhibit high and relatively similar magnitude of binding energies, varying from ca. -15 to -13 kcal/mol. The superposition of the most favorable positions of all ligands interacting with AChE is analyzed. The correlation between the experimentally determined IC50 values and the steric parameters of the molecules is investigated. The inhibition of the enzyme by the analyzed compounds shows their potential to be used as cognition enhancing agents. For the most potent compound (arjunglucoside I; ARG), the kinetics of AChE inhibition is tested. The Michaelis–Menten constant (Km) for the hydrolysis of the acetylthiocholine iodide substrate was calculated to be 0.011 mM.

The outbreak of the COVID-19 pandemic has raised concerns about potential environmental factors that could influence the spread and severity of the SARS-CoV-2 virus. Atmospheric pollution, particularly particulate matter (PM), has been suggested as a contributing factor to viral infections and respiratory complications. This two-year observational study aimed to investigate the relation between air pollution and the spread of COVID-19, focusing on PM2.5. Unlike previous studies limited to specific cities or countries, inevitable to use temporal data. Our research analyzed data from various states across the United States, considering both spatial and temporal correlation. The analysis considered the number and geographic distribution of COVID-19 cases along with daily PM2.5 exposure levels, accounting for monthly average PM2.5 exposure, from March 2020 to December 2021. The observed conflicting results of the temporal and spatial correlation present challenges for researchers in understanding the true nature of the relationship between PM2.5 air pollution and COVID-19 cases. The correlation between various factors, such as population density, PM2.5, temperature, and wind speed, and COVID-19 refers to an association or statistical relationship, not causation. Moreover, the intricate interplay of these variables makes it difficult to establish a clear cause-and-effect relationship.

An increase in Spodoptera species was reported in Bt soybean fields expressing Cry1Ac insecticidal proteins in Brazil, requiring additional management with chemical insecticides. Here, we evaluated the dose effects of flubendiamide and thiodicarb on Spodoptera cosmioides (Walker, 1858), Spodoptera eridania (Stoll, 1782), Spodoptera albula (Walker, 1857) and Spodoptera frugiperda (J. E. Smith, 1797) (Lepidoptera: Noctuidae) that survived on MON 87751 × MON 87708 × MON 87701 × MON 89788, expressing Cry1A.105, Cry2Ab2 and Cry1Ac; MON 87701 × MON 89788 soybean, expressing Cry1Ac; and non-Bt soybean. On unsprayed Cry1A.105/Cry2Ab2/Cry1Ac soybean, only S. frugiperda showed ~60% mortality after 10 d, whereas S. cosmioides, S. eridania and S. albula showed >81% mortality. Surviving larvae of all species on this Bt soybean showed &gt;80% mortality when exposed to the field label dose of flubendiamide (70 mL/ha) or thiodicarb (400 g/ha) or at 50% of these doses. In contrast, all four species had <25% and <19% mortality on Cry1Ac and non-Bt soybean, respectively. Surviving S. cosmioides, S. eridania and S. albula on these soybean types presented >83% mortality post-exposure to both dose levels of flubendiamide and thiodicarb. Some S. frugiperda larvae surviving on Cry1Ac and non-Bt soybean sprayed with a 50% dose of either insecticide developed into adults. However, L1 larvae developing on Cry1Ac soybean leaves sprayed with flubendiamide and L2 larvae on this soybean sprayed with thiodicarb had a prolonged immature stage, and females lower fecundity, which are likely to impact its population growth on soybean.

Introduction: Suicide is the second leading cause of death among 15 to 19-years-olds in Europe. From the beginning of COVID-19 pandemic, literature confirms a significant increase in mental health disease in children and adolescents. At Bambino Gesù Pediatric Hospital emergency department (Rome, Italy) there was a dramatic increase of suicidal attempts, and particularly a rise of suicidal jumpers. Many of these patients presented vertebral fractures. Material and Methods: This retrospective study includes all suicidal jumpers with vertebral fractures treated at our Pediatric Hospital from April 1, 2017 to March 31, 2023. We collected and compared data from three years before to three years after pandemic spreading analyzing vertebral fractures. Results: From April 1 2019 to March 31, 2020 141 cases of suicide attempt arrived at Bambino Gesù Pediatric Hospital emergency department. Five of these patients were suicidal jumpers but none had a vertebral fracture. From April 1, 2020 to March 31, 2023, 362 cases of suicide attempts arrived in the same emergency department and 19 were suicidal jumpers; 12 reported vertebral fractures and were included in this study. Mean age was 14 years. Most common level of fracture was L1. Four patients presented with preoperative neurologic impairment and two cases recovered completely. There was a transforaminal sacral fracture, a spinopelvic dissociation and an Anderson-D’Alonso C2 type II fracture. Two cases with thoracolumbar vertebral fractures were conservatively treated. Seven patients were treated by percutaneous pedicle fixation to achieve an indirect decompression and to restore a better sagittal balance. Only three patients needed an open spinal surgery by posterior approach and in two cases a posterior decompression was performed. One case with cervical fractures was treated by Halo-Vest. Conclusions: Recent literature highlights concern about the consequences of COVID-19 pandemic on pediatric population mental health. This is the first report that shows a significant increase in vertebral body fractures due to suicide jumping attempt. The comparison between three years pre and post pandemic is sufficient to demonstrate a sharp increase of these cases. This could be a new epidemiological phenomenon that could persist or even increase over time because of COVID-19 pandemic.

This article explores the possible ramifications of incorporating ideas from AEC Industry 6.0 into the design and construction of intelligent, environmentally friendly, and long-lasting structures. This statement highlights the need to shift away from the current methods seen in the AEC Industry 5.0 to effectively respond to the increasing requirement for creative and environmentally sustainable infrastructures. The preceding methodology, AEC Industry 6.0, has substantially improved the efficacy and sustainability of construction by using new technology, digitalization, and environmentally conscious methods. Extensive discussions have occurred on the various benefits of AEC Industry 5.0. These merits include heightened stakeholder involvement, increased efficiency via automation and robots, decision-making processes centered around data, and the optimization of resources. Nevertheless, this study also examines the obstacles linked to the complete adoption of AEC Industry 6.0. These challenges require proficient professionals who can effectively utilize contemporary technologies, manage diverse stakeholder technological competencies, establish interoperable systems and standards, and reinforce cybersecurity measures. This study examines the viability of implementing concepts from Industry 6.0 to create intelligent, sustainable, and environmentally friendly structures. The objective is to showcase the potentially revolutionary impact that these principles may have on the construction industry. This study explores the possible applications of AEC Industry 6.0 within the Architecture, Engineering, and Construction (AEC) sector, explicitly highlighting the anticipated industry-wide consequences of the forthcoming paradigm shift. This paper comprehensively examines big data analytics, the Internet of Things (IoT), and collaborative robots as they pertain to the AEC Industry 6.0. This research investigates the interplay between organizational dynamics, human actors, and robotic systems to provide light on the opportunities and obstacles associated with integrating AEC Industry 6.0 concepts into the construction of buildings.

Building on the carbon reduction targets agreed in the Paris Agreements, many nations have renewed their efforts toward achieving carbon neutrality by the year 2050. In line with this ambitious goal, nations are seeking to understand the appropriate combination of technologies which will enable the required reductions in such a way that they are appealing to investors. Around the globe, solar and wind power lead in terms of renewable energy deployment, while carbon capture and storage (CCS) is scaling up toward making a significant contribution to deep carbon cuts. Using Japan as a case study nation, this research proposes a linear optimization modeling approach to identify the potential contributions of renewables and CCS toward maximizing carbon reduction and identifying their economic merits over time. Results identify that the combination of these three technologies could enable a carbon dioxide emission reduction of between 55 and 67 percent in the energy sector by 2050 depending on resilience levels and CCS deployment regimes. Further reductions are likely to emerge with increased carbon pricing over time. The findings provide insights for energy system design, energy policy making and investment in carbon reducing technologies which underpin significant carbon reductions, while identifying potential regional social co-benefits.

The use of the un-indexed web, commonly known as the deep web and dark web, to commit or facilitate criminal activity has drastically increased over the past decade. The dark web is an infamously dangerous place where all kinds of criminal activities take place, despite advances in web forensics techniques, tools, and methodologies, few studies have formally tackled the dark and deep web forensics and the technical differences in terms of investigative techniques and artefacts identification and extraction. This research proposes a novel and comprehensive protocol to guide and assist digital forensics professionals in investigating crimes committed on or via the deep and dark web, the protocol named D2WFP establishes a new sequential approach for performing tasks and subtasks to improve the accuracy and effectiveness of current tools' output. Quantitative and qualitative research has been conducted by testing the protocol following a comprehensive and rigorous process in different scenarios and the obtained results show an apparent increase in the number of artefacts recovered when adopting D2WFP. The second contribution of D2WFP is the artefacts correlation and cross-validation which enables Digital Forensics professionals to better document and structure their analysis of host-based deep and dark web browsing artefacts.

Intra-abdominal pressure (IAP) elevation during capnoperitoneum can cause adverse cardiovascular and respiratory effects. This study aimed to determine if a sequentially increased IAP affects cardiovascular and respiratory variables in anesthetized dogs and evaluate the effects of constant rate infusion of dexmedetomidine (Dex) on cardiovascular and respiratory variables with increased IAP. Five dogs were anesthetized, instrumented, and the Veress needle was equipped to adjust the IAP using a carbonic anhydrase insufflator. Stabilization was conducted for 1 h, and physiological variables were measured in IAPs of 0, 5, 10, 15, and 20 mmHg and after desufflation. After the washout period, the dogs underwent similar procedures along with constant rate infusion of dexmedetomidine. Cardiovascular effects of increased IAP up to 20 mmHg were not significant in healthy beagle dogs and those administered with dexmedetomidine. In the control group, the arterial pressure slightly increased, but not statistically significant, at an IAP of 20 mmHg compared with that at baseline (mean arterial blood pressure, p = 0.399; systolic arterial blood pressure, p = 0.293; diastolic arterial blood pressure, p = 0.141). When comparing the control and dexmedetomidine groups, overall significant effects of dexmedetomidine were noted on heart rate, cardiac output, and systemic vascular resistance during the experiment. Respiratory effects were not affected by abdominal insufflation when compared between different IAPs and between the two groups. Overall, an increased IAP of until 20 mmHg did not significantly affect cardiovascular and respiratory variables in both control and dexmedetomidine groups. This study suggests that dexmedetomidine infusion administration is applicable in laparoscopic procedures in healthy dogs.

Researches are moving to iron and ammonia elimination from ground water. Here, we are using poly acrylic–poly acrylamide hydrogel which grafted with 3-chloroaniline. This copolymer was synthesized by addition polymerization. Effect of agitation time, dosage and adsorbents temperature on the removal process sensitivity has been investigated. The copolymer was described experientially and theoretically. Isothermal, kinetic adsorption models and were discussed. This hydrogel could be regenerated efficiently (98.3%removal of iron and 100% removal of ammonia). Density functional theory DFT method using B3LYP/6-311G(d,p),LANL2DZ level of the theory were managed to investigate stationary states of grafted co-polymer and the complexation energy of the hydrogel with the studied cations. NBO analysis is using DFT to investigate the negative centers on the hydrogel. The complexation energy showed selectively of hydrogel to studied cations.

The perceived poor performance of publicly traded companies on their sustainability commitments and the quality of sustainability reporting has prompted stakeholders to consider the economic, environmental, and social impacts of corporate activities. Economic activities have led to various threats in the form of climate change, pollution, greenhouse gas emissions, natural disasters, and other issues that have negatively impacted the environment and stakeholders. Companies are expected to report to stakeholders on their sustainability performance, but reality proves that present reporting falls below stakeholders’ expectations mainly due to its still voluntary nature. The present study aims to provide a literature review of the relationship between sustainability reporting and the role of companies governance, especially observing if climate change requirements and energy-needed changes are being accounted. Results highlight mixed evidence for the influence of board governance attributes, providing interesting insights for research advancement. The study has practical implications for businesses, regulators, governments, and other stakeholders in their policy deliberations and investment decisions. Further empirical studies are recommended to re-examine sustainability reporting using the variables identified as important factors and gaps in this study and other board characteristics to improve the generalizability of the results.

We have developed additive logistic models for the occurrence of lightning, large (≥ 2 cm), and very large (≥ 5 cm) hail to investigate the evolution of these hazards in the past, in the future, and for forecasting applications. The models, trained with lightning observations, hail reports, and predictors from atmospheric reanalysis, assign an hourly probability to any location and time on a 0.25° × 0.25° × 1-hourly grid as a function of reanalysis-derived predictor parameters, selected following an ingredients- based approach. The resulting hail models outperform the Significant Hail Parameter and the simulated climatological spatial distributions and annual cycles of lightning and hail are consistent with observations from storm report databases, radar, and lightning detection data. As a corollary result, CAPE released above the -10°C isotherm was found to be a more universally skilful predictor for large hail than CAPE. In the period 1950–2021, the models applied to the ERA5 reanalysis indicate significant increases of lightning and hail across most of Europe, primarily due to rising low-level moisture. The strongest modelled hail increases occur in northern Italy with increasing rapidity after 2010. Here, very large hail has become 3 times more likely than it was in the 1950s. Across North America trends are comparatively small, apart from isolated significant increases in the direct lee of the Rocky Mountains and across the Canadian Plains. In the southern Plains, a period of enhanced storm activity occurred in the 1980s and 1990s.

BMAP-27 peptide known to exert cytotoxic effects against cancer cells by membrane integrity disruption. In the current investigation, we aimed to study the role of the BMAP-27 peptide in reducing colon cancer cell proliferation and inducing apoptosis. This study utilized both primary and metastatic colon cancer cell lines (SW480 and SW620). Proliferation was measured using CCK-8, and cellular damage was analyzed by lactate dehydrogenase assay. The study assessed apoptosis, cell cycle, and proliferation by measuring the expression of CASPASE3, BAX, BCL-2, TP53, CDK-6, PCNA, Wnt11, AXIN1, and CTNNB1. Additionally, in-silico studies were conducted to determine the binding affinities of BMAP-27 with APC and β-catenin proteins. BMAP-27 peptide reduced colon cancer cell proliferation, upregulated CASPASE3, BAX, TP53, AXIN1 expression, and downregulated BCL-2, CDK-6, PCNA, WNT11, CTNNB1 in both colon cancer cell lines, however, demonstrated higher activity in primary than metastatic colon cancer cells. The molecular dynamic simulation revealed substantial binding affinity of the peptide to adenomatous polyposis coli and β-catenin proteins.BMAP-27 peptide effectively inhibited the proliferation and enhanced apoptosis in the primary than in metastatic colon cancer cells. In-silico findings suggest that BMAP-27 exhibits a strong binding affinity with APC and β-catenin, highlighting its potential role as an anti-colon cancer agent.

Aim: Streptococcus pneumoniae and influenza H1N1 virus are common organisms associated with human infections. These infections could play a significant role in immune regulation. The study was performed to analyse the genome sequences of these organisms with human genome and study its functional significance. Methods: The study was performed to analyse the overlapping of genome sequences in Streptococcus pneumoniae and Influenza (H1N1) virus against human genome sequences by BLASTn sequence analysis. The alignments are studied against the corresponding genes for their functional significance with DAVID and NDEx software.Results: Several hits or overlapping nucleotide segments were identified. Between streptococcus and homo sapiens 287 overlaps were identified, and among influenza and homo sapiens 124 hits were identified. A wide range of functional significance of these genes were identified, and the results are presented in this study. The results show insights into functional pathways and biological activities associated with the respective vaccinations or infections by these microorganisms. Conclusion: The common organisms like Streptococcus pneumoniae and Influenza H1N1 virus actively interact with the immune system and result in a wide range of immune regulations.